The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are...
Transcript of The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are...
![Page 1: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/1.jpg)
1
The 14-3-3 homolog, ArtA, regulates development and secondary metabolism 1
in the opportunistic plant pathogen Aspergillus flavus 2
3
Beatriz A. Ibarra1, Jessica M. Lohmar1, Timothy Satterlee1, Taylor McDonald1, Jeffrey W. 4
Cary2, Ana M. Calvo1* 5
6
1. Department of Biological Sciences, Northern Illinois University, 155 Castle Dr., Dekalb, IL, 7
60115, USA 8
2. Food and Feed Safety Research Unit, USDA/ARS, Southern Regional Research Center, New 9
Orleans, LA, 70124, USA 10
11
*Corresponding author: Department of Biological Sciences, Northern Illinois University, 155 12
Castle Dr., Dekalb, IL, 60115, USA. [email protected] 13
14
15
Abstract 16
17
The opportunistic plant pathogenic fungus Aspergillus flavus produces carcinogenic mycotoxins 18
termed aflatoxins (AFs). Aflatoxin contamination of agriculturally important crops such as 19
maize, peanut, sorghum and tree nuts is responsible for serious adverse health and economic 20
impacts worldwide. In order to identify possible genetic targets to reduce AF contamination, we 21
have characterized the artA gene, encoding a putative 14-3-3 homolog in A. flavus. The artA 22
deletion mutant presents a slight decrease in vegetative growth and alterations in morphological 23
AEM Accepted Manuscript Posted Online 15 December 2017Appl. Environ. Microbiol. doi:10.1128/AEM.02241-17Copyright © 2017 American Society for Microbiology. All Rights Reserved.
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 2: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/2.jpg)
2
development and secondary metabolism. Specifically, artA affects conidiation, and this effect is 24
influenced by the type of substrate and culture condition. In addition, normal levels of artA are 25
required for sclerotial development. Importantly, artA negatively regulates AF production as 26
well as the concomitant expression of genes in the AF gene cluster. An increase in AF is also 27
observed in seeds infected with the A. flavus strain lacking artA. Furthermore, the expression of 28
other secondary metabolite genes is also artA-dependent, including genes in the cyclopiazonic 29
acid (CPA) and ustiloxin gene clusters, in this agriculturally important fungus. 30
31
Importance 32
33
In the current study, an artA homolog was characterized in the agriculturally and medically 34
important fungus Aspergillus flavus; specifically, its possible role governing sporulation, 35
formation of resistant structures, and secondary metabolism. The highly conserved 14-3-3 artA is 36
necessary for normal fungal morphogenesis in an environment-dependent manner, affecting the 37
balance between production of conidiophores and the formation of resistant structures that are 38
necessary for the dissemination and survival of this opportunistic pathogen. This study reports a 39
14-3-3 protein affecting secondary metabolism in filamentous fungi. Importantly, artA regulates 40
the biosynthesis of the potent carcinogenic compound AFB1 as well as the production of other 41
secondary metabolites. 42
43
44
45
46
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 3: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/3.jpg)
3
Introduction 47
48
The genus Aspergillus includes both beneficial and harmful species. Aspergillus flavus is among 49
the later, producing mycotoxins, including potent carcinogenic polyketides called aflatoxins 50
(AF), when colonizing crops of agricultural importance worldwide. Oil seeds crops are 51
particularly susceptible hosts including maize, spices, peanuts, tree nuts (such as almonds, 52
pistachios, hazelnuts, pecans, and Brazil nuts), cottonseed and sorghum (51, 5, 4, 49, 19). These 53
compounds are responsible for numerous health problems, including acute aflatoxicosis, 54
immunosuppression, and liver cancer in humans and other animal species (48). Acute 55
aflatoxicosis is linked to the consumption of large amounts of AF due to ingestion of 56
contaminated crops, resulting in extreme gastrointestinal symptoms and often death (49). Recent 57
studies have linked AF ingestion with growth impairment in children (25, 48). Exposure to AF 58
coupled with hepatitis B virus further increases risk of liver cancer (18). AF and other 59
mycotoxins are estimated to contaminate one quarter of the world’s crops (35). Economically, 60
AF contamination leads to substantial monetary losses yearly, due in large part to rejection or 61
reduced value of contaminated crops as well as costs associated with monitoring and detection in 62
developed countries. In developing countries the health risks are a major concern due to the lack 63
of strict regulation and monitoring of levels of AFs in commodities prior to consumption by the 64
indigenous population. 65
66
Aspergillus flavus efficiently disseminates causing extensive infestations by producing asexual 67
spores called conidia on specialized structures termed conidiophores (19). Once the fungus is 68
established, formation of highly resistant structures termed sclerotia contribute to its survival 69
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 4: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/4.jpg)
4
under harsh environmental conditions (11, 32, 46). Current approaches are insufficient to control 70
preharvest colonization of crops by A. flavus and AF contamination of food commodities. New 71
approaches, such as those based on genetic strategies, could results in the development of new 72
methodologies to reduce dissemination and survival of this organism, as well as AF biosynthesis. 73
With this purpose, it is important to gain insight into the genetic regulatory pathways that control 74
A. flavus morphogenesis and toxin biosynthesis. The current study focuses on an A. flavus gene 75
encoding a putative 14-3-3 protein. These proteins are a group of highly conserved, acidic, small 76
proteins (42, 51) that are found in many different eukaryotic species, often presenting multiple 77
isoforms per species with a wide range of cellular roles. First discovered in humans, it was later 78
characterized across other eukaryotic species. Isoforms of 14-3-3 homologs have been identified 79
in animals such as Xenopus and Drosophila, as well as in plants and in yeast (42, 43, 30). In 80
mammals, there are seven isoforms with roles in signal transduction pathways affecting 81
apoptosis, adhesion, cellular proliferation, differentiation and survival. These proteins form 82
homodimers and heterodimers with different 14-3-3 isomers. The end result is a U-shaped 83
structure containing two protein binding sites (13, 51, 43, 30). There are two copies in 84
Saccharomyces cerevisiae (BMH1 and BMH2) and Schizosaccharomyces pombe (rad 24 and 85
rad25) (15, 42, 43). Characterization of these four genes and their encoded proteins provided 86
further evidence that the 14-3-3 proteins play a role in a vast variety of cellular processes (42). 87
Due to the large potential for protein interactions with 14-3-3 proteins, and their conservation in 88
eukaryotic organisms, it is possible that 14-3-3 homologs could also influence important 89
functions in filamentous fungi. A 14-3-3 gene, artA, was partially characterized in the model 90
fungus A. nidulans (27), where it was shown that over-expression of artA resulted in a conidial 91
polarization defect, presenting abnormal formation of germ tubes. 92
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 5: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/5.jpg)
5
93
It is likely that, as in the case of other eukaryotes, 14-3-3 proteins bind to numerous proteins in 94
Aspergillus spp., affecting diverse signaling pathways, including those involved in development 95
and secondary metabolism, such as those leading to mycotoxin production. In the current study, 96
an artA homolog was characterized in the agriculturally and medically important fungus A. 97
flavus; specifically, its possible role in the regulation of conidiation, sclerotial formation and the 98
production of AF and other secondary metabolites. 99
100
Materials and Methods 101
Sequence alignment and phylogenetic analysis 102
Gene sequence and the deduced amino acid sequence of A. flavus artA (AFL2G_08271) (Table 103
S1) were obtained from the Aspergillus Genome Database (aspGD) 104
( http://aspgd.broadinstitute.org/cgi-105
bin/asp2_v3/shared/show_protein.cgi?site=asp2_v9&protein_name=afl.polypeptide.1670205416106
.1. ). Sequencing verification using primers A.fl_artA-SEQ5'F & A.fl_artA-SEQ3'R (Table S2), 107
indicated errors, specifically two guanine deletions, in the published sequence at positions +941 108
and +949 bp from the start codon. The corrected sequence was used in this study. 109
Blastp search tool was used to identify homologs in other fungal species. The accession numbers 110
corresponding to all sequences used in this study are listed in Table S1. MUSCLE sequence 111
alignment (http://www.ebi.ac.uk/Tools/msa/muscle/) was used with all sequences. This was 112
followed by shading using the Color Align Conservation from Sequence Manipulation Suite 113
(http://www.bioinformatics.org/sms2/color_align_cons.html). 114
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 6: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/6.jpg)
6
The software MEGA v6.0 was used for sequence alignment and analysis (37). After input of data 115
into MEGA, MUSCLE settings were used to generate a multiple sequence alignment. For 116
generation of phylogenetic trees, a Maximum-likelihood model was used with a bootstrap value 117
of 1000 (http://megasoftware.net/). 118
119
Strains and culture conditions 120
121
In order to characterize the artA gene, CA14 (pyrG-, niaD-, Δku70) (SRRC collection # 1709), 122
CA14 WT (pyrG+, niaD+, Δku70) control strain, artA deletion mutant TBAI3 (ΔartA::pyrG, 123
niaD+, Δku70), and a complementation strain (ΔartA::pyrG, artA::niaD, Δku70), TBAI6, were 124
used. All strains were grown on YGT medium [5 g of yeast extract, 20 g of glucose, and 1 mL of 125
trace elements (20)] at 30 °C in the dark, unless otherwise specified. Agar (10 g/L) was added in 126
the case of solid medium. Strains were maintained as 30% glycerol stocks at -80°C. 127
128
Generation of the ΔartA strain 129
130
The artA deletion cassette was constructed using fusion PCR as previously described (36). The 131
5ʹ and 3ʹ UTR fragments were first PCR amplified from A. flavus genomic DNA using primers 132
1346 and 1347 obtaining a 1.399 kb product, and primers 1348 and 1349, obtaining a 1.587 kb 133
product, respectively. A third fragment containing the auxotrophic marker A. fumigatus pyrG 134
was PCR-amplified from plasmid p1439 using primers 1358 and 1359. Primers 1362 and 1363 135
were used to fuse these three fragments resulting in the generation of the deletion cassette, that 136
was then transformed into A. flavus CA14 (pyrG -, niaD -, Δku70). 137
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 7: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/7.jpg)
7
138
All the primers used in this study are listed in Table S2. Fungal transformation was performed as 139
previous described (7). Transformants were selected on Czapek Dox (CZ, Difco, Franklin Lakes, 140
New Jersey, USA) plus sucrose as osmotic stabilizer without supplementation of uridine and 141
uracil. Transformants were confirmed by Southern blot analysis. A selected artA deletion strain, 142
TBAI2, was then transformed with the wild-type niaD allele from A. flavus, previously PCR-143
amplified from genomic DNA with primers 1576 and 1577, to obtain a prototroph, TBAI3. 144
145
Generation of the complementation strain 146
147
A complementation strain was obtained by transforming the A. flavus ΔartA mutant with the artA 148
wild-type allele. The complementation vector was generated as follows: A DNA fragment 149
containing the artA wild-type allele was PCR amplified from A. flavus wild-type genomic DNA 150
using primers 1507 and 1513. The resulting PCR product was digested with PstI and 151
subsequently ligated to pSD52.2, containing A. fumigatus niaD, which was previously digested 152
with the same enzyme, resulting in plasmid pBAI2. This plasmid was transformed into TBAI2. 153
Presence of the complementation plasmid in the transformants was verified by diagnostic PCR. 154
The resulting complementation strain was denominated TBAI6. 155
156
157
Morphological studies 158
159
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 8: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/8.jpg)
8
The possible role of artA in the regulation of fungal growth, conidiation, and sclerotial 160
development was investigated. A. flavus wild type, ∆artA, and complementation strains were 161
point-inoculated on YGT solid medium, and incubated at 30 °C for 5 days. Fungal growth was 162
measured as colony diameter. The experiment was carried out with three replicates. To quantify 163
production of conidia, spores (106 conidia/mL) from each strain were top-agar inoculated on 164
YGT. After 48 h and 72 h of incubation, 7 mm cores were harvested and homogenized in water. 165
Conidia were quantified using a hemocytometer (Hausser Scientific, Horsham, PA, USA) under 166
a bright-field Nikon Eclipse E400 microscope (Nikon Inc., Melville, NY, USA). In addition, 16 167
mm cores were harvested and washed with 70 % EtOH to visualize and quantify sclerotial 168
production. Micrographs were taken with a Leica MZ7.5 microscope coupled with a Leica 169
MC170 camera (Leica Microsystems Inc., Buffalo Grove, IL, USA). The experiment was 170
performed with three replicates. An additional experiment was carried out with YGT point-171
inoculated cultures incubated for 7 days. Plates were photographed before and after a 70% EtOH. 172
The experiment included three replicates. 173
174
Aflatoxin analysis 175
176
To analyze the effect of artA on the production of AF, specifically AFB1, spores (5 x 106 177
conidia) from wild type, ΔartA, and complementation strains were top-agar inoculated on YGT 178
and incubated for 72 h. Three 16 mm cores were collected, and toxin was extracted with 5 mL 179
chloroform. AF extracts were then allowed to dry overnight and resuspended in 250 μL 180
chloroform. Thin-layer chromatography (TLC) was used to separate the extracts using a 181
chloroform:acetone (85:15, v/v) solvent system. A standard of AFB1 (Sigma-Aldrich, St. Louis, 182
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 9: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/9.jpg)
9
MO, USA) was used as reference. The TLC plate (Macherey-Nagel, Bethlehem, PA, USA) was 183
air dried, sprayed with a 12.5% AlCl3 solution in 95% ethanol and baked at 80 °C for 10 184
minutes. The samples were visualized using UV detection at 375nm. Densitometry of AF bands 185
in the TLC plates were carried out using Gelquant.NET software. This experiment included three 186
replicates. 187
188
Gene expression analysis 189
190
Wild type, ∆artA, and complementation strains were top-agar inoculated (5 x 106 conidia) on 191
YGT medium and incubated for 48 h and 72 h. Mycelium from each strain was collected and 192
lyophilized overnight. Total RNA was extracted using TRIsure (Bioline, Taunton, MA, USA) 193
and RNeasy mini kit (Qiagen, Valencia, CA, USA) as described by the manufacturers. Five 194
micrograms of total RNA was treated using RQ1 DNAse (Promega, Madison, WI, USA) to 195
remove possible DNA contamination. Approximately, 1 μg of DNAsed RNA was used for 196
cDNA synthesis using Moloney murine leukemia virus (MMLV) reverse transcriptase 197
(Promega). qRT-PCR was performed utilizing an Mx3000p thermocycler (Agilent 198
Technologies, Santa Clara, CA, USA) with SYBR green Jumpstart Taq Ready Mix (Sigma) to 199
evaluate the expression of artA as well as the expression of regulatory genes involved in 200
development (brlA, wetA, and nsdC ) and secondary metabolite production (aflR, aflJ, ver1, the 201
PKS/NRPS gene AFLA_139490, and ustD, (AFLA_095040). cDNA was normalized 202
to A. flavus 18S ribosomal gene expression, and the relative expression levels were calculated 203
using the 2-ΔΔCT method (31). Primers used for gene expression analysis are listed in Table S2. 204
205
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 10: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/10.jpg)
10
Pathogenicity assay 206
207
The NC94022 Virginia Peanut line used in this study was kindly provided by Dr. Baozhu Guo 208
(USDA, Tifton, Georgia). The methods utilized in this study are similar to those described in 209
Zhuang et al. (55), with minor modifications. Briefly, the shelled viable peanut cotyledons (0.3 g 210
-0.4 g), with the embryos removed, were surface sterilized utilizing a 10 % beach solution; 211
cotyledons were submerged for approximately 1 minute. The peanut cotyledons were then 212
washed twice in sterile water and dried. Approximately, 10 cotyledons were infected on the 213
adaxial surface of the cotyledon per fungal strain (approximately 105 conidia/ cotyledon) and 214
incubated at 30 °C for 7 days in the dark. 215
216
Conidial quantification in infected seeds 217
Two infected peanut cotyledons were collected in individual 1.7 mL Eppendorf tubes. One 218
milliliter of water was added into each tube and vortexed for 1 minute. Conidia were quantified 219
using a hemacytometer (Hausser Scientific) under a bright-field Nikon Eclipse E400 microscope 220
(Nikon Inc.). This experiment was carried out in duplicate. 221
222
AFB1 analysis of infected seeds 223
Infected cotyledons (four per strain) were ground in liquid nitrogen and added to a 50 mL Falcon 224
tube containing 12 mL of water. Samples were extracted with 6 mL of acetone at room 225
temperature for 3 h on a rotary platform. Extracts were then filtered through a piece of Whatman 226
paper and collected into a separate 50 mL Falcon tube. Seventeen milliliters of methylene 227
chloride was added to the tubes and vortexed for 1 minute. The samples were then centrifuged 228
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 11: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/11.jpg)
11
for 5 minutes at 4,000 rpm before 15 mL of the bottom organic phase was collected and filtered 229
through sodium sulfate to remove any excess water. Extracts were collected into a 50 mL glass 230
beaker and allowed to evaporate. Samples were then resuspended in 2 mL of methylene chloride 231
and transferred to another 50 mL baker where they were allowed to evaporate again. Finally the 232
extracts were solubilized in 150 uL acetone. Ten microliters of each sample were analyzed by 233
TLC as described above. 234
235
Statistical analysis 236
237
Statistical Analysis was carried out for all quantitative data in this study. ANOVA (Analysis of 238
Variance) in conjunction with Tukey’s post hoc test was carried out using the statistical software 239
program R version x64 3.3.0. 240
241
242
Results 243
244
artA is highly conserved in fungi and other eukaryotic species 245
246
Aspergillus flavus ArtA (corresponding to artA AFL2G_08271.2) presents 92.0% identity and 95.1% 247
similarity with its homolog in the model fungus A. nidulans (AAK25817.1). The deduced amino acid 248
sequence of the putative A. flavus artA gene was also compared to other putative homologs from 249
other Aspergillus spp. (Figure S1). This analysis indicated that ArtA is highly conserved among 250
species of this genus. The comparison between A. flavus artA and other Ascomycetes as well as 251
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 12: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/12.jpg)
12
Basidiomycetes showed a similar pattern, with homologs found in numerous species (Figure 1). 252
Multiple sequence alignment of these homologs with that of A. flavus demonstrated strong sequence 253
homology, even between distant fungal species (Figure S2 and S3). 254
255
artA regulates growth and development in A. flavus 256
257
In order to characterize the role of artA in growth and development in A. flavus, a deletion artA 258
(ΔartA), and a complementation (Com) strain were constructed. The deletion strain was 259
confirmed by Southern blot analysis (Figure S4A). Complementation of ΔartA with the artA 260
wild-type allele was verified by diagnostic PCR (Figure S4B). Expression levels of artA in wild-261
type, ΔartA, and complementation artA strains were analyzed using qRT-PCR (Figure S4C). 262
artA transcripts were not detected in the deletion strain, whereas artA was expressed in the wild-263
type and complementation strains. Colony growth was slightly decreased in the ΔartA strain in 264
comparison to the wild type (Figure 2). Complementation of ΔartA with the artA wild-type 265
allele rescued wild-type phenotype. 266
267
In addition, absence of artA affected conidiation. However this effect varied depending on 268
culture conditions. In top-agar inoculated cultures, the ΔartA strain presented a decrease in 269
conidial production with respect to the control strains (Figure 3). This reduction was also 270
accompanied by a decrease in the expression of transcription factor genes brlA and wetA, 271
components of the central regulatory pathway essential for conidiophore formation (1,2,3, 272
reviewed by 28). Interestingly, in point-inoculated cultures, conidiation increased in the artA 273
deletion mutant with respect to the control strain growing under the same conditions (Figure 274
S5). 275
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 13: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/13.jpg)
13
276
In addition to production of conidia, A. flavus forms resistant structures termed sclerotia. Our 277
results revealed that in the absence of artA the production of these structures was precocious and 278
increased with respect to the wild type (Figure 4). Furthermore, gene expression analysis of the 279
nsdC gene, encoding a transcription factor necessary for normal sclerotial production in A. flavus 280
(8), showed an increase in expression of this gene coincided with the observed increased of 281
sclerotia in ΔartA. In contrast, in point-inoculated cultures, sclerotial production was delayed, 282
mainly restricted to the center of the colony (Figure S5). 283
284
artA negatively affects AFB1 production 285
286
To determine if artA plays a role in the production of AFB1, content of this toxin was analyzed 287
in ΔartA cultures as well as in cultures of the wild type and complementation strain (Figure 5A 288
and 5B). Deletion of artA resulted in an increase in AF levels when compared to those in the 289
controls. In addition, expression of AF cluster regulatory genes aflR and aflJ (47,9) was 290
analyzed. (Figure 5C and 5D). Our results indicated that both regulators was greater in the 291
absence of artA compared to the controls. Furthermore, expression of ver1, often used as an 292
indicator of AF gene cluster activation also increased in the artA deletion mutant (Figure 5E). 293
294
artA influences the expression of other secondary metabolite genes in A. flavus 295
296
Aspergillus flavus contains 56 secondary metabolite gene clusters and is known to produce a 297
wide variety of other metabolites in addition to AFs (10,24, 38, 39, 54). In the current study our 298
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 14: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/14.jpg)
14
results showed that artA also affects the expression of genes involved in the synthesis of other 299
secondary metabolites, for example, PKS/NRPS (AFLA_139490), an essential gene in the 300
synthesis of the indole-tetramic acid mycotoxin cyclopiazonic acid (CPA) (10) and ustD, 301
involved in the production of ustiloxin, an inhibitor of microtubule assembly (40). Specifically, 302
artA positively regulates the expression of these genes in A. flavus (Figure 6). 303
304
Effect of artA on peanut seed infection 305
306
Due to the fact that the aflatoxin-producer A. flavus is an opportunistic plant pathogen of 307
economically relevant oil seed crops, the possible effect of artA on peanut seed infection was 308
examined. Our analysis revealed that in the absence of artA conidial production was increased 309
with respect to the controls when the fungus was grown on peanut seed substrate (Figure 7). In 310
addition, analysis of AF content in the infected tissue indicated that artA also negatively 311
regulates AFB1 production under these conditions (Figure 7). 312
313
Discussion 314
In this work we investigated the role of artA, encoding a putative 14-3-3 protein, in 315
morphological development and secondary metabolism of the agriculturally and medically 316
important fungus A. flavus. Our in-silico analysis indicated that the predicted ArtA protein 317
sequence is highly conserved within its corresponding homologs in Ascomycetes and 318
Basidiomycetes, as well as in other eukaryotes, where they have been found to be involved in the 319
regulation of numerous cellular processes. Approximately 200 different proteins from a wide 320
range of eukaryotic organisms have been reported as binding partners for the 14-3-3 proteins (i.e. 321
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 15: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/15.jpg)
15
13,44 ,41,29). Although there are numerous studies in yeast, where these proteins are essential in 322
most genetic backgrounds (i.e. reviewed by 42), 14-3-3 proteins are mostly unknown in 323
filamentous fungi, with few exceptions; in Trichoderma reesei the 14-3-3 proteins were shown to 324
affect the secretory system (45), also, overexpression of the artA homolog in A. nidulans resulted 325
in changes of polarization of conidia, with defects in the formation of germ tubes (27). In A. 326
flavus the majority of the ArtA protein sequence is conserved throughout numerous species, with 327
the exception of the C-terminal region, in agreement with previous observations (15, 42). It is 328
possible that the divergent C-termini of 14-3-3 proteins could have an effect on the diversity of 329
roles of these proteins in the cell. 330
331
Interestingly, our results revealed that artA plays a role in the morphological differentiation and 332
secondary metabolism of this fungus. Specifically, artA is a positive regulator of A. flavus 333
growth as a slight reduction in the diameter of the ΔartA colonies was observed compared to 334
those of wild-type. In addition to the effect of artA on vegetative growth, artA influences 335
asexual development. When the fungus was grown on top-agar inoculated cultures, deletion of 336
artA resulted in a decrease in conidiation, accompanied by a reduction in brlA and wetA 337
expression, essential genes in the central regulatory pathway that controls asexual development 338
(1,3). However, when A. flavus was grown as point-inoculated cultures on the same medium the 339
output changed and conidiation was enhanced in the ΔartA strain with respect to the controls. 340
Similarly, conidiation also increased in the absence of artA when growing on a different 341
substrate such as peanut seeds. This suggests that the role of artA on asexual development 342
depends on environmental clues, such as cell density or crowdedness (22), as well as the type of 343
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 16: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/16.jpg)
16
substrate where this organism is growing on, acting as a modulator of A. flavus development 344
contributing to the optimization of spore dissemination depending on external stimuli. 345
346
Aspergillus flavus also produces sclerotia, structures that allow this fungus to survive extreme 347
environmental conditions (11, 32, 46, 12, 8). These hard-pigmented structures consist of 348
compact mycelia (4, 48) that are vestigial forms of the sexual fruiting bodies (14, 34). Additional 349
research by Horn et al. (21) on the sexual stage in A. flavus demonstrated the presence of 350
ascospores in A. flavus sclerotia (termed stromata) under laboratory conditions. The current 351
study revealed that artA also regulates sclerotial production in this fungus. In this case, absence 352
of artA resulted in the opposite effect than that observed for conidiation, influencing the 353
developmental balance between these two morphological stages. On top-agar inoculated plates 354
absence of artA greatly promoted sclerotial production, while in point-inoculated cultures ΔartA 355
sclerotia were only formed at the center or near the center of the colony, where cell density and 356
rapid depletion of nutrients occurs, while formation of conidiophores abundantly occurred in 357
these colonies. The differential effects of artA on sclerotial formation under different culture 358
conditions suggests, as in the case of conidiation, that artA is a mediator between the 359
environment cues and the developmental changes observed in this mycotoxigenic fungus. 360
361
In addition to its effect of fungal development, artA also affects secondary metabolism in A. 362
flavus. AFB1 levels were significantly increased in the deletion mutant in both laboratory 363
medium and on seeds, indicating that artA negatively regulates the production of this toxin. 364
Genes involved in secondary metabolism are normally found in clusters (23, 52, 53, 16, 17). This 365
is also the case for the AF gene cluster. Two well-known endogenous regulatory genes are found 366
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 17: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/17.jpg)
17
within the AF cluster, aflR and aflJ. The expression of both aflR and aflJ (also called aflS) was 367
increased in the absence of artA. Furthermore, expression of ver1 (also called aflM), which is a 368
structural gene in the AF pathway that is commonly used as an indicator of AF cluster activation, 369
was also enhanced, coinciding with the observed increase in AF biosynthesis. These results 370
indicate that artA is a key negative regulator of AF gene expression and concomitant AF 371
production. Importantly, our chemical analysis indicated that artA also affects the synthesis of 372
other metabolites. Differently from the case of the AF genes, expression of a PKS/NRPS 373
(AFLA_139490) and ustD (AFLA_095040) genes, corresponding to the CPA and ustiloxin gene 374
clusters, respectively, were negatively regulated by artA. These results indicate a broad 375
regulatory role of this gene on A. flavus secondary metabolism differentially affecting diverse 376
gene clusters. 377
378
ArtA homologs have been previously described as scaffolds/adaptors interacting with numerous 379
proteins, and influencing multiple cell functions (13, 50, 42, 51, 43, 26, 6, 33). ArtA could 380
interact and modulate the function of proteins present in the cell, and also affect the 381
transcriptional machinery affecting the expression of numerous genes, including those observed 382
in this study, such as the developmental genes brlA, wetA, nsdC, as well as the described artA-383
dependent secondary metabolite genes. 384
385
In conclusion, A. flavus artA encodes a highly conserved 14-3-3 homolog that is required for 386
normal fungal morphogenesis in an environment-dependent manner, affecting the balance 387
between production of conidiophores and the formation of resistant structures that are necessary 388
for the dissemination and survival of this opportunistic pathogen. In addition, to our knowledge 389
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 18: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/18.jpg)
18
this is the first report of a 14-3-3 protein affecting secondary metabolism in filamentous fungi; 390
importantly, artA negatively regulates the biosynthesis of the potent carcinogenic compound 391
AFB1 as well as the production of other secondary metabolites in this agriculturally and 392
medically relevant fungus. 393
394
Aknowledgements 395
396
This work was supported by USDA grant 58-6435-4-015 and the Department of Biological 397
Sciences at Northern Illinois University. We thank Dr. Bahzhu Guo (USDA, Tifton, Georgia) 398
for kindly providing the NC94022 Virginia peanut line used in this study. 399
400
401
402
403
404
405
406
407
408
409
410
411
412
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 19: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/19.jpg)
19
Table S1. Amino acid sequences of ArtA used for sequence alignment and phylogenetic analysis 413
SPECIES ACCESSION NUMBER
Aspergillus flavus AFL2G_08271
Aspergillus oryzae XP_001823993.1
Aspergillus niger XP_001218186.1
Aspergillus kawachii GAA85416.1
Aspergillus clavatus XP_001272853.1
Aspergillus ruber EYE98024.1
Aspergillus fischeri XP_001265893.1
Aspergillus fumigatus XP_749464.1
Aspergillus nidulans AAK25817.1
Penicillium digitatum XP_014531373.1
Penicillium rubens XP_002562230.1
Penicillium subrubescens OKO90863.1
Talaromyces marneffei XP_002150416.1
Trichoderma virens XP_013949592.1
Trichoderma reesei CAC20377.1
Fusarium verticillioides XP_018750037.1
Fusarium fujikuroi KLO89980.1
Fusarium graminearum XP_011326500.1
Nuerospora crassa XP_964462.1
Candida albicans XP_721512.1
Schizosaccharomyces pombe NP_594167.1
Saccharomyces cerevisiae ONH73069.1
Trichosporon asahii XP_014184402.1
Puccinia graminis KDQ15383.1
Botryobasidium botryosum KDQ15383.1
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 20: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/20.jpg)
20
Coprinopsis cinerea XP_001837506.1
Ustilago maydis XP_011387257.1
Agaricus bisporus XP_006456745.1
Neolentinus lepideus KZT24546.1
Table S2. Primers used in this study 414
NAME SEQUENCE (5' → 3')
1346 - AflartA08271_5'F CGCGGGTGAGTCAGCGGGTC
1347 - AflartA08271_5'R GAGGGCCAAAAGCAACGGAAAAAGCAAGTATGAAATGG
1348 - AflartA08271_3`F GAACGCCTCCACCGAGAAGAAGGAGGA
1349 - AflartA08271_3`R
GGCGAGGCGGGGAGAGTAAGCATTTTCAC
1352 - AflartA08271_Asc1 AAAAAGGCGCGCCATGGGTCACGAAGATGCTGTTTATCTGGCCAA
GC
1353 - AflartA08271_Not1 AAAAAAAAAAAGCGGCCGCTCAGCAGCGGCTCGGCTCAG
1358 - 08271artApyrGF CCATTTCATACTTGCTTTTTCCGTTGCTTTTGGCCCTCACCGGTCGC
CTCAAACAATGCTCT
1359 - 08271artApyrGR TCCTCCTTCTTCTCGGTGGAGGCGTTCGTCTGAGAGGAGGCACTG
ATGCG
1362 - Afl_artA_NF GGGACTCTGGTGCTTGGATACGGGC
1363 - Afl_artA_NR CTAGCCCCATCTCAGCCACACCC
1507 - Afl_artA_Comp. F AAAAAAACTGCAGCGCGGGTGAGTCAGCGGGTC
1513 - Afl_artA_Comp. R AAAAAAACTGCAGGGAGCGACGATGCGCGTGGAG
1576 - 13837-flavus-niaD F CGTGGCGAGATGTTTGACTATCGAATCAC
1577 - 13837-flavus-niaD R AGGGAGCCGTGACACTTGGCCTC
Afla_18S F
TGATGACCCGCTCGGCACCTTACGAGAAATCAAAGT
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 21: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/21.jpg)
21
Afla_18S R
GGCCATGCACCACCATCCAAAAGATCAAGAAAGAGC
qPCR-Afla_artA_F
GGCGAGTCTAAGGTCTTCTACCACAAGAT
qPCR-Afla_artA_R
GGTTGTCTCTGAGAAGCTGCATCATCAG
qPCR-Afla_brlA_F
TATCCAGACATTCAAGACGCACAG
qPCR-Afla_brlA_R
GATAATAGAGGGCAAGTTCTCCAAAG
qPCR_Afla_wetA_F
GGGCTGTTCACGCCTGATCT
qPCR_Afla_wetA_R
GACCCCCTTGCAGGATGTCA
qPCR_Afla_nsdC_F
GGAAGTTACGCTCCTGAAGATG
qPCR_Afla_nsdC_R
CGTTCGTCCTCTTCATCCATAC
qPCR-Afla_ver1 F
CCGACAACCACCGTTTAGATGGC
qPCR-Afla_ver1 R
ACGTCTTTCAGGTGACCGAACGATA
qPCR-Afla_aflR_F
GCAACCTGATGACGACTGATATGG
qPCR-Afla_aflR_R
TGCCAGCACCTTGAGAACGATAAG
qPCR-Afla_aflJ_F
TGGAATATGGCTGTAGGAAGTG
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 22: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/22.jpg)
22
qPCR-Afla_aflJ_R
CATCCGAGTGAGCGTATCC
qPCR-Afla PKS/NRPS CPA F
TCGGGAGACTGCGGTCAACTC
qPCR-Afla PKS/NRPS CPA R
CCCACATAGAGTTTGTCGTCCGG
qCPR-Afla Ustiloxin ustD
NRPS F
TGCACAGGCAGAAACACCTCTTG
qPCR-Afla Ustiloxin ustD
NRPS R
A.fl_artA-SEQ5'F
A.fl_artA-SEQ3'R
CCGGGGGGAAAGGGAAGGAA
GGACACCTTATTAACATTTGTCGCAGAGC
GTTTGAGGGGGCACGAGTCTG
415
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 23: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/23.jpg)
23
23
Figure 1: Ascomycota Phylogenetic tree. Phylogenetic tree of ArtA fungal homologs 416
constructed using MEGA v6.0. Trees were generated with Maximum-Likelihood model with a 417
bootstrap value of 1000. 418
419
Figure 2. Effects of artA on vegetative colony growth. Quantification of colony growth as 420
colony diameter (mm). A. flavus strains were point-inoculated on YGT medium and incubated at 421
30° C in the dark. Measurements were taken 5 days after inoculation. Values shown are the 422
means of three samples. Error bars represent standard error. Different letters on the columns 423
indicate statistically different values (p<0.05). 424
425
Figure 3. Effects of artA on asexual development (A) Quantification of conidia after 72 h of 426
incubation of top-agar inoculated cultures. Seven millimeter cores were taken from each culture. 427
Conidia were counted using a hemocytometer. (B & C) qRT-PCR expression analyses of brlA 428
and wetA. Error bars represent standard error. Different letters on the columns indicate 429
statistically different values (p<0.05). 430
431
Figure 4. artA regulates sclerotial production in A. flavus. (A) Strains grown on YGT top-432
agar for 48 h and 72 h. In the second and third rows, plates were sprayed with ethanol before 433
photographs and micrographs were taken. (B) Quantification of sclerotial production. Sixteen 434
millimeter cores were collected. Number of sclerotia in each core were counted under a Leica 435
MZ75 dissecting microscope. (C) qRT-PCR expression analysis of nsdC. Error bars represent 436
standard error. Different letters on the columns indicate statistically different values (p<0.05). 437
438
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 24: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/24.jpg)
24
24
Figure 5. artA is a negative regulator of AFB1 biosynthesis and other unknown secondary 439
metabolites. (A) TLC analysis of aflatoxin B1 production in wild type, artA, and 440
complementation cultures after 48 h and 72 h of incubation. (B) Densitometry of TLC present in 441
Panel A. (C, D, and E) qRT-PCR expression analyses of aflR, aflJ, and ver1, respectively, after 442
48 h of incubation. Error bars represent standard error. Different letters on the columns indicate 443
statistically different values (p<0.05). 444
445
Figure 6. Effects of artA on the expression of key genes in the ustiloxin and CPA secondary 446
metabolite gene clusters. The A. flavus strains were top-agar inoculated on YGT medium and 447
incubated at 30 °C. Mycelium was collected after 72 h of incubation. (A and B) qRT-PCR results 448
showing the relative expression of the AFLA_139490 gene in the CPA gene cluster, and ustD 449
gene in the ustiloxin gene cluster. Error bars represent standard error. Different letters on the 450
columns indicate statistically different values (p<0.05). 451
452
Figure 7. Effects of artA on A. flavus peanut seed infection. The NC94022 viable peanut line 453
was infected with the A. flavus stains and incubated at 30 °C in the dark for 7 days. (A) 454
Photographs of the infected peanuts after incubation. (B) Quantification of conidia produced on 455
infected peanut cotyledons. (C) TLC analysis of AFB1 present in infected peanuts. (D) 456
Densitometry of TLC present in Panel C. The experiment was carried out in triplicate. Error bars 457
represent standard error. Different letters on the columns indicate statistically different values 458
(p<0.05). 459
460
461
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 25: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/25.jpg)
25
25
References 462
463
1. Adams TH, Boylan MT, Timberlake WE. 1988. brlA is necessary and sufficient to direct 464
conidiophore development in Aspergillus nidulans. Cell. 54(3): 353-62. DOI: 465
http://dx.doi.org/10.1016/0092-8674(88)90198-5 466
467
2. Adams T H, andTimberlake WE. 1990 Developmental repression of growth and gene 468
expression in Aspergillus. Proc. Natl. Acad. Sci.USA. 87: 5405-09. PMCID: PMC54333 469
470
3. AdamsTHWieser JK, Yu J. 1998 Asexual Sporulation in Aspergillus nidulans. Microbiol. 471
Mol. Biol. Rev. 62(1): 35-54. PMCID: PMC98905 472
473
4. Amaike S, Keller NP. 2011 Aspergillus flavus. Ann. Rev. Phytopathol. 49: 107–33. 474
DOI:10.1146/annurev-phyto-072910-095221 475
476
5. Bennett JW. 2010. “An overview of the genus Aspergillus.” Aspergillus. Caister Academic 477
478
6. Bustos DM. 2012 The role of protein disorder in the 14-3-3 interaction network. Mol. 479
Biosyst. 8: 178-84. DOI: 10.1039/C1MB05216K 480
481
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 26: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/26.jpg)
26
26
7. Cary JW, Ehrlich KC, Bland JM, Montalbano BG. 2006. The aflatoxin biosynthesis cluster 482
gene, aflX, encodes an oxidoreductase involved in the conversion of Versicolorin A to 483
Demethylsterigmatocystin. Appl Environ Microbiol. 72: 1096–1101. pmid:16461654 484
485
8. Cary JW, Harris-Coward PY, Ehrlich KC, Mack BM, Kale SP et al.. 2012. NsdC and 486
NsdD affect Aspergillus flavus morphogenesis and aflatoxin production. Eukaryotic Cell 487
11(9): 1104–11. DOI:10.1128/EC.00069-12 488
489
9. Chang PK. 2003. The Aspergillus parasiticus protein AFLJ interacts with the aflatoxin 490
pathway-specific regulator AFLR. Mol Gen Genomics 268:711–719. doi:10.1007/s00438-491
003-0809-3 492
493
10. Chang PK, Horn BW, Dorner JW. 2009. Clustered genes involved in cyclopiazonic acid 494
production are next to the aflatoxin biosynthesis gene cluster in Aspergillus flavus. Fungal 495
Genet Biol. 46(2): 176-182. http://dx.doi.org/10.1016/j.fgb.2008.11.002 496
497
11. Coley-Smith JR, Cooke RC. 1971. Survival and germination of fungal sclerotia. Annual 498
Review of Phytopathology. 9: 65-92. DOI:10.1146/annurev.py.09.090171.000433 499
500
12. DuranRM, Cary JW, Calvo AM. 2007. Production of cyclopiazonic acid, aflatrem, and 501
aflatoxin by Aspergillus flavus is regulated by veA, a gene necessary for sclerotial 502
formation. Appl. Microbiol. Biotechnol. 73: 1158-68. DOI:10.1007/s00253-006-0581-5 503
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 27: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/27.jpg)
27
27
504
13. Fu H, RR Subramanian RR, Masters SC. 2000. 14-3-3 proteins: Structure, function and 505
regulation. Annu. Rev. Pharmacol. Toxicol. 40: 617-47. 506
DOI:10.1146/annurev.pharmtox.40.1.617 507
508
14. Geiser DM, Pitt JI, Taylor JW. 1998. Cryptic speciation and recombination in the aflatoxin-509
producing fungus Aspergillus flavus. Proc. Natl. Acad. Sci. USA. 95: 388-93. PMCID: 510
PMC18233 511
512
15. Gelperin D, Weigle J, Nelson K,Roseboom P, Irie K et al., 1995. 14-3-3 proteins: Potential 513
roles in vesicular transport and Ras signaling in Saccharomyces cerevisiae. Proc. Natl. 514
Acad. Sci. USA. 92: 11539-43. PMCID: PMC40437 515
516
16. Georgianna DR, Fedorova ND, Burroughs JL, Dolezal AL, Bok JWet al., 2010. Beyond 517
aflatoxin: four distinct expression patterns and functional roles associated with Aspergillus 518
flavus secondary metabolism gene clusters. Mol. Plant Pathol. 11(2): 213-226. DOI: 519
10.1111/j.1364-3703.2009.00594.x 520
521
17. Gibbons JG, Rokas A. 2013. The function and evolution of the Aspergillus genome. 522
Trends Microbiol. 21(1): 14-22. DOI: 10.1016/j.tim.2012.09.005 523
524
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 28: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/28.jpg)
28
28
18. Groopman JD, Kensler TW, Wild CP. 2008. Protective interventions to prevent aflatoxin-525
induced carcinogenesis in developing countries. Annu Rev Public Health. 29: 187-203. 526
DOI:10.1146/annurev.publhealth.29.020907.090859 527
528
19. Hedayati M.T, Pasqualotto AC, Warn PA, Bowyer P, Denning DW. 2007. Aspergillus 529
flavus: human pathogen, allergen and mycotoxin producer. Microbiology. 153: 1677-92. 530
DOI: 10.1099/mic.0.2007/007641-0 531
532
20. Hill T, Kafer E (2001) Improved protocols for Aspergillus minimal medium: trace elements 533
and minimal medium stock solution. Fungal Genet Newslett 48: 20–21. 534
535
21. Horn BW, Sorensen RB, Lamb MC, Sobolev VS, Olarte RA, et al., 2014. Sexual 536
reproduction in Aspergillus flavus sclerotia naturally produced in corn. Phytopathology 537
104: 75-85. DOI:10.1094/PHYTO-05-13-0129-R 538
22. Horowitz Brown S, Zarnowski R, Sharpee WC, Keller NP. 2008. Morphological 539
transitions governed by density dependence and lipoxygenase activity in Aspergillus flavus. 540
Appl Environ Microbiol. 74(18):5674-85. doi: 10.1128/AEM.00565-08. 541
542
23. Keller NP, Hohn TM. 1997. Metabolic pathway gene clusters in filamentous fungi. Fungal 543
Genet Biol. 21(1): 17-29. DOI:10.1006/fgbi.1997.0970 544
545
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 29: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/29.jpg)
29
29
24. Khaldi N, Seifuddin FT, Turner G, Haft D, Nierman WC, Wolfe KH, Fedorova ND 2010. 546
SMURF: genomic mapping of fungal secondary metabolite clusters. Fungal Genet Biol 547
47:736–741. http://dx.doi.org/10 .1016/j.fgb.2010.06.003. 548
549
25. Khlangwiset P, Shephard GS, Wu F. 2011. Aflatoxins and growth impairment: A review. 550
Crit Rev Toxicol. 41(9): 740-55. DOI: 10.3109/10408444.2011.575766 551
552
26. Kleppe R, Martinez A., Døskeland SO ,Haavik J. 2011. The 14-3-3 proteins in regulation 553
of cellular metabolism. Seminars in Cell & Developmental Biology 22: 713-19. DOI: 554
10.1016/j.semcdb.2011.08.008 555
556
27. Kraus PR, Hoffman AF,. Harris SD. 2002. Characterization of the Aspergillus nidulans 557
14-3-3 homologue, ArtA. FEMS Microbiology Letters. 210(1): 61-66. 558
DOI:10.1111/j.1574-6968.2002.tb11160. 559
560
28. Krijgsheld P, Bleichrodt RJ, Veluw GJ van, Wang F, Müller WG, et al. 2013 Development 561
of Aspergillus. Studies in Mycology 74: 1–2. DOI: http://doi.org/10.3114/sim0006 562
563
29. Kumar R. 2017. An Account of Fungal 14-3-3 Proteins. Eur J Cell Biol. 96(2):206-217. 564
doi: 10.1016/j.ejcb.2017.02.006. 565
566
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 30: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/30.jpg)
30
30
30. Lalle M, Leptourgidou F, Camerini S, Pozio E, Skoulakis EMC. 2013. Interkingdom 567
complementation reveals structural conservation and functional divergence of 14-3-3 568
proteins. PLOS ONE 8(10): e78090. DOI: 10.1371/journal.pone.0078090 569
570
31. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time 571
quantitative PCR and the 2(-Delta Delta C(T) method. Methods. 25: 402–408. 572
pmid:11846609 573
574
32. Malloch D, Cain RF. 1972. The Trichocomataceae: ascomycetes with Aspergillus, 575
Paecilomyces and Penicillium imperfect states. Can J Bot 50: 2613-28. DOI: 10.1139/b72-576
335 577
578
33. Milroy L, Brunsveld L, Ottmann C. 2012. Stabilization and inhibition of protein−protein 579
interactions: The 14-3-3 case study. ACS Chem. Biol. 8: 27−35. DOI: 10.1021/cb300599t 580
581
34. Ramirez-Prado JH, Moore GG, Horn BW, Carbone I. 2008. Characterization and 582
population analysis of the mating-type genes in Aspergillus flavus and Aspergillus 583
parasiticus. Fungal Genet Biol 45: 1292-1299. DOI:10.1016/j.fgb.2008.06.007 584
585
35. Robens J, Cardwell K. 2003. The costs of mycotoxin management to the USA: 586
management of aflatoxins in the United States. J Toxicol Toxin Rev. 2003; 22: 139–152. 587
DOI: 10.1081/TXR-120024089 588
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 31: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/31.jpg)
31
31
589
36. Szewczyk E, Nayak T, Oakley CE, Edgerton H, Xiong Y et al.. 2006. Fusion PCR and 590
gene targeting in Aspergillus nidulans. Nature Protocols. 1(6): 3111-20. 591
DOI:10.1038/nprot.2006.405 592
593
37. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. (2013) MEGA6: Molecular 594
Evolutionary genetics analysis version 6.0. Mol Biol Evol. 30: 2725–2729. doi: 595
10.1093/molbev/mst197 596
597
38. Terabayshi Y, Sano M, Yamane N, Marui J, Tamani K, Sagara J, Dohmoto M, Oda K, 598
Ohshima E, Tachibana K, HigaY, Ohashi S, Koike HH, Machida M. 2010. Identification 599
and characterization of genes responsible for biosynthesis of kojic acid, an industrially 600
important compound from Aspergillus oryzae. Fungal Genet Biol 47:953–961. 601
http://dx.doi.org /10.1016/j.fgb.2010.08.014 602
603
39. Tokuoka M, Seshime Y, Fujii I, Kitamoto K, Takahashi T, Koyama 604
Y.2008.Identificationof a novel polyketide synthase-nonribosomal peptide synthetase 605
(PKS-NRPS) gene required for the biosynthesis of cyclopiazonic acid in Aspergillus 606
oryzae. Fungal Genet Biol 45:1608–1615. http: //dx.doi.org/10.1016/j.fgb.2008.09.006. 607
608
40. Umemura M, Nagano N, Koike H, Kawano J, Ishii T, Miyamura Y, Kikuchi M, Tamano K, 609
Yu J, Shin-ya’ K, Machida M. 2014. Characterization of the biosynthetic gene cluster for 610
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 32: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/32.jpg)
32
32
the ribosomally synthesized cyclic peptide ustiloxin B in Aspergillus flavus. FungalGenet 611
Biol. 68: 23-30. http://dx.doi.org/10.1016/j.fgb.2014.04.011 612
613
41. van Heusden GPH. 2005. 14-3-3 proteins: regulators of numerous eukaryotic 614
proteins. IUBMB Life 57: 623–629. DOI: 10.1080/15216540500252666 615
616
42. van Heusden G P.H, Steensma HY. 2006. Yeast 14-3-3 proteins. Yeast. 23: 159-71. DOI: 617
10.1002/yea.1338 618
619
43. van Heusden G PH. 2009. 14-3-3 proteins: Insights from genome-wide studies in yeast. 620
Genomics 94: 287-93. DOI: 10.1016/j.ygeno.2009.07.004 621
622
44. van Hemert MJ, van Heusden GPH, Steensma HY. 2001. Yeast 14-3-3 proteins. Yeast 18: 623
889–895. DOI:10.1002/yea.739 624
625
45. Vasara T, Keränen S, Penttilä M, Saloheimo M.2002. Characterization of two 14-3-3 genes 626
from Trichoderma reesei: interactions with yeast secretory pathway components. Biochim 627
Biophys Acta. 2002 Jun 12;1590(1-3):27-40. DOI: 10.1016/S0167-4889(02)00197-0 · 628
629
46. Wicklow DT. 1987 Survival of Aspergillus flavus sclerotia in soil. Trans. Br. mycol. Soc. 630
89(1): 131-4. DOI:10.1094/Phyto-83-1141 631
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 33: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/33.jpg)
33
33
632
47. Woloshuk CP, Yousibova GL, Rollins JA, Bhatnagar D, Payne GA. 1995. Molecular 633
characterization of the afl-1 locus in Aspergillus flavus. Appl Enviorn Microbiol 61:3019–634
3023. PMCID: PMC167577 635
636
48. Wu F, Groopman JD, Pestka1 JJ. 2014. Public health impacts of foodbourne mycotoxins. 637
Annu. Rev. Food Sci. Technol. 5: 351-72. DOI:10.1146/annurev-food-030713-092431. 638
639
49. Wu F, Guclu H. 2012. Aflatoxin Regulations in a Network of Global Maize Trade. PLOS 640
One 7(9): e435151. DOI:10.1371/journal.pone.0045151 641
642
50. Yaffe MB. 2002. How do 14-3-3 proteins work? – Gatekeeper phosphorylation and the 643
molecular anvil hypothesis. FEBS Letters 513: 53-7. DOI: 10.1016/S0014-644
5793(01)03288-4 645
646
51. Yang X, Lee WH, Sobott F, Papagrigoriou E, Robinson CV et al., 2006. Structural basis 647
for protein-protein interactions in the 14-3-3 protein family. PNAS 103(46): 17237- 42. 648
DOI: 10.1073/pnas.0605779103 649
650
52. Yu J, Cleveland TE, Bierman WC, Bennett JW. 2005. Aspergillus flavus genomics: 651
gateway to human and animal health, food, safety, and crop resistance to diseases. Rev 652
Iberoam Micol 22: 194-202. DOI: 10.1016/S1130-1406(05)70043-7 653
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 34: The 14 -3-3 homolog, ArtA, regulates development and ... · In addition, n ormal levels of artA are 26 required for sclerotial development. Importantly, artA negative ly regulat es](https://reader033.fdocuments.net/reader033/viewer/2022041823/5e5f9f1ff72c716de00b9ba3/html5/thumbnails/34.jpg)
34
34
654
53. Yu J, Keller N. 2005. Regulation of secondary metabolism in filamentous fungi. Annual 655
Review of Phytopathology. 22: 194-202. DOI: 10.1146/annurev.phyto.43.040204.14021 656
657
54. Zhang S, Monahan BJ, Tkacz JS, Scott B. 2004. Indole-diterpene gene cluster 658
fromAspergillus flavus. Appl Environ Microbiol 70:687 6883. 659
http://dx.doi.org/10.1128/AEM.70.11.6875-6883.2004. 660
661
55. Zhuang Z, Lohmar JM, Satterlee T, Cary JW., Calvo AM. 2016. The Master Transcription 662
Factor mtfA Governs Aflatoxin Production, Morphological Development and Pathogenicity 663
in the Fungus Aspergillus flavus. Toxins (Basel). Jan 20;8(1). pii: E29. doi: 664
10.3390/toxins8010029 665
on March 4, 2020 by guest
http://aem.asm
.org/D
ownloaded from