Targeting Extracellular Cyclophilins Ameliorates Disease ......Targeting Extracellular Cyclophilins...

INTRODUCTIONBiliary atresia (BA) is a devastating

liver disease in children that results inobstruction of the biliary system and,without treatment, death within twoyears of birth due to hepatic cirrhosis.The incidence of BA is quite rare; it is di-agnosed in approximately one in 10,000

children in the first three months of life.The pathophysiology of BA is inflamma-tion and obstruction of the extrahepaticbile ducts that results in fibrosis, subse-quent cirrhosis and eventual liver failure.Surgical treatment via portoenterostomyresults in only ~60% transplant-free sur-vival 2 years after surgery (1). Since the

exact cause of the disease is unknownand medical and surgical treatments re-main suboptimal, clarification of themechanisms involved in initial inductionand progression of biliary inflammationand identification of potential targets fortherapeutic intervention remain essentialfor new treatment strategies.

The murine model of BA in neonatalmice infected with rhesus rotavirus(RRV) has been used to study the patho-genesis of the disease (2,3). In our earlystudies using this model, we demon-strated increased mRNA expression ofthe matrix metalloproteinases (MMPs) inliver tissue samples of infected mice (4).We had initially suspected that thesegenes may be upregulated via the trans-forming growth factor (TGF)β pathway,as we had also seen perturbations inmRNA expression of tissue inhibitor ofmetalloproteinases (TIMP)-1 and TIMP-4

M O L M E D 2 1 : 6 5 7 - 6 6 4 , 2 0 1 5 | I O R D A N S K A I A E T A L . | 6 5 7

Targeting Extracellular Cyclophilins Ameliorates DiseaseProgression in Experimental Biliary Atresia

Tatiana Iordanskaia,1 Miroslav Malesevic,2 Gunter Fischer,3 Tatiana Pushkarsky,4 Michael Bukrinsky,4 andEvan P Nadler1

1Division of Pediatric Surgery, Children’s National Medical Center, Washington, District of Columbia, United States of America;2Institute of Biochemistry, Martin Luther-University Halle-Wittenberg, Halle, Germany; 3Max-Planck-Institute for BiophysicalChemistry Gottingen, Halle, Germany; 4George Washington University School of Medicine and Health Sciences, Department ofMicrobiology, Immunology and Tropical Medicine Washington, District of Columbia, United States of America

Biliary atresia (BA) is a devastating liver disease of unknown etiology affecting children generally within the first 3 months of life.The disease is manifested by inflammation and subsequent obstruction of the extrahepatic bile ducts, fibrosis and liver failure. Themechanisms responsible for disease pathogenesis are not fully understood, but a number of factors controlled by the SMAD sig-naling pathway have been implicated. In this study, we investigated the role of a known proinflammatory factor, extracellular cy-clophilin A (CypA), in the pathogenesis of biliary atresia using the rhesus rotavirus (RRV) murine model. We used a unique cy-closporine A derivative, MM284, which does not enter cells and therefore inactivates exclusively extracellular cyclophilins, as apotential treatment. We demonstrated that levels of CypA in plasma of RRV-infected mice were increased significantly, and thattreatment of mice with MM284 prior to or one day after disease initiation by RRV infection significantly improved the status of micewith experimental BA: weight gain was restored, bilirubinuria was abrogated, liver infiltration by inflammatory cells was reducedand activation of the SMAD pathway and SMAD-controlled fibrosis mediators and tissue inhibitor of metalloproteinases (TIMP)-4and matrix metalloproteinase (MMP)-7 was alleviated. Furthermore, treatment of human hepatic stellate cells with recombinantcyclophilin recapitulated SMAD2/3 activation, which was also suppressed by MM284 treatment. Our data provide the first evi-dence that extracellular cyclophilins activate the SMAD pathway and promote inflammation in experimental BA, and suggestthat MM284 may be a promising therapeutic agent for treating BA and possibly other intrahepatic chronic disorders.Online address: http://www.molmed.orgdoi: 10.2119/molmed.2015.00076

Address correspondence to Evan P Nadler, Division of Pediatric Surgery, Children’s Na-

tional Medical Center, 111 Michigan Avenue, NW, Washington, DC 20010. Phone: 202-

476-2151; Fax: 202-476-4174; E-mail: [email protected]; or Michael Bukrin-

sky, George Washington University School of Medicine and Health Sciences, 2300 Eye

Street NW, Washington, DC 20037; Phone: 202-994-2036; Fax: 202-994-2913; E-mail:

[email protected].

Submitted April 1, 2015; Accepted for publication July 24, 2015; Published Online

(www.molmed.org) July 24, 2015.

as well as plasminogen activator inhibitor-1 (PAI-1), which are all regu-lated by TGFβ. However, several experi-ments utilizing anti-TGF strategies, com-prised mainly of antibody blockade ofTGF and its pathway members, failed todemonstrate any effect in this animalmodel (data not shown). Therefore, webegan to explore alternative mechanismsthat could be responsible for BA- associated inflammation.

Studies of tumorigenesis have shownthat increased levels of MMPs are de-tected in stromal fibroblasts, endothelialcells and in the tumor cells themselves inresponse to activation of extracellularmatrix metalloproteinase inducer (EMM-PRIN) or CD147 (5). CD147 is a type Itransmembrane glycoprotein, a memberof the immunoglobulin super-family, thatis expressed by a wide array of celltypes, including epithelial, endothelialand hematopoietic cells (6). CD147 is asignaling receptor for extracellular cy-clophilins (Cyp) A and B (7,8), and recentpublications have identified the CD147signaling pathway induced by extracel-lular cyclophilins as a triggering mecha-nism regulating MMP expression and in-flammation in atherosclerosis,rheumatoid arthritis, allergic and chroniclung disease (9–14). Thus, we hypothe-sized that CD147 activation by extracel-lular cyclophilin may play a role in ex-perimental BA as well.

Previous studies showed that the inter-action of extracellular CypA with CD147induces activation of extracellular signal-regulated kinase (ERK) pathway and adownstream increase in the expression ofinterleukins, MMPs and CD147 itself, re-sulting in the progression of inflamma-tion (9,15,16). Thus, blockade of extracel-lular cyclophilin-CD147 interactions mayhave a potential to reduce inflammationand infiltration of inflammatory cells intoinfected tissues. In fact, studies of seruminflammatory cytokine profiles demon-strated that treatment of acute systemicvasculitis (Kawasaki disease) with cy-closporine (a known cyclophilin in-hibitor) resulted in downregulation of cy-clophilin-induced pathways, including

CD147-mediated inflammation (17).Therefore, specific targeting of extracellu-lar cyclophilins may be a valid therapeu-tic strategy to inhibit CD147-dependentpathways. MM284 is a nonimmunosup-pressive cell-impermeable cyclosporinederivative that does not penetrate theplasma membrane and, therefore, cannotinteract with intracellular cyclophilinsand mediate intracellular immunosup-pressive activity; thus MM284 targetsonly the extracellular pool of cyclophilins(12,18). We hypothesized that the liver in-flammation associated with BA may beinduced or activated by the interaction ofextracellular CypA with CD147 located atthe plasma membrane of hepatocytes andhepatic stellate cells, and blocking this in-teraction by MM284 would inhibit thisinflammatory response and subsequentliver inflammation and, potentially, fibrosis.

MATERIALS AND METHODS

Murine Model of Biliary AtresiaPregnant time-dated BALB/c mice

(Charles River Labs) were kept with oneanimal per cage with free access to waterand the standard laboratory diet. Afterspontaneous vaginal delivery, the new-born mice were randomly divided intofour groups. During the first 24 h of life,mice in the control group (n = 10) re-ceived an intraperitoneal injection of 15%Cremophor EL (Sigma-Aldrich) or saline.The initial set of animals in this group(n = 5) was injected with 15% CremophorEL, and no effect of the Cremophor EL onmouse weight or bilirubinuria was con-firmed by comparing these mice to micereceiving saline alone (n = 5) (data notshown). In the second group (RRV group,n = 23), 1.5 × 106 fluorescence formingunits of rhesus rotavirus (RRV) was ad-ministered, and 15% Cremophor EL wasinjected on d 0, 2, 4, 6, 8, 10 and 12. Thethird group (MM284 + RRV group, n = 20total) received RRV plus 20 mg/kg ofMM284 in 15% Cremophor EL. The fourthgroup (MM284 group, n = 5) received 20 mg/kg of MM284 in 15% CremophorEL only. The animal data were collected

from three separate animal trials to ac-count for the variability in the RRVmodel. We used two different schedulesfor MM284 treatment for group 3. In thefirst set of experiments (n = 15), animalsreceived the drug on d 0, 2, 4, 6, 8, 10 and12. This represented initiation of MM284treatment prior to RRV administrationand consequently prior to the onset ofdisease (pretreatment). In the second setof experiments (n = 5), treatment withMM284 was initiated on d 1 after RRVtreatment. The treated mice were keptwith their mothers, maintained in normalenvironment and housed in a room with astandard 12-h dark–light cycle. Subse-quent experimental procedures (such asclinical phenotyping, subcutaneous salineinjection and organ harvest) were per-formed as previously described (4). Liverspecimens were harvested for protein andRNA isolation, as well as histological andimmunohistochemical analysis. All proce-dures were approved by the Children’sNational Medical Center Institutional An-imal Care and Use Committee (IACUC).

RNA Isolation and Real-time ReverseTranscriptase–Polymerase ChainReaction (RT-PCR)

Mice were euthanized on d 14 afterRRV injection, their livers were har-vested, and mRNA expression for in-flammatory cytokines and fibrosis mediators was quantified by RT-PCR.Total RNA from the homogenized liverswas extracted using TRI reagent (Molec-ular Research Center) and purified usingRNeasy Mini Kits (Qiagen) according tothe manufacturer’s instructions. ThecDNA pools were generated by the RTreaction using standard reagents (Invitro-gen) and Oligo-dT primer and subjectedto RT-PCR on an ABI PCR machine usingSYBR GreenPCR Master mix (BioRad).The mRNA expression of selected cy-tokines and fibrotic mediators were thenquantified relative to the referencehousekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH),using techniques previously described(4). All measurements were done in trip-licate. The primers are listed in Table 1.

6 5 8 | I O R D A N S K A I A E T A L . | M O L M E D 2 1 : 6 5 7 - 6 6 4 , 2 0 1 5

E X T R A C E L L U L A R C y p A I N E X P E R I M E N T A L B I L I A R Y A T R E S I A

Enzyme-Linked Immunosorbent Assay(ELISA)

The concentration of phosphorylatedSMAD2 was determined using the com-mercially available PathScan P-SMAD2Sandwich ELISA kit (Cell Signaling Tech-nology). Liver samples were homoge-nized according to the manufacturer’sinstructions in lysis buffer using homog-enizer FastPrep-24 (MP Biomedicals).Subsequent manipulations were per-formed as described earlier (19). The con-centration of murine CypA in plasmawas determined using ELISA kits fromMyBioSource following the manufac-turer’s instructions.

MM284MM284, a side-chain modification in

the 1-position of cyclosporine A (CsA)was prepared according to publishedprocedures (20). For injection, the pow-der was first dissolved in 100% ethanol(Sigma-Aldrich) and then diluted in ster-ile 15% solution of Cremophor EL(Sigma-Aldrich) in PBS.

Cyclophilin AHuman recombinant cyclophilin A was

an Enzo Life Science product.

Cell CultureHuman hepatic stellate cells (HSC)

were a product of ScienCell ResearchLaboratories. Cells were cultured in the

special stellate cell medium supple-mented with 1% stellate cell grow sup-plement, 2% fetal bovine serum and pen-icillin-streptomycin solution (100 U/mLand 100 μg/mL, respectively). HSC cellswere cultured in poly-D-lysine-coated75-cm2 culture flasks (Becton DickinsonLabware) at 37°C and 5% CO2/95% airatmosphere. Cultured HSCs were treatedwith recombinant CypA (800 ng/mL)with or without MM284 (400 ng/mL)and then incubated for 72 h. The dose ofCypA used in this experiment was about15-fold higher than the level measured inthe plasma of BA mice to account forhigher concentration of cyclophilin at thesites of inflammation; this concentrationis similar to CypA levels in the serum ofpatients with systemic inflammation ob-served in sepsis (22).

RESULTS

Presence of CypA in RRV-TreatedMice

To determine whether extracellular cy-clophilins are upregulated in the BAmodel, we measured CypA levels inplasma of RRV-treated mice. As shown inFigure 1, CypA was increased from 17.6 ±3.9 ng/mL in saline-treated control miceto 59.0 ± 18.0 ng/mL in RRV-treated mice(p < 0.0001), suggesting that extracellularCypA may contribute to pathophysiologyof disease in this model. Of note, the ac-

tual concentration of CypA at the site ofinflammation (the place where it is re-leased) is likely considerably higher thanthe plasma levels. Thus, we proceeded toemploy MM284 in the experimentalmodel of BA to assess whether blockadeof the extracellular cyclophilins may havea beneficial effect. In initial experiments,we attempted a dose of 10 mg/kg forMM284 administration, but this dose didnot have any measurable effect (data notshown). The foregoing data are only foranimals treated with the 20-mg/kg doseof the compound.

MM284 Treatment Restores WeightGain and Prevents Bilirubinuria in BAMice

In our previous studies we showedthat mice with experimental BA dis-played significantly less weight gain thanthe normal controls (4). Our current dataconfirm that from d 7 to d 14, experimen-tal BA mice demonstrated 30% lessweight gain compared with control mice(Figure 2A). After d 12, RRV-infectedmice did not increase their weight at all,whereas control animals and RRV- infected mice treated with MM284 contin-ued to gain weight (Figures 2A, B). Inter-estingly both pretreatment with MM284before RRV infection (panel A) and treat-ment with MM284 24 h postinfection

R E S E A R C H A R T I C L E


Table 1. Primers.

Primers for proinflammatory cytokines

Mediator Forward primer (5′-3′) Reverse primer (5′-3′)

TNF-α AGCCCCCAGTCTGTATCCTT CTCCCTTTGCAGAACTCAGGIL-6 AGTTGCCTTCTTGGGACTGA TCCACGATTTCCCAGAGAACIL-1β AGGCCACAGGTATTTTGTCG GCCCATCCTCTGTGACTCAT

Primers for fibrosis mediators

Mediator Forward primer (5′-3′) Reverse primer (5′-3′)

PAI-1 CCGATCCTTTCTCTTTGTGG TCAAGGCTCCATCACTTGGIntegrin αVβ6 GAACGCTCTAAGGCCAAGTG TGCTTCTCCCTGTGCTTGTATIMP-1 GACCTATAGTGCTGGCTGTG TCATCTTCCAGTTTGCAAGGTIMP-4 TGCCAAATCACCACTTGCTA ATAGAGCTTCCGTTCCAGCAMMP-7 CCCTACCTATCAAAGAGACT CAGCGTGTTCCTCTTTCCATMMP-9 CCTGGAACTCACACGACATC GGAAACTCACACGCCAGAAGAPDH GGCATTGCTCTCAATGACAA CCCTGTTGCTGTAGCCGTAT

Figure 1. Increased levels of CypA inplasma of mice with biliary atresia. SerumCypA levels were measured 14 d afterRRV infection (n = 10) and compared with10 uninfected (control) mice. Results repre-sent mean ± SD. P value was calculatedusing Student unpaired t-test.

(panel B) resulted in similar weight gaintrajectories as control mice. There wereno significant differences in weight gainbetween control and RRV-infectedMM284-treated groups. When comparedwith RRV-infected untreated mice, in-fected mice treated with MM284 showedstatistically significant weight increase:7.4 ± 1.2 g versus 5.3 ± 1.2 g (p < 0.01) inthe experiment with MM284 pretreat-ment, and 7.92 ± 1.9 g versus 4.0 ± 0.5 g(p < 0.001) when the mice were givenMM284 after viral infection.

We have previously shown that biliru-binuria correlates well with biliary ob-struction and with histologic BA in theexperimental model of BA (4). In the cur-rent study, no animals treated with salineor Cremophor EL alone without RRV in-fection displayed bilirubinuria on a urinedipstick. In animals infected with RRVbut not receiving MM284, 21 of the 23were positive for bilirubinuria on d 14(Figure 2C). In contrast, only 8 out of 20MM284-treated mice were positive forbilirubinuria after RRV infection. Both

the pretreatment and posttreatmentgroups had the same proportion ofbilirubinuria-positive mice (6/15 and2/5, respectively, p = 1.0 Fischer’s Exacttest). When combining the pretreatmentand posttreatment groups and compar-ing them to untreated animals, thechances that the difference betweenMM284-treated and control animals wasdue to chance alone were insignificant (p< 0.001, chi-square test).

MM284 Ameliorates the InflammatoryResponse in BA Mice

We initially performed routine hema-toxylin and eosin staining, which re-vealed neutrophil infiltration and bileduct proliferation after RRV infection,but lack of fibrosis (Figure 3A), similarto previously described findings in thismodel (4,5). Treatment with MM284prior to RRV infection revealed a reduc-tion of infiltration of neutrophils andinflammatory foci in the liver con-firmed by myeloperoxidase stainingwhen compared with the RRV-onlygroup (Figure 3A).

We previously demonstrated a dra-matic increase of mRNA expression ofcertain mediators of inflammation and fi-brosis, such as TIMP-1, TIMP-4, PAI-1,MMP-7 and MMP-9 in the mouse modelof BA (4). In the present study, we foundthat treatment with MM284 significantlyreduced expression of two of these medi-ators, TIMP-4 and MMP-7, in the liverhomogenates of mice with RRV-inducedBA. Pretreatment with MM284 resultedin an over six-fold (6.6 ± 1.1, p < 0.001) reduction of TIMP-4 mRNA in the liverrelative to untreated animals on d 14(Figure 3B), and posttreatment withMM284 decreased the TIMP-4 mRNA ap-proximately five-fold (5.4 ± 1.12, p < 0.01)(Figure 3C). An even more pronouncedeffect was observed on MMP-7 mRNAexpression: it was reduced about ten-foldon d 14 postinfection in both mice pre-treated and posttreated with MM284(10.7 ± 2.2, p < 0.001 and 9.9 ± 0.7, p <0.01 respectively, relative to untreatedmice) (Figures 3D, E). However, TIMP-4and MMP-7 mRNA expression levels in



Figure 2. MM284 prevented weight loss in newborn mice with biliary atresia induced byrhesus rotavirus. Newborn BALB/c mice were either pretreated with MM284 on the firstday of life and injected with Rhesus Rotavirus (RRV) 24 h posttreatment (A) or infectedwith RRV and then treated with MM284 on d 1 postinfection (B). Subsequent MM284 injec-tions were performed on d 4, 6, 8, 10 and 12 (A), or on d 2, 3, 4, 6, 8, 10 and 12 (B). Weightwas measured daily from d 7 to d 14 when the animals were killed. Results are shown as amean ± SD for each group. Asterisks represent p values <0.05. (C) Bilirubinuria was mea-sured on d 14 in a group of untreated mice (n = 23) and compared with a combinedgroup of mice pretreated or posttreated with MM284 (n = 20). Results were comparedusing chi-square test and the p value is shown above the bars.

MM284-treated animals were still higherthan those in control animals. Quantita-tive RT-PCR did not detect significant dif-ferences in TIMP-1, PAI-1 and MMP-9 ex-pression, although there was a trendtoward decreased expression of these me-diators as well (data not shown).

MM284 Reduces Interleukin (IL)-6mRNA Expression in the Liver of BAMice

IL-6 is a multifunctional cytokine thatis implicated in the pathogenesis of mul-tiple diseases associated with inflamma-tion, including inflammatory liver dis-eases, and is known to be secreted bymacrophages in response to extracellularcyclophilin (24,25). Thus, we next investi-gated whether MM284 had an effect onIL-6 production in our model. RRV infec-tion increased IL-6 mRNA expressionfive-fold relative to control mice 14 dafter RRV infection (5.4 ± 0.3, p < 0.05);pretreatment with MM284 significantlyabrogated this elevated expression (1.65 ± 0.5, p < 0.05 relative to untreatedinfected mice) (Figure 3F). In the experi-ment with MM284 posttreatment, RRVincreased IL-6 mRNA expression approx-imately four-fold relative to the unin-fected group (4.44 ± 0.2, p < 0.01) andMM284 treatment reduced IL-6 to thelevel similar to that in the control group(1.0 ± 0.4) (Figure 3G).

MM284 Reduces SMAD2 ActivationActivation (phosphorylation) of

SMAD2 leads to increased expression ofsuch fibrotic mediators as PAI-1, TIMP-1,TIMP-4 and MMP-7 (26). As TIMP-4 andMMP-7 mRNA expression was decreasedwith MM284 administration, we evalu-ated whether SMAD2 phosphorylationwas affected by MM284 as well. Treat-ment of mice with MM284 prior to RRVinfection led to a dramatic decrease ofSMAD2 phosphorylation relative to RRV-infected mice without MM284 treatment(Figure 4A), suggesting that the mecha-nism by which MM284 downregulatedinflammatory and fibrotic mediators inour model was at least in part via inhibi-tion of SMAD2 phosphorylation. Surpris-



Figure 3. MM284 reduced inflammation in the liver of mice with RRV-induced BA. (A) Myeloperoxidase staining of liver tissue. Representative images are shown for threegroups of animals. (B, C) Quantitative RT-PCR analysis of TIMP-4 mRNA in the liver extractsof RRV-infected mice pretreated (B) or posttreated (C) with MM284. Results are shown asmean ± SD of three independent experiments. Asterisks represent p values <0.05 betweenRRV and RRV + MM284 groups. The pound sign represents p values <0.05 between RRV +MM284 and control groups. (D,E) Quantitative RT-PCR analysis of MMP-7 mRNA in the liverextracts of RRV-infected mice pretreated (D) or posttreated (C) with MM284. Results areshown as mean ± SD of three independent experiments. Asterisks represent p values <0.05between the RRV and RRV + MM284 groups. The pound sign represents p values <0.05 be-tween the RRV + MM284 and control groups. (F,G) Quantitative RT-PCR results of IL-6mRNA in the liver extracts of RRV-infected mice pretreated (F) or posttreated with MM284(G). Asterisks represent p value <0.01 between RRV and RRV + MM284 groups, and thepound sign represents p values <0.05 between RRV + MM284 and control groups.

ingly, MM284-treated mice demonstrateddecreased SMAD2 phosphorylation com-pared with the control group. This sug-gests that extracellular cyclophilin mayplay a physiological role as a regulator ofSMAD2 activation, as well as mediatingthe pathogenesis of experimental BA.

SMAD activation is a previously unre-ported action of extracellular cy-clophilins. To confirm this finding, weanalyzed the effect of recombinanthuman CypA on the inflammatory sig-naling pathways in human hepatic stel-late cells (HSCs), which are known con-tributors to the pathogenesis of fibroticliver diseases (27,28). Similar to the find-ings in the BA mice, lysates from CypA-treated cells demonstrated a 1.5-fold in-crease in SMAD2/3 phosphorylationrelative to untreated cells, and a com-plete absence of the increased SMAD2/3phosphorylation when the cells weretreated with CypA in combination withMM284 (Figure 4B). Importantly, sensi-tivity to MM284 indicates that the effectof recombinant CypA was not due topossible endotoxin contamination butwas mediated by a cyclosporine-sensitiveinteraction (29).

DISCUSSIONIncreased levels of extracellular cy-

clophilins (mostly CypA) have been docu-mented in many inflammatory diseases,and their role in disease pathogenesis hasbeen verified in a variety of animal mod-els of human diseases, including rheuma-toid arthritis, sepsis, asthma, atherosclero-sis and a number of viral infections(33,34). Similarly, we reported a markedinhibitory effect of an extracellularly re-stricted inhibitor of the peptidyl prolylisomerase activity of cyclophilins, thehighly branched CsA-like moleculeMM218, on the inflammatory response ina mouse model of allergic lung inflamma-tion (13). Furthermore, a smaller moleculemember of this type of cell- impermeablecyclosporine derivatives, MM284, inhib-ited the recruitment of leukocytes duringinflammation in a mouse model of experi-mentally induced peritonitis and delayed-type hypersensitivity reaction (21). Thus,we hypothesized that MM284 may pro-vide a benefit in the experimental modelof BA comprised of neonatal mice in-fected with RRV.

In this study we demonstrated thatMM284 reduced inflammation and phe-

notypic signs of disease in the RRV-in-duced mouse model of BA. Given that in-teraction between virus-incorporated cy-clophilin and CD147 has been implicatedin infection by HIV-1 and measles (35,36),we also evaluated a group of mice whichwere infected with RRV first and thentreated with MM284 starting 24 h afterRRV infection to exclude the possibilitythat MM284 prevents RRV infection of theanimal directly. The fact that both pre-treatment and posttreatment with MM284had similar effects on disease manifesta-tion (less bilirubinuria, improved weightgain) indicates that the drug inhibited theinflammatory response after RRV infec-tion rather than RRV infection itself. Wefound that MM284 administration also re-duced mRNA expression of a number ofproinflammatory mediators downstreamfrom SMAD2 activation, which was alsoinhibited, suggesting that extracellular cy-clophilin plays a role in the inflammationassociated with this model of BA. Giventhat the major signaling receptor for extra-cellular cyclophilins is CD147 (30), ourdata suggest that interaction between ex-tracellular cyclophilins and CD147 plays asignificant role in inflammation and he-patic pathology in experimental BA. In-deed, several reports have demonstratedactivation of the CD147-induced signalingpathways by CypA circulating in extracel-lular media in a number of inflammatorydiseases (31). CypA has been shown to besecreted by different types of cells in re-sponse to inflammatory stimuli and ox-idative stress (32–36). While the cells re-sponsible for secretion of extracellularcyclophilin in our BA model have notbeen identified, hepatocytes may be in-volved as these cells have been shown tosecrete CypA in response to infection byanother virus, hepatitis B (37). HSCs areanother type of cells that could contributeto the etiology of BA, although we did notassess whether HSCs secrete CypA in theBA model used in this study. Further ex-periments isolating hepatocytes and HSCsfrom the liver would be required to sortout the relative importance of these twocell types, however, such experiments aretechnically challenging in neonatal mice.



Figure 4. MM284 treatment decreased SMAD2 phosphorylation. (A) The mice were eutha-nized on d 14 post-RRV infection, and portions of liver were harvested for protein extrac-tion. Total protein lysates were used for PathScan Phospho-SMAD2 sandwich ELISA. Datarepresent absorbance at λ = 450 nm. Asterisks represent p values <0.05 between the RRVtreated and control groups; the pound sign represents p values <0.05 between controland RRV + MM284 groups. (B) HSCs were treated with 800 ng/mL of Cyclophilin A (CypA)with or without 400 ng/mL of MM284. Cells were harvested at 72 h posttreatment andSMAD2/3 phosphorylation was analyzed in lysates by PathScan Phospho-SMAD2/3 sand-wich ELISA. The experiment was performed in triplicate, and the error bars represent thestandard deviations. Asterisks represent p values <0.01 between CypA treated and bothcontrol and CypA + MM284 groups.

CD147 is expressed on a wide varietyof cells, which potentially can respond toextracellular cyclophilin and contribute tothe pathogenesis of inflammatory dis-eases. Several beneficial effects of MM284treatment on the experimental BA pro-gression identified in this study allow usto infer possible mechanisms for the ef-fects of extracellular cyclophilins in exper-imental BA. Most likely, the reduction ofneutrophil infiltration in the livers ofMM284-treated BA animals due to inhibi-tion of chemotactic activity of extracellu-lar cyclophilins (31) is the key component.Indeed, the inflammatory response in BA,both in the mouse model and in humans,is associated with infiltration by neu-trophils, which form inflammatory fociaround the areas of bile duct obstruction(21–23). Modulation of neutrophil infiltra-tion by the inhibition of extracellular cy-clophilins or their receptor CD147 hasbeen reported in rheumatoid arthritis(38,39), lung inflammation (14) and myo-cardial ischemia and reperfusion injury(40). The decreased migration of neu-trophils and other inflammatory cells tothe liver may explain the decreased levelsof IL-6 observed in MM284-treated ani-mals in our study. Downregulation of IL-6by MM284 is consistent with previous re-ports demonstrating induction of IL-6, IL-8, IL-1β, MCP-1 and tumor necrosis factor(TNF)-α in monocytes by extracellularCypA (24,25). Another cell type likelycontributing to disease pathogenesis areHSCs, as our data showed activation ofSMAD2 in human HSCs after CypA expo-sure and inhibition of this effect byMM284 treatment, mimicking the effectsobserved with whole liver. Activation(phosphorylation) of SMAD2 is a knownmediator of increased expression of suchmarkers of fibrosis as PAI-1, TIMP-1,TIMP-4 and MMP-7 (26), and inhibition ofthe expression of TIMP-4 and MMP-7 byMM284 was observed in our study. Sup-pression by MM284 of SMAD2/3 activa-tion suggests a novel, previously unrecog-nized activity of extracellular cyclophilins.Previously, SMAD activation was consid-ered a characteristic feature of the TGFβsignaling pathway (41), raising the possi-

bility that TGF was involved in the patho-genesis of BA. However, we did not ob-serve any improvement in disease statusor reduction of SMAD2/3 activation aftertreatment of mice with anti-TGFβ anti-body or TGFβ soluble receptor (data notshown). Our results thus indicate that ex-tracellular cyclophilin may initiate theSMAD-dependent signaling pathway di-rectly. SMAD activation by extracellularcyclophilins may be mediated by activa-tion of ERK, a known effector of cy-clophilin-CD147 interaction (42). Cross-talk between ERK and SMAD2/3pathways has been reported in certain celltypes (43) and may well occur in the liveras well. Figure 5 outlines the proposedmechanism by which CypA and MM284may influence the ongoing inflammationin experimental BA, summarizes the find-ings of this study and indicates remainingquestions that will be addressed in futureexperiments.

CONCLUSIONIn summary, our study adds biliary

atresia to the list of inflammatory diseaseswhere extracellular cyclophilins may playa role in exacerbating disease pathology.While it would be interesting to confirmthe role of CypA in experimental BAusing CypA knockout mice, the specificityof the RRV model to BALB/c mice ren-ders those experiments unfeasible at pres-ent, as the knockout mice have a differentstrain as their background. Our findingssuggest that extracellular cyclophilins areimportant contributors to the liver inflam-mation associated with experimental BA.Most importantly, results reported hereprovide a validation for development ofcell-impermeable cyclosporine A deriva-tives as therapeutics for treatment of BAor other inflammatory diseases of theliver where SMAD2 activation may be in-volved. As this animal model is not wellsuited to address fibrotic liver disease,



Figure 5. Schematic representation of the effects of extracellular CypA and MM284 in exper-imental BA. Extracellular CypA produced by resident liver cells attracts inflammatory cellsand stimulates them to produce IL-6. It also activates the SMAD pathway resulting in produc-tion of TIMP-4, MMP-7 and other mediators. Question marks denote effects with unknownmechanism.

whether or not extracellular cyclophilinsin general or CypA in particular may beputative targets for therapy once fibrosisor cirrhosis has been established remainsin question.

ACKNOWLEDGMENTSThis work was funded in part by Na-

tional Institutes of Health; Grant Num-ber K08 DK083769.

DISCLOSUREThe authors declare that they have no

competing interests as defined by Molecu-lar Medicine, or other interests that mightbe perceived to influence the results anddiscussion reported in this paper.

REFERENCES1. Bezerra JA, et al. (2014) Use of corticosteroids

after hepatoportoenterostomy for bile drainagein infants with biliary atresia: the START ran-domized clinical trial. JAMA. 311:1750–9.

2. Riepenhoff-Talty M, et al. (1993) Group A rotavirusesproduce extrahepatic biliary obstruction in orally in-oculated newborn mice. Pediatr. Res. 33:394–9.

3. Czech-Schmidt G, Verhagen W, Szavay P, Leon-hardt J, Petersen C. (2001) Immunological gapin the infectious animal model for biliary atre-sia. J. Surg. Res. 101:62–7.

4. Nadler EP, et al. (2009) Integrin alphavbeta6and mediators of extracellular matrix deposi-tion are up-regulated in experimental biliaryatresia. J. Surg. Res. 154:21–9.

5. Yan L, Zucker S, Toole BP. (2005) Roles of the multi-functional glycoprotein, emmprin (basigin; CD147),in tumour progression. Thromb. Haemost. 93:199–204.

6. Yurchenko V, Constant S, Eisenmesser E, Bukrin-sky M. (2010) Cyclophilin-CD147 interactions: anew target for anti-inflammatory therapeutics.Clin. Exp. Immunol. 160:305–17.

7. Yurchenko V, et al. (2001) CD147 is a signaling re-ceptor for cyclophilin B. Biochem. Biophys. Res.Commun. 288:786–8.

8. Yurchenko V, et al. (2002) Active site residues ofcyclophilin A are crucial for its signaling activityvia CD147. J. Biol. Chem. 277:22959–65.

9. Kim JY, Kim WJ, Kim H, Suk K, Lee WH. (2009) Thestimulation of CD147 induces MMP-9 expressionthrough ERK and NF-kappaB in macro phages: im-plication for atherosclerosis. Immune Netw. 9:90–7.

10. Zhu P, et al. (2005) Expression of CD147 onmonocytes/macrophages in rheumatoid arthritis:its potential role in monocyte accumulation andmatrix metalloproteinase production. ArthritisRes. Ther. 7:R1023–33.

11. Stemmy EJ, et al. (2011) Blocking cyclophilins inthe chronic phase of asthma reduces the persist-ence of leukocytes and disease reactivation. Am.J. Respir. Cell Mol. Biol. 45:991–8.

12. Balsley MA, et al. (2010) A cell-impermeable cyclosporine a derivative reduces pathology ina mouse model of allergic lung inflammation. J. Immunol. 185:7663–70.

13. Gwinn WM, et al. (2006) Novel approach to in-hibit asthma-mediated lung inflammation usinganti-CD147 intervention. J. Immunol. 177:4870–9.

14. Arora K, et al. (2005) Extracellular cyclophilinscontribute to the regulation of inflammatory re-sponses. J. Immunol. 175:517–22.

15. Kim JY, Kim H, Suk K, Lee WH. (2010) Activa-tion of CD147 with cyclophilin a induces the ex-pression of IFITM1 through ERK and PI3K inTHP-1 cells. Mediators Inflamm. 2010:821940.

16. Yang Y, Lu N, Zhou J, Chen ZN, Zhu P. (2008)Cyclophilin A up-regulates MMP-9 expressionand adhesion of monocytes/macrophages viaCD147 signalling pathway in rheumatoid arthri-tis. Rheumatology. 47:1299–310.

17. Hamada H, et al. (2012) Inflammatory cytokineprofiles during cyclosporin treatment for immunoglobulin-resistant Kawasaki disease.Cytokine. 60:681–5.

18. Malesevic M, et al. (2010) A cyclosporin derivativediscriminates between extracellular and intracellu-lar cyclophilins. Angew Chem. Int. Ed. Engl. 49:213–5.

19. Iordanskaia T, et al. (2013) Dysregulation of up-stream and downstream transforming growthfactor-beta transcripts in livers of children withbiliary atresia and fibrogenic gene signatures. J. Pediatr. Surg. 48:2047–53.

20. Malesevic M, et al. (2013) Anti-inflammatory ef-fects of extracellular cyclosporins are exclusivelymediated by CD147. J. Med. Chem. 56:7302–11.

21. Changho S, Ahmed AA. (2010) Neutrophils inbiliary atresia. A study on their morphologic dis-tribution and expression of CAP37. Pathol. Res.Pract. 206:314–7.

22. Georgiev P, et al. (2008) Characterization of time-related changes after experimental bile duct liga-tion. Br. J. Surg. 95:646–56.

23. Gujral JS, Farhood A, Bajt ML, Jaeschke H. (2003)Neutrophils aggravate acute liver injury duringobstructive cholestasis in bile duct-ligated mice.Hepatology. 38:355–63.

24. Kim H, et al. (2005) Cyclophilin A may contributeto the inflammatory processes in rheumatoidarthritis through induction of matrix degradingenzymes and inflammatory cytokines frommacrophages. Clin. Immunol. 116:217–24.

25. Yuan W, Ge H, He B. (2010) Pro-inflammatoryactivities induced by CyPA-EMMPRIN interac-tion in monocytes. Atherosclerosis. 213:415–21.

26. O’Reilly S, Ciechomska M, Cant R, van Laar JM.(2014) Interleukin-6 (IL-6) trans signaling drives aSTAT3-dependent pathway that leads to hyperac-tive transforming growth factor-beta (TGF-beta)signaling promoting SMAD3 activation and fibro-sis via Gremlin protein. J. Biol. Chem. 289:9952–60.

27. Fujii H, Kawada N. (2014) Fibrogenesis in alcoholicliver disease. World J. Gastroenterol. 20:8048–54.

28. Das D, Barnes MA, Nagy LE. (2014) Anaphyla-toxin C5a modulates hepatic stellate cell migra-tion. Fibrogenesis Tissue Repair. 7:9.

29. Schlegel J, et al. (2009) Solution characterizationof the extracellular region of CD147 and its in-teraction with its enzyme ligand cyclophilin A.J. Mol. Biol. 391:518–35.

30. Yurchenko V, Constant S, Bukrinsky M. (2006)Dealing with the family: CD147 interactions withcyclophilins. Immunology. 117:301–9.

31. Bukrinsky M. (2014) Extracellular cyclophilins inhealth and disease. Biochim. Biophys. Acta. 2014,Nov 18 [Epub ahead of print].

32. Seko Y, et al. (2004) Hypoxia followed by reoxy-genation induces secretion of cyclophilin A fromcultured rat cardiac myocytes. Biochem. Biophys.Res. Commun. 317:162–8.

33. Kim SH, Lessner SM, Sakurai Y, Galis ZS. (2004)Cyclophilin A as a novel biphasic mediator ofendothelial activation and dysfunction. Am. J.Pathol. 164:1567–74.

34. Sherry B, Yarlett N, Strupp A, Cerami A. (1992)Identification of cyclophilin as a proinflamma-tory secretory product of lipopolysaccharide-acti-vated macrophages. Proc. Natl. Acad. Sci. U. S. A.89:3511–5.

35. Jin ZG, et al. (2000) Cyclophilin A is a secretedgrowth factor induced by oxidative stress. Circ.Res. 87:789–96.

36. Liao DF, et al. (2000) Purification and identifica-tion of secreted oxidative stress-induced factorsfrom vascular smooth muscle cells. J Biol. Chem.275:189–96.

37. Tian X, et al. (2010) Hepatitis B virus (HBV) sur-face antigen interacts with and promotes cy-clophilin a secretion: possible link to pathogene-sis of HBV infection. J. Virol. 84:3373–81.

38. Damsker JM, et al. (2009) Targeting the chemotac-tic function of CD147 reduces collagen-inducedarthritis. Immunology. 126:55–62.

39. Wang CH, et al. (2014) CD147 up-regulates cal-cium-induced chemotaxis, adhesion ability andinvasiveness of human neutrophils via a TRPM-7-mediated mechanism. Rheumatology. 53:2288–96.

40. Seizer P, et al. (2011) Disrupting the EMMPRIN(CD147)-cyclophilin A interaction reduces infarctsize and preserves systolic function after myo-cardial ischemia and reperfusion. Arterioscler.Thromb. Vasc. Biol. 31:1377–86.

41. Yoshida K, Murata M, Yamaguchi T, MatsuzakiK. (2014) TGF-beta/Smad signaling during he-patic fibro-carcinogenesis (review). Int. J. Oncol.45:1363–71.

42. Hoffmann H, Schiene-Fischer C. (2014) Func-tional aspects of extracellular cyclophilins. Biol.Chem. 395:721–35.

43. Hayashida T, Decaestecker M, Schnaper HW.(2003) Cross-talk between ERK MAP kinase andSmad signaling pathways enhances TGF-beta-dependent responses in human mesangial cells.FASEB J. 17:1576–8.



Cite this article as: Iordanskaia T, et al. (2015) Tar-geting extracellular cyclophilins ameliorates dis-ease progression in experimental biliary atresia.Mol. Med. 21:657–64.

Targeting Extracellular Cyclophilins Ameliorates Disease ......Targeting Extracellular Cyclophilins...

Documents

Transcript of Targeting Extracellular Cyclophilins Ameliorates Disease ......Targeting Extracellular Cyclophilins...