TALENTO - Fiat Professional · PDF file GOOODS orr r PEPPEOPPLE, itiittoff errs...

Click here to load reader

  • date post

    31-Jul-2020
  • Category

    Documents

  • view

    1
  • download

    0

Embed Size (px)

Transcript of TALENTO - Fiat Professional · PDF file GOOODS orr r PEPPEOPPLE, itiittoff errs...

  • TALENTO

    Trim levels of models and options may vary due to specific market or legal requirements. The data, descriptions and illustrations contained in this brochure are for illustrative purposes and are valid at the date of publication (03/2019). Some equipment described and/or illustrated in this brochure is optional. Refer to the price list for full information. FCA may change the models described in this brochure at any time for technical or commercial reasons.

    Fiat Marketing 04.3.3767.08 - S - 01/2020 - SO - Printed in Italy - Printed on chlorine-free paper.

    w w w. f i a t p r o f e s s i o n a l . c o m

  • MULTI-TALENTED LIKE EVERY PRO.

    BeBeBeBeB inininnggg clclclclevevevevvererereee iiis ss tototoot hhhavavavavaveee e ththththeeeee abababbililillitititititi y y y yyy totototoootoo aaaaaaaadaddaaaaaaaaadaaaaaaaaaadaptptptptptptp .... ToToToToTooo ffaffafacececece ddddiffiffiffiffeeererereeentntntn sssititituauaatititionononnons s sss ananaananaanaannaaanannannnnannnndddddddddddddddddd alalalalalalalaalalaaalaalalwawawawawawawawawawawwwawawwwwwaawayyyyyyyyysysysysyssysysysssysysysyssyysysyyyyysysyysyyyssyyyyysysyssyyyyyyyyyyyyyy hhhhhhhhhhhhhhhhhaaavavavavavavavaaavavavvavavavaaaaavavvavavavaaaaavaavvaavavavaaaaaaaaaaaaave e ththttheeeeeeee pepepepepeperfrfrfrfrfrfececececececect ttt ttttt sososososososososolulululullutitititittittionononnnonon ffffffffororororororooo ttttttttthehehehehehehehheem.m.m.m.mm.m.m

    TATATATAAALELELELELELEL NTNTNTNTNTNTTNTOOOOOOO hhhhhasasasas iiiitttt alalalalall.l.ll.l. DDDDDesesesesese igigigigiggnenenenneedddddd totototototo TRTRTRTRTRTRANANANANANANSPSPSPSPSPSPOOOOOORORROROROOOROOORO TT TTTT GOGOGOGOGOGOOOODODODODODODSSSSSSS oooooooooorrrrr r r PEPEPEPPEPEOPOPOPOPOPPPLELELELELELELE, , , ititititiitititt oooooooff ff ff ffff ffff erererererererrerererssssssss prprprprprprpprpppp ofofofofoffoffffeseseseesesesesee sisisisissisis onononnnnnnnnnnonononalaalalaalllssss aaaaaaaaaaaa wiwiwiwiwwwidededededede rrrranananangegegegegege ooooooofffff ff sossosososooollulullulululutititititit onononononons,s,s,s,s,s fffffrororororroommmmmmm lolololololoadadadadadaaadadadaa iiinininnnniiniininniinngggggg fefefffeatatatta ururururesesesees tttto o o ooooo acacaccecececeecececessssssssssssssssssoroorororororieieieieieiess s s ss ----- thththththhhthhhatatatatatataat mmmmmmmmakkkakkkkkkakakakaa esesesesesees aaaaaa hhhhhhhhhhuguguguguguggugggguugggugeeeeeee diddidiff ffff ffffffererererreneneneenenenncececceccce fffffffffororrorrorror yyyyyyyououououuouououououurr rrrrr evevevevevee ererrerydyddyddydydy ayayayaya wwwwwwororororo k.k.kk.

  • ThThThThThThThThTheeeeeeee AGAGAGAGAGAGAGAGA GRGRGRGRGRGGRGRESESESESESESESSISSISISIS VEVEVEEEVEV DDDDDESESESSSIGIGIGGIGGNNNNNN ooooooof f ffff thththththeee TaTaTaTaTaTT lelelelelelelentntntntntntoooooooo shshshshshshhowowowowowowoowows sssssss hohohohohohow ww ww thththththt isisissss uuuuuuuunininininiququququququuq eeeeee vavavavavavavavannnnnnnn bebebebebebebebeebelolololololololooongngngngnggngngngngn s s s ss s s ss totototototototototot aaaaaaaaa lolololoololoooongngngngngngngngnggng lllllllllininininninininnni eaeaeaeaeaeaeaeaeaeae gegegegegegegegegege ooooooooooffffff hahahahahahahahahahahardrdrdrdrdrdrdrdrdrdrd wwwwwwwwworooorororooorkekekkkekkekekekk rsrsrsrsrrrs.. FrFrFrFFrFFFFrFFromomomomom thththhtthththththt eee eeee eeee stststststststststststststylylylylylylylylylylylee ee eeeeeee stststtttststsststs ananananananndpdpdpdpdpdpdpdpoioiooioioio ntntntntt,,,, TaTaTaTaaTTaaaleleleleentntntntntnto o ooooo isisisisss cccccccomomomomomomompapapapapapapactctctctctc anananananannanndddddddd wewewewewewewewew lllllllllllll -p-p-p-p-p-p- rorororoororooropopopopopopopopp rtrtrtrtrtrtrtioioioioioioioneneneneenened:d:d:d:d:d:d: tttttttheheheheheheee fffffforororororrorwawawawaaaawawwww rdrdrdrdrdrdrd stststststststtrererererererer tctctctctctctctchihihihihihhihih ngngngngngngngg wwwwwwwiniininininii dsdsdsdsdsdsddsdscrcrcrcrcrccrrreeeeeeeeeeeeeen n nnnn plplplplplppp eaeaeaeaeaaeasasasasassass ntntntntntntntlylylyllylyyly ccccccononononononnnneneneneneneenectctctctctcctcc sssssss totoototo ttttttttheheheheheheehehe ssssssshohohohohohoh rtrtrtrtrtrrt bbbbbbononononononnenenenennenet t tttt ananananana ddddddd ththththhthhheeeeeeeee ovovovovovovovoovererererererere alalallalalalll llllll effeffeeffeffeeffeffffeeeeeeeectctctctcttt iiiiiis ssssssss onononononnonne eeee ofofofofofofo aaaaaan n n n imimimimimimmmpopopopopopopoppoppp sisisisissinngngngngngn bbbbbbbutututututtut ddddddddddynynynnynyynnnamamamaaaamiciccic frfrfrfrfrfrronononooonooo tttttt enenenenenend.d.d.d.d.d. TTTTTTheheeeeeeh dddesesessigiggiggnnn isississ hhhorororrrizizizzzzonononononoo tatatataalll l l wwiwiwiwiiwithththththhththththt boboboboooooboobooldldldddd,,, clcllclcleaeaeaeaeear-r-r cucucucuutttt lilil nenenenes s s ininininin tttttttununununununeeeeeee wiwiwiwiwiwiththththththt ttttttheheheheheheheee NENENENENENENENN WW W W W W

    FAMILY FEELING of the Fiat Professional range and enhances the width of the vehicle and its loading capacity, clearly suggested by the SQUARE-SHAPED REAR end, while conveying an idea of dynamism and stability. The Talento’s design ingenuity was also applied to its size, thought to perfectly fi t the space limits of every city, while off ering great cargo capacity to carry every business forward.

    DESIGNED TO STAND OUT.

  • ThThThThThThThThThThThThThThTThThe e eeeee e e e e eeeee inininininininninininininnteteteteteteteteteteteeeeririrririririririrririrr ororororororororororoorrooro ooooooooooooff ff f f fff ff fffff TaTaTaTaTaTaTaTaTaTaTaaTTaTaTTaTaTaTaleleleleleleleeeentntntntntnttntntnnttntn o o oo o oo ooo isisisisisisisssiis ttttttttthehehehehehehehehhhehehh pppppppppppererereererererrrerrrrrrfefefefefefefefefeffeeefeff ctctctctctctctctctctctc oooooooooooffiffiffi ffiffi ffiffi ffiffi ffi ffiffiffi ffiffi ffiffi ffiffiffifficcccccccccccccccceeeeeeeeeeeeeee fofofofofofofofofofofofofofoor r r r r rr rr r r fufufufufufufuuufufufufuuuuufufulllllllllllllllllllllll y y y y yy y yyyyyyyyyy dedededdeededdededededeededededediddididddididdiddddidid cacacacacacacacacacacaccaccaccacacaccacateteteteteteetetetetettteteet dddddddddd wowowowowowowowoowowwworkrkrkrkrkrkrkkrkkkrkkeereererererereerere s sss s s s lililililililikekekekekekekekekeeee yyyyyyyyyyyyyououououououuoououuooo ..... CaCaCaCaCaCaCaCaCaCCaaCaCarerererererererererererererefufufufufufufuufufuuufufufuf llllllllllllllllllllllllllly y y y yy yyyy yyyy ththththththttthhhhhhhththououououououououououoouououoooughghghghghghghghghgghghghghhhght tt t t t t ttt ttt ttototototototototototoo cccccccccccccccomomomomomomomomomomomommmmmbibibibibibibibbibibibibb nenenenenenenenene cccccccccccccomomommomomomomomomomomfofofofofofoofortrtrtrtrttrtrtrt aaaaaaaandndndndnddddndndndndn ffffffffffffunuununununununununnnnnnctctctctctctctctctctctctcccc ioioioioioioioioonananananananannalilililililiiliiliililitytytytytytyttyytyttyttyttttyy, , , ,, ititititiitittititttit coccccocococcocoocoomemememmmememmeemememeem ss s s ssssssssssssss wiwiiwiwiwiwiwiwiwiwiwiwwiwiwww thththththtthththtthhth aaaaaaaaaaalllllllllllllllll tttttttheheheheheehehehh ssssssssssstatatatatataatataataandndndndndndndndnddararararararararrararrddddddddddddd ititititititittitemememememmmemememmmmms s sssssssssssss ththththththtththtththatatatataattatatatta mmmmmmmmmmmmmmmmakakakakakakakakakakakakkakakkka esesesesesesesessesesesesesesesses eveveveveveveevevevevvvevevvveeverererererereereereeerereerery y y y yy yy yy yy hohohohohohoohhohhohohhoohh urururururuurururru aaaaaaaaaaaaattttt tttttt tt wowowowowowowoowwwowoww rkrkrkrkrkrkkrkrkrkrkkrkk ppppppppppppppppleleleleleleleleleleleleasasasassasssaasassssanananananananananaanannnnnnnt tt tttt ttt tt ananananananananannanananandddddddddddddd effeffeffeffeeffeffeffffffeffeffeffeffeffeffeeffeffeeeeeeeeeeeeeeeeectctctctctctctctctctctcttcttctctccctctc ivivivivivivivivivivvvivivivvvvvvvivive.e.ee.e.e.e.ee.e.eeeee.e.e. ThThThThThThThThThThThThhTTThTThTThThThTT e ee e ee ee e e eeeeeee inininininininininininininininninnininggegegegegegegegegegegegegegegegegegeegeg ninininininininnninninininininnnnnniniouououououoououououououououououooououououous s s ss ss s s sssssssssssss sosososossosososossossososossososososooolulullulululullulululululluluulullul titititititiiitititttiiitiononononnonoonnonononnnnononononssssssssssssssss ththhthththththththhthththhhhhhthhatatatatatatatatatatatatatatatatata bbbbbbbbbbbbbbbbbririririririiriringngngngngngngnngnggs s s ss ssssssss a a a a a aaaaa CCCECECECECECECCECECEC NTNTNTNTNTTNTNTTTNNTRARARARAARARARARAARAL L LLL LLLL SESESESSESESEESESESEESESESESESEESESESESESEESESEEES ATATATATATATATATATATATATATTATATATAATATATATATATTATT WWWWWWWWWWWWWWWWWWWWWWITITITITITTITITITTTITITITITITITITITITITTHH H H H HH HHHHHHHHH POPOPOPOPOPOPOPOPOPOPOPOP P-P-P-P-P-P-P-P-P-P-P-PP-P-UPUPUPUPUPUPUPUPUUUUPU TTTTTTTTTABABABABABABAABABABBBABABAABABAAA LELELELELELELELELEEELELEE, , , ,, , cococococooococoococoompmpmpmpmpmppmpmmpmpmpmpmpleleleleleelelelelelelellelelletetetetetetetetetetetetetett dd d d ddddddd bybybybybybybybybyyyy smsmsmsmsmsmsmsmsmmsmsmssms arararararararararararrrrrtptptptptptptptptptptptpttphohohohohooohohohohohohhohohhooonenenenenenenenenenenennenennn aaaaaaaaaaaaaaandndndndndndndndndndndnndndndndndnnd tttttttttttttttabababababababababababababa lelelelelelelelleleleeel tttttttttttttt hohohhohohohohohohohohohohhhhohohh ldldldldldldldldldldldldldererererererrrererrrer****** ananananannnannnananndddddddddddddd ththththhthhhhhthtththtt eeeeeeeeeee rerererererererererreerer arararararararararararararr vvvvvvvvvvvviiieieieieieieieieieieieeeeww w w www wwwww w www ccacacaccacaacacacaaccacacaamememememememmemmmemememmmem rararararararrararra (((((((((((inininininnnininnnnnn ttttttttttttheheheheheheheheheheeeheee rrrrrrrrrrrreaeaeaeaeaeaeae