Systemic acquired resistance (SAR)

Background on SAR

Molecular changes associated with SAR

Role of SA and other signaling molecules

Role of NPR1 (non-expresser of pathogenesis related genes 1)

Roles of TGA and WRKY transcription factors

Role of chromatin remodeling in SAR

What do we know about SAR?

Systemic acquired resistance

Baker et al. 1997. Science. 276:726

Systemic acquired resistance

Systemic acquired resistance was first recognized as a significant phenomenon in the early 1900s.At that time, it was recognized that infection of plants with “necrotizing” pathogens (causing HR)often results in enhanced resistance to subsequent infections by a variety of fungal, bacterial andviral pathogens. This physiological immunity was termed systemic acquired resistance (SAR).

SAR confers a broad spectrum type of resistance

SAR is effective against some but not all pathogens:

Tobacco: Phytophthora parasitica, Cercospora nicotianae, Peronospora tabacinaTobacco mosaic virus, Tobacco necrosis virus,Pseudomonas syringae pv. tabaci, Erwinia carotovora

Not effective against: Botrytis cinerea or Alternaria alternata

Arabidopsis: Phytophthora parasitica Turnip crinkle virus Pseudomonas syringae pv. tomato DC3000

Systemic acquired resistance was associated with the coordinated induction of a set of SAR genesencoding proteins known as Pathogenesis-related (PR) proteins (Van Loon and Gianinazzi (early 1970s).

(1979) White found that acetyl salicylic acid application sufficient to induce PR gene expressionand enhanced resistance to tobacco mosaic virus in tobacco plant. Discovery came out theinterest in developing chemical control methods for viral infection. After that several groups wenton to show that salicylic acid application on tobacco leaves mimics pathogen induced expressionof PR genes and pathogen resistance in treated tissues.

(1990) Two groups one led by Klessig and Raskin and another led by Metrauxfound that salicylic acid accumulates in cucumber and tobacco plants prior to pathogen infection, butbefore the onset of resistance.

The work by these and many others led to the hypothesis that salicylic acid (SA) is the endogenoussignal molecule that is required for the induction of systemic acquired resistance.

(1993/1994) The group headed by Ryals made tobacco plants that could not accumulate SA and found that these plants were defective in their ability to develop systemic acquired resistance.This work demonstrated a central role for SA in establishing systemic acquired resistance.The group also demonstrated that these tobacco plants were defective in their ability to accumulate PR proteins.

(1997) Cloning of NPR1, a key regulator of SAR

Some key events in understanding regulation of SAR

PR (Pathogenesis-Related) proteins

Proteins secreted predominantly into intercellular spaces in response to wounding or infection.

Soluble at pH 3

Basic homologs also found (in vacuole).

Proteinase resistant (but not proteinase inhibitors).

Some are developmentally expressed as part of normal plant development in absence of wound or

infection (e.g. flowering).

PR proteins first identified as major proteins induced by necrotizing pathogens(pathogens that induced the hypersensitive response)

Acidic gel Basic gel

All tobaccoPR proteins

PR proteins

Proteins first isolatedfrom apoplast ofTMV-infected tobacco.

Induced by many other pathogens.

Some PR proteins are also induced byabiotic stresses.

Traditional PR protein gels

old

nom

en

clatu

re

PR genes induced after HR or SA treatment

What do PR proteins do?

Sels et al. (2008) Plant Physiol. Biochem. 46:941-950Also van Loon et al. (2006) Annu. Rev. Phytopathol. 44:135-162

Some are members of large gene families – e.g. PR-1

van Loon et al. (2006) Annu. Rev. Phytopathol. 44:135-162

Constitutive expression of chitinase PR protein confersresistance to Rhizoctonia solani

Brogue et al. (1991) Science 254, 1194-1196

Control Line 373

230238329373

548

18 days after growth in R. solani-laden sand 11 d.a.g. in R. solani sand

Application of salicylic acid mimics SAR

(1979) White found that the application of aspirin, salicylic acid, and benzoic acid resulted in enhanced resistance to TMV. Used 3 tobacco cultivars that contained the N resistance gene that confers HR to TMV. Found > 90% reduction in lesion number in treated leaves versus water control.

Lesi

ons

obta

ined a

fter

seco

nd inocu

lati

on

SA

SA accumulation is associated with acquisition of resistance

Science (1993) 261, 754-756.

Central role of SA in SAR

PR-1

PR-2

PR-3

PR-1 mRNA

Central role for SA in defense continued

Enhanced susceptibility

Loss of resistance

INA induces resistancein presence of nahG

Mobile inducers of SAR

Kachroo. 2013. Curr. Opin. Plant Biol. 16:527

What is the mobile systemic signal(s) for SAR?

Methylsalicylate – meSA

SABP2 (meSA esterase) is required for SAR

Park et al. Science 318:113-116

What is the mobile systemic signal(s) for SAR?

Methylsalicylate – meSA

SAMT1 (SA methyltransferase) is required for SAR

Park et al. Science 318:113-116

What is the mobile systemic signal(s) for SAR?

Methylsalicylate – meSA

meSA induces SAR in systemic tissues expressing SABP2 (MeSA esterase)

Park et al. Science 318:113-116

A role of glycerol-3-phosphate in SAR

Reduced SAR in gly1 and gli1 mutants G3P levels increase in response to pathogenin local and systemic tissues

Chanda et al. (2011) Nat. Genet. 43:421-427

Exogenous G3P restores SAR in gli1 and gly1 plants

A role of glycerol-3-phosphate in SAR

Chanda et al. (2011) Nat. Genet. 43:421-427

G3P conferred SAR is dependent on DIR1DIR1 is a proposed lipid transporter protein

Chanda et al. (2011) Nat. Genet. 43:421-427

DIR1 is needed for G3P transport

Azeleic acid

Model for azeleic acid induced systemic acquired resistance

Yu et al. 2013. Cell Rep. 3:1266

Abietaine diterpenoid dehydroabietinal (DA)

Chaturvedi et al. 2012. Plant J. 71:161

Signaling steps between SA and PR protein expressionand disease resistance.

The Arabidopsis NPR1 Gene That ControlsSystemic Acquired Resistance Encodesa Novel Protein Containing Ankyrin RepeatsHui Cao, Jane Glazebrook, Joseph D. Clarke, Sigrid Volko, and Xinnian Dong (1997) Cell 88, 57–63,

Previously: Linked a PR protein promoter called BGL2 to GUS.

Screened thousands of mutant transgenic BGL2-GUS plants forABSENCE of GUS activity induced by SA treatment.

Using standard Arabidopsis genetic mapping methods, identified asingle mutant gene, npr1. Phenotype: Complete absence of GUS activity in response to SA Absence of PR-1, PR-5, BGL2 expression in response to SA Is now susceptible to Peronospora parasitica and to Pseudomonas syringae pv maculicola (Psm).

Cao et al. (1997) Cell 88, 57–63,

Cloned NPR1 by standard 1990’s methods. Chromosome walking, YAC library…

Proof of cloning by transgenic comple-mentation of mutants w/ wildtype NPR1.

wt

none non-compl. NPR1

npr1-2

NPR1

genotype:

transgene:none

wt npr1-1 npr1-1 + NPR1

Psm

inocu

late

d

GU

Ssy

mpto

ms

Cao et al. (1997) Cell 88, 57–63,

Cao et al. (1997) Cell 88, 57–63,

NPR1 has ankyrin repeats

Ankyrin repeats arein lots of differentproteins.

Involved in protein-protein interactions.Especially in proteinsthat control trans-cription.

In NF-kB and I-kB inmammals. Inducedby many pathogens,stresses…

NPR1 is reduced to a monomer during plant defense

Mou et al., (2003) Cell, 113:935–944

Expression of PR-1 is associated with NPR1 monomerization

Mou et al., (2003) Cell, 113:935–944

Monomeric NPR1 localizes to the nucleus

Mou et al., (2003) Cell, 113:935–944

Zhou et al. (2000) MPMI 13:191–202

NPR1 interacts with TGA transcription factors in yeast two-hybrid assays

TGA transcription factors bind to TGACG sequences found in the promoter of genessuch as PR-1

NPR1 enhances TGA1 binding to the as-1 element underreducing conditions

Despres et al. (2003) Plant Cell. 15:2181–2191,

Recognize the motif: (T)(T)TGAC(C/T).Have the conserved WRKYGQK at N-terminal end.Have a novel zinc-finger-like motif.Bind DNA via divalent cation (probably zinc).Approx. 100 members of WRKY family in Arabidopsis.NPR1 has 3 WRKY motifs in its promoter:

TTGACTTGACTTGGCTCTGCTCGTCAA

WRKY transcription factors: another key group of transcriptionfactors that regulate plant defense responses

The WRKY superfamily of plant transcription factorsThomas Eulgem, Paul J. Rushton, Silke Robatzek and Imre E. Somssich(2000) Trends Plant Sci 5, 199-205.

Conserved amino acidsin WRKY proteins ofArabidopsis (red).

Putative Zn-finger ligandsare highlighted in black.

Eulgem et al. (2000) TIPS 5, 199-205.

Wang et al. (2006) PLoS Pathogens 2:1042-1050

Identification of direct transcriptional targets of NPR1

WRKY54, WRKY38, WRKY59, WRKY18, WRKY70, WRKY66, and WRKY53 are induced directly by NPR1.

Evidence that WRKY58 negatively regulates plant defense

Wang et al. (2006) PLoS Pathogens 2:1042-1050

WRKY70 and 54 negativelyregulate SA biosynthesis andpositively regulate SAR

Wang et al. (2006) PLoS Pathogens 2:1042-1050

Identification and Cloning of a Negative Regulatorof Systemic Acquired Resistance, SNI1,through a Screen for Suppressors of npr1-1Xin Li, Yuelin Zhang, Joseph D. Clarke, Yan Li,†and Xinnian Dong* Cell, 98, 329–339, 1999.

Screened for EMS mutants of npr1-1 plants containing BGL2-GUSreporter.Look for plants that turn blue in response to INA (SA analog) like NPR1 wild type plants. But which, of course still harbor the npr1-1 mutation.Found 11 loci that gave increased GUS, out of 7000 plants screened.

Li et al., Cell 98, 329–339.

Li et al., Cell 98, 329–339.

Li et al., Cell 98, 329–339.

SNI1 is similar to mouse Retinoblastoma (Rb). Rb is a tumor suppressor that represses function of E2F transcription factor

Li et al., Cell 98, 329–339.

93-95% of genes upregulated in sni1 mutants are induced by BTH

SNI1 represses transcription in yeast

Mosher et al. (2006) Plant Cell, 18:1750–1765

sni1 mutation alters gene expression – most genes also induced by BTH

Chromatin modifications at the PR-1 promoter in sni1 mutants

Mosher et al. (2006) Plant Cell, 18:1750–1765

Model for signal transduction in SAR

Fu. 2013. Annu. Rev. Plant Biol. 64:839