Pavey et al., Microarray expression profiling in melanoma reveals a BRAF mutation signature.

Supporting Information

Page Number

Supporting Text Text 1 – Cell culture and RNA extraction 2 Text 2 – PCR for genotyping BRAF and NRAS 3 Text 3 – Microarray probe preparation and hybridization 4 Text 4 – Quantitative RT-PCR 9

Supporting Tables Table 1 – Primers for qRT-PCR 10

Table 2 – BRAF and NRAS cell line mutations 11 Table 3 – BRAF non-parametric genelist 12 Table 4 – NRAS non-parametric genelist 62 Table 5 – Genes ranked within top 80 of SVM for BRAF classification 113 Table 6a – PTPRA qRT-PCR data 114 Table 6b – RAB2L qRT-PCR data 115 Table 6c – ANXA7 qRT-PCR data 116 Table 6d – CD2AP qRT-PCR data 117 Table 6e – DLAT qRT-PCR data 118 Table 6f – DLD qRT-PCR data 119 Table 6g – MUC18 qRT-PCR data 120 Table 6h – BUB3 qRT-PCR data 121 Table 6i – RAB11-FIB2 qRT-PCR data 122

Supporting Figure Figure 1 – ROC curve for BRAF prediction. 123 The ROC curve area was used as a measure of the prediction performance on samples not used to train the SVMs, obtaining an area of 82%. The ROC curve area corresponds to another more intuitive measure of discrimination: the probability that in a randomly chosen pair of samples, one wild type and one harboring a mutation, the wild type sample is the one with SVM output closest to the ideal output for that class.

Supporting Text 1 – Cell Culture and RNA Extraction

Cell Culture All cell lines were cultured in 150 cm2 flasks in RPMI 1640 (Gibco BRL) supplemented with penicillin (60 µg/ml) and steptomycin (100 µg/ml) in the presence of 10 % foetal bovine serum (FBS) from the same batch (CSL, Australia). Cells were split 1-2 days prior to RNA extraction so that on the day of collection, cultures were at approximately 70% confluency, and were in log phase growth. RNA Extraction Cell lysis was performed directly on the plate using Qiagen Midi Kits (Qiagen, Germany). Culture medium was aspirated and the cells were washed twice in 5 ml PBS, and excess PBS aspirated. A total of 2 ml of RLT buffer was added to each 150 cm2 flask and the flask was rotated to ensure complete lysis. Cell lysates were stored at -70oC until extraction, which was carried out as per the manufacturer’s instructions. RNA samples were quantitated spectrophotometrically by diluting in RNase-free water and measuring the absorbance at 260 nm (A260) against a water blank. The integrity and size distribution of total RNA was checked by denaturing agarose gel electrophoresis and ethidium bromide staining. RNA samples were aliquoted and stored at -70oC prior to cDNA synthesis to prevent repeated freeze-thawing. Preparation of Reference RNA using MM329 The cell line MM329 was used as a common reference for all hybridizations, and was prepared in one large batch. The cell line was expanded in culture as described above, and cell lysates were stored at -70oC until RNA extraction. RNA extraction was performed on cell lysates from all flasks of MM329 in one experiment, where the RNA was extracted and pooled, and quantitation and integrity checks were undertaken. The RNA was then aliquoted into 50 µg aliquots and stored at -70oC until hybridization to ensure that the samples were not repeatedly thawed and refrozen.

Supporting Text 2 –

PCR conditions to determine BRAF and NRAS mutation status Genotyping of Cell Lines. DNA was extracted from each cell line using an adaptation of the salting-out method (Miller et al., Nucleic Acids Res., 1988). BRAF was amplified to detect mutations in codons 463 and 468 (located in exon 11), and in codons 596 and 599 (located in exon 15). Using the primers BRAF_11F (ctctcaggcataaggtaatgtac) and BRAF_11R (gagtcccgactgctgtgaac), or BRAF_x15F (ctaagaggaaagatgaagtactatg) and BRAF_x15R (ctagtaactcagcagcatctcag), 360 bp and 328 bp PCR product were amplified respectively. Reactions contained 200 ng of DNA, QIAGEN PCR buffer (10x concentrated, containing Tris-Cl, KCl, (NH4)2SO4, 15 mM MgCl2; pH 8.7), Q solution (PCR enhancer), 20 pmol/µl of each primer, 2 mM of each dNTP, and 1.25 U of QIAGEN Taq polymerase. Amplification involved 35 cycles of denaturation at 94°C for 45 sec, annealing at 56°C for 90 sec, and extension at 72°C for 90 sec. An initial 12 min denaturation step at 94°C and a final 3 min extension at 72°C were also used. NRAS was also amplified to detect mutations in codons 12 and 13 (located in exon 1), and codon 61 (located in exon 2). Using the primers NRASX2F (ctggtttccaacaggttcttg) and NRASX2R (tgctactccaatcatctggtc), or NRASX3F (cacacccccaggattcttac) and NRASX3R (gttccaagtcattcccagtag), 567 bp and 438 bp PCR products were amplified respectively. DNA was amplified using QIAGEN Taq polymerase as described above. PCR involved a “touchdown” thermal cycling routine of two cycles at each annealing temperature, decreasing by steps of 2°C, followed by 25 cycles at the lowest temperature. Each cycle consisted of denaturation at 94°C for 45 sec, annealing at 65°C-57°C for 90 sec, and extension at 72°C for 90 sec. An initial 12 min denaturation at 94°C and a final 3 min extension at 72°C were also employed. PCR products were electrophoresed through a 1.5% TAE/agarose gel stained with ethidium bromide, excised and purified using a QIAGEN QIAquick Gel Extraction Kit. The BRAF and NRAS PCR products were sequenced using Applied Biosystems (ABI) BigDye version 3 according to the manufacturer's instructions using 3.2 pmol/ul of either BRAF_x15R, NRASX2R, or NRASX3R primer. Sequencing products were precipitated using 75% isopropanol and were run on an ABI 377 automated sequencer (PE Applied Biosystems, Foster City, CA).

Supporting Text 3 – Microarray Probe Preparation and Hybridization Protocol

SOLUTIONS RNase/DNase-free distilled water (Invitrogen, Cat #10977-015)

Oligo (dT)15 (Roche, Cat. # 814270) add 20 µl RNase free H2O (Final concentration of 2 µg/µl)

dNTP STOCKS - 25 mM dATP, dCTP, dGTP Mix. Using 100 mM dNTP’s (Promega, Cat # U1240)

50 µl of 100 mM dATP 50 µl of 100 mM dCTP 50 µl of 100 mM dGTP 50 µl of 50 mM Tris-HCl pH 8.0 Aliquot into 20 µl lots, store at –20oC.

dNTP STOCKS - 2.5 mM dTTP Using 100 mM dTTP in above product. 5 µl of 100 mM dTTP 195 µl of 50 mM Tris-HCl pH 8.0 Aliquot into 20 µl lots, store at –20oC. Poly (dA) 25 units lyophilised (Amersham Pharmacia, Cat. # 27-7836). A260 unit of single stranded polymer = 37 µg Therefore, resuspend in 92.5 µl MilliQ total. Aliquot in 10 µl lots in 0.5 ml tubes, and store at –20oC. Cot-1 DNA 500 µg (Invitrogen, Cat. # 15279-011) Aliquot into 50 µl lots, and store at –20oC Cy3- and Cy5-dUTP From NEN products (Geneworks) (Cat. # NEL-578 & NEL-579). Stored in dark at 4oC

0.5 M EDTA pH 8.0 Add 186.1g of disodium ethylenediaminetetraacetate-2H2O to 800 ml water. Stir vigorously on a

magnetic stirrer. Adjust the pH to 8.0 with NaOH (~20 g of NaOH pellets). Filter sterilize.

1M Tris pH 8.0 Dissolve 121.1 g of Tris base in 800 ml of water. Adjust the pH to 8.0 by adding ~42 ml concentrated HCl. Adjust the volume of the solution to 1 L with water. Filter sterilize

20x SSC Dissolve 175.3 g of NaCl and 88.2 g of sodium citrate in 800ml of water. Adjust the pH to 7.0 with a few drops of 10 N solution of NaOH. Adjust the volume to 1 L with water. Filter using a 0.2 µm bottle top filter.

10% SDS Dissolve 100 g of electrophoresis-grade SDS in 900 ml of water. Heat to 68°C to assist dissolution. Adjust the pH to 7.2 by adding a few drops of concentrated HCl. Adjust the volume to 1 L with water. Filter using a 0.2 µm bottle top filter.

2M NaOH Add 80 g of NaOH pellets to 1 L of sterile water.

1M HCl Add 86.2 ml of concentrated HCl solution and make up to a final volume of 1 L with sterile water.

LABELLING 1. Measure out RNA into a 0.2 ml thin wall PCR tube, (if volume is >17 µl add 1 µl of RNasin as below) and

Speedivac down to 18 µl, without heat. Resuspend in RNase free H2O to final volume of 18 µl. 2. Mix the following: 40 µg total RNA (50 µg for mm329 reference) 17 µl

RNasin (Promega) 1 µl Oligo d(T15) (2 µg/µl) 2 µl

3. Heat to 70oC for 10 min in thermal cycler in 0.2 ml tube Prepare the following as a master mix and store on ice until required in Step 6:-

Reaction 3 × Reactions 8 × Reactions 10 x Reactions (1 chip) (3chips) (4 chips)

5 × First Strand Buffer (Invitrogen)* 8 µl 24 µl 64 µl 80 µl 100 mM DTT (Invitrogen) 4 µl 12 µl 32 µl 40 µl (stock) 25.0 mM dATP,dCTP,dGTP 1 µl 3 µl 8 µl 10 µl (stock) 2.5 mM dTTP 2 µl 6 µl 16 µl 20 µl *Give the 5 × First Strand buffer and DTT a vortex before use Add 15ul of reaction mix to each separate tube containing 2 µl of 1.0 mM Cy3- or Cy5-dUTP.

4. Remove tube and cool on ice for 2 min. Change temperature on thermal cycler to 45oC. Zip spin for ~10

seconds to bring down condensation. 5. Transfer back to thermal cycler at 45oC for 10 min. 6. Add the above Reaction Mix (containing the separate dyes) to the separate RNA + oligo (dT)15 mixes. 7. Mix well, zip spin and incubate at 42oC for 2 min. 8. Add 1.5 µl of Superscript II. Mix well & zip spin. Incubate for 60 min at 42oC for 1 hr. 9. Add another 1 µl of Superscript II and incubate for a further 1.5 hrs. Quench tubes on ice for 1 min. Zip

spin to collect condensation. 10. Add 1 µl of 0.5 M EDTA (pH 8.0) and 2 µl of 2 M NaOH to each tube. Heat to 65oC for 10 min. 11. Add 4 µl 1 M HCl and 4 µl 1 M Tris (pH 8.0) . 12. Add 17 µl of 100 mM Sodium acetate (pH 5.2) to each reaction. PURIFICATION (of labelled cDNA) Amended Protocol for Qiaquick PCR purification column.

1. Add a total of 500 µl PB buffer to the reaction tubes. Do this by adding 166 µl PB buffer to each of the tubes, mixing, and transferring to a 1.5 ml tube. The final 166 µl is rinsed through each of the Cy3 and Cy5 reaction tubes. The pooled reactions are mixed well, and loaded onto Qiaquick column (Note that the solution will be purple in color).

2. Spin through at 14,000 rpm for 60 sec. Discard eluate (most of the dyes will go through as they

are un-incorporated, so don’t be surprised at a bright purple colour in eluate).

3. Add 600 µl of PE buffer to the column.

4. Spin 14,000 rpm for 1 min and discard eluate. Transfer column to a fresh collection tube (not supllied (Qiagen Cat #19201).

5. Spin 14,000 rpm for 1 min (to dry).

6. Transfer to column to fresh collection tube (1.5 ml Eppendorf).

7. Add 40 µl of EB buffer to the middle of the column & incubate for 1-2 min. 8. Elute purified cDNA by spinning for 1 min at 14,000 rpm. The product is clear in appearance.

HYBRIDISATION NB: Set-up 0.2 ml tubes and label. 1. To a fresh 0.2 ml tube add: Cot-1 DNA (1 µg/µl) 10 µl poly dA (10 µg/µl) 2 µl

purified probe (from Qiaquick purification) ~40 µl Speedivac down to ~11 µl with heat at 45oC. 2. Then add the following in order: 20 × SSC 8 µl

Deionized Formamide 20 µl 10% SDS 2 µl

Mix, spin down, and heat sample to 95oC for 5 min. 3. Incubate the labelled target at 45oC for 45 min prior to placing on array. Meanwhile, while the probe is incubating…… Prepare Hyb chambers as follows. - Ensure all slides in the black box are flat so that the OCI chips sit on top perfectly horizontal. - Add the following solution to the Hyb chamber (will keep the box humidified)

• 1 ml 20x SSC • 2.5 ml deionised formamide • 250 µL 10% SDS • 1.4 ml H2O

- Place the Hyb chamber inside a boehringer box and pre-heat in an oven at 45oC until probe is ready. Make up the following Hyb solution (to be added to probe before placing on OCI chips):

• 48 µL 20x SSC • 120 µL deionised formamide • 12 µL 10% SDS • 66 µL H2O

4. Place probe on ice for 10 sec, spin for 30 sec at room temperature. Don’t make probe too cold, in case

of precipitation. 5. Add 60µL of the Hyb solution (see above) to the probe, so that probe solution totals ~100 µL. 6. Place first slide into Hyb chamber by holding the slide with forceps on the sticker end. Aim for the middle

of the Hyb chamber. Place the second OCI slide on top of the first so that the stickers are at opposite ends and facing inwards. Position the top slide so that one of the long edges is slightly overhanging that of the bottom slide.

7. Carefully load 100 µL of room-temp probe between the top and bottom slides using a yellow tip and

allow capillary action to distribute the slide between the two slides. 8. Carefully move the top slide so that it is completely aligned with the bottom slide. Close the lid of the Hyb

chamber.

9. Run the hot tap, and fill a Boehringer box with 1-2 cm of hot water (Temp is about 50oC). Gently submerge the Hyb chamber into the water, and place in oven at 45oC for 14 - 24 hrs.

WASHING 1. Prepare the following (in 2 L beakers):

1 l of SDS Wash

MQ WATER 990 ml 20 x SSC 10 ml 10% SDS 5 ml

1 l of SSC Rinse

MQ WATER 990 ml 20 x SSC 10 ml

(An optional second SSC rinse station can also be added) 2. Prior to washing, pre-warm the warm wash solutions to ~37°C. Wrap foil around the washing beakers

and wash slides in the dark to minimize light exposure. 3. After hybridisation, plunge each slide into the SDS/SSC Wash. Place slide into rack and then gently

plunge holder for 15 sec every min for 3 min. 4. Rapidly transfer slide holder into SSC Wash, and gently plunge holder for 15 sec every min for 3min. 5. Remove slide with forceps and place in a 50 ml falcon tube and centrifuge at 600 rpm for 5 min to dry

slide. 6. Store slides in slide box with closed lid to reduce quenching of fluorophores. SCANNING NB: Scan Cy5 first, as it is more photolabile. 1. Turn on scanner. Start GMS 418 Scanner program. 2. Using flat-forceps, insert slide into GMS 418 scanner. • for OCI chips- place sticker end in first (so barcode is at bottom of slide image) 3. Ensure laser selected is the “Red” one on the scanner window, and the correct sector of the wheel

(underneath the slide insert window). 4. Select area you wish to scan by pressing “Go” button. • for OCI chips- will need to move region to be scanned towards top of slide 5. Go to “Advanced settings”, and select appropriate gain setting to ensure that elements remain

withing a dynamic range. Scan slide and they save raw image.

OCI chip

OCI chip

6. When finished, select the laser to be used in the scanning window for “Green”, and physically

change the sector of the wheel on the GMS 418 scanner. Repeat the above steps, until suitable images have been obtained and saved.

7. Press the “eject slide” button from the software and remove slide.

Supporting Text 4 – Quantitative RT-PCR Methods To further confirm the validity of the microarray expression data, the mRNA levels of 12 unique transcripts selected from the 83 highest ranking genes from the SVM output were quantified by real-time quantitative RT-PCR. Reverse Transcription The same RNA samples extracted for the microarray experiments were used. cDNA was made using Superscript III reverse transcriptase (Invitrogen) according to the manufacturer's protocol, with the reverse transcription undertaken for 3 hrs. All cDNAs were quantitated used a spectrophotometer at A260nm, and were aliquoted and stored at -20oC. Quantitative PCR Each PCR was performed in duplicate using a QuantiTect SYBR® Green PCR kit (Qiagen, Germany). Reactions contained 2 µl (20 ng) of cDNA, 0.5 µl of each primer (20 µM), 10 µl 2x QuantiTect SYBR® Green PCR Master Mix and 7 µl RNAse-free water. Test cell lines and the reference cell line (MM329) were amplified in parallel reactions using specific primers (for primer sequences, please refer to Supporting Table 1 on the PNAS web site). All PCR’s were carried out on a Corbett RotorGene 3000 (Corbett Research, Australia). Each PCR reaction involved 45 cycles of denaturation at 95°C for 15 sec, annealing at 60°C for 20 sec, and extension at 72°C for 20 sec followed by a melt from 72oC to 99oC for 30 sec. The following primers required different annealing temperatures; RAB11 underwent annealing at 54°C and BUB3 and DLD underwent annealing at 58°C. An initial 15 min polymerase activation step at 95°C was also employed. Specificity of PCR products obtained was characterized by melting curve analysis. Gel electrophoresis and DNA sequencing was carried out on PCR products for each primer set to confirm identity. To confirm accuracy and reproducibility of qRT-PCR the intra-assay precision was determined in 10 repeats within one run. Inter-assay variation was investigated in 10 different experimental runs performed over 8 days.

Transcripts Verified on total panel of 61 melanoma cell lines

Clone ID on Chip

Verified GenBank

Accession No.

Unigene cluster

Locus Link ID Gene Name Gene

Symbol Forward primer Reverse primer Melting temp (C)

Product length

(bp)

H08441 H08441 Hs.26045 5786 Protein tyrosine phosphatase, receptor type, A PTPRA GAGAGGCCAGGAGAAGTGTG GAGGTCTCGGACGGTGTAG 83.1 118R25789 R25789 Hs.170160 5863 RAB2, member RAS oncogene family-like RAB2L GCAGTGGACAGAGGTTTTGG AGTCAGCAGAGGAGCAGGAG 86.9 112AA135740 BQ009475 Hs.78637 310 Annexin A7 ANXA7 GAAGACCATCTTGCAGTGTGC GGACCAGGGTGGAGTCATC 84.3 101

Trancripts Verified on all BRAF WT cell lines and and equal number of 17 random cell lines containing BRAF mutations

Clone ID on Chip

Verified GenBank

Accession No.

Unigene cluster

Locus Link ID Gene Name Gene

Symbol Forward primer Reverse primer Melting temp (C)

Product length

(bp)

N21289 N31224 Hs.211579 4162 Melanoma cell adhesion molecule MCAM TCTCGTAAGACCGAACTTGTAG CGATGTATTTCTCTCCCTGGT 84.5 121R80585 R80585 Hs.374340 23607 CD2-associated protein CD2AP GAAAAAGGATCACGGGAAAG AGGTCCACACCACTCAAGAAG 79.1 134R60317 R60374 Hs.74635 1738 Dihydrolipoamide dehydrogenase (E3 component) DLD GTGCTGGAGAAATGGTAAATG TTCTGATAAGGTCGGATGTG 79.9 101H12076 H12076T83153 T83153W46396 W46504 Hs.157101 1737 Dihydrolipoamide S-acetyltransferase (E2 component) DLAT AACATTCGTCGGGTTATTGC AAACATGCCAAAGCTGAAGC 78.6 185

Trancripts Verified on 10 BRAF WT cell lines and 10 BRAF Mutant cell lines (5 cell lines with highest expression and 5 with lowest expression)

Clone ID on Chip

Verified GenBank

Accession No.

Unigene cluster

Locus Link ID Gene Name Gene

Symbol Forward primer Reverse primer Melting temp (C)

Product length

(bp)

W42423 BG770889 Hs.173656 22841 Rab11-family interacting protein 2 Rab11-FIP2 GTTCCAGAAAGTGGAAGTCTC TTCCGAAACACAATTCACC 78.6 112N64618 N79947 Hs.40323 9184 BUB3 budding uninhibited by benzimidazoles 3 homolog BUB3 TAATGATGGGACTACGCTTG CAAGTACATGGTGACTTGGG 80.3 132

Realtime RT-PCR Control

Clone ID on Chip

Verified GenBank

Accession No.

Unigene cluster

Locus Link ID Gene Name Gene

Symbol Forward primer Reverse primer Melting temp (C)

Product length

(bp)

Hs.169476 2597 Glyceraldehyde-3-phosphate dehydrogenase GAPDH GAAATCCCATCACCATCTTCC AAATGAGCCCCAGCCTTCTC 85.9 124

Supporting Table 1 - Primers used for Verification of Transcripts using Real-time RT-PCR

Supporting Table 2 - BRAF and NRAS mutation statusName NRAS BRAFA02 WT V599E BRAF Mutations Frequency of Mutation# % of totalA05 WT V599E L596S* 1/61 1.6%A07 G12S,Q61R WT L596V* 1/61 1.6%A11 WT WT V599E** 42/61 69%A15 WT V599K V599K** 1/61 1.6%

A2058 WT V599E WT 17/61 28%BL WT V599E *Total Number of Mutations in codon 596 =2

C-32 WT V599E **Total number of mutations in Codon 599 =43CJM Q61K WT #please note that one sample (D23) contained two BRAF mutations

COLO-F WT V599E (L596V &V599E, and hence appears twice in this table)D04 Q61L WTD05 WT V599E NRAS Mutations Frequency of Mutation* % of totalD08 Q61L WT G12S 1/61 1.6%D10 WT WT G13R 1/61 1.6%D11 Q61L WT Q61K 1/61 1.6%D14 WT V599E Q61L 4/61 6.5%D17 WT V599E Q61R 3/61 4.9%D20 WT V599E HD 1/61 1.6%D23 WT V599E,L596V WT 51/61 84%D24 WT WT *please note that one sample (A07) contained two NRAS mutations D25 WT V599E (G12S &Q61R, and hence appears twice in this table)

HT144 WT V599EJA WT V599E BRAF mutation and NRAS Deletion Frequency % of total

ME-1007 WT WT BRAF mutation and NRAS Deletion 1/61 1.6%ME10538 WT V599EME1402 WT V599EME-4405 Q61R WTMel-FH WT WTMel-RM WT WT

Mel-RMU WT V599EMM127 G13R WTMM170 WT V599EMM200 WT V599EMM229 WT L596SMM253 WT V599EMM329 WT WTMM370 WT V599EMM383 WT V599EMM386 WT V599EMM415 Q61L WTMM426 WT V599EMM455 WT V599EMM466 WT V599EMM470 WT V599EMM472 WT V599EMM473 WT V599EMM485 Q61R WTMM537 WT V599EMM540 WT V599EMM595 WT V599EMM603 WT V599EMM608 WT V599EMM622 WT V599EMM629 WT V599EMM648 WT V599EMM649 HD V599EMM96L WT V599E

RPMI 7932 WT WTSKMEL13 WT V599E

WSB WT V599EWW WT V599E

Summary - Statistical Breakdown (n=61)

Supporting Table 3 - Mann-Whitney P-values and SVM consensus gene ranks for the BRAF classification and for all 5041 quality filtered genes.The genes are sorted according to SVM gene rank.

Mann-Whitney P-value: The P-value from the BRAF status analysis using all 61 samples. SVM consensus gene rank: The 25th percentile of the 30 ranks from the SVM cross-validation scheme. The ranks are based on the Mann-Whitney test. Sign: 1 if the gene has higher expression for samples with BRAF mutations. -1 if it has higher expression for BRAF wild type samples.Confidence in sign: 1 if the sign is identical for all 30 SVMs. 0 if the sign is 1 for 15 SVMs and -1 for 15 SVMs. *for sequence verification of Clone ID's on chip, please refer to the manufacter's website http:/www.microarrays.ca/support/glists.html

Original Clone ID on Chip*

Mann-Whitney P-value

SVM consensus gene rank

Sign Confidence in sign Original Gene Name* Original Gene

Symbol*

Original Unigene cluster*

W88806 0.0001 5 -1 1 Uroporphyrinogen III synthase (congenital erythropoietic porphyria) UROS Hs.75593W46396 0.0004 5 1 1 Dihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex) DLAT Hs.115285R60317 0.0006 8 1 1 Dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex) DLD Hs.74635H78941 0.0004 9 -1 1 Thioesterase, adipose associated THEA Hs.234786N63044 0.0003 11 -1 1 Hypothetical protein FLJ20048 FLJ20048 Hs.116470R52086 0.0004 11 1 1 Hypothetical protein FLJ31657 FLJ31657 Hs.5518H12076 0.0004 12 1 1 Dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex) DLD Hs.74635W42423 0.0006 14 -1 1 Cyclin-dependent kinase 2 CDK2 Hs.19192AA133960 0.0011 14 -1 1 Ubiquitin-conjugating enzyme E2A (RAD6 homolog) UBE2A Hs.80612H08441 0.0008 16 1 1 Protein tyrosine phosphatase, receptor type, A PTPRA Hs.26045T83153 0.001 17 1 1 Dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex) DLD Hs.74635N29673 0.0011 17 1 1 Hypoxia up-regulated 1 HYOU1 Hs.277704W42634 0.0004 20 1 1 Fibroblast activation protein, alpha FAP Hs.418T91050 0.0008 20 1 1 KIAA1586 protein KIAA1586 Hs.180663W58034 0.0015 20 -1 1 Small nuclear ribonucleoprotein polypeptide A' SNRPA1 Hs.80506N27557 0.0008 21 -1 1 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 PSMD9 Hs.5648N72115 0.0017 21 -1 1 Cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) CDKN2C Hs.4854R59224 0.0013 23 1 1 MBD2 (methyl-CpG-binding protein)-interacting zinc finger protein MIZF Hs.7987R36627 0.001 24 1 1 POU transcription factor 10/11/2002 Hs.227115AA001144 0.0007 26 -1 1 Similar to RIKEN cDNA 5730528L13 gene MGC17337 Hs.78531AA033605 0.0015 26 1 1 CD2 antigen (cytoplasmic tail) binding protein 2 CD2BP2 Hs.202677T79604 0.0021 26 1 1 Hypothetical protein DKFZp434F2322 DKFZp434F2322Hs.144633AA102088 0.0021 26 -1 1 Tripartite motif-containing 37 TRIM37 Hs.8164R13127 0.0019 28 1 1 Suppressor of potassium transport defect 3 SKD3 Hs.21263N53295 0.0009 29 -1 1 Ribosomal protein L39-like RPL39L Hs.132748N/A2 0.0016 29 1 1 - - -H90879 0.0015 30 -1 1 Hypothetical protein MGC8974 MGC8974 Hs.40094AA001333 0.0036 32 -1 1 Fusion, derived from t(12;16) malignant liposarcoma FUS Hs.99969R33452 0.0009 33 1 1 Protein O-fucosyltransferase 1 POFUT1 Hs.178292N73284 0.0011 33 -1 1 KIAA1089 protein KIAA1089 Hs.4990AA034917 0.0069 33 -1 1 Chaperonin containing TCP1, subunit 3 (gamma) CCT3 Hs.1708N51855 0.0021 34 -1 1 ADP-ribosyltransferase (NAD+; poly(ADP-ribose) polymerase)-like 2 ADPRTL2 Hs.24284AA099636 0.001 35 -1 1 KIAA1039 protein KIAA1039 Hs.301552AA041401 0.0017 35 -1 1 ESTs ESTs Hs.57967H09315 0.0029 36 1 1 Proprotein convertase subtilisin/kexin type 7 PCSK7 Hs.32978W87530 0.002 37 -1 1 Hypothetical protein FLJ32919 FLJ32919 Hs.293224N21289 0.0018 38 1 1 Melanoma cell adhesion molecule MCAM Hs.211579R80243 0.0019 38 1 1 X-box binding protein 1 XBP1 Hs.149923R32855 0.004 38 1 1 - - -N52744 0.0014 39 -1 1 HSPC043 protein HSPC043 Hs.46624AA101823 0.0026 42 -1 1 Elastin microfibril interface located protein EMILIN Hs.63348N63458 0.002 43 -1 1 Sialyltransferase 6 (N-acetyllacosaminide alpha 2,3-sialyltransferase) SIAT6 Hs.48793N64618 0.0022 43 -1 1 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast) BUB3 Hs.40323N66208 0.0025 43 -1 1 Protein phosphatase 1, regulatory (inhibitor) subunit 8 PPP1R8 Hs.356590R35157 0.0021 45 1 1 Diacylglycerol kinase, delta 130kDa DGKD Hs.115907T96118 0.0044 45 1 1 - - Hs.226313R54062 0.0054 45 1 1 Crn, crooked neck-like 1 (Drosophila) CRNKL1 Hs.268281N20259 0.0015 47 -1 1 Hypothetical protein MGC2840 similar to a putative glucosyltransferase MGC2840 Hs.155356AA029361 0.0019 48 -1 1 - - Hs.31841AA215407 0.0025 48 -1 1 - - Hs.349755T80625 0.0044 48 1 1 Prohibitin PHB Hs.75323R55182 0.0019 49 1 1 - - Hs.374526H10318 0.002 49 1 1 HLA-B associated transcript 4 BAT4 Hs.247478W31471 0.0024 50 -1 1 Hypothetical protein DKFZp547A023 DKFZp547A023 Hs.23921H15871 0.0025 50 1 1 Nicotinamide nucleotide transhydrogenase NNT Hs.18136R54777 0.0036 50 1 1 - - Hs.374908H20850 0.0044 50 1 1 Thioredoxin 2 TXN2 Hs.211929R80802 0.0036 52 1 1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 KDELR1 Hs.78040W33047 0.0054 53 -1 1 - - Hs.348976AA059311 0.0028 55 -1 1 Collagen, type VI, alpha 2 COL6A2 Hs.159263T96379 0.0036 57 1 1 Protein phosphatase 2, regulatory subunit B (B56), delta isoform PPP2R5D Hs.118244N36349 0.0034 59 -1 1 ESTs ESTs Hs.374577W90083 0.0036 59 -1 1 Hypothetical protein BC013587 LOC219738 Hs.94943N62816 0.0051 60 -1 1 Hypothetical protein FLJ11236 FLJ11236 Hs.10441T39460 0.0049 61 -1 1 Protein phosphatase 1, catalytic subunit, alpha isoform PPP1CA Hs.183994AA135740 0.0042 62 -1 1 ESTs ESTs Hs.135270W37210 0.0031 63 1 1 Hypothetical protein MGC40361 MGC40361 Hs.284170R34632 0.0034 63 1 1 Zinc finger, DHHC domain containing 6 ZDHHC6 Hs.22353AA031913 0.0046 64 -1 1 - - Hs.351573N79912 0.0036 65 -1 1 Guanine nucleotide binding protein (G protein), beta polypeptide 1 GNB1 Hs.215595R06281 0.0062 65 1 1 KIAA0349 protein KIAA0349 Hs.15303R25789 0.0072 65 1 1 RAB2, member RAS oncogene family-like RAB2L Hs.170160AA033545 0.0031 71 -1 1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 TIAL1 Hs.182741W15337 0.0049 71 -1 1 ESTs ESTs Hs.297784W03395 0.0049 71 -1 1 Elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 ELOVL1 Hs.25597AA099341 0.0051 72 -1 1 Golgi-specific brefeldin A resistance factor 1 GBF1 Hs.155499R49336 0.0069 72 1 1 SKI-interacting protein SNW1 Hs.79008H49981 0.0036 74 1 1 - - Hs.113994R61759 0.0101 75 1 1 - - Hs.8078N59182 0.0044 76 -1 1 - - Hs.311002R07295 0.0105 76 -1 1 Sterol O-acyltransferase (acyl-Coenzyme A: cholesterol acyltransferase) 1 SOAT1 Hs.14553AA121306 0.0044 77 -1 1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 KDELR1 Hs.78040R80585 0.0101 77 1 1 CD2-associated protein CD2AP Hs.374340R55020 0.0032 81 1 1 - - -W87615 0.0038 82 -1 1 Isoprenylcysteine carboxyl methyltransferase ICMT Hs.183212W78880 0.0076 83 -1 1 Hypothetical protein MGC14697 MGC14697 Hs.171625H89834 0.0059 84 -1 1 Hypothetical protein BC000919 LOC90736 Hs.33020R18713 0.0083 84 1 1 HLA-B associated transcript 8 BAT8 Hs.75196

H95383 0.0069 86 -1 1 Death effector domain containing DEDD Hs.169681H80498 0.0096 86 -1 1 KIAA0286 protein KIAA0286 Hs.14912AA045664 0.008 87 -1 1 Uncharacterized hematopoietic stem/progenitor cells protein MDS031 MDS031 Hs.110853R44861 0.0105 87 1 1 Hypothetical protein FLJ10637 FLJ10637 Hs.22595H16834 0.0096 90 1 1 Amyloid beta (A4) precursor protein-binding, family A, member 2 binding protein APBA2BP Hs.324104AA007350 0.0036 93 -1 1 Similar to yeast BET3 (S. cerevisiae) BET3 Hs.288013W47619 0.0049 93 -1 1 2'-5'-oligoadenylate synthetase 3, 100kDa OAS3 Hs.56009AA043334 0.008 93 1 1 Small nuclear RNA activating complex, polypeptide 3, 50kDa SNAPC3 Hs.164915N93962 0.0092 93 -1 1 Mitochondrial ribosomal protein L43 MRPL43 Hs.151945T87767 0.0062 94 1 1 ESTs ESTs Hs.16439AA011556 0.0059 95 1 1 - - Hs.49136H94763 0.0069 97 -1 1 SH3-domain GRB2-like endophilin B1 SH3GLB1 Hs.136309N41035 0.0042 98 -1 1 - - Hs.378848T94596 0.0046 98 -1 1 Vacuolar protein sorting 26 (yeast) VPS26 Hs.67052N30054 0.0049 98 -1 1 - - -W47326 0.0072 98 -1 1 - - Hs.194051N34758 0.0057 99 -1 1 Chromosome 2 open reading frame 6 C2orf6 Hs.196437AA132089 0.0057 100 -1 1 Hypothetical protein FLJ20522 FLJ20522 Hs.35406W37846 0.0101 100 -1 1 Hypothetical protein MGC955 MGC955 Hs.55608AA032037 0.0057 102 -1 1 Ubiquitin-conjugating enzyme E2A (RAD6 homolog) UBE2A Hs.80612R43738 0.0092 102 1 1 UDP-glucose ceramide glucosyltransferase-like 2 UGCGL2 Hs.22983AA133962 0.008 104 -1 1 PRO0149 protein PRO0149 Hs.64056H90406 0.0101 104 -1 1 Deoxythymidylate kinase (thymidylate kinase) DTYMK Hs.79006R19317 0.0069 105 1 1 - - -N30854 0.0076 106 1 1 Lectin, mannose-binding, 1 LMAN1 Hs.287912AA056541 0.0083 106 -1 1 D component of complement (adipsin) DF Hs.155597AA193264 0.0057 107 -1 1 ESTs ESTs Hs.85875N46198 0.0121 107 -1 1 - - Hs.43744N34765 0.0151 107 -1 1 - - -H14441 0.0057 108 1 1 - - -R93361 0.0069 109 -1 1 - - -R46328 0.011 109 1 1 Trinucleotide repeat containing 5 TNRC5 Hs.56828H45103 0.0087 112 1 1 Attractin ATRN Hs.194019W48561 0.0096 113 -1 1 - - -R76088 0.011 113 1 1 Ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) UCHL3 Hs.77917H78795 0.0076 115 -1 1 Heart and neural crest derivatives expressed 2 HAND2 Hs.36029AA047468 0.0214 115 -1 1 - - Hs.127824W42880 0.0046 116 -1 1 Tripartite motif-containing 8 TRIM8 Hs.54580AA054518 0.0121 117 -1 1 Sm protein F LSM6 Hs.42438N72125 0.0096 119 -1 1 - - -R27996 0.0092 120 1 1 Signal sequence receptor, alpha (translocon-associated protein alpha) SSR1 Hs.250773H04804 0.0062 121 1 1 ESTs ESTs Hs.374236H38504 0.0087 121 1 1 DKFZP566I1024 protein DKFZP566I1024Hs.279696AA150817 0.0116 121 -1 1 Thioredoxin TXN Hs.76136H79622 0.0145 121 -1 1 ESTs ESTs Hs.13751H85870 0.0066 122 1 1 - - -N73986 0.0087 122 -1 1 ESTs ESTs Hs.50408W88723 0.008 123 -1 1 Peptidyl prolyl isomerase H (cyclophilin H) PPIH Hs.9880W86900 0.0151 124 -1 1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 B4GALT2 Hs.206713T96901 0.011 126 1 1 - - -N95545 0.0116 128 -1 1 Interleukin 11 IL11 Hs.1721N45674 0.0151 128 1 1 KIAA0759 protein KIAA0759 Hs.7285H26200 0.0151 128 1 1 - - Hs.121001AA037600 0.0096 129 -1 1 Chromosome condensation 1 CHC1 Hs.84746AA047163 0.0096 132 1 1 Hypothetical protein DKFZp434C0328 DKFZp434C032 Hs.24583W42674 0.011 132 -1 1 FK506 binding protein 14, 22 kDa FKBP14 Hs.264636N46185 0.0069 133 -1 1 ESTs ESTs Hs.165084H59130 0.0145 134 1 1 Sec23 homolog B (S. cerevisiae) SEC23B Hs.173497N66072 0.0224 134 1 1 ESTs ESTs Hs.13680W86818 0.0069 135 -1 1 Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein IKBKAP Hs.31323R52104 0.0101 135 1 1 Gemin 5 GEMIN5 Hs.25882N92371 0.0087 136 -1 1 Hypothetical protein, clone 24751 CL24751 Hs.29344H00660 0.0145 136 -1 1 - - Hs.313342W78867 0.0173 136 -1 1 Agrin AGRN Hs.273330W60763 0.0092 137 -1 1 Thyroid hormone receptor-associated protein, 240 kDa subunit TRAP240 Hs.11861AA029847 0.011 137 -1 1 Cyclin fold protein 1 CFP1 Hs.6820H50481 0.0101 139 1 1 Dishevelled associated activator of morphogenesis 2 DAAM2 Hs.100113AA136615 0.0151 139 -1 1 V-yes-1 Yamaguchi sarcoma viral related oncogene homolog LYN Hs.80887W67797 0.0087 140 -1 1 Laminin, alpha 5 LAMA5 Hs.11669T99677 0.0092 140 -1 1 CGI-105 protein LOC51011 Hs.279932R78183 0.0158 140 1 1 Pre-B-cell leukemia transcription factor 2 PBX2 Hs.93728N63962 0.0311 142 1 1 Component of oligomeric golgi complex 5 COG5 Hs.239631R07187 0.0188 143 1 1 Ornithine decarboxylase antizyme 2 OAZ2 Hs.74563H64252 0.0173 144 1 1 Acyl-Coenzyme A dehydrogenase family, member 8 ACAD8 Hs.14791AA047569 0.0069 145 -1 1 Hypothetical protein FLJ10597 FLJ10597 Hs.90375N44485 0.0127 145 -1 1 - - Hs.13809H23246 0.0145 145 1 1 Hypothetical protein FLJ13433 FLJ13433 Hs.23259N74700 0.0165 145 -1 1 Similar to Caenorhabditis elegans protein C42C1.9 KEO4 Hs.285818AA045615 0.0205 146 1 1 Membrane-bound transcription factor protease, site 1 MBTPS1 Hs.75890R79632 0.0138 147 1 1 Family with sequence similarity 3, member C FAM3C Hs.29882R14667 0.0165 148 1 1 Zinc finger protein of the cerebellum 4 ZIC4 Hs.326796R55696 0.011 149 1 1 KIAA1107 protein KIAA1107 Hs.21554AA193317 0.0158 150 -1 1 - - Hs.356786H58331 0.0173 150 1 1 Glucose regulated protein, 58kDa GRP58 Hs.289101N42278 0.0121 151 -1 1 ADP-ribosylation-like factor 6 interacting protein 2 ARL6IP2 Hs.27099R39865 0.0105 153 1 1 Jerky homolog (mouse) JRK Hs.142296H17385 0.0145 153 1 1 Hypothetical protein DKFZp564D1378 DKFZP564D137Hs.318401R02822 0.0127 154 1 1 - - Hs.243901N56712 0.0116 156 -1 1 PWP2 periodic tryptophan protein homolog (yeast) PWP2H Hs.79380T79507 0.0205 156 1 1 Erythropoietin receptor EPOR Hs.127826H44309 0.0101 158 1 1 Solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 SLC25A1 Hs.111024H95311 0.0127 159 -1 1 - - Hs.13431R80587 0.0096 160 1 1 Protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform PPP2R2A Hs.179574AA203686 0.0101 160 -1 1 Retinoid X receptor, alpha RXRA Hs.20084AA054486 0.0158 160 -1 1 V-raf-1 murine leukemia viral oncogene homolog 1 RAF1 Hs.349650H11233 0.0205 160 1 1 CGI-203 protein CGI-203 Hs.184860N89775 0.0145 161 1 1 - - Hs.379753AA040043 0.0096 162 -1 1 Protocadherin 20 PCDH20 Hs.132892AA150112 0.011 162 -1 1 Intermediate filament protein syncoilin SYNCOILIN Hs.348415R94555 0.0151 162 1 1 Collagen, type IV, alpha 2 COL4A2 Hs.75617

AA150894 0.011 163 -1 1 Guanine nucleotide binding protein 11 GNG11 Hs.83381T91993 0.0132 163 1 1 ESTs ESTs Hs.347475N25612 0.0138 163 -1 1 Papillomavirus regulatory factor PRF-1 LOC55893 Hs.27410N39088 0.0173 163 -1 1 - - Hs.356387N77922 0.0116 165 -1 1 - - Hs.343271H20531 0.011 168 1 1 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4 B3GALT4 Hs.21495H49329 0.0145 168 1 1 Breakpoint cluster region protein, uterine leiomyoma, 1; barrier to autointegration factor BCRP1 Hs.268763W93073 0.0233 169 -1 1 - - Hs.269180AA043805 0.0138 170 -1 1 Integrin beta 3 binding protein (beta3-endonexin) ITGB3BP Hs.82084R60825 0.0145 170 1 1 Mitogen-activated protein kinase 9 MAPK9 Hs.246857AA037078 0.0214 171 -1 1 B7-H1 protein B7-H1 Hs.97269N74713 0.0105 172 -1 1 - - -AA151211 0.0092 173 -1 1 Bone morphogenetic protein 1 BMP1 Hs.1274AA031501 0.0138 177 -1 1 Adaptor-related protein complex 3, mu 1 subunit AP3M1 Hs.298442W47547 0.0151 177 -1 1 Adenylate cyclase 9 ADCY9 Hs.20196AA136060 0.0188 177 -1 1 Hypothetical protein MGC16202 MGC16202 Hs.246914H01676 0.0165 180 1 1 Hypothetical protein BC002494 LOC92579 Hs.294005R71156 0.0275 180 1 1 Programmed cell death 7 PDCD7 Hs.143253T83937 0.0092 181 1 1 Hypothetical protein FLJ31638 FLJ31638 Hs.14832W63752 0.0145 182 -1 1 DnaJ (Hsp40) homolog, subfmaily B, member 1 DNAJB1 Hs.82646N55283 0.0197 182 -1 1 KIAA0469 gene product KIAA0469 Hs.7764AA056486 0.0188 183 -1 1 - - -W68453 0.0205 183 -1 1 Hypothetical protein FLJ10468 FLJ10468 Hs.48855R32522 0.0138 184 1 1 Endothelial zinc finger protein 2 EZF-2 Hs.24545R60480 0.018 184 1 1 Beclin 1 (coiled-coil, myosin-like BCL2 interacting protein) BECN1 Hs.12272W25075 0.0254 184 -1 1 Hypothetical protein MGC23908 MGC23908 Hs.93748N73741 0.0127 185 -1 1 Hypothetical protein DKFZp761P1121 DKFZp761P112 Hs.350243T49898 0.0151 185 -1 1 Bladder cancer associated protein BLCAP Hs.5300R40176 0.0165 185 1 1 Chemokine (C-X-C motif) ligand 14 CXCL14 Hs.24395W04808 0.0127 186 1 1 - - Hs.16346R72846 0.0233 186 1 1 Branched chain alpha-ketoacid dehydrogenase kinase BCKDK Hs.20644N27828 0.0173 187 -1 1 Sentrin/SUMO-specific protease SENP7 Hs.30443AA046891 0.0138 188 -1 1 Defender against cell death 1 DAD1 Hs.82890N45678 0.0145 188 -1 1 CDC26 subunit of anaphase promoting complex CDC26 Hs.3991T87973 0.0224 189 1 1 - - Hs.332988R18948 0.0233 189 1 1 Cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa CRSP2 Hs.21586N47294 0.0173 190 -1 1 - - Hs.350001N42184 0.0165 192 -1 1 Hypothetical protein BC013073 LOC92703 Hs.17481H58362 0.0121 194 1 1 Adaptor-related protein complex 2, beta 1 subunit AP2B1 Hs.74626N36888 0.0224 196 -1 1 DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae) DCLRE1A Hs.1560AA005369 0.0287 196 1 1 KIAA1270 protein KIAA1270 Hs.197668W31281 0.0145 197 -1 1 - - Hs.182036R41888 0.018 198 1 1 - - -AA027986 0.0197 198 -1 1 Protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform PPP2CB Hs.80350N90947 0.0165 199 -1 1 - - -N91450 0.0173 199 -1 1 - - Hs.141003AA142967 0.0233 200 -1 1 Uncharacterized hematopoietic stem/progenitor cells protein MDS029 MDS029 Hs.43549H03208 0.0461 200 1 1 Mitotic control protein dis3 homolog DIS3 Hs.323346H73928 0.0365 201 -1 1 Protein translocation complex beta SEC61B Hs.77028N32500 0.0243 203 -1 1 ESTs ESTs Hs.170277H83405 0.018 204 1 1 Faciogenital dysplasia (Aarskog-Scott syndrome) FGD1 Hs.1572H18868 0.018 205 1 1 Ribonucleotide reductase M2 B (TP53 inducible) RRM2B Hs.94262W92051 0.0151 206 -1 1 ESTs ESTs Hs.58694AA015841 0.0224 206 1 1 Guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1 GNGT1 Hs.73112N20541 0.0411 206 -1 1 Cadherin 1, type 1, E-cadherin (epithelial) CDH1 Hs.194657AA005173 0.0173 208 -1 1 Hypothetical protein FLJ21144 FLJ21144 Hs.59584W73717 0.0188 208 -1 1 V-raf-1 murine leukemia viral oncogene homolog 1 RAF1 Hs.349650T79713 0.0214 208 1 1 SET binding factor 1 SBF1 Hs.112049H70971 0.0145 209 -1 1 - - -W68672 0.0197 209 -1 1 RAB, member of RAS oncogene family-like 2B RABL2B Hs.355874W88468 0.0205 209 1 1 Hypothetical protein MGC20781 MGC20781 Hs.237536N69475 0.0127 210 -1 1 Mitochondrial ribosomal protein L48 MRPL48 Hs.82389T78823 0.0197 210 1 1 Hypothetical protein MGC5149 MGC5149 Hs.284741R37665 0.0243 211 1 1 Pescadillo homolog 1, containing BRCT domain (zebrafish) PES1 Hs.13501W58698 0.0264 211 -1 1 - - Hs.63236H71793 0.0151 212 1 1 X-box binding protein 1 XBP1 Hs.149923AA135452 0.0324 213 -1 1 CGG triplet repeat binding protein 1 CGGBP1 Hs.86041R71157 0.0264 217 1 1 Hypothetical protein FLJ10759 FLJ10759 Hs.15921H90534 0.0287 217 -1 1 Adaptor-related protein complex 4, beta 1 subunit AP4B1 Hs.28298H20853 0.0224 218 -1 1 - - Hs.288862R55959 0.0243 218 1 1 KIAA1091 protein KIAA1091 Hs.26797H17078 0.0205 219 1 1 Core-binding factor, runt domain, alpha subunit 2; translocated to, 2 CBFA2T2 Hs.153934R38809 0.0254 221 1 1 ESTs ESTs Hs.13420H11054 0.0254 223 1 1 Protein kinase C, delta PRKCD Hs.155342T78696 0.0264 223 1 1 GS3955 protein GS3955 Hs.155418N25614 0.0287 223 -1 1 - - Hs.270725AA126700 0.0324 224 -1 1 Nucleolar and coiled-body phosphoprotein 1 NOLC1 Hs.75337AA039224 0.0197 225 -1 1 Hypothetical protein MGC14817 MGC14817 Hs.124813H15638 0.0243 225 1 1 Solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11 SLC25A11 Hs.184877N99127 0.0138 227 -1 1 Hypothetical protein MGC5540 MGC5540 Hs.267400W68490 0.0264 227 -1 1 TAF9-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa TAF9L Hs.171723AA128472 0.0188 228 -1 1 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 GNAI3 Hs.73799R53544 0.0214 228 1 1 - - Hs.4285R54089 0.0158 230 1 1 Solute carrier family 19 (folate transporter), member 1 SLC19A1 Hs.84190H14085 0.0127 231 1 1 Transmembrane 4 superfamily member tetraspan NET-5 NET-5 Hs.129826H26559 0.0214 231 1 1 TGFB1-induced anti-apoptotic factor 1 TIAF1 Hs.75822R75921 0.0233 232 1 1 Serologically defined breast cancer antigen 84 SDBCAG84 Hs.169992H70044 0.0287 233 -1 1 Calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma CAMK2G Hs.12436N41921 0.0287 233 -1 1 - - Hs.33264N52383 0.0243 235 -1 1 Hypothetical protein FLJ20079 FLJ20079 Hs.165948AA041262 0.0275 235 1 1 KIAA1228 protein KIAA1228 Hs.306867W60704 0.0287 235 -1 1 Hypothetical protein FLJ20312 FLJ20312 Hs.7862T96535 0.0243 236 1 1 Zinc finger protein 278 ZNF278 Hs.27801H62271 0.0287 236 1 1 D11lgp1e-like LGP1 Hs.38039R76298 0.0197 238 1 1 Heat shock transcription factor 1 HSF1 Hs.1499T87794 0.0365 238 1 1 - - -N90789 0.038 238 1 1 Membrane component, chromosome 11, surface marker 1 M11S1 Hs.278672R22893 0.0395 238 1 1 Synaptosomal-associated protein, 23kDa SNAP23 Hs.184376R56756 0.018 239 1 1 Hypothetical protein FLJ20422 FLJ20422 Hs.26570AA054522 0.038 242 -1 1 Similar to triple functional domain (PTPRF interacting) LOC115557 Hs.61581

R36709 0.0275 243 1 1 Over-expressed breast tumor protein OBTP Hs.347297R68948 0.0145 244 1 1 Calumenin CALU Hs.7753T66879 0.0243 244 1 1 Hypothetical protein LOC54103 LOC54103 Hs.12969H87311 0.018 246 1 1 Excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antiseERCC1 Hs.59544H43602 0.0224 246 1 1 Chondroitin 4-O-sulfotransferase 2 C4S-2 Hs.25204R20810 0.0311 246 1 1 Topoisomerase (DNA) I TOP1 Hs.317T99761 0.038 246 1 1 Programmed cell death 8 (apoptosis-inducing factor) PDCD8 Hs.18720W61132 0.0173 247 1 1 - - Hs.301226R38922 0.0214 247 1 1 High-mobility group protein 2-like 1 HMG2L1 Hs.92260AA150397 0.0224 247 -1 1 - - -N70274 0.0287 247 1 1 CGI-87 protein LOC51112 Hs.5008R28554 0.0337 248 -1 1 Hypothetical protein DKFZp313A2432 DKFZp313A2432Hs.349096R93042 0.0243 250 1 1 - - -AA047414 0.0337 250 -1 1 Lactate dehydrogenase A LDHA Hs.2795AA099585 0.0214 252 -1 1 Phosphodiesterase 7B PDE7B Hs.283016AA029775 0.0351 252 -1 1 Lung cancer candidate FUS1 Hs.8186R67103 0.0444 252 1 1 Bone morphogenetic protein 6 BMP6 Hs.285671AA041349 0.0427 253 -1 1 Macrophage erythroblast attacher MAEA Hs.20815R59227 0.0233 254 1 1 KIAA0365 gene product KIAA0365 Hs.190452T81712 0.0411 254 1 1 Defensin, alpha 1, myeloid-related sequence DEFA1 Hs.274463N92363 0.0287 256 -1 1 Ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) UBE2I Hs.84285H02915 0.0311 256 1 1 Trans-activated by hepatitis C virus core protein 1 TAHCCP1 Hs.118087R45681 0.0233 257 1 1 TRAF and TNF receptor-associated protein AD022 Hs.46847H73751 0.0337 257 -1 1 Mitogen-activated protein kinase kinase kinase 6 MAP3K6 Hs.194694AA034395 0.038 257 -1 1 Protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1 PIN1 Hs.161362R51179 0.0224 258 1 1 - - -W85882 0.0395 258 -1 1 Hypothetical protein FLJ10349 FLJ10349 Hs.19333N63791 0.0444 258 -1 1 - - Hs.355772AA149333 0.0287 260 -1 1 Actinin, alpha 1 ACTN1 Hs.119000H39162 0.0299 261 1 1 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha) AGPAT1 Hs.240534N79649 0.018 262 -1 1 C21orf19-like protein LOC51072 Hs.20814W37878 0.0287 263 -1 1 - - Hs.294142H46056 0.0224 264 1 1 Radixin RDX Hs.263671N93218 0.0299 264 -1 1 Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein ID2 Hs.180919H84657 0.0365 264 1 1 Glutamate rich WD repeat protein GRWD GRWD Hs.218842T66745 0.0497 264 -1 1 Mitochondrial glutamate carrier 1 GC1 Hs.99486H03098 0.0264 265 1 1 - - -R84453 0.0224 266 -1 1 DKFZP586F1524 protein DKFZP586F152 Hs.241543N41672 0.0254 266 -1 1 Adenylyl cyclase-associated protein CAP Hs.104125R71970 0.0324 266 1 1 Retinoic acid receptor, alpha RARA Hs.250505AA016242 0.0536 266 -1 1 Splicing factor, arginine/serine-rich 2 SFRS2 Hs.73965H39095 0.0264 269 1 1 Cell cycle progression 2 protein CPR2 Hs.347349N54526 0.0365 273 -1 1 KIAA1979 protein KIAA1979 Hs.352638R52017 0.0275 274 1 1 Uncharacterized bone marrow protein BM036 BM036 Hs.7731H53288 0.0395 276 1 1 BCL2-associated athanogene 4 BAG4 Hs.194726AA115939 0.0427 276 1 1 Capping protein (actin filament) muscle Z-line, alpha 2 CAPZA2 Hs.75546H00120 0.0311 277 1 1 - - -R69581 0.0716 277 1 1 PRO1914 protein PRO1914 Hs.5327N59231 0.0243 278 -1 1 Pyruvate carboxylase PC Hs.89890AA150891 0.0479 278 -1 1 SET domain-containing protein 7 SET7 Hs.78521H06739 0.0254 281 1 1 Collagen, type V, alpha 2 COL5A2 Hs.82985H29857 0.0275 283 1 1 Transducer of ERBB2, 1 TOB1 Hs.178137H28168 0.0351 283 1 1 Centaurin, gamma 3 CENTG3 Hs.286084N29431 0.0461 284 -1 1 NEDD8 ultimate buster-1 LOC51667 Hs.279780H97361 0.0516 284 1 1 - - Hs.36258H94541 0.0411 285 -1 1 Chromosome 20 open reading frame 64 C20orf64 Hs.282990N24689 0.0643 286 1 1 - - Hs.372542H19719 0.0479 287 1 1 Gemin 5 GEMIN5 Hs.25882N72697 0.0395 288 -1 0.93 Hypothetical protein FLJ10604 FLJ10604 Hs.26516R56381 0.0556 288 1 1 Hypothetical protein FLJ14775 FLJ14775 Hs.334878T92246 0.0287 289 -1 1 Hypothetical protein FLJ20265 FLJ20265 Hs.7099N70500 0.0299 289 -1 1 KIAA0842 protein KIAA0842 Hs.74569N24364 0.0311 290 -1 1 Hypothetical protein FLJ13154 FLJ13154 Hs.25303AA056695 0.0395 290 -1 1 Tight junction protein 2 (zona occludens 2) TJP2 Hs.75608N21545 0.0536 290 -1 1 KIAA1033 protein KIAA1033 Hs.12144N45464 0.0395 291 -1 1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1 SMARCAL1 Hs.16933T75394 0.0536 293 1 1 Eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa EIF2B3 Hs.283627R56010 0.0254 294 1 1 HIRA interacting protein 3 HIRIP3 Hs.26484N35485 0.0497 295 -1 1 MAD1 mitotic arrest deficient-like 1 (yeast) MAD1L1 Hs.7345AA034009 0.0311 296 -1 1 Outer dense fibre of sperm tails 2 ODF2 Hs.129055H51380 0.0536 296 1 0.93 P450 (cytochrome) oxidoreductase POR Hs.167246R34801 0.0716 296 1 1 TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa TAF2 Hs.122752R34696 0.0351 297 1 1 - - -H77593 0.0643 298 -1 1 CDA017 protein CDA017 Hs.39780N21648 0.0243 299 -1 1 MpV17 transgene, murine homolog, glomerulosclerosis MPV17 Hs.75659W03386 0.0254 301 -1 1 - - Hs.29808H90643 0.0287 301 -1 1 - - -AA031495 0.0691 302 -1 0.93 Peptidylprolyl isomerase E (cyclophilin E) PPIE Hs.33251H00846 0.0299 303 1 1 Chromosome 11 hypothetical protein ORF4 LOC56834 Hs.25274W78790 0.0667 305 1 1 TNF receptor-associated factor 4 TRAF4 Hs.8375H97357 0.0667 305 -1 1 - - Hs.227699AA213820 0.0427 307 -1 1 - - Hs.256533W42446 0.0287 309 -1 1 NICE-5 protein HSA243666 Hs.337078R35007 0.0287 309 -1 1 - - -AA043510 0.0395 309 -1 1 Nm23-phosphorylated unknown substrate MGC15437 Hs.55067R12987 0.0264 310 1 1 - - -R12743 0.0287 310 1 1 KIAA1131 protein KIAA1131 Hs.210850N62491 0.0299 310 -1 1 Folate hydrolase (prostate-specific membrane antigen) 1 FOLH1 Hs.1915H97136 0.0598 310 -1 1 CGI-41 protein LOC51093 Hs.5056H38703 0.0351 313 -1 1 Hypothetical protein FLJ10512 FLJ10512 Hs.93581H93167 0.0516 313 -1 1 KIAA0332 protein KIAA0332 Hs.7976N20579 0.062 314 -1 1 Proteasome (prosome, macropain) 26S subunit, ATPase, 2 PSMC2 Hs.61153N30625 0.0287 315 -1 1 - - Hs.44205N63825 0.0577 315 -1 1 Ras homolog gene family, member G (rho G) ARHG Hs.75082AA058632 0.0427 318 -1 1 Kinesin family member 1B KIF1B Hs.375193AA039452 0.0365 319 -1 1 YY1 transcription factor YY1 Hs.97496N43796 0.0479 319 -1 1 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 ATP6V0D1 Hs.106876AA130095 0.062 320 -1 1 Hypothetical protein FLJ21749 FLJ21749 Hs.288761W04645 0.0768 320 -1 1 ESTs ESTs Hs.322915W37084 0.0556 321 -1 1 Hypothetical protein FLJ14743 FLJ14743 Hs.169577

H72575 0.0299 324 1 1 Ninein (GSK3B interacting protein) NIN Hs.44054R50403 0.0691 326 1 1 Chromosome 20 open reading frame 188 C20orf188 Hs.168073N36411 0.0411 327 -1 1 ESTs ESTs Hs.44754T79660 0.0598 327 1 1 - - Hs.14600N63795 0.0479 328 -1 1 ESTs ESTs Hs.355467T87912 0.0479 328 -1 1 - - Hs.16478AA045207 0.0536 328 -1 1 Actin related protein 2/3 complex, subunit 5, 16kDa ARPC5 Hs.82425AA043906 0.0351 329 -1 1 ESTs ESTs Hs.367688T83255 0.0351 330 1 1 Zinc finger protein 106 ZFP106 Hs.15220N92218 0.0411 330 -1 1 KIAA1598 protein KIAA1598 Hs.23740W47177 0.0577 330 -1 1 GCN5 general control of amino-acid synthesis 5-like 1 (yeast) GCN5L1 Hs.94672N92370 0.062 331 -1 1 6-pyruvoyl-tetrahydropterin synthase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) PCBD Hs.3192R50163 0.0667 331 1 1 Hypothetical protein similar to beta-transducin family FLJ10458 Hs.85570AA136073 0.0395 332 -1 1 Hypothetical protein FLJ36888 FLJ36888 Hs.103845H93335 0.0823 332 -1 1 Zinc finger protein, subfamily 1A, 4 (Eos) ZNFN1A4 Hs.302031AA047135 0.0427 333 -1 1 Ribonuclease/angiogenin inhibitor RNH Hs.75108R31309 0.0556 333 1 1 MAP-kinase activating death domain MADD Hs.82548H20726 0.0351 334 1 1 Casein kinase 2, beta polypeptide CSNK2B Hs.165843W61360 0.0365 335 -1 1 Hypothetical protein MGC15563 MGC15563 Hs.64552AA194944 0.0427 335 1 1 - - -R51875 0.0536 335 1 1 Breakpoint cluster region BCR Hs.234799R28281 0.0536 337 -1 1 - - -AA131566 0.0365 338 -1 1 Fatty-acid-Coenzyme A ligase, long-chain 2 FACL2 Hs.154890R53567 0.038 338 1 1 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble) HMGCS1 Hs.77910N93443 0.0275 339 -1 1 Ubiquitin protein ligase UBE3B Hs.17639N44152 0.0516 339 -1 1 Hypothetical protein HSPC196 HSPC196 Hs.22546N63830 0.0556 339 -1 0.93 - - Hs.6127W46553 0.0667 339 -1 1 Hypothetical protein FLJ38984 FLJ38984 Hs.112023H87044 0.038 340 1 1 Translocase of inner mitochondrial membrane 22 homolog (yeast) TIMM22 Hs.87595W58176 0.0427 340 -1 1 ATPase, H+ transporting, lysosomal 21kDa, V0 subunit c'' ATP6V0B Hs.7476AA101859 0.0516 340 -1 1 Endosulfine alpha ENSA Hs.111680H26555 0.0516 340 -1 1 Protein phosphatase 1, regulatory subunit 7 PPP1R7 Hs.36587H96308 0.0365 341 -1 1 - - Hs.58210AA136060 0.0497 341 -1 1 Hypothetical protein MGC16202 MGC16202 Hs.246914N49623 0.0516 341 -1 1 Hypothetical protein AL133206 LOC64744 Hs.7750R40400 0.0598 341 1 1 Cell adhesion molecule with homology to L1CAM (close homolog of L1) CHL1 Hs.210863W47334 0.0254 342 -1 1 Hypothetical protein MGC5560 MGC5560 Hs.233150T96059 0.0444 344 1 1 Uterine-derived 14 kDa protein LOC64150 Hs.173780N58731 0.0444 345 -1 1 - - -W15280 0.0275 346 -1 1 Chromosome 9 open reading frame 5 C9orf5 Hs.86412H94177 0.0337 346 -1 1 High-mobility group nucleosomal binding domain 2 HMGN2 Hs.181163N50370 0.0287 349 -1 1 - - Hs.178485R53566 0.0351 350 1 1 - - Hs.184779R42536 0.0536 350 1 1 Dachshund homolog (Drosophila) DACH Hs.63931R85099 0.0577 350 1 1 ADP-ribosylation factor 3 ARF3 Hs.119177H23370 0.0461 351 1 1 RAB22A, member RAS oncogene family RAB22A Hs.288968R85666 0.0556 353 1 1 KIAA1634 protein KIAA1634 Hs.49169AA204664 0.0324 354 -1 1 SMC1 structural maintenance of chromosomes 1-like 2 (yeast) SMC1L2 Hs.182437R52048 0.0337 354 1 1 Upstream regulatory element binding protein 1 UREB1 Hs.3383H03079 0.0427 354 -1 1 Hypothetical protein FLJ21156 FLJ21156 Hs.26058R68168 0.0577 354 1 1 MRNA decapping enzyme DCPS Hs.279900AA029926 0.0243 355 1 1 - - Hs.351292R45593 0.0427 355 1 1 FLN29 gene product FLN29 Hs.5148N66188 0.0444 355 -1 1 Splicing factor, arginine/serine-rich 2 SFRS2 Hs.73965R55180 0.0497 355 1 1 Muskelin 1, intracellular mediator containing kelch motifs MKLN1 Hs.288791W60936 0.0299 356 -1 1 Tripartite motif-containing 8 TRIM8 Hs.54580AA039447 0.0768 356 -1 1 Suppressor of fused homolog (Drosophila) SUFU Hs.21431R36089 0.0479 357 1 1 Nuclear receptor subfamily 2, group F, member 6 NR2F6 Hs.239752AA147549 0.038 359 -1 1 KIAA1999 protein KIAA1999 Hs.9343AA043477 0.0427 359 -1 1 Zinc finger protein 36, C3H type, homolog (mouse) ZFP36 Hs.343586AA031564 0.0536 360 -1 1 - - Hs.221255W06829 0.0497 361 -1 1 - - Hs.356718R26222 0.0536 361 1 0.93 - - Hs.379149R78049 0.038 362 1 1 DKFZP566I1024 protein DKFZP566I1024Hs.279696AA054948 0.0444 363 -1 1 - - Hs.61307W15295 0.0497 363 -1 1 BCL2-associated athanogene 5 BAG5 Hs.5443AA011445 0.0497 364 -1 1 Caspase 3, apoptosis-related cysteine protease CASP3 Hs.74552N93302 0.1113 364 -1 0.93 Hypothetical protein MGC4549 MGC4549 Hs.326422H66700 0.0351 365 1 1 Hypothetical protein FLJ20758 FLJ20758 Hs.274248R13936 0.0411 366 1 1 Deoxyhypusine synthase DHPS Hs.79064H16934 0.0536 367 1 1 Zinc finger protein 278 ZNF278 Hs.27801R97690 0.1225 367 -1 1 Limkain beta 2 FLJ22471 Hs.288909R50246 0.0365 368 1 1 - - Hs.351469R19117 0.0395 369 1 1 ESTs ESTs Hs.169142H21835 0.0427 369 1 1 - - -R14816 0.0461 369 1 1 - - -W37381 0.0411 370 -1 1 Splicing factor, arginine/serine-rich 2 SFRS2 Hs.73965H50517 0.0427 370 1 1 Gamma-aminobutyric acid (GABA) B receptor, 1 GABBR1 Hs.167017T86392 0.0444 370 1 1 Dynein, cytoplasmic, heavy polypeptide 1 DNCH1 Hs.7720T95699 0.0461 370 1 1 Chromosome 11 hypothetical protein ORF4 LOC56834 Hs.25274AA195600 0.0643 370 -1 1 Follistatin FST Hs.9914W37098 0.0337 371 -1 1 Fukuyama type congenital muscular dystrophy (fukutin) FCMD Hs.55777AA137082 0.0823 371 -1 1 - - Hs.351869N50369 0.0444 372 1 1 Nijmegen breakage syndrome 1 (nibrin) NBS1 Hs.25812AA029842 0.0516 372 -1 1 Mature T-cell proliferation 1 MTCP1 Hs.3548H73971 0.038 374 -1 1 ESTs ESTs Hs.53455AA010033 0.0395 375 -1 1 CDNA FLJ00103 FLJ00103 Hs.380465R74076 0.038 376 1 1 Hypothetical protein FLJ30656 FLJ30656 Hs.349887H27344 0.0395 376 -1 1 Hypothetical protein MGC5338 MGC5338 Hs.99598T66784 0.0411 376 1 1 Zinc-fingers and homeoboxes 1 ZHX1 Hs.12940AA044632 0.1113 377 -1 1 - - -W65276 0.0852 378 1 1 Hypothetical protein FLJ10900 FLJ10900 Hs.16277T80134 0.0427 379 1 1 Tubulin-specific chaperone d TBCD Hs.12570H47146 0.0444 379 1 1 Excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antiseERCC1 Hs.59544H93200 0.0497 380 -1 1 ESTs ESTs Hs.269052H45907 0.0411 381 1 1 - - -R74161 0.0556 381 1 1 Phosphorylase, glycogen; liver (Hers disease, glycogen storage disease type VI) PYGL Hs.771N63319 0.0299 383 1 1 Protein tyrosine phosphatase, receptor type, A PTPRA Hs.26045W38759 0.0365 383 -1 1 - - Hs.356739AA040219 0.0577 383 -1 1 Nuclear transcription factor Y, gamma NFYC Hs.168157

W88821 0.0795 383 -1 1 - - Hs.288924R62973 0.0577 384 -1 1 Hypothetical protein MGC4796 MGC4796 Hs.21396AA114976 0.0912 385 -1 0.87 Tenascin XB TNXB Hs.169886R43900 0.0577 388 1 1 Calcineurin binding protein 1 CABIN1 Hs.7840H42146 0.0365 390 -1 1 Inositol polyphosphate-5-phosphatase, 40kDa INPP5A Hs.124029AA046359 0.0395 391 -1 1 Protein predicted by clone 23882 HSU79303 Hs.82482H03156 0.0351 392 1 1 Glutamine-fructose-6-phosphate transaminase 1 GFPT1 Hs.1674T66813 0.038 392 -1 1 - EST Hs.12947N29706 0.0497 392 -1 1 Hypothetical protein FLJ10587 FLJ10587 Hs.7296R64091 0.0742 392 -1 1 ESTs ESTs Hs.28482W04611 0.0351 394 -1 1 Hypothetical protein FLJ22794 FLJ22794 Hs.19525R31115 0.038 394 1 1 Polymerase (RNA) mitochondrial (DNA directed) POLRMT Hs.153880H90918 0.0598 394 -1 0.93 KIAA0368 protein KIAA0368 Hs.3852R28329 0.0365 395 1 1 Hypothetical protein MGC16063 MGC16063 Hs.288544N45541 0.0556 395 -1 1 Adenosine kinase ADK Hs.94382H00845 0.0395 396 -1 1 Mitochondrial ribosomal protein L33 MRPL33 Hs.14454W31516 0.0516 396 -1 1 - - Hs.7000W32115 0.0577 396 -1 1 Cryptochrome 1 (photolyase-like) CRY1 Hs.151573AA028144 0.1008 397 -1 0.87 BCS1-like (yeast) BCS1L Hs.150922AA099137 0.0444 398 -1 1 Clathrin, light polypeptide (Lca) CLTA Hs.104143T75481 0.1042 398 1 0.93 Ras responsive element binding protein 1 RREB1 Hs.171942T96934 0.062 399 1 1 Exportin 5 XPO5 Hs.9805AA101862 0.0643 399 -1 1 Source of immunodominant MHC-associated peptides SIMP Hs.183454T84038 0.0427 400 1 1 POU domain, class 2, transcription factor 1 POU2F1 Hs.182237R00170 0.0643 400 1 1 Bifunctional apoptosis regulator BFAR Hs.168159H10393 0.0395 401 1 1 Hypothetical protein FLJ13117 FLJ13117 Hs.152982N24109 0.0577 401 -1 1 Annexin A11 ANXA11 Hs.75510H49910 0.0943 401 -1 0.93 Insulin-like growth factor binding protein 7 IGFBP7 Hs.119206H62189 0.0497 403 1 1 Elongator protein 2 ELP2 Hs.8739AA142937 0.0516 403 -1 1 Claudin 10 CLDN10 Hs.26126H79507 0.0768 404 -1 1 - - -R49307 0.0556 405 1 1 Formin 2 FMN2 Hs.24889N66251 0.038 407 1 1 - - -W63760 0.0479 407 -1 1 Coilin COIL Hs.966R66209 0.0882 408 -1 1 Synaptosomal-associated protein, 29kDa SNAP29 Hs.194714N49880 0.0598 409 -1 1 RAS p21 protein activator (GTPase activating protein) 1 RASA1 Hs.758N30285 0.0395 410 -1 1 FUS interacting protein (serine-arginine rich) 1 FUSIP1 Hs.3530W31524 0.0461 410 -1 1 - - Hs.95262AA054503 0.0479 410 -1 1 - - -R28236 0.0768 410 -1 1 Hypothetical protein MGC12217 MGC12217 Hs.288193W52126 0.038 411 -1 1 - - -R26919 0.1042 411 1 0.93 Down syndrome critical region gene 1-like 2 DSCR1L2 Hs.129319AA047382 0.0411 412 -1 1 Clathrin, light polypeptide (Lcb) CLTB Hs.380749AA059202 0.0536 412 -1 1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) GALNT7 Hs.246315N34004 0.062 412 -1 1 Signal transducer and activator of transcription 6, interleukin-4 induced STAT6 Hs.181015N25611 0.0598 413 -1 1 ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) ACTR1A Hs.153961N39233 0.0691 413 -1 1 - - Hs.44976N33577 0.0912 413 -1 1 - - Hs.24359R05282 0.0516 416 -1 1 ESTs ESTs Hs.272116H38541 0.0577 416 1 1 CCR4-NOT transcription complex, subunit 3 CNOT3 Hs.343571AA056740 0.1225 416 1 1 Heterogeneous nuclear ribonucleoprotein K HNRPK Hs.129548AA120872 0.0716 417 1 1 - - Hs.27552R73175 0.0427 418 1 1 Leucine-zipper-like transcriptional regulator, 1 LZTR1 Hs.78788R53743 0.0444 418 1 1 Ankyrin 3, node of Ranvier (ankyrin G) ANK3 Hs.75893R45669 0.0497 418 1 1 MORF-related gene 15 MRG15 Hs.6353R17720 0.0577 420 1 1 ESTs ESTs Hs.13287R93685 0.0643 420 1 1 Werner helicase interacting protein WHIP Hs.236828AA044954 0.0598 421 -1 1 Tight junction protein 2 (zona occludens 2) TJP2 Hs.75608W68614 0.0667 422 -1 1 DnaJ (Hsp40) homolog, subfamily B, member 12 DNAJB12 Hs.7960N74698 0.0823 422 -1 0.87 ESTs ESTs Hs.114536H08164 0.0598 423 1 0.93 KIAA1265 protein KIAA1265 Hs.355925H12750 0.0667 423 1 1 - - -N70020 0.1077 423 -1 1 - - Hs.272034R71067 0.0444 425 1 1 Low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor) LRP1 Hs.89137R52315 0.0479 425 1 1 Oculocutaneous albinism II (pink-eye dilution homolog, mouse) OCA2 Hs.82027W47128 0.0598 425 -1 1 Cyclin-dependent kinase 9 (CDC2-related kinase) CDK9 Hs.150423R67243 0.038 426 1 1 Chromosome 20 open reading frame 99 C20orf99 Hs.28608AA047640 0.0479 426 -1 1 Dolichyl-phosphate mannosyltransferase polypeptide 3 DPM3 Hs.110477R17665 0.0691 426 1 1 COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) COPS5 Hs.198767H43477 0.1077 426 1 0.87 PCF11p homolog PCF11 Hs.123654N43796 0.0411 427 -1 1 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 ATP6V0D1 Hs.106876H12151 0.0497 427 1 1 Phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazolGART Hs.82285T72620 0.0516 427 1 1 ESTs ESTs Hs.117915R63546 0.0556 427 1 0.93 KIAA1728 protein KIAA1728 Hs.252748H30758 0.0643 428 1 1 Glucose phosphate isomerase GPI Hs.279789N64271 0.0577 429 -1 1 - - -R89061 0.062 429 1 1 Hypothetical protein MGC12909 MGC12909 Hs.33862AA203162 0.0598 430 -1 1 - - -H09002 0.038 431 1 1 ESTs ESTs Hs.170267N36387 0.0556 431 -1 1 ESTs ESTs Hs.93813AA007617 0.1225 431 1 0.93 Hypothetical protein AD034 AD034 Hs.281397W33159 0.0768 432 -1 1 Phospholipase C, beta 1 (phosphoinositide-specific) PLCB1 Hs.41143T95778 0.0882 432 -1 0.93 SH3-domain binding protein 4 SH3BP4 Hs.17667R77028 0.0943 432 1 0.93 Lymphotoxin beta receptor (TNFR superfamily, member 3) LTBR Hs.1116T77325 0.0691 433 -1 1 Polycystic kidney disease 2 (autosomal dominant) PKD2 Hs.82001R77424 0.0691 436 1 1 - - -W57953 0.0497 437 -1 1 V-raf-1 murine leukemia viral oncogene homolog 1 RAF1 Hs.349650R54445 0.0427 438 1 1 HSPC189 protein HSPC189 Hs.20768T84046 0.0497 438 1 1 - - Hs.372951R48060 0.0395 440 1 1 DKFZP564O243 protein DKFZP564O243Hs.92700N24030 0.0556 440 -1 1 Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma IKBKG Hs.43505AA037763 0.0598 440 -1 1 WAS protein family, member 2 WASF2 Hs.288908R28109 0.0577 441 1 1 Single stranded DNA binding protein 4 SSBP4 Hs.324618AA053304 0.0976 441 -1 1 Hypothetical protein BC017169 LOC91137 Hs.75639T98226 0.0598 442 -1 1 Tropomyosin 4 TPM4 Hs.250641R26509 0.0742 442 -1 1 Platelet-derived growth factor receptor, beta polypeptide PDGFRB Hs.76144T81220 0.062 443 1 1 - - -N74710 0.0536 444 -1 1 Signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 STAM Hs.153487AA203677 0.0768 444 -1 1 - - -R53559 0.0742 447 1 1 Non-metastatic cells 1, protein (NM23A) expressed in NME1 Hs.118638

AA039649 0.0691 448 -1 1 Hypothetical protein FLJ10743 FLJ10743 Hs.3376H03532 0.0461 449 -1 1 Discs, large (Drosophila) homolog 5 DLG5 Hs.170290R13557 0.0598 450 -1 1 Replication protein A2, 32kDa RPA2 Hs.79411H89739 0.0716 450 -1 0.93 ESTs ESTs Hs.114280H08480 0.0823 450 1 1 MDS024 protein MDS024 Hs.286122H00122 0.0643 451 1 1 - - -R78627 0.0497 452 1 1 - - Hs.23240R52542 0.0643 452 1 1 IMP (inosine monophosphate) dehydrogenase 1 IMPDH1 Hs.850R39264 0.1077 452 1 1 Mitotic phosphoprotein 44 LOC129401 Hs.180591N71361 0.1187 452 -1 1 ESTs ESTs Hs.50019R49537 0.0497 453 1 1 Met proto-oncogene (hepatocyte growth factor receptor) MET Hs.285754R96161 0.0516 453 -1 1 - - -N36043 0.0497 454 -1 1 Hypothetical protein FLJ10597 FLJ10597 Hs.90375W85901 0.0716 454 -1 1 Eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa EIF2S2 Hs.12163H15553 0.0536 455 1 1 COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) COX10 Hs.77513H47425 0.0716 457 -1 1 Proteolipid protein 2 (colonic epithelium-enriched) PLP2 Hs.77422AA010187 0.062 458 -1 1 Pericentrin 2 (kendrin) PCNT2 Hs.15896H50240 0.0643 459 1 1 - - Hs.250879W37617 0.0667 459 -1 1 Transmembrane 7 superfamily member 1 (upregulated in kidney) TM7SF1 Hs.15791W44318 0.0427 460 -1 1 Mitogen-activated protein kinase 1 MAPK1 Hs.324473R73412 0.0536 461 1 1 NS1-associated protein 1 NSAP1 Hs.46801R20452 0.062 461 -1 0.93 Calpain 10 CAPN10 Hs.112218N26506 0.0795 462 -1 1 Ribosomal protein S17 RPS17 Hs.5174W74523 0.0395 463 -1 1 Aldo-keto reductase family 1, member A1 (aldehyde reductase) AKR1A1 Hs.89529H81036 0.0536 463 -1 1 Hypothetical protein FLJ22059 FLJ22059 Hs.13323AA210734 0.062 463 -1 1 ESTs ESTs Hs.291386N20517 0.0556 464 -1 0.93 Hypothetical protein DKFZp434A1319 DKFZP434A131 Hs.307084W67797 0.0598 464 -1 0.93 Laminin, alpha 5 LAMA5 Hs.11669W49768 0.0643 466 -1 0.93 Interferon, alpha-inducible protein (clone IFI-6-16) G1P3 Hs.265827R31364 0.0556 467 1 1 - - Hs.128676H58445 0.0598 469 1 1 Nucleoporin 98kDa NUP98 Hs.112255H94111 0.062 469 -1 1 Tyrosylprotein sulfotransferase 2 TPST2 Hs.26350R69765 0.0716 469 1 1 Target of myb1 (chicken) TOM1 Hs.9482AA029451 0.0768 470 -1 1 Transcription factor 7-like 2 (T-cell specific, HMG-box) TCF7L2 Hs.348412R54435 0.0882 471 1 1 - - Hs.352614R61014 0.0716 472 1 0.93 Leucine-zipper-like transcriptional regulator, 1 LZTR1 Hs.78788R45198 0.0395 473 1 1 Hypothetical protein CDA08 CDA08 Hs.23047R52301 0.0444 473 1 1 - - Hs.302182N92254 0.0516 473 -1 1 Splicing factor, arginine/serine-rich 2 SFRS2 Hs.73965W52888 0.0912 473 -1 1 Serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 1 SERPINB1 Hs.183583W92014 0.0516 474 -1 1 Alcohol dehydrogenase 6 (class V) ADH6 Hs.76800H64513 0.0912 477 -1 0.93 - - -AA055938 0.0742 478 -1 1 Laminin, alpha 4 LAMA4 Hs.78672N93186 0.0882 479 1 1 Heme oxygenase (decycling) 2 HMOX2 Hs.284279H86876 0.0536 480 1 1 Heparan sulfate (glucosamine) 3-O-sulfotransferase 1 HS3ST1 Hs.40968R15291 0.0598 480 1 1 - - -AA130297 0.0768 481 -1 1 - - Hs.379757R88246 0.1077 481 -1 1 Adrenergic, beta, receptor kinase 1 ADRBK1 Hs.83636W00877 0.0444 483 -1 1 - - -H13698 0.0598 483 1 0.93 CGI-83 protein LOC51110 Hs.118554H49062 0.0742 483 -1 1 Hypothetical protein FLJ22056 FLJ22056 Hs.24956N44132 0.0852 483 -1 1 Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein ID2 Hs.180919N79042 0.0598 484 1 1 - - -AA147003 0.0577 485 -1 1 - - Hs.356291R34443 0.0768 485 1 1 - - Hs.4194W24393 0.1225 485 -1 0.93 Syntaxin 10 STX10 Hs.43812H89655 0.0768 486 -1 1 Hypothetical protein FLJ10607 similar to glucosamine-phosphate N-acetyltransferase FLJ10607 Hs.27931R60482 0.1389 486 -1 1 DNA methyltransferase 1-associated protein 1 DMAP1 Hs.8008W56466 0.0742 489 -1 0.93 ESTs ESTs Hs.130214AA151485 0.0823 489 -1 1 Insulin-like growth factor binding protein 7 IGFBP7 Hs.119206N24276 0.1389 489 -1 0.87 Transaldolase 1 TALDO1 Hs.77290H96619 0.0556 492 -1 1 Seven in absentia homolog 1 (Drosophila) SIAH1 Hs.295923N43860 0.0536 493 -1 1 Polymyositis/scleroderma autoantigen 1, 75kDa PMSCL1 Hs.91728H30227 0.0598 493 1 1 Putative mitochondrial solute carrier MRS3/4 Hs.326104H87262 0.0852 493 1 1 - - -AA055457 0.0882 495 -1 1 Down syndrome critical region gene 2 DSCR2 Hs.5198N28014 0.0768 496 -1 1 BRCA1 associated protein BRAP Hs.122764H06405 0.062 497 1 1 PCTAIRE protein kinase 1 PCTK1 Hs.171834R81742 0.0795 497 1 1 Solute carrier family 23 (nucleobase transporters), member 1 SLC23A1 Hs.82042N20373 0.0667 498 1 1 - - -W46155 0.0643 499 -1 1 - - Hs.355892N21515 0.1522 499 -1 0.8 Choline/ethanolaminephosphotransferase CEPT1 Hs.363572T79937 0.0643 500 1 1 Cutaneous T-cell lymphoma tumor antigen se70-2 SE70-2 Hs.39140N52622 0.1305 500 -1 0.93 General transcription factor IIH, polypeptide 1, 62kDa GTF2H1 Hs.89578AA047464 0.0768 501 -1 0.93 RAN binding protein 2 RANBP2 Hs.199179R66525 0.0768 501 1 1 - - Hs.99804W78924 0.0691 503 -1 1 HSPC142 protein HSPC142 Hs.6468W86640 0.0716 503 -1 1 Receptor (TNFRSF)-interacting serine-threonine kinase 1 RIPK1 Hs.296327H28053 0.0768 503 1 1 Down-regulated by Ctnnb1, a DRCTNNB1A Hs.85603R56028 0.0852 504 1 1 - - Hs.293407T65042 0.0643 505 1 1 - - -R13546 0.0795 506 1 1 Endothelial differentiation, sphingolipid G-protein-coupled receptor, 1 EDG1 Hs.154210AA046034 0.1113 506 -1 1 Retinoblastoma binding protein 1 RBBP1 Hs.380994H87204 0.0742 507 1 1 Cyclin-dependent kinase 5 CDK5 Hs.166071R01627 0.0852 511 1 1 Major histocompatibility complex, class II, DQ beta 1 HLA-DQB1 Hs.73931H13699 0.0691 512 1 1 ESTs ESTs Hs.171575R01529 0.1389 513 1 0.93 Interferon (alpha, beta and omega) receptor 2 IFNAR2 Hs.86958T99676 0.1113 514 1 1 Hypothetical protein MGC40405 MGC40405 Hs.193482AA044141 0.1225 515 1 1 Chromosome 20 open reading frame 98 C20orf98 Hs.286128AA211825 0.1265 516 -1 0.93 - - -H66279 0.0556 518 1 1 - - Hs.216226H53712 0.0912 518 1 1 Protein kinase C, delta PRKCD Hs.155342R62399 0.1265 520 1 0.93 Tetraspanin similar to TM4SF9 DC-TM4F2 Hs.101395R60159 0.0795 521 1 1 Topoisomerase (DNA) I TOP1 Hs.317N22841 0.0536 523 -1 1 Hypothetical protein MGC17943 MGC17943 Hs.106390N30234 0.0852 523 -1 1 Tripartite motif-containing 33 TRIM33 Hs.287414W58440 0.0691 524 -1 1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 B4GALT1 Hs.198248W67706 0.0556 526 -1 1 Natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B) NPR2 Hs.78518H40373 0.0795 526 1 1 S164 protein S164 Hs.180789T86358 0.0823 526 1 1 - - Hs.193931

H14291 0.0882 526 1 1 Amyloid beta (A4) precursor-like protein 1 APLP1 Hs.74565R90829 0.0742 527 1 1 Vascular endothelial growth factor B VEGFB Hs.78781H51393 0.0768 528 1 1 Transient receptor potential cation channel, subfamily V, member 2 TRPV2 Hs.279746H26802 0.1008 528 1 1 - - Hs.352614N27996 0.0643 529 -1 1 Hypothetical protein MGC26818 MGC26818 Hs.23765R16551 0.0667 529 -1 1 - - -N56633 0.0795 530 -1 0.97 Syntaxin 12 STX12 Hs.106823H22702 0.0912 530 1 1 Hypothetical protein MGC10540 MGC10540 Hs.108824H15059 0.0577 531 1 1 KIAA0582 protein KIAA0582 Hs.79507H26567 0.0643 532 -1 1 Bone morphogenetic protein 1 BMP1 Hs.1274W04643 0.0691 532 -1 1 Solute carrier family 17 (anion/sugar transporter), member 5 SLC17A5 Hs.117865AA033874 0.1113 532 -1 0.93 - - Hs.12035AA005070 0.0823 533 1 1 Hypothetical protein FLJ10890 FLJ10890 Hs.17283N50315 0.0768 534 -1 1 Pre-mRNA splicing SR protein rA4 KIAA1172 Hs.125134N67638 0.1149 535 -1 1 Disrupted in renal carcinoma 2 DIRC2 Hs.11360AA134878 0.0598 536 -1 1 KIAA0117 protein KIAA0117 Hs.322478W61184 0.062 536 -1 1 ATPase, Class VI, type 11B ATP11B Hs.75478N95220 0.0716 536 -1 1 Hypothetical protein MBC3205 MBC3205 Hs.43621AA001329 0.0598 537 -1 1 Cyclin A2 CCNA2 Hs.85137R20578 0.0976 538 1 1 ESTs ESTs Hs.90431AA194129 0.0912 539 -1 0.93 Hypothetical protein FLJ13102 FLJ13102 Hs.225160R51121 0.1042 539 1 0.93 KIAA1880 protein KIAA1880 Hs.100256H93203 0.0667 540 -1 1 Nesca protein NESCA Hs.226499AA057293 0.0691 541 1 1 Peptidylprolyl isomerase C (cyclophilin C) PPIC Hs.110364R05441 0.0556 542 1 1 MT-protocadherin KIAA1775 Hs.137556R56535 0.0823 542 -1 1 ESTs ESTs Hs.106672AA148461 0.0943 542 1 1 Hypothetical protein LOC51315 LOC51315 Hs.5721N51027 0.1008 542 -1 1 Hypothetical protein FLJ10420 FLJ10420 Hs.289087H82175 0.0691 543 1 1 Sialidase 1 (lysosomal sialidase) NEU1 Hs.118721N31564 0.0742 544 -1 1 - - Hs.111364N95196 0.0577 545 -1 1 Deoxyribonuclease II, lysosomal DNASE2 Hs.118243AA045668 0.0742 545 1 1 TRIAD3 protein TRIAD3 Hs.86228H16449 0.1042 545 1 1 Staufen, RNA binding protein (Drosophila) STAU Hs.6113N41715 0.0643 546 -1 1 Hypothetical protein FLJ11294 FLJ11294 Hs.107000AA031407 0.0667 546 1 1 ESTs ESTs Hs.303016AA035451 0.1113 546 -1 0.93 - - Hs.295963N92570 0.0577 547 -1 1 Uncharacterized bone marrow protein BM042 BM042 Hs.324136R87400 0.0667 548 1 1 Butyrophilin, subfamily 2, member A1 BTN2A1 Hs.169963T75252 0.0742 548 1 1 Hypothetical protein DKFZp434B195 DKFZP434B195 Hs.10748AA046086 0.1008 548 -1 1 CDC-like kinase 1 CLK1 Hs.2083R39774 0.0976 549 1 1 KIAA1698 protein KIAA1698 Hs.6259N28568 0.0598 550 1 1 Signal sequence receptor, alpha (translocon-associated protein alpha) SSR1 Hs.250773AA149493 0.0912 550 1 1 - - -R51495 0.0667 551 1 1 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa NDUFB8 Hs.198273H52752 0.1077 551 1 1 Heat shock 70kDa protein 9B (mortalin-2) HSPA9B Hs.3069R05480 0.0852 552 1 1 Solute carrier family 26, member 6 SLC26A6 Hs.298476H19945 0.1042 553 1 1 Syntaxin 5A STX5A Hs.302300N78845 0.0852 554 -1 1 Hypothetical protein FLJ20542 FLJ20542 Hs.6449AA001141 0.0667 555 -1 1 Heparan sulfate proteoglycan 2 (perlecan) HSPG2 Hs.211573AA059276 0.1113 555 1 1 Hypothetical protein MGC13010 MGC13010 Hs.332040H95186 0.0667 559 -1 1 - - Hs.378739N72995 0.0795 560 -1 1 Neuroblastoma, suppression of tumorigenicity 1 NBL1 Hs.76307H26288 0.0976 562 1 1 Hypothetical protein FLJ13448 FLJ13448 Hs.288945R77731 0.1522 562 -1 0.93 DKFZP566C0424 protein DKFZP566C042Hs.226770N90242 0.0852 563 -1 1 Glyoxylate reductase/hydroxypyruvate reductase GRHPR Hs.155742H19829 0.062 564 1 1 Rab acceptor 1 (prenylated) RABAC1 Hs.11417R54957 0.1225 564 1 1 - - Hs.356757AA037447 0.1617 564 -1 0.93 Acid phosphatase 1, soluble ACP1 Hs.75393N98296 0.0716 565 1 1 Hypothetical protein FLJ10808 FLJ10808 Hs.59838T81296 0.0823 565 1 0.93 Glucocorticoid receptor DNA binding factor 1 GRLF1 Hs.102548H38160 0.0691 566 1 1 Hypothetical protein FLJ10769 FLJ10769 Hs.8083R79616 0.0716 566 1 1 Thioredoxin domain containing TXNDC Hs.24766R36452 0.1008 566 -1 0.93 ESTs ESTs Hs.300817T86647 0.1042 566 1 1 ESTs ESTs Hs.332087H98836 0.0536 567 -1 1 Sac domain-containing inositol phosphatase 3 SAC3 Hs.10037H98783 0.0882 567 -1 1 Hypothetical protein FLJ31413 FLJ31413 Hs.24643H69082 0.0912 567 1 1 KIAA0241 protein KIAA0241 Hs.150275N94471 0.0667 569 -1 1 Small membrane protein 1 SMP1 Hs.107979R97175 0.0882 570 1 1 - - Hs.110783N25631 0.1042 570 -1 0.93 Regulatory factor X-associated ankyrin-containing protein RFXANK Hs.296776AA009672 0.1113 570 -1 0.87 Tyrosine kinase 2 TYK2 Hs.75516AA069400 0.0882 571 -1 0.93 Hypothetical protein MGC10974 MGC10974 Hs.111099R32023 0.1818 571 1 0.8 Golgi autoantigen, golgin subfamily a, 5 GOLGA5 Hs.241572H05096 0.0716 573 1 0.93 ESTs ESTs Hs.138417W32998 0.1265 573 -1 1 - - Hs.355841R37498 0.062 575 1 1 V-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protein) RALB Hs.348024R16301 0.0823 575 1 1 - - -H08027 0.1187 575 1 0.93 - - Hs.288963R18453 0.1225 576 1 1 - - -H30637 0.0768 577 1 1 ESTs ESTs Hs.27362R17409 0.1077 577 1 0.93 - - -N20343 0.1008 578 -1 0.87 - - -R18817 0.0716 579 1 1 ESTs ESTs Hs.22550W16814 0.0742 580 -1 1 Hypothetical protein MGC18257 MGC18257 Hs.350860W93648 0.0852 580 -1 1 CD47 antigen (Rh-related antigen, integrin-associated signal transducer) CD47 Hs.82685AA134944 0.1225 580 1 0.93 - - -H18491 0.1432 580 1 1 - - Hs.268701AA150728 0.0823 581 -1 1 ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 3 ADPRTL3 Hs.271742H41751 0.0943 581 1 1 General transcription factor IIF, polypeptide 1, 74kDa GTF2F1 Hs.68257R08338 0.0823 582 1 1 - - Hs.309257N49523 0.1008 583 -1 1 DKFZP434C128 protein DKFZP434C128Hs.222909AA099692 0.0976 584 -1 0.93 Epsilon-tubulin LOC51175 Hs.34851H14838 0.1042 584 -1 0.93 Defender against cell death 1 DAD1 Hs.82890N58012 0.0691 585 -1 1 - - -H65659 0.1187 585 1 0.93 Acyl-Coenzyme A oxidase 1, palmitoyl ACOX1 Hs.379991N73090 0.0716 586 1 1 Homolog of yeast MAF1 MAF1 Hs.324157AA045730 0.0976 586 -1 0.93 TGFB inducible early growth response TIEG Hs.82173H92328 0.0667 587 1 1 Hypothetical protein FLJ10874 FLJ10874 Hs.30318R25107 0.0716 587 -1 1 Protein phosphatase methylesterase-1 PME-1 Hs.63304R11719 0.0943 587 1 1 Nucleolar protein 1, 120kDa NOL1 Hs.15243

R36748 0.1113 587 1 0.87 - - Hs.22545T78109 0.0976 588 1 1 - - Hs.296322N80155 0.0976 589 -1 1 - - Hs.18672H00239 0.1008 589 1 1 ATP-binding cassette, sub-family F (GCN20), member 2 ABCF2 Hs.153612AA203552 0.0643 590 -1 1 - - Hs.193007R13215 0.1113 591 1 0.93 Protocadherin 19 PCDH19 Hs.4993R16127 0.1265 591 -1 0.93 - - Hs.121575N42484 0.0691 592 -1 1 - - -T80880 0.0823 592 1 1 ESTs ESTs Hs.268957AA148577 0.0852 592 1 1 Zinc finger protein 20 (KOX 13) ZNF20 Hs.110956H50391 0.0882 592 -1 1 Acid phosphatase 1, soluble ACP1 Hs.75393W86860 0.1042 592 -1 1 Nuclear VCP-like NVL Hs.58927R59448 0.0497 594 -1 1 Aryl hydrocarbon receptor nuclear translocator-like ARNTL Hs.74515R14321 0.0943 595 1 1 NEL-like 1 (chicken) NELL1 Hs.21602W07372 0.1113 595 -1 1 MBIP protein MBIP Hs.16755AA203394 0.1008 596 -1 1 ESTs ESTs Hs.365593W90154 0.1477 596 -1 1 DKFZP434B168 protein DKFZP434B168 Hs.48604R70694 0.0912 597 1 1 ESTs ESTs Hs.29126T98538 0.1042 602 1 1 Adaptor-related protein complex 3, beta 1 subunit AP3B1 Hs.155172AA125942 0.0882 605 -1 1 ESTs ESTs Hs.61881R93690 0.0823 607 1 1 Hydroxysteroid (17-beta) dehydrogenase 4 HSD17B4 Hs.75441H03286 0.1347 607 -1 1 3 beta-hydroxy-delta 5-C27-steroid oxidoreductase C(27)-3BETA-HSHs.23628AA054102 0.1225 608 -1 0.93 Suppressor of cytokine signaling 5 SOCS5 Hs.169836R51894 0.0795 610 1 1 Replication factor C (activator 1) 1, 145kDa RFC1 Hs.166563W03006 0.0882 611 -1 1 Myristoylated alanine-rich protein kinase C substrate MARCKS Hs.75607W32102 0.1077 611 -1 1 UDP-glucose pyrophosphorylase 2 UGP2 Hs.77837R21785 0.1042 612 1 1 Nucleoporin 155kDa NUP155 Hs.23255R54764 0.0742 614 1 1 KIAA1295 protein KIAA1295 Hs.26204R60752 0.1077 614 1 1 NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase) NDUFS1 Hs.8248AA036794 0.1225 614 -1 0.93 Hypothetical protein MGC3162 MGC3162 Hs.95196H43499 0.0742 615 1 1 Immunoglobulin lambda locus IGL@ Hs.181125N92087 0.0795 615 -1 1 Cyclin-dependent kinase inhibitor 3 (CDK2-associated dual specificity phosphatase) CDKN3 Hs.84113N46505 0.1305 615 -1 0.93 Hypothetical protein FLJ13273 FLJ13273 Hs.126119R31564 0.1008 616 1 1 Prenylcysteine lyase PCL1 Hs.278627H03154 0.1347 616 -1 1 CAC-1 CAC-1 Hs.343912R37954 0.0882 617 1 1 Ras association (RalGDS/AF-6) domain family 2 RASSF2 Hs.80905R97935 0.1265 617 1 0.93 Cell division cycle 34 CDC34 Hs.76932AA150238 0.0912 619 -1 1 - - -R55688 0.1008 619 1 0.93 KIAA0349 protein KIAA0349 Hs.15303T78869 0.1149 619 1 1 ESTs ESTs Hs.182898N56810 0.1305 619 -1 0.93 CAMP responsive element modulator CREM Hs.155924H38879 0.0497 621 1 1 Phosphoserine phosphatase PSPH Hs.56407H89555 0.0852 622 1 1 Hypothetical protein FLJ34588 FLJ34588 Hs.375580AA010355 0.1008 622 -1 1 ESTs ESTs Hs.187568H68440 0.1008 623 1 1 Phosphatidylinositol-4-phosphate 5-kinase, type I, beta PIP5K1B Hs.78406R01094 0.1225 624 1 1 Likely ortholog of mouse brain protein 17 BRP17 Hs.375161H91044 0.1389 624 -1 0.93 Mitogen-activated protein kinase phosphatase x MKPX Hs.29106AA033982 0.0768 625 -1 1 - - Hs.110059R59009 0.0976 626 1 1 KIAA0052 protein KIAA0052 Hs.278608H87272 0.1569 626 1 0.97 RAB2, member RAS oncogene family RAB2 Hs.78305N21528 0.0768 627 -1 1 Leucine rich repeat (in FLII) interacting protein 2 LRRFIP2 Hs.57672H10355 0.062 628 1 0.93 Transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) TCEB2 Hs.172772AA039984 0.0882 628 -1 1 CCR4-NOT transcription complex, subunit 8 CNOT8 Hs.26703AA069620 0.0882 628 -1 1 - - Hs.198552AA121519 0.1008 629 -1 1 - - -W31441 0.1715 629 -1 1 UDP-N-acetylglucosamine-2-epimerase/N-acetylmannosamine kinase GNE Hs.5920AA099587 0.0795 630 -1 1 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31 DDX31 Hs.69331H21773 0.1077 632 1 0.93 - - Hs.31845H15697 0.0976 634 1 0.93 Propionyl Coenzyme A carboxylase, beta polypeptide PCCB Hs.63788N90788 0.1477 634 -1 0.93 Annexin A4 ANXA4 Hs.77840R14323 0.0742 635 1 1 MDN1, midasin homolog (yeast) MDN1 Hs.76730T74342 0.1042 635 1 0.87 - - -H83003 0.1187 635 1 1 Immunoglobulin superfamily, member 1 IGSF1 Hs.22111R70121 0.0912 636 1 1 Inositol 1,3,4-triphosphate 5/6 kinase ITPK1 Hs.6453AA010675 0.1766 636 1 0.87 Glycogen synthase 1 (muscle) GYS1 Hs.772W92270 0.0943 637 1 1 Fc fragment of IgG, low affinity IIa, receptor for (CD32) FCGR2A Hs.78864N32221 0.1042 637 -1 1 Solute carrier family 12 (potassium/chloride transporters), member 6 SLC12A6 Hs.4876AA053221 0.1113 637 -1 1 Seven in absentia homolog 2 (Drosophila) SIAH2 Hs.20191AA036894 0.0976 638 1 1 Hypothetical protein FLJ20303 FLJ20303 Hs.17138AA040805 0.1077 638 -1 0.93 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 5 PSMD5 Hs.193725W07300 0.1305 638 1 1 Adaptor-related protein complex 1, gamma 1 subunit AP1G1 Hs.5344AA099327 0.1077 639 -1 1 General transcription factor IIA, 2, 12kDa GTF2A2 Hs.76362T94447 0.1149 639 -1 0.87 Cortical thymocyte receptor (X. laevis CTX) like CTXL Hs.112377R00798 0.0852 640 1 1 Solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17 SLC25A17 Hs.62245N28293 0.0852 640 -1 1 Autism-related protein 1 KIAA0442 Hs.32168R20373 0.1113 641 1 0.93 Transmembrane trafficking protein TMP21 Hs.74137R35160 0.2038 641 1 0.87 Insulin-like growth factor 2 receptor IGF2R Hs.76473N54859 0.1077 642 -1 1 Hypothetical protein FLJ11151 FLJ11151 Hs.14992AA114842 0.1305 642 -1 0.93 Tripartite motif-containing 3 TRIM3 Hs.321576W93272 0.1225 643 -1 0.93 Diphosphate dimethylallyl diphosphate isomerase 2 IDI2 Hs.9270AA044119 0.0976 644 1 1 - - Hs.103441N39391 0.1008 644 -1 1 Hypothetical protein MGC14799 MGC14799 Hs.333166N23976 0.1042 645 -1 1 Dystroglycan 1 (dystrophin-associated glycoprotein 1) DAG1 Hs.76111AA121308 0.0516 646 -1 1 TRNA isopentenylpyrophosphate transferase IPT Hs.356554H99486 0.0795 647 -1 1 LIM and SH3 protein 1 LASP1 Hs.334851N33563 0.2339 647 -1 0.87 Transgelin TAGLN Hs.75777AA004801 0.1008 648 -1 0.93 - - -H15131 0.1008 648 1 0.93 - - Hs.4866AA134529 0.1042 648 -1 0.93 DKFZP566D193 protein DKFZP566D193Hs.106909W04539 0.1389 649 1 1 KIAA0295 protein KIAA0295 Hs.155979W96076 0.1389 650 -1 0.93 Immediate early protein ETR101 Hs.737N81096 0.1008 651 -1 1 KIAA0614 protein KIAA0614 Hs.7314H13047 0.0823 652 1 1 F-box only protein 22 FBXO22 Hs.369030T78404 0.0912 653 1 0.93 ESTs ESTs Hs.14280W47134 0.1077 653 -1 1 CGI-58 protein CGI-58 Hs.19385H14810 0.1149 653 -1 1 - - Hs.303154N95821 0.1265 653 -1 0.93 KIAA0768 protein LEC3 Hs.21917R51937 0.1077 655 1 1 LIM domain kinase 2 LIMK2 Hs.278027AA131821 0.0823 656 -1 1 Proteasome (prosome, macropain) subunit, beta type, 2 PSMB2 Hs.1390H04766 0.0943 656 -1 1 - - -

AA150896 0.0976 656 -1 1 Hypothetical protein MGC13090 MGC13090 Hs.333389AA128183 0.0667 657 -1 1 Meningioma expressed antigen 5 (hyaluronidase) MGEA5 Hs.5734T77239 0.1149 657 1 1 - - -AA056090 0.1347 659 -1 1 - - -N46725 0.0823 660 1 1 Hypothetical protein FLJ22679 FLJ22679 Hs.5472W93096 0.1042 660 -1 1 - - -T88726 0.1113 663 1 0.93 Hypothetical protein FLJ20313 FLJ20313 Hs.126721R44195 0.1225 663 1 1 DiGeorge syndrome critical region gene DGSI; likely ortholog of mouse expressed sequence 2 embryonic lethal DGSI Hs.154879R12050 0.1149 665 -1 1 KIAA0014 gene product KIAA0014 Hs.155650AA129727 0.1569 665 -1 0.93 RAB5C, member RAS oncogene family RAB5C Hs.479R18944 0.2534 666 1 0.87 Transcriptional co-repressor Sin3A SIN3A Hs.22583R24934 0.1305 667 1 1 - - Hs.356564W73052 0.0943 669 -1 1 Ring-box 1 RBX1 Hs.279919N27829 0.1077 672 -1 0.93 Hypothetical protein BC013035 LOC114926 Hs.10018H90247 0.1225 672 -1 1 - - Hs.356089N72901 0.1265 672 -1 0.93 U5 snRNP-specific 40 kDa protein (hPrp8-binding) HPRP8BP Hs.10290H44601 0.1715 672 -1 1 ESTs ESTs Hs.134542W20391 0.0852 673 -1 1 Kinesin-like 2 KNSL2 Hs.20830AA035651 0.1008 674 -1 1 ESTs ESTs Hs.143813N55023 0.0823 675 -1 1 HSPC150 protein similar to ubiquitin-conjugating enzyme HSPC150 Hs.5199R62636 0.1008 676 -1 1 ESTs ESTs Hs.107060H53623 0.0943 677 -1 1 - - -W05750 0.0943 677 -1 1 Protein containing CXXC domain 2 PCCX2 Hs.199009H39920 0.1265 677 1 1 - - -H28138 0.1389 677 1 1 HLA-B associated transcript 1 BAT1 Hs.55296AA099135 0.1008 679 -1 0.93 Hypothetical protein FLJ20186 FLJ20186 Hs.62771AA131615 0.1113 680 -1 0.93 HRAS-like suppressor 3 HRASLS3 Hs.37189AA005389 0.1305 680 -1 1 DKFZP727G051 protein DKFZP727G051Hs.119960AA127846 0.1077 681 1 0.93 ESTs ESTs Hs.348901H62770 0.1113 681 -1 0.97 ESTs ESTs Hs.176721W52798 0.1187 681 -1 0.93 Emerin (Emery-Dreifuss muscular dystrophy) EMD Hs.2985T85141 0.1305 681 1 1 Golgi coiled coil 1 GCC1 Hs.4783W38635 0.1477 681 -1 0.97 Protein kinase C substrate 80K-H PRKCSH Hs.1432W52914 0.1187 682 -1 1 - - Hs.188212W58432 0.0852 683 -1 1 Microtubule-associated protein 4 MAP4 Hs.239298AA131579 0.0882 683 -1 1 Platelet-derived growth factor receptor, beta polypeptide PDGFRB Hs.76144AA005154 0.0716 684 -1 1 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin) DDX9 Hs.74578T66206 0.1305 684 1 1 VCY2 interacting protein 1 VCY2IP1 Hs.66048H20507 0.1477 685 1 0.93 Similar to ecotropic viral integration site 5; Neuroblastoma stage 4S gene LOC115704 Hs.26870N89707 0.1077 686 -1 0.87 Dynein light chain 2A DNLC2A Hs.100002N50349 0.1113 687 -1 0.93 Rho guanine nucleotide exchange factor (GEF) 10 ARHGEF10 Hs.20695H87034 0.1265 687 -1 1 Bicaudal D homolog 1 (Drosophila) BICD1 Hs.164975R42203 0.1617 687 1 1 Mitochondrial ribosomal protein S27 MRPS27 Hs.122669W58197 0.1872 687 1 1 Amyloid beta (A4) precursor-like protein 2 APLP2 Hs.279518H10439 0.1008 688 -1 1 Hypothetical protein MGC5560 MGC5560 Hs.233150AA056378 0.1187 688 -1 0.93 Alveolar soft part sarcoma chromosome region, candidate 1 ASPSCR1 Hs.298351AA058623 0.0912 690 -1 1 Proteasome (prosome, macropain) subunit, beta type, 1 PSMB1 Hs.75748T99083 0.1617 690 1 1 CSE1 chromosome segregation 1-like (yeast) CSE1L Hs.90073R92026 0.1265 691 1 0.93 Fracture callus 1 homolog (rat) FXC1 Hs.54943R20380 0.1569 692 -1 0.9 ESTs ESTs Hs.12758H05616 0.1008 693 -1 1 Nuclear receptor co-repressor 1 NCOR1 Hs.144904AA044402 0.1113 693 -1 0.93 Hypothetical protein FLJ11749 FLJ11749 Hs.22897N36912 0.1347 693 -1 0.93 KIAA1737 protein KIAA1737 Hs.22452N95498 0.1665 693 -1 0.8 - - Hs.109007W03011 0.1187 694 -1 0.93 MSTP043 protein MSTP043 Hs.306881T81806 0.1225 694 1 0.87 - - -R59532 0.1305 696 1 1 Phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazolGART Hs.82285W92049 0.1008 697 -1 1 - - -N38855 0.1265 697 1 0.93 Enhancer of invasion 10 HEI10 Hs.107003W07487 0.0976 698 -1 1 KIAA0870 protein KIAA0870 Hs.18166R20713 0.0852 699 1 1 - - -AA054499 0.1347 699 -1 0.93 - - Hs.143885W42742 0.1389 699 -1 0.93 CGI-29 protein LOC51074 Hs.104058R12730 0.1522 699 1 0.93 Ocular development-associated gene ODAG Hs.21145H02918 0.1926 699 1 0.73 Hypothetical protein MGC2941 MGC2941 Hs.288217AA010318 0.1149 701 -1 1 Striatin, calmodulin binding protein STRN Hs.258538H58427 0.0852 702 1 1 ESTs ESTs Hs.307940H78479 0.1042 703 -1 1 Thioredoxin-like 2 TXNL2 Hs.42644N68522 0.1042 703 -1 1 Transforming growth factor, beta 3 TGFB3 Hs.2025T93107 0.1113 703 -1 0.93 - - Hs.110771W21221 0.1389 703 -1 0.93 RNA binding motif protein 4 RBM4 Hs.42826W70111 0.1389 704 -1 1 Alcohol dehydrogenase 5 (class III), chi polypeptide ADH5 Hs.78989N48198 0.0823 705 -1 1 Zinc finger protein 151 (pHZ-67) ZNF151 Hs.33532R01903 0.2276 705 -1 0.93 Dystonia 1, torsion (autosomal dominant; torsin A) DYT1 Hs.19261H18275 0.1225 706 -1 1 - - -N48742 0.1522 706 -1 1 Hypothetical protein FLJ12788 FLJ12788 Hs.20242H24644 0.0882 707 1 1 - - -N41670 0.1766 707 1 0.93 KIAA1673 KIAA1673 Hs.301444N30514 0.2096 707 -1 1 Adenylosuccinate synthase ADSS Hs.90011H95278 0.1042 710 -1 1 Phosphogluconate dehydrogenase PGD Hs.75888N22357 0.1522 710 1 0.87 - - -W31460 0.0943 711 1 1 Aldehyde dehydrogenase 9 family, member A1 ALDH9A1 Hs.2533W86191 0.1008 711 -1 1 Pseudouridylate synthase 1 PUS1 Hs.23723N93937 0.1042 711 -1 1 Amyloid beta precursor protein (cytoplasmic tail) binding protein 2 APPBP2 Hs.84084R87373 0.1926 711 -1 0.87 - - -AA101835 0.0912 713 -1 1 - - Hs.374524AA011400 0.1347 714 -1 1 Dipeptidylpeptidase 9 DPP9 Hs.237617N40831 0.1389 716 -1 1 Microsomal glutathione S-transferase 3 MGST3 Hs.111811H87736 0.0742 717 1 1 - - -R74454 0.1305 717 1 1 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1 B3GNT1 Hs.173203W40108 0.0742 720 1 1 - - Hs.346735R22904 0.1347 721 1 1 8D6 antigen 8D6A Hs.106196N39954 0.1265 722 -1 1 - - Hs.109012H83363 0.1477 722 -1 1 Translocase of inner mitochondrial membrane 10 homolog (yeast) TIMM10 Hs.355993N53897 0.1305 723 1 1 - - Hs.58966N42428 0.1569 723 -1 1 Ribosomal protein S24 RPS24 Hs.180450N35859 0.0795 725 -1 1 Phosphodiesterase 7A PDE7A Hs.21857AA009678 0.0882 725 -1 1 - - -H12615 0.0912 725 1 1 Hypothetical protein FLJ11273 FLJ11273 Hs.3542W47189 0.1008 726 -1 0.93 HSPC041 protein LOC51125 Hs.7953

H05532 0.1149 726 1 1 Hypothetical protein BC004501 LOC90231 Hs.110906N79577 0.1926 726 -1 0.93 Hypothetical protein MGC4368 MGC4368 Hs.9732N79584 0.1569 727 1 0.93 CK2 interacting protein 1; HQ0024c protein CKIP-1 Hs.173380T96407 0.1665 729 -1 0.87 - - -N34884 0.0768 731 -1 1 NIF3 NGG1 interacting factor 3-like 1 (S. pombe) NIF3L1 Hs.21943H28165 0.0943 731 1 1 Chaperone, ABC1 activity of bc1 complex like (S. pombe) CABC1 Hs.273186R46262 0.1042 731 1 1 Hypothetical protein MGC17515 MGC17515 Hs.350549R68213 0.1149 731 1 1 AD026 protein AD026 Hs.28847AA056755 0.1305 731 1 1 Peroxisomal proliferator-activated receptor A interacting complex 285 PRIC285 Hs.151714N54855 0.1149 732 -1 0.93 ESTs ESTs Hs.269340T39635 0.1347 733 -1 1 ESTs ESTs Hs.345204AA046800 0.1008 734 1 1 Tuftelin interacting protein 11 TFIP11 Hs.20225AA142987 0.1347 734 -1 1 DKFZP586I111 protein DKFZP586I111 Hs.227429H19181 0.1477 734 1 1 Ureidopropionase, beta UPB1 Hs.126926N26477 0.1187 735 -1 1 Iduronate 2-sulfatase (Hunter syndrome) IDS Hs.172458W56088 0.1305 735 -1 1 Ethanolamine kinase EKI1 Hs.120439R17312 0.1477 736 1 1 SON DNA binding protein SON Hs.92909N99008 0.1715 736 1 0.87 DnaJ (Hsp40) homolog, subfamily A, member 1 DNAJA1 Hs.94N79538 0.1113 737 -1 1 - - Hs.380093R02581 0.1225 738 1 1 F-box only protein 9 FBXO9 Hs.11050N38958 0.1077 739 -1 0.93 CCCTC-binding factor (zinc finger protein) CTCF Hs.57419AA043504 0.1617 741 -1 0.87 Inositol polyphosphate phosphatase-like 1 INPPL1 Hs.75339H00297 0.2038 741 1 0.8 CGI-100 protein LOC50999 Hs.348996N49756 0.1008 742 -1 1 - - Hs.348978N99911 0.1149 742 -1 0.93 SNARE associated protein snapin SNAPAP Hs.32018R88190 0.0742 743 1 1 Solute carrier family 5 (sodium/glucose cotransporter), member 2 SLC5A2 Hs.356900AA031950 0.1432 744 -1 0.87 Hypothetical protein FLJ22688 FLJ22688 Hs.288800AA043899 0.1042 745 -1 1 - - -N69540 0.1008 746 -1 1 - - Hs.351310AA026302 0.1265 746 -1 1 Myeloid leukemia factor 1 MLF1 Hs.85195R34766 0.1187 747 -1 0.93 Dipeptidylpeptidase III DPP3 Hs.22880W45534 0.1569 747 1 0.93 Laminin, alpha 4 LAMA4 Hs.78672N90844 0.2339 747 -1 0.8 Alcohol dehydrogenase 5 (class III), chi polypeptide ADH5 Hs.78989R72314 0.0912 749 1 1 - - -W57795 0.0976 749 1 1 TSC-22-like THG-1 Hs.102447H25530 0.1077 749 1 1 - - -AA035227 0.1872 749 -1 0.87 Unknown LOC51693 Hs.27445AA058815 0.1389 750 -1 0.93 Hypothetical protein BC000919 LOC90736 Hs.33020W76572 0.0943 751 -1 1 Nudix (nucleoside diphosphate linked moiety X)-type motif 1 NUDT1 Hs.388H28105 0.1113 751 1 1 Small nuclear ribonucleoprotein polypeptide N SNRPN Hs.48375AA035000 0.1225 751 1 1 - - -N31736 0.1766 751 -1 0.93 Hypothetical protein FLJ25211 FLJ25211 Hs.44269AA024810 0.1149 752 -1 1 S100 calcium binding protein A10 (annexin II ligand, calpactin I, light polypeptide (p11)) S100A10 Hs.119301H06584 0.1477 752 1 0.93 Tetratricopeptide repeat domain 3 TTC3 Hs.118174H58750 0.1432 754 1 1 Similar to RIKEN cDNA 2610030J16 gene MGC2541 Hs.173103H03409 0.1477 754 1 1 Alg5, S. cerevisiae, homolog of ALG5 Hs.227933N32277 0.1818 754 -1 0.87 - - -N95811 0.1766 755 1 0.87 Williams Beuren syndrome chromosome region 22 WBSCR22 Hs.155020N95462 0.1149 756 1 1 ATP-binding cassette, sub-family F (GCN20), member 2 ABCF2 Hs.153612H52742 0.1305 756 1 0.93 HMT1 hnRNP methyltransferase-like 2 (S. cerevisiae) HRMT1L2 Hs.20521T66828 0.1665 756 -1 0.93 Hypothetical protein FLJ36748 FLJ36748 Hs.64313T84742 0.1187 757 1 1 Prenylcysteine lyase PCL1 Hs.278627N34756 0.1477 757 -1 1 Sorting nexin 4 SNX4 Hs.267812H78210 0.2038 757 1 0.93 Uridine kinase-like 1 URKL1 Hs.39850T79936 0.1766 758 -1 0.87 ESTs ESTs Hs.119583H22827 0.1113 759 1 1 Serine hydroxymethyltransferase 2 (mitochondrial) SHMT2 Hs.75069T80795 0.1305 759 1 0.87 - - -R45197 0.1766 759 1 0.87 Hypothetical protein MGC11349 MGC11349 Hs.288697R60239 0.1715 760 1 0.93 Similar to S. cerevisiae SSM4 TEB4 Hs.380875T92561 0.1008 761 1 1 Suppression of tumorigenicity 7 ST7 Hs.5814W48875 0.1113 761 -1 1 Ras association (RalGDS/AF-6) domain family 1 RASSF1 Hs.26931N41297 0.2096 761 1 0.93 ESTs ESTs Hs.355658N24066 0.1077 762 1 1 Cold shock domain protein A CSDA Hs.198726AA011361 0.1077 762 -1 1 Soc-2 suppressor of clear homolog (C. elegans) SHOC2 Hs.104315R59976 0.1113 762 -1 1 KIAA1831 protein KIAA1831 Hs.26714H10444 0.1042 763 1 1 Era G-protein-like 1 (E. coli) ERAL1 Hs.3426N36628 0.1149 763 -1 0.93 - - Hs.233382N79772 0.1225 764 1 1 Mitochondrial ribosomal protein S10 MRPS10 Hs.380887R94106 0.2468 765 1 0.8 - - -W85899 0.1715 767 1 1 Cytidine monophosphate N-acetylneuraminic acid synthetase CMAS Hs.12492N72764 0.0823 768 -1 1 - - -AA036798 0.0882 768 -1 1 - - Hs.339024AA044429 0.1042 768 -1 1 Tho2 THO2 Hs.16411R88082 0.0976 773 -1 1 ESTs ESTs Hs.31755H90090 0.1766 773 -1 1 DKFZP564G0222 protein DKFZP564G022Hs.13370W87791 0.1818 773 -1 0.93 - - -N28014 0.0882 774 -1 1 BRCA1 associated protein BRAP Hs.122764N23517 0.1265 775 -1 0.93 Heterogeneous nuclear ribonucleoprotein F HNRPF Hs.808AA149279 0.1569 775 -1 1 DNAJ domain-containing MCJ Hs.279884AA127818 0.1265 776 -1 1 - - -H44523 0.1569 776 1 1 KIAA0370 protein KIAA0370 Hs.70500R77994 0.1477 777 1 0.87 Zinc finger protein 313 ZNF313 Hs.10590R71648 0.1265 780 1 1 CDC2-related protein kinase 7 CRK7 Hs.278346AA043201 0.0943 781 -1 1 - - Hs.179891N55592 0.1347 781 -1 1 Ubiquitin specific protease 20 USP20 Hs.5452W05850 0.1432 782 -1 0.93 Emopamil binding protein (sterol isomerase) EBP Hs.75105W46270 0.2215 782 -1 0.93 Hypothetical protein FLJ22625 FLJ22625 Hs.106534H17025 0.1477 783 1 0.93 Phosphotidylinositol transfer protein, beta PITPNB Hs.7370R88297 0.2038 785 1 1 - - Hs.144531R26953 0.1077 787 1 1 Solute carrier family 31 (copper transporters), member 1 SLC31A1 Hs.380728R24850 0.1389 790 1 1 - - -R02587 0.1113 791 -1 1 ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) ACTR1A Hs.153961R88098 0.1432 791 1 1 Myosin IC MYO1C Hs.286226N50617 0.1522 791 -1 0.93 Small nuclear ribonucleoprotein polypeptide A' SNRPA1 Hs.80506W60492 0.1347 794 -1 0.93 Amino-terminal enhancer of split AES Hs.244H11043 0.2602 796 1 0.73 Kinesin family member 3B KIF3B Hs.301206H50522 0.1617 797 1 1 Proteasome (prosome, macropain) inhibitor subunit 1 (PI31) PSMF1 Hs.75925R62925 0.1617 798 1 0.93 - - Hs.285193N64706 0.1225 799 1 1 KIAA1951 protein KIAA1951 Hs.137282R99213 0.1665 799 1 0.93 Diacylglycerol O-acyltransferase homolog 1 (mouse) DGAT1 Hs.288627

AA150792 0.1818 800 -1 0.93 - - -AA039374 0.1715 801 -1 1 - - -N90432 0.1477 802 -1 0.93 Hypothetical protein FLJ10706 FLJ10706 Hs.273193R11184 0.1818 802 -1 0.73 - - Hs.14337AA099134 0.1187 803 1 0.93 Hypoxia up-regulated 1 HYOU1 Hs.277704R77347 0.1926 804 1 0.87 Peptidyl-prolyl isomerase G (cyclophilin G) PPIG Hs.77965H68838 0.0912 805 1 1 Nuclear receptor subfamily 2, group C, member 1 NR2C1 Hs.108301H63676 0.1042 805 1 1 Optic atrophy 1 (autosomal dominant) OPA1 Hs.147946H27818 0.1347 805 1 1 Hypothetical protein FLJ30656 FLJ30656 Hs.349887R88840 0.2096 805 -1 0.93 - - Hs.268832R48249 0.1149 806 1 1 - - Hs.301885N71038 0.0943 808 1 0.93 Wiskott-Aldrich syndrome-like WASL Hs.170065R86231 0.1149 809 1 1 PC326 protein PC326 Hs.279882R25983 0.1225 809 1 1 N-ethylmaleimide-sensitive factor NSF Hs.108802AA046886 0.1077 810 -1 1 Hypothetical protein FLJ20473 FLJ20473 Hs.9096AA047085 0.1926 810 -1 0.93 Synaptotagmin-like 2 SYTL2 Hs.92254N51196 0.1149 812 -1 1 - - -N63416 0.1926 812 -1 0.8 - - Hs.82719R41613 0.1149 813 1 1 ESTs ESTs Hs.22514AA026136 0.1113 814 -1 1 Proteasome (prosome, macropain) subunit, alpha type, 6 PSMA6 Hs.74077N64488 0.1187 814 -1 0.93 Putative homeodomain transcription factor 1 PHTF1 Hs.123637H72283 0.1305 814 1 1 KIAA0265 protein KIAA0265 Hs.192966AA150728 0.1389 814 1 0.87 ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 3 ADPRTL3 Hs.271742T65539 0.1225 816 1 1 Kinesin heavy chain member 2 KIF2 Hs.113319N23950 0.1008 817 -1 1 High-mobility group box 2 HMGB2 Hs.80684N42666 0.1389 817 -1 1 Preimplantation protein 3 PREI3 Hs.107942H95259 0.1149 818 -1 1 Membrane protein, palmitoylated 1, 55kDa MPP1 Hs.1861N48827 0.1477 818 -1 1 FLJ23277 protein FLJ23277 Hs.334477R47837 0.1665 818 1 1 Zinc finger protein 265 ZNF265 Hs.194718W15595 0.1818 818 1 1 Coactivator for steroid receptors COASTER Hs.172329AA156746 0.1665 819 -1 1 FLJ00005 protein FLJ00005 Hs.367690T77388 0.1981 819 1 0.87 Hypothetical protein FLJ38045 FLJ38045 Hs.170226AA032039 0.1347 820 -1 1 Hypothetical protein FLJ13102 FLJ13102 Hs.225160AA035309 0.2276 821 1 0.8 Hypothetical protein 20D7-FC4 20D7-FC4 Hs.128702R71531 0.1113 822 1 1 Hypothetical protein FLJ32731 FLJ32731 Hs.380474R34114 0.1305 822 -1 1 - - Hs.352487T90545 0.1569 823 1 0.87 KIAA1536 protein KIAA1536 Hs.156667AA135498 0.1766 823 1 1 CCAAT/enhancer binding protein (C/EBP), beta CEBPB Hs.99029R11580 0.1225 824 1 1 Formin binding protein 3 FNBP3 Hs.107213H39913 0.1522 824 -1 0.87 - - Hs.144532N47456 0.1818 824 -1 0.87 KH domain containing, RNA binding, signal transduction associated 1 KHDRBS1 Hs.119537N79069 0.1187 825 -1 1 - - -N47346 0.1569 825 -1 1 G-protein gamma-12 subunit LOC55970 Hs.8107AA045053 0.1113 826 -1 1 Pleiotrophin (heparin binding growth factor 8, neurite growth-promoting factor 1) PTN Hs.44N26378 0.1305 826 -1 1 Glycerol kinase GK Hs.1466R40254 0.1522 826 1 0.93 Hypothetical protein DKFZp434L0718 DKFZP434L0718Hs.59236T91747 0.1818 826 -1 0.87 ESTs ESTs Hs.268612R10284 0.1187 827 1 1 Hyaluronan-mediated motility receptor (RHAMM) HMMR Hs.72550N32304 0.1818 828 -1 0.8 Proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) PSME1 Hs.75348W02274 0.1305 830 -1 1 - - -AA029543 0.1872 830 -1 0.93 - - Hs.112619R17664 0.1715 831 1 1 Methyltransferase-like 1 METTL1 Hs.42957AA195759 0.1477 832 -1 0.93 ESTs ESTs Hs.142104AA043530 0.1766 832 -1 0.93 - - Hs.99841R46183 0.1225 833 1 0.93 Hypothetical protein DKFZp313A2432 DKFZp313A2432Hs.349096AA126902 0.1305 833 -1 1 UBX domain containing 1 UBXD1 Hs.11081T74007 0.1347 834 1 1 Nicastrin NCSTN Hs.4788N28908 0.1432 835 -1 0.93 - - Hs.356659R08800 0.1149 836 1 1 Tubulin, gamma 2 TUBG2 Hs.279669N53193 0.1389 836 -1 1 Polymerase (DNA directed), epsilon POLE Hs.166846AA004836 0.1818 836 -1 0.93 Hypothetical nuclear factor SBBI22 LOC57117 Hs.26323T96870 0.1766 837 -1 1 ESTs ESTs Hs.17910R20016 0.1766 837 1 0.87 - - Hs.22689R64137 0.1225 838 1 0.93 ESTs ESTs Hs.108887R50300 0.1522 845 1 0.93 Hypothetical protein DKFZp434N1923 DKFZP434N192Hs.295866AA147492 0.1187 847 -1 1 - - Hs.343211W60893 0.1187 848 -1 1 Polymerase (DNA-directed), delta 4 POLD4 Hs.82520H30717 0.1665 848 -1 0.87 GRB2-associated binding protein 2 GAB2 Hs.30687R34667 0.1981 848 1 1 Hypothetical protein DKFZP434G1411 DKFZP434G141Hs.3837H69320 0.1766 849 1 1 Vesicle docking protein p115 P115 Hs.325948T79825 0.1305 850 1 1 - EST Hs.332668R75976 0.1617 850 1 0.93 - - Hs.373548R20435 0.1981 850 1 0.93 ESTs ESTs Hs.167361AA156696 0.2403 850 -1 0.87 B-cell translocation gene 1, anti-proliferative BTG1 Hs.77054AA056534 0.2038 851 1 0.8 ESTs ESTs Hs.110294T51729 0.1347 852 -1 0.93 Regulator of G-protein signalling 14 RGS14 Hs.9347T78059 0.1569 854 1 0.87 Protein associated with PRK1 AWP1 Hs.83954AA057338 0.1617 854 -1 1 General transcription factor IIH, polypeptide 1, 62kDa GTF2H1 Hs.89578W35315 0.1477 855 -1 1 - - Hs.381207AA041347 0.2096 855 -1 0.8 Hypothetical protein FLJ13984 FLJ13984 Hs.135146T93597 0.1187 857 1 1 ESTs ESTs Hs.187429R98049 0.1818 857 1 1 Testis intracellular mediator protein PEAS Hs.281706AA028073 0.1569 860 -1 0.93 - - -R89246 0.1665 860 1 1 KIAA0711 gene product KIAA0711 Hs.5333T77481 0.1477 861 1 0.93 LIS1-interacting protein NUDEL; endooligopeptidase A NUDEL Hs.3850T83747 0.1617 861 1 1 - - -H07904 0.1872 861 1 0.93 Hypothetical protein FLJ38045 FLJ38045 Hs.170226R71560 0.1077 862 1 1 - - -AA031672 0.1522 863 -1 1 Dual specificity phosphatase 12 DUSP12 Hs.44229H70392 0.1522 863 1 1 ATP-dependent RNA helicase ROK1 Hs.380430H55914 0.1818 863 -1 1 - - -W46792 0.1432 864 -1 1 Transcription factor Dp-2 (E2F dimerization partner 2) TFDP2 Hs.19131H63547 0.2155 864 1 0.67 N-ethylmaleimide-sensitive factor attachment protein, alpha NAPA Hs.75932H69659 0.1389 866 1 1 - - -R52052 0.1477 866 1 1 Hypothetical protein BC012357 LOC89953 Hs.53447H85577 0.1265 867 1 1 Hypothetical protein FLJ11273 FLJ11273 Hs.3542R79439 0.1305 867 1 1 ADP-ribosylation factor-like 1 ARL1 Hs.242894H01133 0.1522 867 -1 0.97 - - Hs.30120N64510 0.2468 867 -1 0.8 - - Hs.350475R12917 0.1818 868 1 1 - - Hs.21195

AA134109 0.1569 869 1 0.93 Hypothetical protein MGC14327 MGC14327 Hs.231029H57791 0.2038 869 1 0.87 - - -N33225 0.1522 870 -1 1 ESTs ESTs Hs.237749R91821 0.1715 870 1 1 ESTs ESTs Hs.245997AA054477 0.1389 871 -1 1 - - Hs.25391H06915 0.2096 871 1 0.73 Hypothetical protein FLJ21919 FLJ21919 Hs.105894H84980 0.1305 872 1 1 Tripartite motif-containing 11 TRIM11 Hs.13543R65823 0.1389 872 1 1 Two-pore channel 1, homolog KIAA1169 Hs.26440H66475 0.1347 873 -1 1 Homolog of rat nadrin RICH1 Hs.14169N47249 0.2339 873 -1 0.73 - - Hs.28264R27994 0.1477 874 1 0.97 - - Hs.83086R14811 0.1818 875 1 1 ESTs ESTs Hs.380463T98251 0.2038 875 1 0.87 - - Hs.288581R76958 0.1665 876 1 1 Muscleblind-like protein MBLL39 MBLL39 Hs.283609H21748 0.1926 876 1 0.8 Caveolin 2 CAV2 Hs.139851AA047259 0.2276 876 1 0.8 Endometrial bleeding associated factor (left-right determination, factor A; transforming growth factor beta superfamilyEBAF Hs.25195AA099381 0.1665 877 -1 0.87 COX15 homolog, cytochrome c oxidase assembly protein (yeast) COX15 Hs.226581R39405 0.1926 877 1 0.93 Dishevelled, dsh homolog 2 (Drosophila) DVL2 Hs.118640H22657 0.2884 877 -1 0.83 Carboxylesterase 2 (intestine, liver) CES2 Hs.282975R35798 0.1265 878 1 0.93 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 ABCC4 Hs.139336N25348 0.1926 878 1 0.73 V-ets erythroblastosis virus E26 oncogene homolog 1 (avian) ETS1 Hs.18063R38456 0.1225 879 -1 1 - - -T95724 0.1432 879 1 1 Solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 SLC25A15 Hs.78457R00710 0.1818 879 1 0.83 - - Hs.379472N24302 0.2096 881 1 1 Zinc finger protein 146 ZNF146 Hs.301819R54426 0.1225 882 1 1 - - Hs.96716N71955 0.1818 884 -1 0.93 Chromosome 20 open reading frame 111 C20orf111 Hs.75798N74427 0.1008 885 -1 1 ESTs ESTs Hs.222413R72283 0.1569 885 1 1 Hypothetical protein FLJ12089 FLJ12089 Hs.11896R53336 0.1715 885 1 0.93 Ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3) RAC3 Hs.45002AA031411 0.1715 885 1 1 Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa PAFAH1B1 Hs.77318N48162 0.1389 886 -1 1 P53-regulated DDA3 DDA3 Hs.77550R45618 0.1617 887 1 1 Hypothetical protein FLJ20498 FLJ20498 Hs.97925AA044143 0.1305 888 1 1 Molybdenum cofactor synthesis 1 MOCS1 Hs.349416AA029359 0.3508 889 -1 0.73 Laminin, beta 2 (laminin S) LAMB2 Hs.90291H74279 0.1715 891 -1 0.73 Hypothetical protein DKFZp547B1713 DKFZp547B1713Hs.349262R60613 0.2403 891 1 0.8 General transcription factor II, i GTF2I Hs.278589AA046615 0.1522 892 1 1 Interleukin 2 receptor, beta IL2RB Hs.75596N80988 0.2276 893 1 0.8 GTP binding protein 2 GTPBP2 Hs.13011AA046918 0.1477 894 1 0.87 Splicing factor 3b, subunit 2, 145kDa SF3B2 Hs.75916N27188 0.1818 894 1 0.93 Hypothetical protein from BCRA2 region CG005 Hs.23518R35358 0.1347 896 -1 1 Hypothetical protein FLJ20011 FLJ20011 Hs.334647N52496 0.2096 896 -1 0.87 BTG family, member 3 BTG3 Hs.77311W07319 0.2155 896 -1 1 Zinc finger protein 41 ZNF41 Hs.143700T96932 0.1305 897 1 1 Chromosome 6 open reading frame 11 C6orf11 Hs.17930T87251 0.1432 897 1 0.93 ESTs ESTs Hs.114604N28259 0.1389 898 -1 1 - - Hs.12030H50906 0.2215 898 1 0.8 Stannin SNN Hs.76691H18273 0.1389 899 1 1 Bernardinelli-Seip congenital lipodystrophy 2 (seipin) BSCL2 Hs.293981H88463 0.1432 899 1 1 Lysophospholipase I LYPLA1 Hs.12540R61769 0.1522 899 1 0.93 Crm, cramped-like (Drosophila) CRAMP1L Hs.15441R19512 0.1665 900 1 1 Regulator of G-protein signalling 19 RGS19 Hs.22698N92759 0.274 900 1 0.87 Cytoskeleton-associated protein 4 CKAP4 Hs.74368R26339 0.1569 901 1 1 Adaptor-related protein complex 2, alpha 2 subunit AP2A2 Hs.19121AA044234 0.2215 901 -1 0.93 Inositol 1,4,5-trisphosphate 3-kinase C ITPKC Hs.21453AA135731 0.385 902 -1 0.73 ESTs ESTs Hs.71428H18242 0.1766 903 1 0.93 Neighbor of A-kinase anchoring protein 95 NAKAP95 Hs.96200T70331 0.1766 903 1 0.93 - - -AA037091 0.1926 904 -1 1 Transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) TCEB1 Hs.184693AA040152 0.1077 905 -1 1 Cleavage and polyadenylation specific factor 3, 73kDa CPSF3 Hs.16251R07975 0.1477 905 -1 1 Hypothetical protein MGC955 MGC955 Hs.55608H86108 0.1347 906 1 1 RAB11A, member RAS oncogene family RAB11A Hs.75618W17368 0.2276 906 1 0.8 - - Hs.261734AA011515 0.1715 907 -1 1 KIAA0451 gene product KIAA0451 Hs.18586W67471 0.2096 907 -1 0.93 Ras homolog gene family, member B ARHB Hs.204354H44128 0.1477 908 1 1 Eukaryotic translation elongation factor 1 alpha 1 EEF1A1 Hs.181165AA034352 0.1766 911 -1 0.93 MADS box transcription enhancer factor 2, polypeptide A (myocyte enhancer factor 2A) MEF2A Hs.182280W46217 0.2339 911 -1 0.73 Tigger transposable element derived 6 TIGD6 Hs.169333T78899 0.1389 912 -1 0.93 NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase) NDUFS8 Hs.90443R01692 0.1766 913 1 1 Junctional adhesion molecule 1 JAM1 Hs.12284W55903 0.1617 914 -1 0.93 Adipose differentiation-related protein ADFP Hs.3416H69440 0.1872 914 1 0.93 NY-REN-25 antigen NY-REN-25 Hs.15301AA203234 0.1872 916 1 0.93 KIAA1728 protein KIAA1728 Hs.252748W74601 0.2339 916 1 0.93 Phosphotidylinositol transfer protein PITPN Hs.79709N24671 0.1225 917 -1 1 CGI-111 protein LOC51015 Hs.11085H57853 0.2038 917 1 0.93 CGI-43 protein LOC51622 Hs.289112R52021 0.2155 917 1 0.73 - - -W72686 0.1113 918 -1 0.93 Diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein) DBI Hs.78888R91793 0.1522 918 1 0.8 ESTs ESTs Hs.369100AA127687 0.1665 919 1 0.93 - - -AA043535 0.1665 919 -1 1 Lysophosphatidic acid acyltransferase-delta LPAAT-delta Hs.353175R84726 0.1715 919 1 1 Adenosine A1 receptor ADORA1 Hs.77867N48166 0.2403 919 -1 0.8 Histone deacetylase 11 HDAC11 Hs.74280R12704 0.1347 921 1 1 - - -H00267 0.1389 921 1 1 Hypothetical protein FLJ22955 FLJ22955 Hs.83097N42817 0.1766 921 1 0.97 Cytochrome c oxidase subunit VIc COX6C Hs.351875W68697 0.2339 921 -1 0.93 Hypothetical protein FLJ10998 FLJ10998 Hs.78110R12622 0.1715 923 1 1 FtsJ homolog 2 (E. coli) FTSJ2 Hs.279877R00802 0.1766 924 -1 0.93 ESTs ESTs Hs.191359R14520 0.1818 924 1 0.93 ESTs ESTs Hs.137129H26621 0.1187 925 1 1 Membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen) MCP Hs.83532R14307 0.1225 927 1 1 Low density lipoprotein receptor-related protein 4 LRP4 Hs.4930R60451 0.1225 928 1 1 N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase LOC51172 Hs.21334N59460 0.2096 928 -1 0.93 Hypothetical protein FLJ14824 FLJ14824 Hs.22399H43653 0.1522 929 1 1 Cytochrome c oxidase subunit VIII COX8 Hs.374980H15400 0.2038 929 1 1 Hypothetical protein FLJ12661 FLJ12661 Hs.318526R62209 0.2096 929 -1 0.8 - - Hs.120785AA037777 0.1766 930 -1 0.93 Phosphatidylinositol 4-kinase type II PI4KII Hs.25300N71958 0.2468 930 1 0.93 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa NDUFA9 Hs.75227R76834 0.274 930 1 0.87 Hypothetical protein FLJ10392 FLJ10392 Hs.20887

H48031 0.2038 931 1 0.93 Tankyrase 1 binding protein 1, 182kDa TNKS1BP1 Hs.9645R55335 0.1715 932 -1 1 - - -H03870 0.1265 933 1 1 Chromosome 20 open reading frame 18 C20orf18 Hs.247280AA149853 0.1477 934 -1 1 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4 CITED4 Hs.355820T84822 0.1617 934 1 1 TAR (HIV) RNA binding protein 1 TARBP1 Hs.151518R72217 0.1715 935 1 1 Acetyl-Coenzyme A carboxylase beta ACACB Hs.183857W33066 0.1477 938 -1 1 Mitochondrial ribosomal protein L9 MRPL9 Hs.288936AA044810 0.1715 938 1 0.93 KIAA0547 gene product KIAA0547 Hs.200596H00554 0.1347 939 1 1 Putative G-protein coupled receptor GPCR41 FLJ11856 Hs.6459W72937 0.1617 939 1 1 Caldesmon 1 CALD1 Hs.325474R76897 0.1569 940 1 1 Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) UBE2D3 Hs.118797AA010057 0.1522 941 -1 0.93 Thyroid hormone receptor interactor 11 TRIP11 Hs.85092AA046217 0.1926 941 -1 0.93 - - Hs.293821W47352 0.2602 941 -1 0.73 Ribosomal protein S6 kinase, 70kDa, polypeptide 2 RPS6KB2 Hs.103081R22967 0.1347 942 1 1 Hypothetical protein FLJ12442 FLJ12442 Hs.84753R91819 0.1872 942 1 1 Phosphoinositide-3-kinase, regulatory subunit, polypeptide 2 (p85 beta) PIK3R2 Hs.211586AA034317 0.2339 942 1 0.93 Candidate tumor suppressor protein LOC57107 Hs.16608R66879 0.1617 943 1 0.87 KIAA1911 protein KIAA1911 Hs.290931N24676 0.1665 943 -1 1 Chaperonin containing TCP1, subunit 4 (delta) CCT4 Hs.79150AA055220 0.1477 944 -1 0.93 Cell death regulator aven LOC57099 Hs.63168AA193393 0.1926 944 -1 0.87 Hypothetical protein FLJ20294 FLJ20294 Hs.7995W68755 0.1305 945 -1 0.93 Nucleotide binding protein 1 (MinD homolog, E. coli) NUBP1 Hs.81469H53827 0.1715 945 1 0.93 ESTs ESTs Hs.36822AA115289 0.1926 945 1 1 Huntingtin-associated protein interacting protein (duo) HAPIP Hs.8004N46182 0.2155 945 -1 1 ATP-binding cassette, sub-family A (ABC1), member 1 ABCA1 Hs.211562N92463 0.1766 946 1 0.93 - - -W90607 0.1872 946 1 1 Homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 HERPUD1 Hs.146393R11717 0.1981 946 1 0.93 Dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) DUSP11 Hs.14611H64822 0.1569 947 -1 1 RNA binding motif protein 8A RBM8A Hs.10283R12731 0.1715 947 1 0.93 Zinc finger protein 335 ZNF335 Hs.165983AA156753 0.1981 947 1 1 Chromosome 14 open reading frame 3 C14orf3 Hs.204041N36299 0.2215 947 -1 1 COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) COX10 Hs.77513N90248 0.1432 948 1 1 Suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) ST13 Hs.119222N66214 0.1569 948 -1 0.93 Aminopeptidase puromycin sensitive NPEPPS Hs.293007T87998 0.1665 948 1 0.93 ESTs ESTs Hs.16414N52681 0.2215 950 -1 0.87 Golgi complex associated protein 1, 60kDa GOCAP1 Hs.6831R72548 0.2602 950 -1 0.8 Serine/threonine kinase 11 interacting protein STK11IP Hs.22410H44228 0.2215 951 -1 1 Calcium/calmodulin-dependent protein kinase kinase 2, beta CAMKK2 Hs.108708T85558 0.2276 951 1 0.8 ESTs ESTs Hs.332720N24593 0.267 951 1 0.73 - - Hs.170538R59901 0.1617 952 1 0.93 Mevalonate kinase (mevalonic aciduria) MVK Hs.130607N36898 0.1522 954 -1 1 Similar to rat nuclear ubiquitous casein kinase 2 NUCKS Hs.118064AA028145 0.1617 954 -1 0.87 Tissue inhibitor of metalloproteinase 3 (Sorsby fundus dystrophy, pseudoinflammatory) TIMP3 Hs.245188R36970 0.2038 954 -1 0.93 Sec22 homolog SEC22A Hs.183655N32803 0.2276 955 -1 0.87 KIAA0494 gene product KIAA0494 Hs.62515N25352 0.1665 956 -1 1 Coxsackie virus and adenovirus receptor CXADR Hs.79187N22700 0.1766 956 -1 0.93 Hypothetical protein FLJ12584 FLJ12584 Hs.288897H87188 0.1981 957 -1 0.87 Hypothetical protein FLJ14511 FLJ14511 Hs.40919N91510 0.2215 957 -1 0.87 Hypothetical protein from EUROIMAGE 2107395 LOC58492 Hs.38004R66367 0.1981 958 1 0.87 ESTs ESTs Hs.118769T70340 0.2215 958 1 0.93 General transcription factor IIIC, polypeptide 3, 102kDa GTF3C3 Hs.90847T85305 0.2468 958 1 0.8 - - -AA040370 0.1569 959 1 1 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 CDS2 Hs.24812R48247 0.2096 960 1 0.87 Hypothetical protein MGC15429 MGC15429 Hs.79T83725 0.1389 961 1 1 KIAA1255 protein KIAA1255 Hs.351633R98214 0.1265 962 1 0.93 Chromosome 1 open reading frame 22 C1orf22 Hs.279951R54946 0.1569 962 1 1 - - -W25036 0.1818 963 -1 0.87 Hypothetical protein BC009925 LOC113246 Hs.9634H82729 0.1872 963 1 0.93 Homeo box C9 HOXC9 Hs.40408N73879 0.1113 965 -1 0.93 - - Hs.109553N25253 0.2468 965 1 0.87 Chromosome 5 open reading frame 8 C5orf8 Hs.75864N36070 0.1665 966 -1 1 Hypothetical protein DKFZp564A176 DKFZp564A176 Hs.322844R31649 0.2339 966 1 0.93 Huntingtin interacting protein 2 HIP2 Hs.155485R68921 0.2155 968 1 0.93 Exportin 1 (CRM1 homolog, yeast) XPO1 Hs.79090AA036844 0.267 968 -1 0.8 - - Hs.20000AA043836 0.1522 970 -1 1 Hypothetical protein BC009518 LOC90799 Hs.135265T69714 0.1715 970 -1 1 Polymerase (DNA directed), beta POLB Hs.180107R05889 0.1766 970 1 1 Chromosome 1 open reading frame 2 C1orf2 Hs.19554R87929 0.1225 971 1 1 H326 H326 Hs.110707H15640 0.1766 972 -1 1 - - Hs.279607H71112 0.1715 973 -1 0.93 MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae) MCM2 Hs.57101N27830 0.1872 973 1 1 - - Hs.43047N39021 0.3032 973 -1 0.8 Solute carrier family 20 (phosphate transporter), member 1 SLC20A1 Hs.78452T86389 0.1432 975 1 0.93 ESTs ESTs Hs.100640H43647 0.2534 975 1 1 Uncharacterized hematopoietic stem/progenitor cells protein MDS033 MDS033 Hs.54960T96045 0.3508 975 1 0.67 - - -N45679 0.1305 976 1 0.93 Likely ortholog of mouse variant polyadenylation protein CSTF-64 CSTF2T Hs.21992AA039275 0.1818 976 1 0.93 - - Hs.125073R13700 0.2339 976 1 0.8 Hypothetical protein MGC5442 MGC5442 Hs.238513N71552 0.267 976 -1 0.67 Hypothetical protein DKFZp434D1428 DKFZp434D142 Hs.321775H88039 0.1305 977 -1 1 - - Hs.55098AA028961 0.2155 977 1 0.87 Hypothetical protein FLJ12150 FLJ12150 Hs.118983W15390 0.1766 978 -1 1 Bone morphogenetic protein receptor, type IA BMPR1A Hs.2534T80623 0.3186 979 1 0.73 - - -N30036 0.1569 981 -1 0.93 Chorionic gonadotropin, beta polypeptide CGB Hs.348407AA043503 0.1872 981 -1 0.87 Down-regulator of transcription 1, TBP-binding (negative cofactor 2) DR1 Hs.16697N35883 0.3265 981 -1 0.83 Profilin 2 PFN2 Hs.91747H25547 0.1569 982 1 1 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34 DDX34 Hs.151706AA135452 0.1715 982 -1 1 CGG triplet repeat binding protein 1 CGGBP1 Hs.86041AA053340 0.2811 983 -1 0.73 - - Hs.109212AA007448 0.3345 983 -1 0.6 Retinoblastoma binding protein 4 RBBP4 Hs.16003H85363 0.1432 984 -1 1 - - -N52339 0.2096 984 -1 0.8 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) ELAVL1 Hs.12379H49724 0.1477 985 -1 1 KIAA1373 protein KIAA1373 Hs.16229N74271 0.1715 985 1 1 Membrane-bound transcription factor protease, site 1 MBTPS1 Hs.75890AA035052 0.2096 985 -1 0.87 Ornithine aminotransferase (gyrate atrophy) OAT Hs.75485R84594 0.267 986 1 1 Suppressor of G2 allele of SKP1, S. cerevisiae, homolog of SGT1 Hs.5169R86128 0.1432 987 1 1 Nucleoporin-like protein 1 NLP_1 Hs.168352AA028142 0.1766 987 -1 1 SLC2A4 regulator SLC2A4RG Hs.170088W19744 0.2155 987 1 0.93 - - Hs.180059

N90250 0.1872 988 -1 1 ESTs ESTs Hs.94881AA036873 0.2811 988 1 0.87 Chromosome 20 open reading frame 108 C20orf108 Hs.352413R51929 0.1522 989 1 0.97 KIAA0864 protein KIAA0864 Hs.84883W93379 0.1715 990 -1 0.87 NIMA (never in mitosis gene a)-related kinase 2 NEK2 Hs.153704H16828 0.267 990 1 0.87 Cyclic AMP phosphoprotein, 19 kD ARPP-19 Hs.7351W89053 0.1617 991 -1 1 Hypothetical protein FLJ20343 FLJ20343 Hs.252692T77328 0.1432 992 1 0.93 Similar to HYPOTHETICAL 34.0 KDA PROTEIN ZK795.3 IN CHROMOSOME IV MGC19606 Hs.91579H59065 0.1522 992 1 1 - - -R64079 0.267 993 -1 0.87 KIAA0592 protein KIAA0592 Hs.13273H17492 0.1715 995 1 1 DnaJ (Hsp40) homolog, subfamily B, member 2 DNAJB2 Hs.77768H57824 0.2534 995 1 0.87 ESTs ESTs Hs.128746T67521 0.2096 996 1 0.93 U2 small nuclear ribonucleoprotein auxiliary factor, small subunit 2 U2AF1RS2 Hs.171909AA057033 0.1981 997 1 0.93 - - Hs.103388N54113 0.2811 998 -1 0.8 Progesterone receptor membrane component 1 PGRMC1 Hs.90061H59203 0.1981 999 1 0.93 CDC6 cell division cycle 6 homolog (S. cerevisiae) CDC6 Hs.69563W00952 0.2468 999 1 0.8 ESTs ESTs Hs.118163H25840 0.1872 1000 1 1 V-crk sarcoma virus CT10 oncogene homolog (avian) CRK Hs.343220N35067 0.1522 1001 1 0.93 Cell division cycle 2-like 5 (cholinesterase-related cell division controller) CDC2L5 Hs.59498R54992 0.1926 1003 1 1 - - -R01105 0.1766 1005 1 1 ATP-binding cassette, sub-family E (OABP), member 1 ABCE1 Hs.12013R43082 0.2602 1005 -1 0.87 - - Hs.41974T66828 0.1926 1006 1 0.93 Hypothetical protein FLJ36748 FLJ36748 Hs.64313H10385 0.1389 1010 1 1 - - Hs.374535AA136889 0.1766 1010 -1 1 ESTs ESTs Hs.62578R98866 0.2038 1011 1 1 Proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein) PRG2 Hs.99962R18145 0.1981 1012 1 0.93 ESTs ESTs Hs.22381AA059201 0.2096 1012 -1 1 Ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) UBE2E3 Hs.4890N39397 0.1872 1013 -1 0.87 Brain acyl-CoA hydrolase BACH Hs.8679H74312 0.2403 1014 -1 0.87 Phosphatidic acid phosphatase type 2B PPAP2B Hs.173717AA055948 0.1766 1015 -1 1 Rho-associated, coiled-coil containing protein kinase 2 ROCK2 Hs.58617T75396 0.2276 1015 1 1 GMPR2 for guanosine monophosphate reductase isolog LOC51292 Hs.234546AA039437 0.2534 1015 -1 0.93 Solute carrier family 39 (zinc transporter), member 1 SLC39A1 Hs.7854R59435 0.2096 1016 1 0.93 HCCA2 protein HCCA2 Hs.19223R26854 0.1522 1017 1 1 - - Hs.261734W04706 0.2811 1017 -1 0.8 Hypothetical protein FLJ10300 FLJ10300 Hs.42233R51991 0.1522 1019 1 1 Similar to ubiquitin binding protein UBPH Hs.3459AA136755 0.2339 1019 1 0.87 ESTs ESTs Hs.29475AA029467 0.1187 1020 1 1 - - -W21233 0.2096 1020 -1 0.93 Hypothetical protein FLJ10496 FLJ10496 Hs.379807W45562 0.2339 1021 1 0.93 - - -R41426 0.1569 1022 1 1 ESTs ESTs Hs.175370R88034 0.1477 1023 1 1 Hypothetical protein MGC3101 MGC3101 Hs.301394N92710 0.1522 1023 -1 1 Cold inducible RNA binding protein CIRBP Hs.119475H60436 0.1766 1023 1 1 Hypothetical protein FLJ10422 FLJ10422 Hs.267905W56249 0.1818 1024 -1 0.93 - - Hs.80285H11807 0.2155 1024 -1 0.9 CTP synthase CTPS Hs.251871H78668 0.2276 1026 -1 0.93 - - Hs.189869H03349 0.3186 1027 1 0.8 DNA (cytosine-5-)-methyltransferase 3 alpha DNMT3A Hs.241565H83706 0.1872 1029 -1 0.93 ESTs ESTs Hs.141358AA152287 0.1766 1030 1 1 Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon NFKBIE Hs.182885N36068 0.1569 1031 -1 1 Nit protein 2 NIT2 Hs.15627H75548 0.2155 1031 -1 0.93 Tumor protein p53 binding protein, 1 TP53BP1 Hs.170263AA129848 0.2038 1032 1 1 Exosome component Rrp41 FLJ20591 Hs.343589AA135334 0.2276 1032 -1 0.93 TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa TAF1C Hs.153022H80760 0.1818 1035 1 1 Hypothetical protein BM-009 BM-009 Hs.92918R93621 0.2038 1035 1 0.87 Eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa EIF2S2 Hs.12163N74411 0.1305 1037 1 0.93 Trophinin associated protein (tastin) TROAP Hs.171955AA009926 0.2602 1037 -1 0.93 - - -R50640 0.3109 1038 -1 0.8 DKFZP564C186 protein DKFZP564C186Hs.134200AA151290 0.1522 1039 1 1 Double ring-finger protein, Dorfin DORFIN Hs.48320N91060 0.2096 1039 1 0.87 Vascular endothelial growth factor VEGF Hs.73793AA055986 0.2096 1040 -1 0.93 Chromosome 20 open reading frame 80 C20orf80 Hs.10726T78441 0.3032 1040 1 0.63 KIAA0553 protein KIAA0553 Hs.105749AA010640 0.1872 1041 1 1 N-myristoyltransferase 1 NMT1 Hs.111039H79768 0.2534 1041 -1 0.93 Activity-dependent neuroprotector ADNP Hs.3657AA041273 0.267 1041 -1 0.87 BRG1-binding protein ELD/OSA1 ELD/OSA1 Hs.73287N62464 0.2276 1042 -1 0.87 - - Hs.355530H92226 0.2602 1042 -1 0.87 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa TAF12 Hs.82037H89571 0.1715 1043 -1 0.93 - - -H92968 0.2403 1043 -1 0.93 - - -AA203723 0.3265 1043 -1 0.73 ESTs ESTs Hs.188016N48155 0.1818 1044 -1 1 - - Hs.46826H72121 0.2215 1045 1 0.8 Mitochondrial ribosomal protein S12 MRPS12 Hs.9964R35255 0.3032 1045 -1 0.73 - - Hs.283839W70336 0.3265 1045 -1 0.63 Hypothetical protein BC007540 LOC144097 Hs.63405AA053317 0.2403 1046 1 1 Bromodomain adjacent to zinc finger domain, 2B BAZ2B Hs.8383AA045295 0.3677 1046 -1 0.63 - - Hs.376116AA147010 0.1617 1049 -1 1 Hypothetical protein BC015148 LOC93081 Hs.13413H60343 0.1569 1050 1 0.93 Hypothetical protein LOC57143 LOC57143 Hs.15251W94597 0.1617 1050 1 1 ATPase, Ca++ transporting, plasma membrane 1 ATP2B1 Hs.78546AA054495 0.1818 1050 -1 0.87 - - -H80862 0.1818 1050 -1 0.87 Hypothetical protein KIAA1259 KIAA1259 Hs.40193T77588 0.1926 1051 -1 0.8 ESTs ESTs Hs.187466H46276 0.1926 1052 1 1 RNA, U17D small nucleolar RNU17D Hs.196769W93342 0.2038 1052 -1 0.8 Hypothetical protein FLJ22127 FLJ22127 Hs.59457N48615 0.2155 1055 -1 1 GS3955 protein GS3955 Hs.155418H05163 0.2155 1055 1 0.87 FGF receptor activating protein 1 FRAG1 Hs.133968T53417 0.2339 1055 -1 0.93 Purinergic receptor P2X, ligand-gated ion channel, 4 P2RX4 Hs.321709W39414 0.1432 1057 -1 0.93 ESTs ESTs Hs.55327N50068 0.1981 1057 -1 0.93 - - Hs.356733R13348 0.1617 1058 1 0.93 Plexin A1 PLXNA1 Hs.334666R46209 0.1926 1058 1 0.93 Phosphatidylglycerophosphate synthase PGS1 Hs.162604AA043365 0.1477 1059 -1 1 Origin recognition complex, subunit 4-like (yeast) ORC4L Hs.55055R69953 0.2155 1059 1 0.93 - - Hs.27552R25877 0.2276 1059 1 0.93 Hypothetical protein FLJ10511 FLJ10511 Hs.106768R76008 0.1432 1061 1 1 RAB11B, member RAS oncogene family RAB11B Hs.239018AA056998 0.1665 1061 1 1 - - -N98535 0.1872 1061 -1 1 Chromosome 20 open reading frame 7 C20orf7 Hs.44296R39529 0.1766 1063 1 1 Homolog of yeast long chain polyunsaturated fatty acid elongation enzyme 2 HELO1 Hs.250175H11653 0.1818 1064 1 1 - - -

R51977 0.1926 1064 1 0.93 KIAA1402 protein KIAA1402 Hs.86392AA131255 0.2096 1064 -1 0.87 AD24 protein AD24 Hs.74899N40345 0.1477 1065 1 0.93 Ras homolog gene family, member J ARHJ Hs.243010W32961 0.1766 1066 1 1 ESTs ESTs Hs.271125N75222 0.2339 1067 -1 1 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 28 DDX28 Hs.155049N76007 0.2811 1069 1 0.87 - - Hs.141648R42552 0.1981 1070 1 1 ESTs ESTs Hs.351142R43198 0.2276 1071 1 0.87 Nuclear factor (erythroid-derived 2)-like 3 NFE2L3 Hs.22900W02149 0.2468 1071 -1 0.87 Cell division cycle 2-like 1 (PITSLRE proteins) CDC2L1 Hs.214291T70741 0.1766 1073 1 1 - - Hs.293476T93721 0.2096 1073 1 0.87 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16 DDX16 Hs.12797R60241 0.2276 1073 1 0.8 Hypothetical protein FLJ21908 FLJ21908 Hs.26750R35530 0.2602 1075 -1 0.8 RAD23 homolog B (S. cerevisiae) RAD23B Hs.178658H92499 0.1715 1080 1 1 ESTs ESTs Hs.289083N43897 0.2339 1081 -1 0.87 Integrin beta 4 binding protein ITGB4BP Hs.5215R12025 0.1981 1085 1 0.93 Bifunctional apoptosis regulator BFAR Hs.168159H49229 0.2534 1085 -1 0.93 Hypothetical protein FLJ20040 FLJ20040 Hs.61960AA029328 0.2811 1085 -1 0.87 KIAA0073 protein KIAA0073 Hs.1191N29889 0.1872 1086 1 1 UBX domain containing 2 UBXD2 Hs.77495N51684 0.2096 1086 -1 1 - - Hs.47315T83158 0.1926 1089 -1 0.93 Hypothetical protein DJ328E19.C1.1 DJ328E19.C1.1 Hs.218329N48160 0.1665 1091 -1 0.87 - - Hs.43619R52828 0.2534 1091 1 0.87 Retinoic acid induced 14 RAI14 Hs.15165T50083 0.2534 1091 -1 0.73 ESTs ESTs Hs.22247R93504 0.1766 1092 -1 1 Rag C protein GTR2 Hs.110950AA010467 0.1926 1094 -1 0.93 Lysyl oxidase-like 1 LOXL1 Hs.65436R82847 0.267 1095 1 0.87 PHD finger protein 7 PHF7 Hs.30127AA043838 0.1981 1096 -1 0.93 Cleavage and polyadenylation specific factor 6, 68kDa CPSF6 Hs.64542AA099522 0.2468 1096 -1 0.8 Hypothetical protein FLJ11565 FLJ11565 Hs.61763R48311 0.2215 1097 1 0.93 - - -R13362 0.2884 1097 1 0.8 - - Hs.262716T82149 0.1766 1099 1 0.93 - - Hs.252873AA054041 0.2038 1099 -1 1 Protein kinase C substrate 80K-H PRKCSH Hs.1432H30688 0.2215 1100 1 0.93 - - -AA149043 0.2215 1100 -1 0.93 Type I transmembrane protein Fn14 FN14 Hs.10086R93168 0.2403 1100 -1 0.93 Immune associated nucleotide 4 like 1 (mouse) IAN4L1 Hs.26194AA151027 0.2155 1101 -1 0.87 Chromosome 21 open reading frame 108 C21orf108 Hs.18759N95253 0.2276 1101 -1 0.8 ESTs ESTs Hs.5669N90287 0.1872 1102 -1 0.87 - - -N54088 0.3763 1102 -1 0.73 - - Hs.96566N39072 0.1872 1103 -1 0.93 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 GNAI1 Hs.203862AA147542 0.1477 1104 -1 1 Serine/arginine repetitive matrix 1 SRRM1 Hs.18192R01912 0.1617 1104 1 1 Ubiquitin specific protease 7 (herpes virus-associated) USP7 Hs.78683R72179 0.1926 1105 1 1 Hypothetical protein DKFZp761H0421 DKFZp761H042 Hs.218182AA046956 0.2155 1105 -1 0.87 DAZ associated protein 1 DAZAP1 Hs.65588H56935 0.2468 1106 1 1 Hypothetical protein MGC32124 MGC32124 Hs.284163R70167 0.267 1107 1 0.87 Hypothetical protein MDS025 MDS025 Hs.154938AA057870 0.4593 1107 -1 0.6 Solute carrier family 26, member 10 SLC26A10 Hs.353207T81538 0.1926 1108 1 0.93 MADS box transcription enhancer factor 2, polypeptide B (myocyte enhancer factor 2B) MEF2B Hs.78881R17451 0.2215 1108 1 1 Male-enhanced antigen MEA Hs.278362T97034 0.2602 1108 1 0.67 KIAA0877 protein KIAA0877 Hs.11217H15287 0.2602 1110 -1 1 P21(CDKN1A)-activated kinase 6 PAK6 Hs.21420R76588 0.1926 1112 1 0.93 - - -AA039284 0.2534 1112 -1 0.87 Hypothetical protein FLJ10290 FLJ10290 Hs.25516R05455 0.2958 1112 1 0.87 Myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila) MLL5 Hs.333300R62439 0.1818 1113 1 0.87 - - -H44888 0.1715 1114 1 0.93 - - Hs.57483AA126734 0.2038 1114 -1 0.93 Downstream neighbor of SON DONSON Hs.17834R09420 0.1766 1115 1 1 Hypothetical protein FLJ20397 FLJ20397 Hs.272688N51855 0.274 1116 1 0.8 ADP-ribosyltransferase (NAD+; poly(ADP-ribose) polymerase)-like 2 ADPRTL2 Hs.24284R24816 0.1715 1118 1 1 KIAA0056 protein KIAA0056 Hs.13421AA151305 0.1872 1118 -1 0.93 DNA directed RNA polymerase II polypeptide J-related gene POLR2J2 Hs.375569R37626 0.2038 1119 1 0.87 - - Hs.6630R39303 0.2403 1120 1 0.93 Rab geranylgeranyltransferase, alpha subunit RABGGTA Hs.78920H38496 0.2811 1120 1 0.93 REV3-like, catalytic subunit of DNA polymerase zeta (yeast) REV3L Hs.115521R55789 0.2038 1121 -1 1 Amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like) APBA2 Hs.26468N95418 0.2602 1121 1 0.87 FK506 binding protein 8, 38kDa FKBP8 Hs.173464R86309 0.2602 1123 1 0.93 Vacuolar protein sorting 35 (yeast) VPS35 Hs.355901H03130 0.2811 1123 1 0.93 ESTs ESTs Hs.24370R83178 0.2155 1124 1 1 Hydroxysteroid (17-beta) dehydrogenase 7 HSD17B7 Hs.187579AA044639 0.3186 1124 -1 0.87 - - -N69464 0.1818 1125 -1 1 Hypothetical protein FLJ22087 FLJ22087 Hs.17230R98672 0.2038 1125 1 1 - - Hs.27004W85843 0.2215 1125 -1 1 - - Hs.101282W90601 0.267 1125 1 0.93 Hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctionHADHA Hs.75860N21661 0.2096 1126 -1 0.93 BMP-2 inducible kinase BIKE Hs.20137W52940 0.2534 1126 1 0.8 MIL1 protein MIL1 Hs.10267R40486 0.1818 1127 1 0.93 Mitogen-activated protein kinase kinase kinase 7 interacting protein 1 MAP3K7IP1 Hs.31472H59215 0.267 1127 1 0.93 Solute carrier family 25, member 13 (citrin) SLC25A13 Hs.9599N78968 0.2958 1127 -1 0.73 Diphtheria toxin receptor (heparin-binding epidermal growth factor-like growth factor) DTR Hs.799AA043491 0.2958 1127 1 0.83 Chromosome 6 open reading frame 1 C6orf1 Hs.62620H48016 0.2155 1128 1 1 - - -W38442 0.2534 1128 -1 0.93 Acidic 82 kDa protein mRNA HSU15552 Hs.85769H83025 0.2602 1130 1 0.93 ESTs ESTs Hs.151692R69610 0.3186 1130 1 0.73 B-cell receptor-associated protein BAP29 BAP29 Hs.27135H79508 0.2215 1131 -1 1 - - -N52646 0.2602 1131 -1 0.93 KIAA0144 gene product KIAA0144 Hs.8127AA035296 0.2276 1132 1 0.87 Vasodilator-stimulated phosphoprotein VASP Hs.93183AA116105 0.1926 1133 -1 1 - - Hs.351649H73169 0.2403 1133 -1 0.93 Hypothetical protein MGC2454 MGC2454 Hs.38399N33089 0.274 1133 -1 0.67 CGI-128 protein LOC51647 Hs.9825H43827 0.1617 1134 1 1 V-myc myelocytomatosis viral oncogene homolog (avian) MYC Hs.79070N28915 0.2038 1134 -1 1 Ceramide kinase CERK Hs.34516N48163 0.267 1134 -1 0.8 Hypothetical protein MGC13186 MGC13186 Hs.16034AA047258 0.2038 1135 -1 0.93 TNF receptor-associated factor 5 TRAF5 Hs.29736N93130 0.2096 1135 -1 0.93 Glutamate-cysteine ligase, modifier subunit GCLM Hs.89709AA001906 0.267 1135 -1 0.87 Thyroid hormone receptor-associated protein, 240 kDa subunit TRAP240 Hs.11861W44535 0.2276 1136 -1 0.87 Neurochondrin NCDN Hs.94653AA037360 0.274 1136 1 0.8 - - Hs.90960AA134766 0.2155 1137 1 0.93 Chromosome 7 open reading frame 11 C7orf11 Hs.66666

AA129763 0.1872 1138 1 1 Hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctionHADHB Hs.146812H61280 0.2884 1138 1 0.8 - - -AA056752 0.3109 1139 -1 0.67 Hypothetical protein FLJ20568 FLJ20568 Hs.279581W32039 0.1617 1140 -1 1 Hypothetical protein dJ37E16.5 DJ37E16.5 Hs.5790T86448 0.1926 1141 1 0.87 - - -H82057 0.267 1141 -1 0.93 - - Hs.372741H73053 0.1617 1142 -1 1 Von Hippel-Lindau syndrome VHL Hs.174007AA040506 0.1926 1142 -1 0.93 - - Hs.251865AA152194 0.1926 1142 -1 0.93 Hypothetical protein FLJ37312 FLJ37312 Hs.181480N80145 0.2215 1142 1 1 ESTs ESTs Hs.50873AA047388 0.1981 1143 -1 0.93 Hepatitis C virus core-binding protein 6 HCBP6 Hs.283674W24394 0.2276 1143 1 0.87 Alpha-2-macroglobulin A2M Hs.74561R27100 0.274 1145 1 0.87 Hypothetical protein FLJ10826 FLJ10826 Hs.24809R33031 0.2811 1145 1 0.93 Adaptor-related protein complex 3, sigma 2 subunit AP3S2 Hs.154782N79456 0.1347 1147 -1 1 Ferritin, heavy polypeptide 1 FTH1 Hs.62954N77703 0.1766 1147 -1 0.93 Unknown MGC21654 product MGC21654 Hs.95631AA040372 0.2468 1147 -1 1 Proline-rich protein HaeIII subfamily 1 PRH1 Hs.278469H52618 0.1665 1148 1 1 - - -AA044021 0.1715 1148 -1 1 Cyclin C CCNC Hs.118442AA034109 0.3109 1149 1 0.87 Misshapen/NIK-related kinase MINK Hs.112028R19913 0.2884 1150 -1 0.87 ESTs ESTs Hs.22860H23269 0.1818 1151 1 0.93 Vacuolar protein sorting 41 (yeast) VPS41 Hs.180941R49227 0.1926 1151 1 0.93 - - Hs.13702H40662 0.2339 1151 -1 0.93 - - -H28872 0.2096 1153 1 0.93 Aspartyl-tRNA synthetase DARS Hs.80758T78019 0.274 1153 1 0.87 - - Hs.5461N94606 0.274 1154 -1 0.73 HSCARG protein HSCARG Hs.288969N36402 0.2276 1155 1 0.87 Hypothetical protein PRO2032 PRO2032 Hs.372571H51373 0.2276 1155 -1 0.93 - - -W47644 0.2096 1156 -1 0.87 Transmembrane 4 superfamily member 7 TM4SF7 Hs.26518H24050 0.1981 1157 -1 0.93 ESTs ESTs Hs.28039H12710 0.3109 1157 -1 0.83 KIAA0802 protein KIAA0802 Hs.27657T79066 0.4212 1157 1 0.73 Hypothetical protein FLJ10460 FLJ10460 Hs.14347R53661 0.267 1158 1 0.8 Phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila) PDE4D Hs.172081AA044383 0.2215 1159 -1 0.93 Interferon regulatory factor 2 IRF2 Hs.83795AA131302 0.2339 1159 1 0.93 - - Hs.71404W47002 0.2534 1159 -1 0.87 Non-metastatic cells 2, protein (NM23B) expressed in NME2 Hs.275163R70784 0.2276 1160 1 1 MCT-1 protein MCT-1 Hs.102696W90758 0.2038 1163 1 1 Hypothetical protein FLJ10514 FLJ10514 Hs.59346R71647 0.2276 1163 -1 1 Pleckstrin homology, Sec7 and coiled/coil domains 3 PSCD3 Hs.7984AA054454 0.274 1164 -1 0.73 Proteasome (prosome, macropain) subunit, alpha type, 1 PSMA1 Hs.82159H95380 0.2339 1165 1 1 Hydroxysteroid (17-beta) dehydrogenase 7 HSD17B7 Hs.187579H47495 0.1715 1166 1 1 Hypothetical protein MGC15504 MGC15504 Hs.13810H04530 0.274 1166 -1 0.93 Enoyl Coenzyme A hydratase, short chain, 1, mitochondrial ECHS1 Hs.76394H08978 0.2884 1166 1 0.73 Calcium channel, voltage-dependent, beta 3 subunit CACNB3 Hs.250712R51134 0.2339 1168 1 0.93 ESTs ESTs Hs.378118R91050 0.2534 1168 1 0.67 Endoplasmic reticulum resident protein 44 kDa ERp44 Hs.154023N31721 0.2215 1169 -1 0.93 DKFZP434N161 protein DKFZP434N161Hs.284208R65863 0.2534 1169 1 0.7 Ring finger protein 13 RNF13 Hs.6900N27628 0.2884 1169 -1 0.87 - - -T85113 0.2403 1174 1 0.93 Tumor protein, translationally-controlled 1 TPT1 Hs.279860AA053876 0.1872 1175 -1 0.93 DKFZP586M1523 protein DKFZP586M152Hs.22981N58733 0.1872 1175 -1 0.87 - - -AA130176 0.3186 1175 -1 0.8 SNF-1 related kinase SNRK Hs.79025N68160 0.2155 1176 -1 0.87 Hypothetical protein FLJ23306 FLJ23306 Hs.5890R37031 0.2811 1176 1 0.93 G protein-coupled receptor 108 GPR108 Hs.167641W33069 0.3032 1177 1 0.87 SFRS protein kinase 2 SRPK2 Hs.78353T88719 0.2276 1178 -1 1 Baculoviral IAP repeat-containing 5 (survivin) BIRC5 Hs.1578H09731 0.267 1178 -1 0.87 - - Hs.7133R77598 0.274 1179 -1 0.93 Hypothetical protein FLJ22530 FLJ22530 Hs.14570H06560 0.2811 1179 -1 0.93 F-box and leucine-rich repeat protein 11 FBXL11 Hs.219614AA045634 0.2958 1179 -1 0.8 ESTs ESTs Hs.364644AA099489 0.2468 1181 -1 0.8 KIAA0111 gene product KIAA0111 Hs.79768R01677 0.267 1181 -1 0.93 Ring finger protein 4 RNF4 Hs.66394AA055863 0.2884 1181 1 1 Cytoskeleton-associated protein 4 CKAP4 Hs.74368R48434 0.2811 1183 1 0.8 ESTs ESTs Hs.25560W88660 0.2038 1184 1 1 DKFZP586F1524 protein DKFZP586F152 Hs.241543R61777 0.2155 1184 1 0.87 Hypothetical protein MGC14421 MGC14421 Hs.334713H51386 0.2215 1184 1 0.93 KIAA0202 protein KIAA0202 Hs.80712AA101835 0.2468 1184 -1 0.87 - - Hs.374524R38502 0.412 1184 1 0.87 Hypothetical protein FLJ13154 FLJ13154 Hs.25303H88464 0.2096 1185 -1 0.93 KIAA0560 gene product KIAA0560 Hs.129952AA043767 0.2811 1185 -1 0.93 Runt-related transcription factor 1 (acute myeloid leukemia 1; aml1 oncogene) RUNX1 Hs.129914AA133284 0.3032 1185 1 0.93 Hypothetical protein FLJ40452 FLJ40452 Hs.339834AA036871 0.2811 1187 1 1 DnaJ (Hsp40) homolog, subfamily A, member 2 DNAJA2 Hs.21189T96983 0.2403 1189 1 0.93 Cerebroside (3'-phosphoadenylylsulfate:galactosylceramide 3') sulfotransferase CST Hs.17958R17452 0.2403 1189 -1 1 ATPase, Class II, type 9B ATP9B Hs.91471H26130 0.2602 1190 1 0.93 Hypothetical protein PRO1580 PRO1580 Hs.270863R54308 0.3265 1192 -1 0.93 SLIT-ROBO Rho GTPase-activating protein 2 SRGAP2 Hs.5003AA148637 0.2534 1193 -1 0.93 Neurofascin NFASC Hs.13349N23137 0.274 1194 -1 0.93 M-phase phosphoprotein 9 MPHOSPH9 Hs.351230R00834 0.2884 1194 1 0.73 SLIT-ROBO Rho GTPase-activating protein 1 SRGAP1 Hs.18995W87502 0.2038 1195 -1 1 - - Hs.356201N74625 0.2276 1195 -1 0.87 - - -H17934 0.267 1195 1 1 Hypothetical protein MGC11287 similar to ribosomal protein S6 kinase , MGC11287 Hs.194286R18357 0.2215 1196 1 0.9 KIAA1045 protein KIAA1045 Hs.7989AA010396 0.267 1198 -1 0.93 - - Hs.58210AA039428 0.2468 1199 -1 0.87 - - -R09933 0.1981 1201 1 1 - - Hs.355762N24364 0.267 1201 -1 1 Hypothetical protein FLJ13154 FLJ13154 Hs.25303R51031 0.1981 1202 1 1 - - Hs.349283N92448 0.2403 1203 -1 0.93 Transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47) TCF3 Hs.101047T98615 0.2468 1204 1 0.93 Mitogen-activated protein kinase kinase kinase 10 MAP3K10 Hs.30223H43176 0.3109 1204 1 0.87 Calcium homeostasis endoplasmic reticulum protein CHERP Hs.6430H27559 0.2339 1205 1 0.87 Conserved gene telomeric to alpha globin cluster CGTHBA Hs.19699H82142 0.1766 1206 -1 0.93 PC326 protein PC326 Hs.279882N22229 0.2096 1206 -1 0.93 Protein phosphatase 1, catalytic subunit, gamma isoform PPP1CC Hs.79081W42426 0.3265 1206 1 0.7 Iron-responsive element binding protein 2 IREB2 Hs.370324R81939 0.1569 1207 1 0.87 - - Hs.13396H04597 0.1981 1207 1 1 Inner membrane protein, mitochondrial (mitofilin) IMMT Hs.78504

H11052 0.2155 1207 1 0.93 Kinesin family member 3C KIF3C Hs.21611R25990 0.2215 1207 1 0.87 Telomeric repeat binding factor (NIMA-interacting) 1 TERF1 Hs.194562AA055314 0.2811 1208 -1 0.8 RAB14, member RAS oncogene family RAB14 Hs.5807H01504 0.274 1209 1 0.87 - - -W51986 0.3345 1210 1 0.73 - - -W19663 0.2811 1211 1 0.7 KIAA0103 gene product KIAA0103 Hs.154387W37491 0.2403 1212 -1 0.8 Biliverdin reductase B (flavin reductase (NADPH)) BLVRB Hs.76289H89827 0.2468 1212 1 0.93 RAS p21 protein activator (GTPase activating protein) 3 (Ins(1,3,4,5)P4-binding protein) GAP1IP4BP Hs.119274N22132 0.2602 1212 -1 1 - - Hs.310359W02089 0.2534 1213 1 0.83 Hypothetical protein PRO1843 PRO1843 Hs.283330AA057856 0.2958 1213 1 0.93 ESTs ESTs Hs.63344N48161 0.1872 1214 -1 0.93 Upstream transcription factor 2, c-fos interacting USF2 Hs.93649H08432 0.2811 1214 1 0.83 RNA, U transporter 1 RNUT1 Hs.21577N36898 0.267 1216 -1 0.93 Similar to rat nuclear ubiquitous casein kinase 2 NUCKS Hs.118064W73506 0.2403 1217 -1 0.87 Activated RNA polymerase II transcription cofactor 4 PC4 Hs.349506H57835 0.2534 1217 -1 0.83 Hypothetical protein LOC51240 LOC51240 Hs.7870N90523 0.2038 1218 1 1 Methionyl-tRNA formyltransferase, mitochondrial MtFMT Hs.54627R34842 0.2339 1218 -1 1 ESTs ESTs Hs.24185R25019 0.267 1219 1 1 ESTs ESTs Hs.21364AA011688 0.2958 1220 -1 0.87 ATP-dependant interferon responsive ADIR Hs.26267W40227 0.3186 1220 -1 0.73 Nucleobindin 2 NUCB2 Hs.3164AA011595 0.3186 1220 1 0.7 Zinc finger protein 38 ZNF38 Hs.20082R55277 0.2155 1221 1 0.93 KIAA1143 protein KIAA1143 Hs.173042R74477 0.2215 1222 1 1 Microtubule-associated proteins 1A/1B light chain 3 MAP1A/1BLC3 Hs.121849AA131747 0.2468 1222 1 0.87 Scribble SCRIB Hs.239784AA148906 0.2468 1223 -1 1 Tumor rejection antigen (gp96) 1 TRA1 Hs.82689H16254 0.3592 1223 1 0.6 Pannexin 1 PANX1 Hs.30985AA036635 0.2155 1224 1 1 - - Hs.168450R88980 0.2602 1225 1 0.87 - - Hs.285165N77925 0.2038 1227 -1 0.93 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa NDUFA1 Hs.74823H50923 0.2339 1227 1 0.87 KIAA0747 protein KIAA0747 Hs.8309R92833 0.2096 1228 1 1 - - Hs.285519N62617 0.2602 1228 -1 0.87 Hypothetical protein CL640 CL640 Hs.44563N51466 0.3508 1230 1 0.8 - - -AA058398 0.2884 1231 1 1 - - Hs.6670R42555 0.3032 1232 1 1 KIAA0494 gene product KIAA0494 Hs.62515R50698 0.3426 1232 1 0.8 KIAA1938 protein KIAA1938 Hs.25734R15336 0.3763 1232 1 0.67 KIAA0673 protein KIAA0673 Hs.106487AA203387 0.3763 1234 -1 0.93 Trophinin associated protein (tastin) TROAP Hs.171955R31383 0.2958 1235 1 0.73 Hypothetical protein FLJ31131 FLJ31131 Hs.23853T78200 0.2602 1237 1 0.8 Hypothetical protein HSPC213 HSPC213 Hs.170219R52844 0.2534 1238 -1 0.87 - - Hs.356786R59109 0.3508 1238 1 0.8 A kinase (PRKA) anchor protein (yotiao) 9 AKAP9 Hs.58103T86807 0.2276 1240 1 0.93 Serine/threonine kinase 19 STK19 Hs.444N46171 0.2534 1241 -1 0.87 Hypothetical protein FLJ32001 FLJ32001 Hs.288742H84793 0.2038 1242 1 1 - - -H29171 0.2811 1242 -1 1 DKFZP564A2416 protein DKFZP564A241 Hs.5297H26012 0.2958 1244 -1 0.8 - - Hs.102558N29139 0.2155 1245 -1 1 V-jun sarcoma virus 17 oncogene homolog (avian) JUN Hs.78465AA027815 0.3426 1245 1 0.8 KIAA1311 protein KIAA1311 Hs.61441R93684 0.3508 1245 1 0.73 Hypothetical protein My014 MY014 Hs.67619AA056513 0.2096 1246 -1 1 Glutaredoxin 2 GLRX2 Hs.5054T78280 0.3426 1246 1 0.93 Histone acetyltransferase 1 HAT1 Hs.13340R31858 0.2096 1247 1 0.87 Kaiso ZNF-kaiso Hs.143604N51794 0.274 1247 -1 1 Transforming growth factor, beta-induced, 68kDa TGFBI Hs.118787AA036778 0.3109 1247 -1 0.8 - - -N72505 0.2215 1249 1 0.87 Hypothetical protein MGC5508 MGC5508 Hs.13662W02900 0.2339 1251 -1 0.87 Cytochrome P450, subfamily I (dioxin-inducible), polypeptide 1 (glaucoma 3, primary infantile) CYP1B1 Hs.154654R69571 0.3032 1252 1 0.8 CDA14 LOC51290 Hs.26813H21785 0.2811 1253 1 0.87 Zinc finger protein 91 homolog (mouse) ZFP91 Hs.46366H45307 0.2811 1253 1 0.87 Dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 DYRK4 Hs.17154AA210890 0.2339 1254 -1 1 - - -T80951 0.274 1254 1 0.8 Replication protein A1, 70kDa RPA1 Hs.84318R81830 0.3508 1257 1 0.4 Zinc finger protein 217 ZNF217 Hs.155040W15360 0.1766 1259 -1 0.93 Epidermal growth factor receptor pathway substrate 8-related protein 1 EPS8R1 Hs.28907R74114 0.2403 1261 -1 0.93 - - Hs.285833N43952 0.2534 1261 1 0.8 - - Hs.236443H85447 0.2276 1262 -1 0.87 - - -H22064 0.274 1262 1 0.87 PHD zinc finger transcription factor PF1 Hs.135890AA192730 0.3345 1262 -1 0.8 - - -AA010668 0.2215 1263 -1 0.87 Protein tyrosine phosphatase, receptor type, C-associated protein PTPRCAP Hs.155975H10223 0.2468 1263 -1 0.8 - - Hs.63368AA043201 0.2468 1263 1 0.93 - - Hs.179891N59242 0.3109 1263 -1 0.73 Hypothetical protein HH114 HH114 Hs.48348N29496 0.2403 1265 1 1 ESTs ESTs Hs.44041N29422 0.2811 1265 1 0.8 Matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase) MMP2 Hs.111301R52958 0.3032 1265 1 0.73 Calcium channel, voltage-dependent, gamma subunit 4 CACNG4 Hs.331904R86741 0.3265 1265 1 0.73 HRD1 protein HRD1 Hs.334819R60357 0.2468 1266 1 0.87 Alanyl-tRNA synthetase AARS Hs.75102H71225 0.2096 1267 1 1 KIAA1673 KIAA1673 Hs.301444H18988 0.2215 1267 -1 0.93 Hypothetical protein FLJ12242 FLJ12242 Hs.94810H52616 0.2884 1268 -1 1 Beta-amyloid binding protein precursor BBP Hs.333541AA053322 0.2958 1268 -1 0.87 - - -N24229 0.3345 1268 -1 0.8 Polypyrimidine tract binding protein 1 PTBP1 Hs.172550AA046481 0.1981 1269 -1 0.93 Chloride channel 6 CLCN6 Hs.211614N32620 0.2215 1270 -1 0.87 CGI-36 protein LOC51078 Hs.182986AA130098 0.3763 1271 -1 0.73 - - Hs.44829N75042 0.2276 1272 -1 0.87 V-rel reticuloendotheliosis viral oncogene homolog A, nuclear factor of kappa light polypeptide gene enhancer in B-ceRELA Hs.75569W03928 0.2468 1273 -1 0.93 Ribosomal protein S8 RPS8 Hs.151604N79531 0.2534 1274 1 1 Hypothetical protein MGC2714 MGC2714 Hs.74284AA054468 0.3677 1274 -1 0.67 - - Hs.356385AA057871 0.2155 1275 -1 0.93 DNA-damage-inducible transcript 3 DDIT3 Hs.337761H96259 0.2155 1275 -1 0.87 Similar to putative transmembrane protein; homolog of yeast Golgi membrane protein Yif1p (Yip1p-interacting factor)LOC90522 Hs.334725H15848 0.2534 1275 -1 0.87 - - Hs.31388N63833 0.1872 1276 1 1 Glucosamine (N-acetyl)-6-sulfatase (Sanfilippo disease IIID) GNS Hs.334534T72626 0.2403 1276 1 0.87 Hypothetical protein DJ971N18.2 DJ971N18.2 Hs.169358N94608 0.3265 1276 -1 0.6 Interferon gamma receptor 2 (interferon gamma transducer 1) IFNGR2 Hs.177559W91979 0.2534 1277 -1 0.93 24-dehydrocholesterol reductase DHCR24 Hs.75616AA036798 0.3508 1277 -1 0.63 - - Hs.339024AA059131 0.2602 1278 -1 0.93 BTB (POZ) domain containing 1 BTBD1 Hs.21332

T67217 0.3032 1278 -1 0.8 Hypothetical protein MGC3207 MGC3207 Hs.372737N93458 0.2468 1279 1 0.93 Ubiquinol-cytochrome c reductase core protein II UQCRC2 Hs.173554H56534 0.3265 1280 -1 0.87 - - -N31486 0.2602 1281 -1 0.87 Hypothetical protein FLJ37562 FLJ37562 Hs.356734R63808 0.2403 1282 1 0.87 TSPY-like TSPYL Hs.278479H23211 0.2403 1282 1 1 Hypothetical protein MGC3077 MGC3077 Hs.288649N42273 0.3265 1282 1 0.73 Signal-induced proliferation-associated gene 1 SIPA1 Hs.7019W32666 0.274 1283 -1 0.8 TNFRSF1A-associated via death domain TRADD Hs.89862T97531 0.3265 1283 1 0.93 - - -AA026902 0.4029 1283 -1 0.6 GDP-fucose transporter 1 FLJ11320 Hs.12211T85094 0.274 1284 1 0.87 Hypothetical protein FLJ20725 FLJ20725 Hs.15467AA026852 0.2468 1285 1 0.87 Chromosome 20 open reading frame 67 C20orf67 Hs.272814W39284 0.267 1285 -1 0.87 Pumilio homolog 1 (Drosophila) PUM1 Hs.153834AA150909 0.274 1286 -1 0.67 - - -T66763 0.2884 1287 -1 0.8 Hypothetical protein MGC4276 similar to CG8198 MGC4276 Hs.177776AA150315 0.2958 1288 -1 0.87 Chromosome 5 open reading frame 3 C5orf3 Hs.166551W15155 0.2038 1289 -1 1 - - -H14058 0.2403 1290 1 0.93 Similar to HYPOTHETICAL 43.1 KD TRP-ASP REPEATS CONTAINING PROTEIN K04G11.4 IN CHROMOSOME XLOC197336 Hs.12705N53940 0.274 1290 -1 1 Hypothetical protein MGC20481 MGC20481 Hs.324127H83024 0.2884 1290 1 0.87 Phosphatidylethanolamine N-methyltransferase PEMT Hs.15192T85009 0.3109 1290 -1 0.87 Hypothetical protein FLJ32203 FLJ32203 Hs.351706W87527 0.1872 1291 -1 1 Hypothetical protein PNAS-131 PNAS-131 Hs.37883R38964 0.2339 1292 1 1 - - -H20945 0.2534 1292 -1 0.87 - - Hs.379958AA010958 0.2602 1292 -1 0.87 Myogenic factor 6 (herculin) MYF6 Hs.35937AA126385 0.3109 1292 1 0.93 Hypothetical protein BC010736 LOC92609 Hs.355819N20508 0.3032 1293 1 0.73 Fidgetin FIGN Hs.274281R18742 0.2602 1294 1 0.93 KIAA1896 protein KIAA1896 Hs.5476T52348 0.274 1294 -1 0.8 Hypothetical protein FLJ40629 FLJ40629 Hs.99807H51316 0.3032 1294 1 0.67 Sestrin 2 SES2 Hs.8026H51270 0.2468 1296 1 0.67 Ubiquitously transcribed tetratricopeptide repeat gene, X chromosome UTX Hs.13980H59677 0.4496 1296 -1 0.53 Hypothetical protein FLJ13909 FLJ13909 Hs.288672N63014 0.2534 1298 -1 1 Poly (ADP-ribose) glycohydrolase PARG Hs.91390AA043061 0.3032 1298 -1 0.93 - - Hs.352417T84447 0.1766 1299 1 1 - - -H85554 0.3109 1299 1 0.8 V-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog KRAS2 Hs.351221R59926 0.2534 1303 1 0.87 Paired basic amino acid cleaving enzyme (furin, membrane associated receptor protein) PACE Hs.59242AA010875 0.3186 1304 -1 0.6 Proteasome (prosome, macropain) subunit, alpha type, 1 PSMA1 Hs.82159N95807 0.2958 1305 1 0.87 Insulin-like growth factor binding protein 4 IGFBP4 Hs.1516R25125 0.385 1307 -1 0.67 NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa NDUFC2 Hs.193313W23575 0.1872 1308 -1 0.93 Phosphofructokinase, platelet PFKP Hs.99910AA210725 0.2534 1308 1 1 ESTs ESTs Hs.365595R72425 0.2811 1308 1 0.93 HLA-B associated transcript 1 BAT1 Hs.55296N34328 0.2884 1308 -1 0.93 KIAA1641 protein KIAA1641 Hs.44566H95221 0.2884 1309 1 0.8 Hypothetical protein MGC12972 MGC12972 Hs.13972N73885 0.2811 1311 -1 0.87 CDA02 protein CDA02 Hs.332404N33831 0.1926 1312 1 1 Glutathione peroxidase 4 (phospholipid hydroperoxidase) GPX4 Hs.2706H80533 0.3186 1312 1 0.6 Interleukin 1 receptor accessory protein IL1RAP Hs.173880AA031576 0.2339 1313 -1 0.9 - - Hs.143812T95126 0.3592 1313 1 0.87 - - -N67708 0.2958 1314 -1 0.8 Hypothetical protein FLJ20644 FLJ20644 Hs.49376R34225 0.2958 1314 1 0.87 KIAA0998 protein KIAA0998 Hs.131525T86593 0.2534 1315 1 0.93 ESTs ESTs Hs.16222AA137220 0.2534 1315 1 0.8 - - Hs.83286W51779 0.2602 1315 1 0.93 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 SMARCE1 Hs.332848AA040295 0.3265 1316 -1 0.8 Formin homology 2 domain containing 1 FHOD1 Hs.95231R98462 0.274 1317 -1 0.93 Likely ortholog of mouse Abl-philin 2 APH2 Hs.76662N47654 0.3186 1317 -1 0.87 KIAA0140 gene product KIAA0140 Hs.156016N95293 0.2403 1318 -1 1 SPPL2b SPPL2B Hs.284161R34925 0.3186 1318 1 0.73 Phospholipase D1, phophatidylcholine-specific PLD1 Hs.82587H70682 0.2155 1319 1 0.83 Propionyl Coenzyme A carboxylase, alpha polypeptide PCCA Hs.80741N28292 0.2811 1319 -1 0.87 Sec23-interacting protein p125 P125 Hs.300208N92858 0.3265 1320 -1 0.93 U6 snRNA-associated Sm-like protein LSM4 Hs.76719T79625 0.274 1321 1 0.87 ESTs ESTs Hs.14064N75519 0.274 1322 1 0.87 - - Hs.367854H18113 0.3186 1322 1 0.8 - - Hs.379038N36953 0.1981 1323 -1 1 Deoxycytidine kinase DCK Hs.709N91929 0.2534 1323 1 0.93 Hypothetical protein FLJ12799 FLJ12799 Hs.22549H11384 0.3508 1323 -1 0.67 - - Hs.352554AA024415 0.385 1323 -1 0.67 Keratin 1 (epidermolytic hyperkeratosis) KRT1 Hs.80828AA053007 0.4212 1323 1 0.8 Putative receptor protein PMI Hs.15196AA213541 0.2811 1324 1 0.87 Ninein (GSK3B interacting protein) NIN Hs.44054R00402 0.3508 1324 1 0.83 - - Hs.380859R70785 0.2602 1325 1 0.87 Chromosome 8 open reading frame 2 C8orf2 Hs.125849AA059125 0.412 1326 -1 0.73 Filamin B, beta (actin binding protein 278) FLNB Hs.81008H16663 0.2468 1327 1 0.87 HSPC049 protein HSPC049 Hs.172622N76256 0.2602 1327 -1 0.87 Tubulin, gamma complex associated protein 3 TUBGCP3 Hs.9884N94625 0.2884 1327 -1 0.93 Protein x 013 AD-020 Hs.82933AA010349 0.2276 1328 1 0.87 Slingshot 1 SSH1 Hs.60377H25157 0.2534 1328 1 1 - - -AA029802 0.3109 1328 1 0.73 High density lipoprotein binding protein (vigilin) HDLBP Hs.177516W38730 0.4891 1328 -1 0.47 Poly(rC) binding protein 2 PCBP2 Hs.63525R12051 0.2403 1330 -1 1 - - Hs.264915W90379 0.2811 1330 -1 0.87 - - -R68381 0.2602 1331 1 0.93 - - -AA029050 0.267 1331 -1 1 - - -W02280 0.3186 1331 -1 0.67 - - Hs.374582N27544 0.2534 1334 -1 1 Cell division cycle 27 CDC27 Hs.172405H63197 0.2958 1334 1 0.77 KIAA0251 protein KIAA0251 Hs.343566H44375 0.2534 1336 1 0.87 Regulatory factor X-associated ankyrin-containing protein RFXANK Hs.296776W17221 0.3592 1336 1 0.87 Hypothetical protein MGC2217 MGC2217 Hs.323164N33439 0.4691 1336 -1 0.6 Eukaryotic translation elongation factor 2 EEF2 Hs.75309H06279 0.2403 1338 1 0.9 Hypothetical protein DKFZp762M136 DKFZp762M136Hs.351747AA156864 0.3345 1338 1 0.8 Hypothetical protein IMAGE3455200 IMAGE3455200 Hs.324844H12660 0.2403 1340 1 0.9 Sarcolemma associated protein SLMAP Hs.4007N50403 0.267 1340 -1 0.87 Nucleosome assembly protein 1-like 1 NAP1L1 Hs.302649R71158 0.2811 1341 1 0.87 Catenin (cadherin-associated protein), delta 1 CTNND1 Hs.166011N91920 0.3426 1342 -1 0.73 - - -T86121 0.3677 1342 -1 0.87 ESTs ESTs Hs.191445T86315 0.2468 1343 1 1 Ribonuclease, RNase A family, 2 (liver, eosinophil-derived neurotoxin) RNASE2 Hs.728

W81465 0.267 1344 -1 1 Mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase MGAT1 Hs.151513H16646 0.3109 1345 1 0.8 Hypothetical protein PP591 PP591 Hs.118666H04610 0.3265 1345 1 0.73 Splicing factor 3a, subunit 1, 120kDa SF3A1 Hs.334691R71650 0.2276 1346 1 0.87 MUM2 protein MUM2 Hs.24379H77636 0.3186 1346 -1 0.73 CD68 antigen CD68 Hs.246381N93056 0.2403 1347 -1 1 Mitochondrial ribosomal protein L14 MRPL14 Hs.343579H21780 0.267 1347 1 0.87 Craniofacial development protein 1 CFDP1 Hs.296460N/A2 0.3109 1347 1 0.73 - - -N43008 0.3265 1347 -1 0.87 Nuclear antigen Sp100 SP100 Hs.77617N28734 0.3763 1348 1 0.87 Ring finger protein (C3H2C3 type) 6 RNF6 Hs.32597N89606 0.274 1349 -1 0.93 Mitochondrial ribosomal protein S36 MRPS36 Hs.41182N99927 0.2811 1349 -1 0.87 Beta-1,4 mannosyltransferase HMT-1 Hs.44592H01598 0.1665 1350 1 1 Translocating chain-associating membrane protein TRAM Hs.4147AA045130 0.2884 1351 1 0.93 Hypothetical protein FLJ10761 FLJ10761 Hs.343154AA032065 0.2096 1352 -1 1 Hypothetical protein BC002942 BC002942 Hs.150540AA045904 0.2403 1352 1 0.8 6-pyruvoyltetrahydropterin synthase PTS Hs.366R60986 0.3426 1353 -1 0.8 - - Hs.348282H85213 0.3109 1354 1 0.87 - - Hs.30909W67427 0.2339 1355 1 1 Prolylcarboxypeptidase (angiotensinase C) PRCP Hs.75693T88721 0.2602 1355 1 0.93 Epithelial membrane protein 2 EMP2 Hs.29191W31584 0.3186 1355 -1 0.93 Hypothetical protein MGC3251 MGC3251 Hs.13467H79855 0.3677 1355 -1 0.73 Translational inhibitor protein p14.5 UK114 Hs.18426H86793 0.3032 1356 1 0.8 - - Hs.81376AA099685 0.3265 1356 1 0.8 Progesterone-induced blocking factor 1 PIBF1 Hs.43913W90281 0.44 1356 -1 0.47 Sprouty homolog 2 (Drosophila) SPRY2 Hs.18676H28453 0.2038 1357 1 0.87 Hypothetical protein MGC4840 MGC4840 Hs.301872H02889 0.3345 1357 1 0.73 Inositol(myo)-1(or 4)-monophosphatase 1 IMPA1 Hs.171776AA047412 0.3763 1357 -1 0.67 Zinc finger protein 23 (KOX 16) ZNF23 Hs.55606H05011 0.2468 1358 1 1 - - -N43819 0.2534 1358 -1 0.93 KIAA0036 gene product KIAA0036 Hs.169387H71737 0.2811 1358 1 0.8 - - -AA054731 0.412 1358 1 0.6 Hypothetical protein BC014942 LOC89941 Hs.21497R83448 0.1981 1359 1 0.93 - - Hs.331666H16789 0.2884 1361 1 0.93 CGI-152 protein CGI-152 Hs.9275R18841 0.267 1363 1 1 Neurotrimin HNT Hs.288433AA129720 0.274 1365 -1 0.93 - - Hs.286241R80979 0.2602 1366 1 0.8 Mitogen-activated protein kinase kinase kinase 11 MAP3K11 Hs.89449AA046321 0.3508 1366 -1 0.87 Utrophin (homologous to dystrophin) UTRN Hs.286161N95578 0.1981 1367 -1 0.93 - - Hs.5855R48937 0.5734 1367 -1 0.4 - - Hs.334606N34679 0.267 1368 -1 0.93 - - Hs.9042R43033 0.3426 1368 -1 0.87 - - Hs.374352H52714 0.3763 1368 1 0.73 Ubinuclein 1 UBN1 Hs.21479T94859 0.2958 1370 1 1 Ring finger protein 10 RNF10 Hs.5094AA056558 0.2602 1371 -1 0.87 Tight junction protein 2 (zona occludens 2) TJP2 Hs.75608T65437 0.3677 1371 1 0.8 R3H domain (binds single-stranded nucleic acids) containing R3HDM Hs.268053R92012 0.2958 1372 1 0.87 Death-associated protein DAP Hs.75189T98946 0.2534 1374 -1 1 Hypothetical protein FLJ12707 FLJ12707 Hs.16157T56959 0.2958 1374 -1 1 Hypothetical protein FLJ12525 FLJ12525 Hs.321618W37346 0.3426 1374 -1 0.67 DIPB protein HSA249128 Hs.14512R22413 0.2403 1376 1 0.73 Protein phosphatase 1, regulatory (inhibitor) subunit 14B PPP1R14B Hs.100623AA055170 0.3426 1376 -1 0.87 - - Hs.265891W15457 0.3508 1377 -1 0.67 HSPC067 protein HSPC067 Hs.279938N95603 0.3265 1379 -1 0.8 Excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum g ERCC3 Hs.77929N67477 0.3426 1379 -1 0.93 - - Hs.281561R63806 0.3032 1381 -1 0.8 Likely ortholog of mouse heat shock protein, 70 kDa 4 LOC51182 Hs.44581H13832 0.4306 1381 1 0.67 Hypothetical protein FLJ10404 FLJ10404 Hs.111279N74404 0.2339 1382 -1 0.87 - - Hs.38516R46284 0.2534 1383 1 0.8 Lipase, hormone-sensitive LIPE Hs.95351N51128 0.2602 1383 1 0.87 Inositol hexaphosphate kinase 2 IHPK2 Hs.323432H57367 0.274 1383 1 0.83 - - Hs.335274T81338 0.2468 1385 1 0.93 Trans-golgi network protein 2 TGOLN2 Hs.14894AA036809 0.3109 1386 -1 0.8 - - Hs.188826R12879 0.3109 1386 1 0.93 KIAA1336 protein KIAA1336 Hs.145365H02290 0.2468 1387 1 1 SEC10-like 1 (S. cerevisiae) SEC10L1 Hs.29494H62252 0.3345 1388 1 0.93 Amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2 ALS2CR2 Hs.5771H80753 0.3508 1388 -1 0.93 Chromodomain helicase DNA binding protein 1 CHD1 Hs.22670R22236 0.3763 1388 -1 0.6 KIAA0336 gene product KIAA0336 Hs.278671H80258 0.2468 1389 -1 0.93 - - Hs.41352AA203338 0.3032 1389 -1 0.87 Hypothetical SBBI03 protein SBB103 Hs.153639T94898 0.2884 1390 -1 0.87 Hypothetical protein SP192 SP192 Hs.169854N51465 0.2038 1391 1 1 ESTs ESTs Hs.46476AA115514 0.3939 1393 -1 0.8 MAX interacting protein 1 MXI1 Hs.118630N27866 0.4791 1393 -1 0.6 Pp21 homolog LOC51186 Hs.15984AA039246 0.2038 1394 -1 1 Transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila) TLE2 Hs.332173R50526 0.267 1394 1 0.87 - - -R50558 0.2958 1394 -1 0.87 Transposon-derived Buster1 transposase-like protein LOC58486 Hs.25726R18790 0.3345 1395 1 0.8 - - -R54424 0.3426 1396 1 0.87 Glutamate dehydrogenase 1 GLUD1 Hs.77508H37983 0.2958 1397 1 0.87 Sphingomyelin phosphodiesterase 1, acid lysosomal (acid sphingomyelinase) SMPD1 Hs.77813N21227 0.2602 1398 -1 1 Brain protein I3 BRI3 Hs.75922R26005 0.2884 1400 1 0.8 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa NDUFB7 Hs.661AA131280 0.3032 1400 1 0.87 B-cell CLL/lymphoma 6 (zinc finger protein 51) BCL6 Hs.155024H99570 0.3265 1400 1 0.8 ESTs ESTs Hs.337736W55924 0.3426 1401 -1 0.87 - - Hs.35962R66029 0.3109 1402 1 0.77 Bromodomain adjacent to zinc finger domain, 1A BAZ1A Hs.8858H58340 0.3345 1402 1 0.6 RNA binding motif protein 10 RBM10 Hs.154583AA043774 0.44 1402 -1 0.8 Programmed cell death 5 PDCD5 Hs.166468H78385 0.5199 1402 1 0.57 Huntingtin interacting protein 2 HIP2 Hs.155485T88813 0.274 1403 1 0.93 Hypothetical protein PRO1855 PRO1855 Hs.283558AA045048 0.2534 1404 1 1 Sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytopSEMA5B Hs.61384H89477 0.2811 1404 -1 1 Cyclin D3 CCND3 Hs.83173AA122364 0.2958 1404 -1 0.83 Receptor tyrosine kinase-like orphan receptor 2 ROR2 Hs.155585N74699 0.2534 1405 -1 0.93 Malonyl-CoA decarboxylase MLYCD Hs.150748H87386 0.2096 1406 1 1 Hypothetical protein FLJ11362 FLJ11362 Hs.8929H03878 0.3763 1406 1 0.8 Eukaryotic translation initiation factor 4 gamma, 2 EIF4G2 Hs.183684R88505 0.3345 1407 1 0.73 Serine arginine-rich pre-mRNA splicing factor SR-A1 SR-A1 Hs.103521R55896 0.3677 1408 -1 0.73 - - -R59415 0.3508 1409 1 0.6 - - -W04736 0.2602 1410 1 0.93 Hypothetical protein MGC40107 MGC40107 Hs.94316

R74573 0.267 1410 1 0.87 Male-specific lethal 3-like 1 (Drosophila) MSL3L1 Hs.88764R88122 0.2811 1410 -1 0.87 Pericentriolar material 1 PCM1 Hs.75737N20843 0.3592 1410 -1 0.87 - - -R94499 0.44 1410 1 0.6 Guanine nucleotide binding protein (G protein), beta 5 GNB5 Hs.155090N99001 0.3032 1411 1 0.87 BCL2-associated athanogene 2 BAG2 Hs.55220R32376 0.3345 1411 1 0.67 Syntaxin 3A STX3A Hs.82240R41834 0.2215 1413 1 1 KIAA1116 protein KIAA1116 Hs.227602AA054080 0.3939 1414 1 0.8 Zinc finger protein 36, C3H type, homolog (mouse) ZFP36 Hs.343586R73484 0.5199 1414 1 0.53 Similar to CG9886 gene product LOC132158 Hs.109414N27178 0.2534 1416 1 1 T-box 3 (ulnar mammary syndrome) TBX3 Hs.267182T97968 0.2884 1417 1 0.93 ESTs ESTs Hs.325159AA055989 0.3345 1417 1 0.67 - - Hs.285050AA056593 0.3677 1417 -1 0.73 KIAA0063 gene product KIAA0063 Hs.3094AA054570 0.2215 1418 -1 0.93 Apolipoprotein E APOE Hs.169401W93404 0.2602 1418 1 1 Mitotic spindle coiled-coil related protein DEEPEST Hs.16244H01923 0.3032 1418 1 0.93 HSPC019 protein HSPC019 Hs.163724R20374 0.4029 1419 -1 0.6 Chromatin assembly factor 1, subunit B (p60) CHAF1B Hs.75238R37843 0.2811 1421 1 0.93 Mannosidase, alpha, class 1A, member 1 MAN1A1 Hs.25253AA043196 0.274 1422 1 0.93 Hypothetical protein FLJ10450 FLJ10450 Hs.267604T71262 0.385 1422 -1 0.9 Neuron navigator 2 NAV2 Hs.23467AA053145 0.3265 1423 -1 0.87 Coronin, actin binding protein, 1C CORO1C Hs.17377R69062 0.3592 1423 1 0.87 Lipidosin BG1 Hs.277543R92869 0.6641 1425 -1 0.4 - - Hs.356340N20900 0.4212 1427 -1 0.47 ESTs ESTs Hs.32163H61387 0.274 1428 -1 0.87 Reticulon 4 receptor RTN4R Hs.30868N58514 0.3032 1428 -1 0.8 Mitochondrial Acyl-CoA Thioesterase MT-ACT48 Hs.18625R13813 0.2215 1429 1 0.93 Growth factor receptor-bound protein 2 GRB2 Hs.381152R37680 0.274 1429 1 1 ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1 ADPRTL1 Hs.77225W15594 0.3677 1429 -1 0.67 Hypothetical protein FLJ20811 FLJ20811 Hs.83530R32834 0.412 1429 1 0.73 CLLL7 protein FLJ10716 Hs.24129R25217 0.3426 1430 -1 0.87 Surfeit 6 SURF6 Hs.274430N25620 0.3186 1431 -1 0.8 Midline 1 (Opitz/BBB syndrome) MID1 Hs.27695R32270 0.3265 1431 1 0.9 Epithelial membrane protein 2 EMP2 Hs.29191N75350 0.2096 1432 -1 0.93 Gastrin-releasing peptide GRP Hs.1473W47031 0.2468 1433 -1 0.87 Hypothetical protein LOC51241 LOC51241 Hs.171566T39578 0.2155 1434 -1 1 Mitochondrial ribosomal protein S18C MRPS18C Hs.3385AA028124 0.2339 1435 -1 0.93 - - Hs.61472N30724 0.44 1435 1 0.47 - - Hs.350364T96990 0.3939 1436 -1 0.67 Ubiquitination factor E4B (UFD2 homolog, yeast) UBE4B Hs.24594AA203496 0.4496 1436 1 0.5 - - Hs.20818R23917 0.3265 1437 -1 0.8 Three prime repair exonuclease 1 TREX1 Hs.278408H16888 0.44 1437 -1 0.67 Protein-L-isoaspartate (D-aspartate) O-methyltransferase PCMT1 Hs.79137AA036953 0.385 1438 -1 0.67 Growth arrest and DNA-damage-inducible, alpha GADD45A Hs.80409N35002 0.2155 1439 -1 1 Dom-3 homolog Z (C. elegans) DOM3Z Hs.153299AA005168 0.2884 1439 1 0.87 Zinc finger protein 7 (KOX 4, clone HF.16) ZNF7 Hs.2076AA101713 0.4306 1439 1 0.73 - - Hs.19215AA142965 0.4496 1439 1 0.47 Protein kinase C binding protein 1 PRKCBP1 Hs.75871N58114 0.3508 1441 -1 0.8 E2F transcription factor 4, p107/p130-binding E2F4 Hs.108371AA114891 0.3508 1441 -1 0.8 Syndecan 2 (heparan sulfate proteoglycan 1, cell surface-associated, fibroglycan) SDC2 Hs.1501H88485 0.4593 1441 -1 0.73 - - Hs.108806R65766 0.3265 1443 -1 0.93 SEC22 vesicle trafficking protein-like 1 (S. cerevisiae) SEC22L1 Hs.50785N31931 0.3592 1443 -1 0.67 - - -AA037517 0.3592 1445 -1 0.73 Chromosome 20 open reading frame 13 C20orf13 Hs.88367R79688 0.2958 1446 1 0.93 - - -AA046075 0.3265 1446 -1 0.93 - - Hs.88845T75394 0.3265 1447 -1 1 Eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa EIF2B3 Hs.283627W45178 0.3345 1447 -1 0.87 DIP13 beta DIP13B Hs.107882AA045241 0.2215 1448 -1 1 Hypothetical protein FLJ12118 FLJ12118 Hs.381043H16519 0.2958 1448 -1 0.8 Dolichyl-diphosphooligosaccharide-protein glycosyltransferase DDOST Hs.34789AA128271 0.3426 1448 -1 0.83 Regulatory factor X, 5 (influences HLA class II expression) RFX5 Hs.166891H15122 0.4496 1448 -1 0.43 Sex comb on midleg homolog 1 SCMH1 Hs.57475R19114 0.3032 1449 1 0.73 ESTs ESTs Hs.22634H71745 0.4212 1449 1 0.7 Proteasome (prosome, macropain) 26S subunit, ATPase, 4 PSMC4 Hs.211594R01140 0.2602 1451 1 0.93 Heat shock 90kDa protein 1, alpha HSPCA Hs.289088H50945 0.3345 1451 1 0.93 Proteasome (prosome, macropain) subunit, beta type, 5 PSMB5 Hs.78596N66473 0.4593 1451 -1 0.53 - - Hs.249247H02832 0.267 1452 -1 1 Hypothetical protein FLJ23476 FLJ23476 Hs.46736T81285 0.3032 1452 1 0.93 Phosphofructokinase, liver PFKL Hs.155455N50375 0.3763 1452 -1 0.6 Activated RNA polymerase II transcription cofactor 4 PC4 Hs.349506R10734 0.4212 1452 1 0.6 - - -N79532 0.3345 1453 -1 0.93 - - Hs.378235N79517 0.3032 1455 -1 0.87 Fibrinogen, gamma polypeptide FGG Hs.75431N75516 0.3763 1455 1 0.67 KIAA1096 protein KIAA1096 Hs.69559R39199 0.4593 1455 -1 0.4 Notch homolog 2 (Drosophila) NOTCH2 Hs.8121N45664 0.2958 1456 -1 0.67 Putative Rab5 GDP/GTP exchange factor homologue RABEX5 Hs.187660N93335 0.3032 1457 1 0.87 DKFZP566C243 protein DKFZP566C243Hs.107747R24964 0.3508 1457 1 0.87 ESTs ESTs Hs.23766R43107 0.4496 1457 1 0.53 Hypothetical protein FLJ10450 FLJ10450 Hs.267604R83815 0.2403 1458 -1 1 Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein ID2 Hs.180919W81586 0.2339 1459 -1 0.93 Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog FGR Hs.1422W78859 0.3677 1459 1 0.73 Emopamil binding related protein, delta8-delta7 sterol isomerase related protein EBRP Hs.298490R20594 0.3265 1461 1 0.87 Glutathione S-transferase M4 GSTM4 Hs.348387H56686 0.385 1464 1 0.6 Serine/arginine repetitive matrix 1 SRRM1 Hs.18192W44956 0.267 1465 1 1 2,4-dienoyl CoA reductase 1, mitochondrial DECR1 Hs.81548AA043297 0.385 1465 -1 0.73 Vacuolar protein sorting 45A (yeast) VPS45A Hs.6650H43746 0.3592 1466 -1 0.73 Hypothetical protein DKFZp761F0118 DKFZp761F0118Hs.6685N29775 0.3677 1466 1 0.77 Small fragment nuclease DKFZP566E144 Hs.7527AA005109 0.4029 1467 1 0.7 Oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) OGDH Hs.168669R39701 0.3265 1468 1 0.67 - - -N22081 0.3508 1468 -1 0.87 PC4 and SFRS1 interacting protein 2 PSIP2 Hs.82110H09093 0.3763 1470 1 0.8 Gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase) GGH Hs.78619W60709 0.2811 1471 1 1 C-terminal modulator protein CTMP Hs.293691AA053903 0.2276 1473 -1 0.93 KIAA0826 protein KIAA0826 Hs.169600H48501 0.2958 1473 1 0.93 SCN Circadian Oscillatory Protein (SCOP) SCOP Hs.38176T79037 0.3032 1473 1 0.93 - - -H51834 0.2958 1474 -1 0.93 Tetratricopeptide repeat domain 1 TTC1 Hs.7733R23473 0.2884 1475 1 0.87 Hypothetical protein FLJ20624 FLJ20624 Hs.52256H50875 0.3186 1475 -1 1 Hepatocyte nuclear factor 3, gamma HNF3G Hs.36137N75841 0.3677 1476 -1 0.87 H1 histone family, member 2 H1F2 Hs.7644H53969 0.2468 1477 1 1 Clone FLB5214 LOC51219 Hs.5486

N74995 0.2811 1477 -1 0.9 RAB35, member RAS oncogene family RAB35 Hs.94308N95400 0.3032 1477 -1 0.93 DKFZP564G2022 protein DKFZP564G202Hs.16492T89586 0.3508 1480 1 0.67 - - -R19063 0.5844 1481 1 0.43 - - -H21648 0.385 1482 1 0.73 - - Hs.31834AA040087 0.2811 1483 -1 1 Collagen, type IV, alpha 3 (Goodpasture antigen) binding protein COL4A3BP Hs.21276W04542 0.3109 1484 -1 0.87 Hepatocellular carcinoma-associated protein HCA4 HCA4 Hs.94011H16689 0.3186 1484 -1 0.8 RNA binding motif protein 8A RBM8A Hs.10283N69904 0.3939 1484 -1 0.73 Nuclear receptor coactivator 5 NCOA5 Hs.288140H38361 0.4029 1485 1 0.73 Vacuolar protein sorting 16 (yeast) VPS16 Hs.302441R62540 0.3265 1486 -1 0.8 ATPase, Cu++ transporting, beta polypeptide (Wilson disease) ATP7B Hs.84999AA161069 0.3677 1486 -1 0.87 E1B-55kDa-associated protein 5 E1B-AP5 Hs.155218H38322 0.541 1487 1 0.33 SET binding factor 1 SBF1 Hs.112049AA156433 0.2811 1488 -1 0.87 ESTs ESTs Hs.103864AA132068 0.3763 1490 -1 0.67 - - Hs.352381R87919 0.2403 1491 1 1 KIAA0370 protein KIAA0370 Hs.70500H05011 0.3345 1492 1 0.8 - - -H89995 0.3677 1492 -1 0.87 - - -N49728 0.2958 1493 1 0.87 KIAA0916 protein KIAA0916 Hs.151411AA120840 0.3763 1494 -1 0.67 ESTs ESTs Hs.323473R46208 0.4891 1494 1 0.57 PL6 protein PL6 Hs.91566W69156 0.4212 1495 1 0.67 KIAA0095 gene product KIAA0095 Hs.155314N31849 0.3345 1496 1 0.93 - - Hs.282895N31589 0.3592 1496 -1 0.67 Type I sigma receptor SR-BP1 Hs.24447AA194139 0.2534 1497 -1 1 C-Mpl binding protein LOC113251 Hs.26613AA033787 0.2884 1497 -1 0.87 G protein-coupled receptor 108 GPR108 Hs.167641N78857 0.3109 1498 1 0.93 - - Hs.82171N25253 0.3265 1498 -1 0.73 Chromosome 5 open reading frame 8 C5orf8 Hs.75864R06442 0.3508 1499 1 0.73 TP53 target gene 1 TP53TG1 Hs.274329H67560 0.2403 1500 -1 1 Chaperonin containing TCP1, subunit 8 (theta) CCT8 Hs.15071N42803 0.3032 1500 -1 0.73 - - Hs.356063H55916 0.3345 1500 -1 0.8 Peptidylprolyl isomerase F (cyclophilin F) PPIF Hs.173125N80289 0.2534 1501 -1 0.87 ORM1-like 2 (S. cerevisiae) ORMDL2 Hs.13144N47737 0.2534 1501 -1 1 ESTs ESTs Hs.41272R20590 0.2884 1501 -1 0.8 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 ABCC4 Hs.139336N20259 0.3426 1501 -1 0.8 Hypothetical protein MGC2840 similar to a putative glucosyltransferase MGC2840 Hs.155356R13117 0.6409 1501 1 0.43 - - Hs.348516N62283 0.2884 1502 1 0.87 Translocating chain-associating membrane protein TRAM Hs.4147N64621 0.3109 1503 -1 0.8 Regulator of G-protein signalling 19 interacting protein 1 RGS19IP1 Hs.6454R72445 0.2602 1504 -1 0.87 Sarcospan (Kras oncogene-associated gene) SSPN Hs.183428AA033710 0.3508 1505 -1 0.93 - - Hs.351928H57284 0.2602 1507 -1 0.8 Neural precursor cell expressed, developmentally down-regulated 5 NEDD5 Hs.155595AA063580 0.4029 1508 -1 0.57 TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa TAF7 Hs.155188R69288 0.5734 1508 1 0.4 ESTs ESTs Hs.268693R17839 0.2811 1509 1 0.93 Wolf-Hirschhorn syndrome candidate 2 WHSC2 Hs.21771R84964 0.2602 1510 -1 0.93 Hypothetical protein FLJ22127 FLJ22127 Hs.59457AA151396 0.267 1510 -1 0.93 Poly(A) binding protein, nuclear 1 PABPN1 Hs.117176N99930 0.3426 1510 -1 0.67 BDG-29 proten BDG-29 Hs.81505AA136882 0.4496 1510 -1 0.67 Activin A receptor, type I ACVR1 Hs.150402N92594 0.4593 1510 1 0.67 S-adenosylmethionine decarboxylase 1 AMD1 Hs.262476AA102111 0.385 1511 -1 0.7 Collagen, type XV, alpha 1 COL15A1 Hs.83164W58375 0.3109 1512 -1 0.8 Solute carrier family 2 (facilitated glucose transporter), member 1 SLC2A1 Hs.169902T78883 0.2602 1514 1 1 ESTs ESTs Hs.268596H56572 0.4029 1514 1 0.8 Proteasome activator 200 kDa PA200 Hs.112396N29439 0.3032 1515 -1 0.93 Sarcoglycan, delta (35kDa dystrophin-associated glycoprotein) SGCD Hs.151899N78582 0.4212 1515 -1 0.8 Protein kinase, AMP-activated, beta 2 non-catalytic subunit PRKAB2 Hs.50732H20847 0.2276 1516 -1 1 KIAA0923 protein KIAA0923 Hs.22587AA063424 0.3265 1516 -1 1 DKFZP586D0623 protein DKFZP586D062Hs.44468H15642 0.3592 1516 1 0.73 - - -AA044180 0.3508 1517 -1 0.6 - - Hs.373497W56402 0.385 1518 1 0.67 Musashi homolog 2 (Drosophila) MSI2 Hs.173179R98516 0.385 1518 1 0.67 H2B histone family, member G H2BFG Hs.182137R34439 0.4029 1518 1 0.87 - - Hs.290270R17728 0.3186 1519 1 0.87 Molybdenum cofactor synthesis 3 MOCS3 Hs.159410H77659 0.3345 1519 1 0.87 Tubulin, gamma 1 TUBG1 Hs.21635AA151412 0.3032 1520 -1 1 - - -R39287 0.385 1520 1 0.87 Melanin-concentrating hormone receptor 1 interacting zinc-finger protein MIZIP Hs.128096H75530 0.5199 1520 1 0.53 V-crk sarcoma virus CT10 oncogene homolog (avian) CRK Hs.343220N29438 0.3032 1521 -1 0.93 Mitochondrial ribosomal protein L46 MRPL46 Hs.278328R67235 0.3186 1521 1 0.87 HLA-B associated transcript 1 BAT1 Hs.55296N20310 0.3345 1521 -1 0.93 - - -R50259 0.3763 1521 1 0.73 Protein kinase C-like 1 PRKCL1 Hs.2499T81540 0.4791 1523 -1 0.53 Nucleoporin 62kDa NUP62 Hs.9877N31736 0.2403 1524 -1 1 Hypothetical protein FLJ25211 FLJ25211 Hs.44269H58642 0.3345 1524 1 0.87 Hypothetical protein FLJ23499 FLJ23499 Hs.17546T81946 0.4593 1525 -1 0.6 - - -R72606 0.3763 1527 -1 0.8 Hypothetical protein FLJ20457 FLJ20457 Hs.29276T95014 0.3939 1527 -1 0.73 Serine/threonine kinase 4 STK4 Hs.35140H06274 0.4306 1527 1 0.67 Hypothetical protein MGC2508 MGC2508 Hs.11110AA053901 0.4993 1527 -1 0.53 - - Hs.60740R96472 0.3508 1528 -1 0.9 Hypothetical protein FLJ10276 FLJ10276 Hs.333149AA203625 0.3592 1528 -1 0.73 Vacuolar protein sorting 4A (yeast) VPS4A Hs.234839R24574 0.3592 1528 1 0.8 Chromosome 7 open reading frame 14 C7orf14 Hs.84790H93264 0.274 1529 -1 1 - - Hs.283378N72916 0.2811 1529 -1 1 Ubiquitin specific protease 12 USP12 Hs.42400R38345 0.3677 1529 1 0.73 Transcriptional intermediary factor 1 TIF1 Hs.183858R34626 0.7114 1529 -1 0.33 ESTs ESTs Hs.6795AA004355 0.2534 1531 1 0.93 Mitochondrial ribosomal protein S31 MRPS31 Hs.154655AA063161 0.3109 1531 1 0.87 - - Hs.181767N21653 0.2811 1533 1 0.93 Synovial sarcoma translocation, chromosome 18 SS18 Hs.153221H52061 0.3032 1533 1 0.87 Hypothetical protein FLJ22313 FLJ22313 Hs.30211T81080 0.4029 1533 1 0.73 - - -N69431 0.3032 1534 -1 0.93 Hypothetical protein FLJ20699 FLJ20699 Hs.15125N46199 0.3345 1534 1 0.87 Hypothetical protein DKFZp761N0624 DKFZp761N062 Hs.21893R51348 0.3592 1534 1 0.87 - - -H18767 0.3592 1534 -1 0.57 - - -W86753 0.3265 1535 -1 0.93 Chemokine (C-X-C motif) ligand 16 CXCL16 Hs.82407H77460 0.3508 1535 1 0.83 Lymphocyte adaptor protein LNK Hs.13131R33946 0.412 1535 1 0.8 Quinolinate phosphoribosyltransferase (nicotinate-nucleotide pyrophosphorylase (carboxylating)) QPRT Hs.8935H10026 0.3032 1536 1 0.8 Zinc finger protein 193 ZNF193 Hs.96448

R22188 0.3186 1536 1 0.87 - - Hs.356392W85883 0.3939 1536 -1 0.67 Hypothetical protein FLJ10847 FLJ10847 Hs.48403R34648 0.4212 1536 -1 0.6 Cell adhesion molecule with homology to L1CAM (close homolog of L1) CHL1 Hs.210863W87404 0.2884 1537 1 0.93 Hypothetical protein FLJ10715 FLJ10715 Hs.58974N21353 0.385 1537 -1 0.87 - - -N39320 0.5844 1539 -1 0.47 DKFZP564I052 protein DKFZP564I052 Hs.5364R71145 0.4791 1540 -1 0.8 KIAA1577 protein KIAA1577 Hs.13913H88566 0.3763 1542 -1 0.67 - - -H04220 0.3265 1543 1 0.87 - - -T85855 0.385 1544 1 0.8 Hypothetical protein FLJ10209 FLJ10209 Hs.58589AA120761 0.2534 1548 1 0.93 E74-like factor 1 (ets domain transcription factor) ELF1 Hs.154365H08969 0.3345 1548 1 0.8 Hypothetical protein FLJ12529 FLJ12529 Hs.169100AA203544 0.3508 1548 -1 0.87 Ubiquitin-activating enzyme E1-like UBE1L Hs.16695AA058318 0.3508 1548 1 0.73 Plastin 3 (T isoform) PLS3 Hs.4114R60393 0.385 1548 -1 0.67 Makorin, ring finger protein, 2 MKRN2 Hs.279474AA043249 0.2339 1550 1 1 ESTs ESTs Hs.275224AA041350 0.4029 1550 -1 0.8 - - Hs.57847T58690 0.3592 1551 -1 0.87 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 39 DDX39 Hs.311609R14063 0.4306 1551 1 0.8 Hypothetical protein DKFZp586M1819 DKFZp586M181Hs.355753H84157 0.4791 1551 1 0.53 Bobby sox homolog (Drosophila) BBX Hs.35380W46239 0.267 1552 1 0.87 Sprouty homolog 4 (Drosophila) SPRY4 Hs.381153AA001139 0.4029 1552 -1 0.87 Zinc finger protein 274 ZNF274 Hs.83761R14112 0.4212 1552 1 0.6 Cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 1 CYP1A1 Hs.72912AA045637 0.412 1553 -1 0.73 Ubiquinol-cytochrome c reductase (6.4kD) subunit UQCR Hs.8372R83637 0.4496 1553 1 0.6 KIAA1204 protein KIAA1204 Hs.300670AA057398 0.4212 1554 -1 0.63 - - -N59818 0.2884 1555 -1 0.8 Endocrine regulator HRIHFB2436 Hs.48433R20231 0.3939 1555 1 0.87 Raptor raptor Hs.20677R61634 0.3032 1556 1 0.93 Hypothetical protein PRO1855 PRO1855 Hs.283558R35308 0.2958 1557 -1 0.93 HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae) HRMT1L1 Hs.235887R68364 0.3032 1557 -1 1 - - -AA115202 0.3265 1557 -1 0.8 - - Hs.136061R52949 0.2958 1558 1 0.87 - - Hs.25978R17350 0.3032 1558 1 0.8 KIAA1387 protein KIAA1387 Hs.301434R32925 0.2155 1559 1 1 - - -R83037 0.3265 1559 1 0.93 Hypothetical protein FLJ20008 FLJ20008 Hs.14235N42979 0.2403 1560 -1 1 Sialyltransferase STHM Hs.288215T95061 0.3265 1560 1 0.8 Matrix metalloproteinase 19 MMP19 Hs.154057N93807 0.2811 1561 -1 0.8 - EST Hs.144224T79317 0.412 1561 -1 0.73 ESTs ESTs Hs.302245N42285 0.4212 1561 1 0.63 Lysosomal-associated membrane protein 1 LAMP1 Hs.150101T86841 0.3345 1562 -1 0.93 - - -R39286 0.4993 1562 1 0.43 Citron (rho-interacting, serine/threonine kinase 21) CIT Hs.15767N59347 0.5517 1563 1 0.53 Hypothetical protein MGC9344 MGC9344 Hs.84131W73595 0.3109 1564 -1 0.93 Spondin 2, extracellular matrix protein SPON2 Hs.288126W31684 0.3592 1564 -1 0.87 Hypothetical protein FLJ34969 FLJ34969 Hs.373580W67895 0.2403 1565 -1 1 Small EDRK-rich factor 1A (telomeric) SERF1A Hs.32567W94646 0.3763 1565 -1 0.87 Integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide) ITGAE Hs.851AA099154 0.412 1566 -1 0.67 Cell division cycle 34 CDC34 Hs.76932T94585 0.2958 1567 -1 0.87 - - Hs.116691N90076 0.2468 1569 1 0.87 Exostoses (multiple)-like 2 EXTL2 Hs.61152AA037624 0.3032 1569 1 0.93 Hypothetical protein MGC5242 MGC5242 Hs.77365H70975 0.3426 1569 -1 0.8 - - -R64592 0.3508 1569 1 0.8 - - -N79524 0.5517 1569 -1 0.47 Zinc finger protein, subfamily 2A (FYVE domain containing), 1 ZNFN2A1 Hs.20047H13889 0.2958 1574 -1 1 - - Hs.259347H05378 0.3186 1576 -1 0.73 Down syndrome critical region gene 3 DSCR3 Hs.26146R14308 0.3345 1576 1 0.93 - - Hs.107242AA099226 0.4306 1577 -1 0.53 - - Hs.356377R24577 0.3939 1578 -1 0.8 Arginine-glutamic acid dipeptide (RE) repeats RERE Hs.194369T85465 0.267 1579 1 1 ESTs ESTs Hs.268613T75200 0.3186 1579 1 0.87 Hypothetical protein FLJ14566 FLJ14566 Hs.12313R18621 0.2958 1581 -1 0.93 - - -R32829 0.3032 1581 1 0.87 KIAA1327 protein KIAA1327 Hs.106204T84135 0.3592 1581 1 0.93 Cytochrome b5 outer mitochondrial membrane precursor CYB5-M Hs.381218R64299 0.2884 1582 1 0.93 ESTs ESTs Hs.28507T77389 0.3032 1582 -1 0.93 Leiomodin 1 (smooth muscle) LMOD1 Hs.79386T71625 0.3592 1582 1 0.87 - - -N25228 0.4496 1582 1 0.67 Heparan sulfate 2-O-sulfotransferase 1 HS2ST1 Hs.169939R72275 0.5199 1582 1 0.53 Dolichyl-p-mannose:Man7GlcNAc2-PP-dolichyl mannosyltransferase ALG12 Hs.77575N27544 0.5517 1582 -1 0.33 Cell division cycle 27 CDC27 Hs.172405R47758 0.4496 1583 -1 0.53 Hypothetical protein MGC2721 MGC2721 Hs.76084H09104 0.4891 1583 1 0.73 Syntrophin, alpha 1 (dystrophin-associated protein A1, 59kDa, acidic component) SNTA1 Hs.31121AA045266 0.3265 1585 -1 0.8 Thymopoietin TMPO Hs.11355N59677 0.3265 1585 -1 0.9 Proteasome (prosome, macropain) subunit, alpha type, 7 PSMA7 Hs.233952T90893 0.44 1586 -1 0.6 Rab geranylgeranyltransferase, beta subunit RABGGTB Hs.78948W68697 0.2958 1587 -1 0.87 Hypothetical protein FLJ10998 FLJ10998 Hs.78110R98517 0.4212 1587 -1 0.67 H1 histone family, member 2 H1F2 Hs.7644H11708 0.4306 1587 1 0.73 Mitogen-activated protein kinase kinase 4 MAP2K4 Hs.75217N66246 0.3109 1589 -1 0.93 Activating transcription factor 6 ATF6 Hs.5813R71176 0.4029 1589 -1 0.83 Slingshot 3 SSH-3 Hs.29173R80700 0.3677 1593 -1 0.87 - - Hs.25218H84220 0.3032 1595 1 1 MIC2 like 1 MIC2L1 Hs.169388W37617 0.3508 1595 -1 0.93 Transmembrane 7 superfamily member 1 (upregulated in kidney) TM7SF1 Hs.15791H20342 0.6294 1595 1 0.67 - - Hs.173699AA044646 0.6409 1595 1 0.4 HSPC126 protein HSPC126 Hs.181112AA115948 0.3109 1596 -1 0.83 Collagen, type V, alpha 2 COL5A2 Hs.82985N32560 0.4691 1596 -1 0.67 Forkhead box M1 FOXM1 Hs.239AA043293 0.412 1597 -1 0.87 Hypothetical protein DT1P1A10 DT1P1A10 Hs.178207W37533 0.4212 1598 -1 0.67 Hexokinase 1 HK1 Hs.118625R81337 0.3032 1599 1 0.87 Colon carcinoma related protein LOC51159 Hs.30343W02781 0.3939 1599 1 0.67 Chromosome 12 open reading frame 4 C12orf4 Hs.296198H88577 0.3032 1601 -1 0.87 Heterogeneous nuclear ribonucleoprotein H1 (H) HNRPH1 Hs.245710N25756 0.385 1601 -1 0.63 - - -H75344 0.4791 1601 -1 0.6 ESTs ESTs Hs.167614H18154 0.3508 1603 1 0.8 RAB5B, member RAS oncogene family RAB5B Hs.77690T97533 0.6876 1604 -1 0.47 ESTs ESTs Hs.193125N64693 0.3345 1606 -1 0.8 ESTs ESTs Hs.132918H45410 0.5625 1607 -1 0.67 Uveal autoantigen with coiled-coil domains and ankyrin repeats UACA Hs.49753R71614 0.2811 1608 1 0.93 - - Hs.233354

H17513 0.3032 1608 1 0.93 Heat shock 70kDa protein 1-like HSPA1L Hs.80288H39778 0.3763 1608 1 0.67 Hypothetical protein MGC11134 MGC11134 Hs.326586N69014 0.3939 1608 1 0.6 SRY (sex determining region Y)-box 12 SOX12 Hs.43627AA128582 0.4791 1610 -1 0.57 Translocase of inner mitochondrial membrane 44 homolog (yeast) TIMM44 Hs.123178H25201 0.3508 1613 1 0.8 - - -N33086 0.44 1613 1 0.73 - - -R70779 0.3426 1614 1 0.87 - - Hs.352579W88760 0.7722 1614 1 0.27 Calcium/calmodulin-dependent protein kinase (CaM kinase) II delta CAMK2D Hs.111460W55890 0.4212 1615 -1 0.67 RNA processing factor 1 RPF1 Hs.287863W21078 0.3939 1618 -1 0.73 Exosome component Rrp46 RRP46 Hs.283741N90836 0.5199 1618 -1 0.47 Fragile X mental retardation 1 FMR1 Hs.89764N75204 0.3345 1619 1 0.87 - - Hs.107410H29484 0.3939 1619 1 0.87 Sjogren syndrome antigen B (autoantigen La) SSB Hs.83715N29018 0.4029 1619 -1 0.87 - - -AA147647 0.3763 1621 1 0.63 Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa PAFAH1B1 Hs.77318W87755 0.4029 1621 -1 0.87 ESTs ESTs Hs.269571H84204 0.3345 1622 1 0.73 Protein phosphatase 1, catalytic subunit, beta isoform PPP1CB Hs.21537H13694 0.385 1622 1 0.73 Sec15B protein SEC15B Hs.44175R12039 0.2339 1623 1 0.87 Chromosome 21 open reading frame 108 C21orf108 Hs.18759R27762 0.3592 1623 1 0.53 CGI-141 protein LOC51026 Hs.62275N33169 0.4496 1623 1 0.73 GPAA1P anchor attachment protein 1 homolog (yeast) GPAA1 Hs.4742W42543 0.5955 1623 -1 0.27 Hexosaminidase A (alpha polypeptide) HEXA Hs.119403W74536 0.2276 1624 1 0.8 Advanced glycosylation end product-specific receptor AGER Hs.184AA203681 0.3592 1624 1 0.73 ESTs ESTs Hs.293589N73861 0.3592 1625 1 0.8 - - -N92376 0.3677 1625 -1 0.77 Hypothetical protein MGC23918 MGC23918 Hs.43773AA040149 0.4891 1625 1 0.47 - - Hs.348989T70324 0.4791 1626 -1 0.6 - - Hs.13179AA040790 0.3508 1630 -1 0.6 - - Hs.356395R61132 0.4891 1630 -1 0.67 KIAA0943 protein Apg4B Hs.352535R20737 0.4993 1630 1 0.6 CDC23 (cell division cycle 23, yeast, homolog) CDC23 Hs.153546W58007 0.5734 1630 1 0.6 KIAA0222 gene product KIAA0222 Hs.48450N70291 0.3032 1634 -1 0.77 Apolipoprotein A-II APOA2 Hs.237658AA193482 0.3186 1634 -1 0.8 Hypothetical protein FLJ12287 similar to semaphorins FLJ12287 Hs.7634R32216 0.3592 1634 1 0.93 P53-induced protein PIGPC1 PIGPC1 Hs.303125R76215 0.5625 1635 1 0.57 - - Hs.182723AA121308 0.3677 1636 -1 0.87 TRNA isopentenylpyrophosphate transferase IPT Hs.356554AA131584 0.3763 1636 1 0.83 DKFZP564O0463 protein DKFZP564O046Hs.273344H53071 0.3508 1637 1 0.87 Phosphatidylserine decarboxylase PISD Hs.8128AA148416 0.4691 1637 -1 0.47 Hypothetical protein FLJ14917 FLJ14917 Hs.154706H10406 0.5517 1637 -1 0.4 Profilin 2 PFN2 Hs.91747H38584 0.3109 1638 1 0.87 - - -W49707 0.44 1638 -1 0.6 Steroid receptor RNA activator 1 SRA1 Hs.32587H27211 0.4496 1639 -1 0.73 Splicing factor 3a, subunit 2, 66kDa SF3A2 Hs.115232AA044737 0.541 1639 -1 0.57 Flotillin 2 FLOT2 Hs.184488T69784 0.3677 1640 1 0.8 Fragile X mental retardation, autosomal homolog 2 FXR2 Hs.52788T79589 0.4593 1641 1 0.63 Transmembrane protease, serine 4 TMPRSS4 Hs.63325W04602 0.4791 1641 -1 0.67 Hypothetical protein FLJ11807 FLJ11807 Hs.285813AA044382 0.6067 1641 1 0.43 YY1 transcription factor YY1 Hs.97496AA213820 0.3186 1642 1 0.93 - - Hs.256533H29534 0.44 1642 -1 0.73 ESTs ESTs Hs.22248W85813 0.4496 1642 1 0.53 Cleavage and polyadenylation specific factor 1, 160kDa CPSF1 Hs.83727AA045469 0.3592 1643 1 0.87 Hypothetical protein FLJ20186 FLJ20186 Hs.62771R12948 0.5304 1643 1 0.6 NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa NDUFV1 Hs.7744AA036810 0.3677 1644 -1 0.8 LIM domains containing 1 LIMD1 Hs.48469N39086 0.618 1644 1 0.43 Zinc finger protein AF020591 Hs.142634AA055333 0.274 1646 -1 0.87 CCAAT/enhancer binding protein (C/EBP), gamma CEBPG Hs.2227T97206 0.3677 1646 1 0.6 Hypothetical protein FLJ10747 FLJ10747 Hs.189782N41933 0.385 1647 -1 0.8 KIAA0409 protein KIAA0409 Hs.5158W04197 0.6294 1648 1 0.53 ESTs ESTs Hs.380239W68273 0.412 1649 -1 0.67 CGI-18 protein LOC51008 Hs.121599AA128278 0.3592 1650 1 0.8 KIAA0326 protein KIAA0326 Hs.301094AA005395 0.3763 1650 -1 0.87 - - Hs.187564H27593 0.4593 1651 -1 0.73 Socius SOC Hs.145061R38155 0.3186 1652 1 0.9 - - Hs.351029N52015 0.4212 1652 -1 0.67 ADP-ribosylation factor 4 ARF4 Hs.75290AA142986 0.3426 1653 -1 0.67 Hypothetical protein FLJ11294 FLJ11294 Hs.107000N47551 0.4029 1653 -1 0.63 - - -AA054552 0.3186 1655 -1 1 Chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) CXCL1 Hs.789R73223 0.3677 1655 1 0.6 TGFB1-induced anti-apoptotic factor 1 TIAF1 Hs.75822AA120759 0.3763 1656 -1 0.73 DnaJ (Hsp40) homolog, subfamily B, member 5 DNAJB5 Hs.237506T84669 0.3939 1657 1 0.8 HP1-BP74 HP1-BP74 Hs.142442AA150500 0.3426 1659 -1 0.87 Interferon stimulated gene 20kDa ISG20 Hs.183487H77996 0.3677 1659 -1 0.8 KIAA1463 protein KIAA1463 Hs.21104AA149177 0.3032 1660 -1 0.67 Autoantigen RCD-8 Hs.75682W86803 0.3592 1660 1 0.77 Exostoses (multiple) 2 EXT2 Hs.75334T81304 0.385 1660 -1 0.87 Similar to cyclin-E binding protein 1 (H. sapiens) MGC14386 Hs.14870N35507 0.4306 1660 1 0.53 Oxysterol binding protein OSBP Hs.24734AA121513 0.4029 1661 -1 0.73 KIAA0084 protein KIAA0084 Hs.79123AA128311 0.4891 1661 -1 0.73 Peripheral myelin protein 22 PMP22 Hs.103724AA131590 0.8849 1661 1 0.13 DiGeorge syndrome critical region gene 6-like DGCR6L Hs.347285W87783 0.3186 1662 -1 0.87 REV1-like (yeast) REV1L Hs.110347R02816 0.3508 1662 1 0.73 KIAA0790 protein KIAA0790 Hs.12002AA148608 0.3763 1662 -1 0.67 - - -H81063 0.4593 1662 1 0.6 Citrate synthase CS Hs.239760AA036758 0.274 1663 -1 0.93 S100 calcium binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog) S100A4 Hs.81256N42335 0.3508 1663 -1 0.87 Hypothetical protein FLJ20452 FLJ20452 Hs.351327W40304 0.6294 1664 1 0.4 Apoptosis inhibitor 5 API5 Hs.227913R60081 0.274 1665 1 1 - - -W84735 0.4791 1665 -1 0.6 Protein inhibitor of activated STAT3 PIAS3 Hs.76578W74466 0.4496 1666 -1 0.73 Keratin 10 (epidermolytic hyperkeratosis; keratosis palmaris et plantaris) KRT10 Hs.99936H07938 0.2811 1667 1 0.87 Hypothetical protein FLJ21044 similar to Rbig1 FLJ21044 Hs.25477T80488 0.3345 1668 1 0.83 Suppressor of Ty 6 homolog (S. cerevisiae) SUPT6H Hs.12303AA130235 0.3592 1670 1 0.9 Optic atrophy 1 (autosomal dominant) OPA1 Hs.147946R56622 0.3763 1670 1 0.73 ESTs ESTs Hs.274728R69611 0.3939 1670 -1 0.8 Karyopherin alpha 6 (importin alpha 7) KPNA6 Hs.301553H37804 0.7477 1670 1 0.17 Glucose-6-phosphatase, transport (glucose-6-phosphate) protein 1 G6PT1 Hs.132760H20147 0.3186 1671 1 1 Chromosome 20 open reading frame 154 C20orf154 Hs.88959AA121547 0.412 1671 -1 0.67 IMP (inosine monophosphate) dehydrogenase 2 IMPDH2 Hs.75432H67348 0.3426 1674 -1 0.8 - - Hs.61976

R51281 0.3939 1675 1 0.73 Anaphase-promoting complex 1; meiotic checkpoint regulator MCPR Hs.40137R35167 0.4791 1675 -1 0.67 BAI1-associated protein 2 BAIAP2 Hs.7936AA042830 0.4993 1675 -1 0.73 Lymphocyte-specific protein 1 LSP1 Hs.56729AA033813 0.4691 1677 -1 0.6 Chromatin assembly factor 1, subunit A (p150) CHAF1A Hs.79018H26570 0.385 1678 -1 0.77 V-akt murine thymoma viral oncogene homolog 2 AKT2 Hs.326445W05406 0.385 1679 -1 0.87 Phosphatidylinositol glycan, class K PIGK Hs.62187N90061 0.3592 1680 -1 0.8 Sulfotransferase, estrogen-preferring STE Hs.54576R13125 0.4029 1680 1 0.67 Similar to CG4995 gene product LOC153328 Hs.129539T87787 0.618 1680 1 0.53 Crumbs homolog 1 (Drosophila) CRB1 Hs.169745N20172 0.2958 1681 -1 0.93 Tumor protein p53 binding protein, 2 TP53BP2 Hs.44585H14087 0.3508 1681 -1 0.83 LDL receptor adaptor protein ARH Hs.184482R76349 0.541 1682 1 0.67 Ran binding protein 11 LOC51194 Hs.13109R42777 0.3508 1683 1 0.8 - - Hs.22216N92276 0.3763 1683 1 0.73 Chromosome 4 open reading frame 1 C4orf1 Hs.270956W68408 0.4212 1683 -1 0.8 24-dehydrocholesterol reductase DHCR24 Hs.75616W15429 0.3109 1686 -1 0.83 - - Hs.102951H80740 0.3426 1687 1 1 Phosphofructokinase, muscle PFKM Hs.75160R87411 0.274 1690 1 0.87 Growth arrest-specific 7 GAS7 Hs.226133R44852 0.3592 1690 -1 0.87 ESTs ESTs Hs.3737N31725 0.3677 1690 -1 0.8 TRAF family member-associated NFKB activator TANK Hs.146847AA029012 0.4593 1690 1 0.73 SMA3 SMA3 Hs.289061AA054119 0.6524 1690 1 0.47 - - Hs.31835AA029564 0.2884 1691 -1 1 Component of oligomeric golgi complex 2 COG2 Hs.82399AA045672 0.3345 1691 -1 0.93 LIM domain protein RIL Hs.79691W31480 0.5734 1692 -1 0.53 Coiled-coil protein BICD2 BICD2 Hs.330988N90939 0.4029 1694 1 0.73 Major histocompatibility complex, class II, DR alpha HLA-DRA Hs.76807R23871 0.4212 1694 1 0.6 Poly(rC) binding protein 1 PCBP1 Hs.2853R77690 0.3939 1695 1 0.67 Epidermal growth factor receptor pathway substrate 8-related protein 1 EPS8R1 Hs.28907W02086 0.6524 1695 -1 0.3 Sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) SMPD2 Hs.55235T94382 0.4593 1696 -1 0.73 - - -N36861 0.3345 1697 -1 0.8 ESTs ESTs Hs.42344W52113 0.3592 1697 -1 0.8 - - Hs.106510N64399 0.412 1697 1 0.8 Oxysterol binding protein-like 1A OSBPL1A Hs.252716AA142968 0.6294 1698 -1 0.4 NS1-associated protein 1 NSAP1 Hs.46801AA029530 0.44 1699 -1 0.6 Hypothetical protein FLJ20005 FLJ20005 Hs.184634W78711 0.44 1699 -1 0.47 - - Hs.110069R83313 0.3763 1700 1 0.9 Polymerase (RNA) II (DNA directed) polypeptide A, 220kDa POLR2A Hs.171880W68622 0.44 1700 1 0.73 Coatomer protein complex, subunit alpha COPA Hs.75887N59616 0.6524 1700 1 0.2 Hypothetical protein FLJ11274 FLJ11274 Hs.18104W68588 0.3592 1701 -1 0.87 Collagen, type VII, alpha 1 (epidermolysis bullosa, dystrophic, dominant and recessive) COL7A1 Hs.1640N41517 0.4593 1701 1 0.67 Aminoacylase 1 ACY1 Hs.334707R14363 0.5517 1701 1 0.4 Histone deacetylase 5 HDAC5 Hs.9028N80149 0.8596 1701 -1 0.13 - - Hs.323017AA135667 0.44 1702 1 0.67 Early development regulator 2 (polyhomeotic 2 homolog) EDR2 Hs.165263W48584 0.2534 1703 1 0.93 Procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II P4HA2 Hs.3622R61879 0.3109 1703 -1 0.93 - - -H24894 0.4691 1703 -1 0.73 - - -R25698 0.5844 1704 1 0.6 - - -AA029590 0.3939 1705 -1 0.73 NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) NHP2L1 Hs.182255N34887 0.541 1706 1 0.4 Ubiquitin protein ligase E3A (human papilloma virus E6-associated protein, Angelman syndrome) UBE3A Hs.180686H03425 0.3939 1707 -1 0.87 Alpha-1-microglobulin/bikunin precursor AMBP Hs.76177H78287 0.3592 1709 -1 0.9 Myosin ID MYO1D Hs.39871AA128825 0.4691 1709 -1 0.67 Arylsulfatase B ARSB Hs.1256H28105 0.4993 1709 1 0.47 Small nuclear ribonucleoprotein polypeptide N SNRPN Hs.48375R06577 0.3265 1710 1 0.87 Deltex homolog 2 (Drosophila) DTX2 Hs.89135H98718 0.3939 1710 -1 0.8 - - Hs.12460N52232 0.4496 1710 -1 0.73 NEDD8 ultimate buster-1 LOC51667 Hs.279780W69323 0.3508 1711 -1 0.93 - - -W23819 0.3592 1712 -1 0.73 Hypothetical protein FLJ11305 FLJ11305 Hs.7049AA053311 0.44 1712 -1 0.67 KIAA0233 gene product KIAA0233 Hs.79077R72787 0.4791 1712 1 0.6 Immunoglobulin heavy constant mu IGHM Hs.153261W31443 0.3265 1713 -1 0.77 Hypothetical protein MGC14433 MGC14433 Hs.83572N27463 0.3265 1715 -1 0.9 CCAAT-box-binding transcription factor CBF2 Hs.184760AA114905 0.5096 1715 -1 0.67 Sperm associated antigen 7 SPAG7 Hs.90436AA151232 0.5955 1715 -1 0.37 Hypothetical protein MGC15677 MGC15677 Hs.71941W38731 0.385 1716 -1 0.87 - - -W92898 0.4306 1716 -1 0.53 RAE1 RNA export 1 homolog (S. pombe) RAE1 Hs.196209N92995 0.2811 1717 -1 1 Monocytic leukemia zinc finger protein-related factor MORF Hs.27590R66076 0.4306 1717 -1 0.6 Hypothetical protein FLJ20038 FLJ20038 Hs.72071T86708 0.4593 1717 1 0.6 Solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group) SLC4A1 Hs.185923H11615 0.4593 1717 -1 0.6 Zinc finger, DHHC domain containing 4 ZDHHC4 Hs.5268W04515 0.3763 1718 -1 0.8 Syntaphilin SNPH Hs.323833H20379 0.4029 1718 1 0.8 Breakpoint cluster region protein, uterine leiomyoma, 2 BCRP2 Hs.284294H98614 0.3345 1719 -1 0.93 Zinc finger homeobox 1b ZFHX1B Hs.34871N80280 0.3186 1720 -1 0.77 Actinin, alpha 2 ACTN2 Hs.83672W35370 0.4306 1720 -1 0.93 Nuclear domain 10 protein NDP52 Hs.154230R87806 0.4791 1720 -1 0.67 ESTs ESTs Hs.356099R11257 0.4891 1721 1 0.6 DNA directed RNA polymerase II polypeptide J-related gene POLR2J2 Hs.375569H21214 0.44 1722 1 0.73 NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase) NDUFS7 Hs.211914AA043506 0.5844 1722 -1 0.53 CCAAT/enhancer binding protein (C/EBP), delta CEBPD Hs.76722W90073 0.3939 1723 1 0.93 Sel-1 suppressor of lin-12-like (C. elegans) SEL1L Hs.181300H16830 0.5304 1723 1 0.33 Hypothetical protein FLJ10374 FLJ10374 Hs.21811W24831 0.3032 1724 1 1 Dermatopontin DPT Hs.80552AA045083 0.4496 1724 1 0.6 - - Hs.289047T97307 0.541 1724 1 0.43 - - -W45565 0.5734 1724 -1 0.4 Vacuolar protein sorting protein 18 VPS18 Hs.23876R14543 0.5844 1724 1 0.47 KIAA1500 protein KIAA1500 Hs.15420R74281 0.3508 1725 1 0.93 Protein phosphatase 4 (formerly X), catalytic subunit PPP4C Hs.2903N50326 0.4496 1725 1 0.73 Hypothetical protein MGC16063 MGC16063 Hs.288544H72617 0.4593 1725 1 0.6 Hypothetical protein FLJ13150 FLJ13150 Hs.169728H52753 0.4212 1726 -1 0.67 - - Hs.21213R24727 0.44 1726 1 0.73 Phosphatidylserine receptor PSR Hs.72660H82518 0.4212 1728 1 0.8 Ribokinase RBSK Hs.11916R70783 0.8469 1731 -1 0.1 BCL2-like 2 BCL2L2 Hs.75244H01162 0.5517 1732 1 0.5 Hypothetical protein FLJ23251 FLJ23251 Hs.170737T87161 0.44 1733 1 0.6 ESTs ESTs Hs.16335AA004951 0.4496 1733 -1 0.6 DKFZP434C212 protein DKFZP434C212Hs.172069R39195 0.3508 1734 -1 0.8 Junctional adhesion molecule 1 JAM1 Hs.12284R62721 0.5625 1734 1 0.6 Small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating) SCYE1 Hs.333513R31945 0.2884 1735 -1 1 Chondroitin sulfate proteoglycan 6 (bamacan) CSPG6 Hs.24485

R77520 0.4029 1735 1 0.93 Mannose-P-dolichol utilization defect 1 MPDU1 Hs.6710N34859 0.4306 1735 1 0.8 Histone deacetylase 10 HDAC10 Hs.26593H24891 0.3592 1736 -1 0.87 - - Hs.293663AA213820 0.4593 1736 -1 0.7 - - Hs.256533H11052 0.7477 1737 1 0.27 Kinesin family member 3C KIF3C Hs.21611R12960 0.6524 1738 1 0.53 KIAA1110 protein KIAA1110 Hs.22479N71959 0.3592 1739 -1 0.8 Hypothetical protein MGC13204 MGC13204 Hs.157148N70859 0.4212 1739 -1 0.8 Exportin 1 (CRM1 homolog, yeast) XPO1 Hs.79090H84617 0.3763 1741 -1 0.87 P300/CBP-associated factor PCAF Hs.199061AA039643 0.412 1741 -1 0.87 Endothelial-derived gene 1 EG1 Hs.380864R22673 0.4993 1741 1 0.53 Chromosome 16 open reading frame 5 C16orf5 Hs.7765AA047380 0.3939 1742 -1 0.73 Like-glycosyltransferase LARGE Hs.25220T80249 0.4891 1742 1 0.53 Carnitine deficiency-associated gene expressed in ventricle 1 CDV-1 Hs.333120T97640 0.4212 1744 1 0.87 - - -H49584 0.5304 1744 -1 0.67 KIAA0962 protein KIAA0962 Hs.9059R35199 0.412 1747 -1 0.67 Hypothetical protein FLJ21080 FLJ21080 Hs.8109N49211 0.4691 1747 -1 0.6 HEMK homolog 7kb HEMK Hs.46907R21579 0.6524 1747 1 0.33 GTP binding protein 1 GTPBP1 Hs.283677H50978 0.3032 1748 1 0.87 ATP-binding cassette, sub-family D (ALD), member 4 ABCD4 Hs.94395AA149828 0.3939 1748 -1 0.93 Gm117 gm117 Hs.26226W05126 0.4496 1748 -1 0.8 - - Hs.18949H01638 0.4306 1749 1 0.67 Hypothetical protein FLJ23518 FLJ23518 Hs.112250W93284 0.618 1749 -1 0.27 Transcription elongation factor A (SII), 3 TCEA3 Hs.94952AA190714 0.3345 1750 1 0.93 Cytoskeleton associated protein 2 CKAP2 Hs.24641N54827 0.3186 1752 -1 0.93 KIAA0471 gene product KIAA0471 Hs.242271AA043507 0.8976 1752 -1 0.03 Kinesin-like 5 (mitotic kinesin-like protein 1) KNSL5 Hs.270845R53443 0.385 1753 -1 0.73 ESTs ESTs Hs.23691W58500 0.3939 1753 -1 0.6 DNA segment on chromosome X (unique) 9928 expressed sequence DXS9928E Hs.54277R50868 0.3939 1753 1 0.8 Hypothetical protein FLJ23861 FLJ23861 Hs.380669T93661 0.3426 1754 1 0.8 Endogenous retroviral family W, env(C7), member 1 (syncytin) ERVWE1 Hs.373811H72703 0.3592 1755 1 0.87 Chromosome 11 open reading frame 10 C11orf10 Hs.90918W31293 0.3763 1755 -1 0.67 Hypothetical protein FLJ10631 FLJ10631 Hs.238944N70152 0.412 1755 -1 0.53 CGI-99 protein LOC51637 Hs.110803W86341 0.5955 1755 -1 0.47 Hypothetical protein BC006130 LOC93622 Hs.6815N72553 0.385 1756 1 0.87 Calmodulin 3 (phosphorylase kinase, delta) CALM3 Hs.334330N92308 0.412 1756 -1 0.8 Protein phosphatase 1, regulatory (inhibitor) subunit 16A PPP1R16A Hs.12185AA132039 0.5199 1757 -1 0.53 - - Hs.43266R64172 0.6409 1758 -1 0.47 ESTs ESTs Hs.260100N25636 0.4791 1759 1 0.73 Esterase D/formylglutathione hydrolase ESD Hs.82193W92121 0.3508 1760 1 0.8 KIAA0618 gene product KIAA0618 Hs.295112R43282 0.385 1760 1 0.83 Leucine zipper, putative tumor suppressor 1 LZTS1 Hs.93605AA032250 0.412 1761 -1 0.73 - - Hs.15806AA043736 0.9103 1761 0 0 Actinin, alpha 1 ACTN1 Hs.119000T84043 0.3345 1762 -1 0.8 Chromosome 1 open reading frame 6 C1orf6 Hs.283739T76961 0.541 1762 1 0.73 ESTs ESTs Hs.268586T89662 0.541 1763 1 0.33 - - Hs.268617R31509 0.385 1764 -1 0.93 Arfaptin 1 HSU52521 Hs.301064H02590 0.4306 1764 1 0.73 - - -N30559 0.4691 1764 -1 0.8 - - -H00222 0.4791 1764 -1 0.77 XPA binding protein 1; putative ATP(GTP)-binding protein NTPBP Hs.18259R02682 0.5096 1765 1 0.73 Double-stranded RNA-binding zinc finger protein JAZ JAZ Hs.181012R59970 0.44 1767 1 0.8 GABA(A) receptor-associated protein like 1 GABARAPL1 Hs.336429R83247 0.44 1767 1 0.6 Galactosidase, beta 1 GLB1 Hs.79222AA040638 0.4791 1767 -1 0.8 KIAA1554 protein KIAA1554 Hs.17767R06564 0.3763 1768 -1 0.93 Galactose-4-epimerase, UDP- GALE Hs.76057R48933 0.4593 1768 -1 0.73 Polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa POLR2J Hs.80475AA054300 0.4891 1768 1 0.73 Kelch-like 4 (Drosophila) KLHL4 Hs.49075H63543 0.5199 1769 -1 0.43 FK506 binding protein 12-rapamycin associated protein 1 FRAP1 Hs.338207T97692 0.6641 1769 -1 0.47 Nicotinamide nucleotide transhydrogenase NNT Hs.18136N77879 0.4029 1770 1 0.73 WD-repeat protein HAN11 Hs.288283N47087 0.8344 1770 -1 0.17 Polymerase (RNA) II (DNA directed) polypeptide C, 33kDa POLR2C Hs.79402R71436 0.3677 1772 -1 0.93 - - Hs.6236H43658 0.3677 1773 -1 0.73 Gene overexpressed in astrocytoma GOA Hs.293660H19387 0.412 1773 1 0.93 Malic enzyme 2, NAD(+)-dependent, mitochondrial ME2 Hs.75342H61334 0.8849 1773 -1 0.13 RNA binding protein S1, serine-rich domain RNPS1 Hs.75104R52028 0.3939 1775 1 0.67 Protein tyrosine phosphatase, non-receptor type 23 PTPN23 Hs.25524R82668 0.3592 1776 1 0.8 Hypothetical protein MGC2577 MGC2577 Hs.30114H82521 0.4791 1777 -1 0.43 ATPase, H+ transporting, lysosomal 21kDa, V0 subunit c'' ATP6V0B Hs.7476R79279 0.5199 1778 1 0.67 Zinc finger protein 226 ZNF226 Hs.145956AA116099 0.3426 1779 1 1 Melanoma antigen, family D, 2 MAGED2 Hs.4943R37394 0.3763 1779 1 0.67 Hypothetical protein MGC3123 MGC3123 Hs.288600N98883 0.5304 1779 1 0.57 General transcription factor IIA, 1, 19/37kDa GTF2A1 Hs.299542T91994 0.3763 1780 1 0.8 - - Hs.188626R47985 0.4791 1780 1 0.73 - - Hs.378970N33201 0.5199 1780 -1 0.47 Cullin 4B CUL4B Hs.155976H11588 0.6067 1781 1 0.47 Bromodomain containing 2 BRD2 Hs.75243H28667 0.2958 1782 1 0.8 Sterile alpha motif and leucine zipper containing kinase AZK ZAK Hs.115175R20347 0.3426 1782 -1 0.87 Hypothetical protein FLJ22386 FLJ22386 Hs.22795T66788 0.5734 1782 -1 0.43 Component of oligomeric golgi complex 4 COG4 Hs.108779AA203403 0.44 1784 -1 0.73 Hypothetical protein MGC13064 MGC13064 Hs.333524H17141 0.4791 1784 -1 0.67 KIAA0376 protein KIAA0376 Hs.4791N68960 0.44 1785 1 0.83 Mitochondrial ribosomal protein L45 MRPL45 Hs.19347W90706 0.385 1786 -1 0.63 Chromosome 20 open reading frame 119 C20orf119 Hs.372714R85053 0.4306 1786 1 0.53 Glucosidase, beta; acid (includes glucosylceramidase) GBA Hs.282997T79902 0.4993 1786 1 0.6 - - Hs.376652T53316 0.5304 1786 1 0.53 Proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) PSME3 Hs.152978H51684 0.3939 1788 1 0.8 PDZ domain protein (Drosophila inaD-like) INADL Hs.321197H66118 0.5625 1788 1 0.37 - - Hs.285520T89040 0.3677 1789 1 0.73 CDw92 antigen CDW92 Hs.179902W40367 0.44 1791 1 0.73 3-hydroxy-3-methylglutaryl-Coenzyme A reductase HMGCR Hs.11899N68522 0.4691 1791 -1 0.73 Transforming growth factor, beta 3 TGFB3 Hs.2025AA152026 0.4891 1791 -1 0.6 - - Hs.323527N69389 0.4496 1792 -1 0.67 Nerve injury gene 283 NIN283 Hs.320834N74019 0.3032 1793 -1 0.93 KIAA0265 protein KIAA0265 Hs.192966H20195 0.4212 1793 1 0.67 Chromosome 12 open reading frame 10 C12orf10 Hs.15760R56392 0.4891 1793 1 0.67 Discoidin domain receptor family, member 1 DDR1 Hs.75562R84556 0.4891 1793 1 0.73 WD repeat domain 10 WDR10 Hs.70202H78069 0.4891 1794 1 0.43 For protein disulfide isomerase-related PDIR Hs.76901W31430 0.4496 1795 -1 0.67 Membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen) MCP Hs.83532H83019 0.3426 1796 1 0.93 Ribosomal protein S27 (metallopanstimulin 1) RPS27 Hs.195453

H06474 0.6641 1797 -1 0.4 Fatty acid desaturase 3 FADS3 Hs.21765H43854 0.7355 1797 -1 0.4 A disintegrin and metalloproteinase domain 11 ADAM11 Hs.6088R32753 0.3426 1798 1 0.67 Hypothetical protein FLJ12541 similar to Stra6 FLJ12541 Hs.24553AA034128 0.3592 1798 -1 1 - - -AA005152 0.4029 1798 1 0.8 - - Hs.356494N23380 0.541 1798 -1 0.53 Hypothetical protein MGC33602 MGC33602 Hs.274415AA132067 0.385 1799 1 0.8 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 SMARCC2 Hs.236030W40235 0.3508 1800 1 0.83 Heat shock 105kD HSP105B Hs.36927H58957 0.3592 1800 1 1 Myeloid cell leukemia sequence 1 (BCL2-related) MCL1 Hs.86386H69632 0.4891 1800 1 0.53 Slingshot 1 SSH1 Hs.60377H51915 0.3677 1801 -1 0.87 - - Hs.180372N49742 0.4691 1801 -1 0.8 Nuclear receptor subfamily 1, group D, member 2 NR1D2 Hs.37288AA053736 0.6409 1801 -1 0.33 Hypothetical protein FLJ23375 FLJ23375 Hs.285996N25073 0.4496 1802 -1 0.67 - EST Hs.322020W46682 0.3677 1803 -1 0.73 ESTs ESTs Hs.21475H17690 0.3592 1804 -1 0.87 APG12 autophagy 12-like (S. cerevisiae) APG12L Hs.264482R18779 0.3592 1804 -1 0.93 - - -R66080 0.4306 1805 -1 0.73 KIAA1530 protein KIAA1530 Hs.191268N33193 0.44 1805 -1 0.67 Glioma-amplified sequence-41 GAS41 Hs.4029H45117 0.5199 1805 1 0.6 KIAA0140 gene product KIAA0140 Hs.156016AA039869 0.7969 1805 -1 0.4 Charot-Leyden crystal protein CLC Hs.889H44437 0.3265 1806 1 0.87 - - Hs.324342AA195455 0.7599 1808 1 0.13 Stanniocalcin 2 STC2 Hs.155223T84583 0.3345 1809 1 0.87 KIAA0195 gene product KIAA0195 Hs.301132H50940 0.3763 1809 1 0.93 Nef-associated factor 1 NAF1 Hs.109281H43482 0.3763 1809 1 0.67 Valyl-tRNA synthetase 2 VARS2 Hs.159637AA150244 0.3592 1810 1 0.83 Aspartylglucosaminidase AGA Hs.207776H12368 0.4593 1810 1 0.6 Mucolipin 1 MCOLN1 Hs.12909AA047466 0.4593 1812 -1 0.6 RUN and FYVE domain-containing 1 RUFY1 Hs.289064W93121 0.541 1812 -1 0.6 KIAA0355 gene product KIAA0355 Hs.186840T81553 0.6641 1813 1 0.27 - - -H17405 0.4212 1816 1 0.87 KIAA0435 gene product KIAA0435 Hs.31438W19134 0.4791 1816 1 0.67 DKFZP564F0522 protein DKFZP564F052 Hs.23060AA101984 0.5844 1816 1 0.6 G-protein coupled receptor RE2 Hs.301642W47043 0.6995 1816 1 0.4 Cyclin-dependent kinase 5 CDK5 Hs.166071AA044730 0.9103 1816 1 0.07 FLJ23277 protein FLJ23277 Hs.334477R21859 0.3508 1817 1 0.8 Microfibrillar-associated protein 2 MFAP2 Hs.83551R51845 0.3763 1817 1 0.8 Cyclin-dependent kinase 8 CDK8 Hs.25283N78568 0.44 1817 -1 0.8 - - Hs.288671W90523 0.4691 1817 -1 0.6 Hypothetical protein FLJ20211 FLJ20211 Hs.311100H97372 0.5517 1817 1 0.6 Integrin, beta 5 ITGB5 Hs.149846N36697 0.3345 1818 -1 0.93 ESTs ESTs Hs.41322H09771 0.412 1818 1 0.73 - - -R72851 0.3508 1819 1 0.87 Phosphatidylinositol glycan, class S PIGS Hs.347950H01212 0.4891 1820 -1 0.73 Dynein, cytoplasmic, light intermediate polypeptide 1 DNCLI1 Hs.266483H53410 0.385 1821 -1 0.8 Polymerase (DNA-directed), delta 4 POLD4 Hs.82520T84454 0.4593 1821 1 0.67 COP9 subunit 6 (MOV34 homolog, 34 kD) MOV34-34KD Hs.15591AA213820 0.4593 1821 1 0.73 - - Hs.256533AA037128 0.5625 1821 1 0.47 Cisplatin resistance related protein CRR9p CRR9 Hs.323769R15335 0.4691 1822 1 0.67 Importin 4 FLJ23338 Hs.61790H40649 0.5955 1822 1 0.4 Hypothetical protein FLJ20628 FLJ20628 Hs.32356H85873 0.385 1823 1 0.83 SUMO-1 activating enzyme subunit 2 UBA2 Hs.4311H99068 0.5844 1824 1 0.4 - - Hs.101810AA149240 0.5096 1825 -1 0.53 Similar to DNA-directed RNA polymerase I (135 kDa) Rpo1-2 Hs.86337AA055269 0.4891 1826 1 0.53 - - Hs.41269H89293 0.3426 1828 -1 0.93 - - Hs.108646AA037624 0.3763 1828 1 0.93 Hypothetical protein MGC5242 MGC5242 Hs.77365AA031503 0.4791 1828 -1 0.53 CGI-20 protein LOC51608 Hs.107387N32967 0.4891 1829 -1 0.6 KIAA0678 protein KIAA0678 Hs.12707N58341 0.4993 1829 1 0.63 Mitochondrial ribosomal protein L22 MRPL22 Hs.41007T83371 0.6067 1829 -1 0.4 - - Hs.296979AA047410 0.6758 1829 -1 0.47 Tafazzin (cardiomyopathy, dilated 3A (X-linked); endocardial fibroelastosis 2; Barth syndrome) TAZ Hs.79021H83357 0.4496 1830 -1 0.67 Hypothetical protein BC012008 LOC144467 Hs.348374W61013 0.4496 1831 -1 0.6 V-abl Abelson murine leukemia viral oncogene homolog 1 ABL1 Hs.146355AA127045 0.4791 1831 1 0.73 Hypothetical protein BC009331 LOC92305 Hs.337772T80727 0.4029 1832 -1 0.8 Protease, serine, 25 PRSS25 Hs.115721T83106 0.618 1832 -1 0.5 Chemokine-like factor 1 CKLF1 Hs.15159H23225 0.3763 1833 1 0.87 Protein kinase C, epsilon PRKCE Hs.211592AA121538 0.4691 1833 1 0.8 Homer, neuronal immediate early gene, 3 HOMER-3 Hs.166146AA007570 0.5304 1833 -1 0.53 KIAA0682 gene product KIAA0682 Hs.7482N25190 0.3939 1834 -1 0.87 Glutathione peroxidase 1 GPX1 Hs.76686N74870 0.3032 1835 -1 0.87 Ring-box 1 RBX1 Hs.279919N76056 0.44 1836 -1 0.8 ARP1 actin-related protein 1 homolog B, centractin beta (yeast) ACTR1B Hs.2477W31103 0.4593 1836 -1 0.73 Bromodomain containing 2 BRD2 Hs.75243T80857 0.5199 1836 -1 0.47 - - -R76096 0.618 1837 -1 0.33 Hypothetical protein FLJ20502 FLJ20502 Hs.23956AA133959 0.6524 1837 -1 0.33 Brain-specific protein p25 alpha p25 Hs.29353AA043178 0.3109 1840 1 0.93 Mitogen-activated protein kinase 3 MAPK3 Hs.861AA099731 0.4593 1840 -1 0.8 Follicular lymphoma variant translocation 1 FVT1 Hs.74050N70097 0.4212 1841 1 0.53 - - -H75270 0.541 1841 -1 0.6 Hypothetical protein FLJ14743 FLJ14743 Hs.169577AA203467 0.541 1842 1 0.47 - - -T51260 0.3677 1843 -1 0.87 Hexosaminidase A (alpha polypeptide) HEXA Hs.119403R52448 0.3508 1844 1 0.9 Synovial sarcoma translocation, chromosome 18 SS18 Hs.153221N71709 0.4496 1845 1 0.67 DC11 protein DC11 Hs.42785AA150731 0.412 1846 -1 0.67 - - Hs.374418R07486 0.4691 1846 1 0.6 ESTs ESTs Hs.18920AA136473 0.9743 1846 1 0.1 - - Hs.46609R74157 0.3763 1847 1 0.73 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 ATP6V0D1 Hs.106876H44188 0.5199 1848 1 0.5 - - -H75274 0.4691 1849 -1 0.67 Solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 SLC1A4 Hs.323878N31735 0.5625 1849 -1 0.6 Hypothetical protein FLJ20671 FLJ20671 Hs.180201AA007414 0.4496 1850 1 0.6 Copper metabolism gene MURR1 MURR1 Hs.339669W24575 0.4212 1852 1 0.8 WW domain binding protein 1 WBP1 Hs.375564AA037862 0.5517 1854 -1 0.53 Nucleotide-sugar transporter similar to C. elegans sqv-7 SQV7L Hs.90078AA115581 0.385 1855 1 0.8 Phosphoglycerate kinase 1 PGK1 Hs.78771AA034330 0.412 1855 1 0.83 - - -W81033 0.5517 1855 -1 0.67 Sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3 SULT1A3 Hs.274614W88726 0.5625 1855 -1 0.67 Metaxin 1 MTX1 Hs.247551H79184 0.5955 1855 -1 0.47 Hypothetical protein FLJ14981 FLJ14981 Hs.76925

N68626 0.6876 1855 -1 0.4 Splicing factor 1 SF1 Hs.180677W47347 0.412 1857 -1 0.8 Hypothetical protein FLJ11198 FLJ11198 Hs.91251N26710 0.44 1857 -1 0.73 Hypothetical protein BC011593 LOC112495 Hs.344097AA203622 0.4306 1858 1 0.73 - - -N62381 0.3426 1861 -1 0.87 Fring LOC117584 Hs.172694N24303 0.4212 1861 -1 0.87 - - -AA035066 0.4496 1861 1 0.67 Hypothetical protein MGC4268 MGC4268 Hs.22708H08185 0.4593 1861 -1 0.53 Hypothetical protein BC004409 LOC92170 Hs.301693H91623 0.4593 1861 -1 0.73 - - -R68212 0.4691 1861 1 0.53 - - -AA101823 0.5199 1861 1 0.73 Elastin microfibril interface located protein EMILIN Hs.63348N36282 0.3186 1863 -1 1 ESTs ESTs Hs.356537N93402 0.4691 1863 1 0.73 Guanine nucleotide binding protein-like 1 GNL1 Hs.83147AA101710 0.7234 1863 -1 0.13 - - Hs.12396W32377 0.3265 1864 1 1 Methylmalonyl Coenzyme A mutase MUT Hs.155212R39304 0.3426 1865 1 0.87 Ephrin-B2 EFNB2 Hs.30942R08328 0.4306 1865 1 0.67 Nucleoporin 133kDa NUP133 Hs.12457R47801 0.6409 1865 -1 0.53 Protein inhibitor of activated STAT3 PIAS3 Hs.76578H60501 0.5625 1866 -1 0.67 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 MLLT4 Hs.100469T75262 0.5625 1866 1 0.53 - - -R19153 0.44 1868 -1 0.57 - - Hs.356751AA033687 0.5844 1868 1 0.67 STAT induced STAT inhibitor-2 STATI2 Hs.110776R91365 0.618 1868 1 0.4 G protein-coupled receptor kinase-interactor 2 GIT2 Hs.57734W33139 0.7114 1868 -1 0.4 Hypothetical protein dJ122O8.2 DJ122O8.2 Hs.268115R42554 0.4496 1869 1 0.73 T-box, brain, 1 TBR1 Hs.210862N91767 0.541 1869 -1 0.53 Twisted gastrulation TSG Hs.247302R21825 0.7477 1869 1 0.47 - - Hs.23272R44307 0.3763 1871 1 0.83 Neurabin II LOC84687 Hs.110095T80433 0.4306 1872 -1 0.73 HSKM-B protein HSKM-B Hs.66170H12149 0.4212 1873 1 0.6 MAX dimerization protein 4 MAD4 Hs.102402AA099555 0.5734 1874 -1 0.4 Hypothetical protein FLJ12666 FLJ12666 Hs.23767AA152304 0.8976 1874 -1 0.27 ADP-ribosylation factor 3 ARF3 Hs.119177N90407 0.5734 1875 -1 0.47 Ems1 sequence (mammary tumor and squamous cell carcinoma-associated (p80/85 src substrate) EMS1 Hs.119257H67165 0.3677 1877 1 0.8 Nitric oxide synthase 2A (inducible, hepatocytes) NOS2A Hs.193788T78345 0.618 1877 1 0.6 - - Hs.269116R07576 0.3265 1878 1 0.87 L(3)mbt-like (Drosophila) L3MBTL Hs.119021AA152294 0.3939 1878 -1 0.73 Presenilin 2 (Alzheimer disease 4) PSEN2 Hs.25363N50540 0.4029 1880 1 0.93 - - Hs.346742R20723 0.4496 1880 1 0.73 ESTs ESTs Hs.374490H67893 0.4496 1882 -1 0.8 Sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 SULT1A1 Hs.142T95735 0.4496 1884 1 0.63 Phosphatidylinositol-4-phosphate 5-kinase, type I, alpha PIP5K1A Hs.149255H03273 0.5625 1885 -1 0.5 PEST-containing nuclear protein PCNP Hs.283728H52789 0.4791 1886 1 0.73 DKFZP434P106 protein DKFZP434P106 Hs.236522H61357 0.385 1887 1 0.73 Tumor protein p53 (Li-Fraumeni syndrome) TP53 Hs.1846N93055 0.385 1888 1 0.87 Interferon, gamma-inducible protein 30 IFI30 Hs.14623AA150898 0.412 1888 1 0.8 FK506 binding protein 9, 63 kDa FKBP9 Hs.302749AA043766 0.6294 1888 1 0.4 - - -R45200 0.3265 1889 1 1 YME1-like 1 (S. cerevisiae) YME1L1 Hs.206521R23189 0.3592 1889 -1 0.87 ESTs ESTs Hs.172610R89847 0.412 1889 -1 0.93 ESTs ESTs Hs.175979W47014 0.3592 1890 1 0.87 Ts translation elongation factor, mitochondrial TSFM Hs.340959AA213887 0.385 1890 1 0.87 Hypothetical protein FLJ21908 FLJ21908 Hs.26750H86173 0.3939 1890 1 0.93 - - -H79385 0.4496 1890 -1 0.6 Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B APOBEC3B Hs.226307T39368 0.4496 1891 -1 0.67 Solute carrier family 7 (cationic amino acid transporter, y+ system), member 4 SLC7A4 Hs.197116H69511 0.5096 1891 1 0.67 Hypothetical protein FLJ38975 FLJ38975 Hs.27769H85791 0.4691 1892 1 0.83 - - Hs.380059N74712 0.8849 1892 -1 0.07 Similar to RIKEN cDNA 3110001D03 gene (M. musculus) MGC4730 Hs.7517T77130 0.2958 1893 -1 1 ESTs ESTs Hs.268606H84616 0.4891 1893 1 0.6 Hypothetical protein MGC18216 MGC18216 Hs.104679AA101783 0.5625 1893 -1 0.4 ESTs ESTs Hs.22380H16773 0.3939 1894 -1 0.93 - - Hs.12245AA040629 0.4212 1894 -1 0.8 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 MLLT6 Hs.349196R52847 0.541 1894 1 0.6 - - -R02573 0.4496 1895 1 0.73 Similar to yeast Upf3, variant A UPF3A Hs.274412H68599 0.4993 1895 -1 0.43 Hypothetical protein MGC15737 MGC15737 Hs.39122AA044433 0.5955 1895 -1 0.47 - - Hs.279607H10430 0.618 1895 1 0.27 Hypothetical protein FLJ21939 similar to 5-azacytidine induced gene 2 FLJ21939 Hs.164478R34257 0.3763 1897 -1 1 Hepatocyte growth factor-regulated tyrosine kinase substrate HGS Hs.24756AA069532 0.3939 1897 1 0.87 - - Hs.287955R72133 0.5517 1897 -1 0.4 - - Hs.5957AA047581 0.4212 1898 1 0.67 Peroxiredoxin 5 PRDX5 Hs.31731W58640 0.4496 1898 -1 0.73 SECIS binding protein 2 SBP2 Hs.288141W31714 0.412 1899 -1 0.8 - - Hs.122656T54683 0.5199 1899 -1 0.53 DNA helicase homolog PIF1 PIF1 Hs.112160R50487 0.4212 1900 -1 0.87 - - Hs.25717H05539 0.4496 1901 1 0.8 Uncharacterized bone marrow protein BM046 BM046 Hs.177812N63482 0.4891 1902 1 0.67 Lysosomal-associated membrane protein 2 LAMP2 Hs.8262H44192 0.5625 1902 1 0.47 Nischarin NISCH Hs.26285R76103 0.3032 1903 -1 0.93 - - Hs.367898AA056394 0.4993 1903 1 0.6 Carbonic anhydrase IX CA9 Hs.63287R23374 0.618 1903 1 0.47 Hypothetical protein FLJ10462 FLJ10462 Hs.100895R20808 0.4993 1904 1 0.6 POP7 (processing of precursor, S. cerevisiae) homolog RPP20 Hs.18747R21171 0.412 1905 1 0.87 Electron-transfer-flavoprotein, alpha polypeptide (glutaric aciduria II) ETFA Hs.169919W56565 0.4306 1905 -1 0.8 - - Hs.56185H52953 0.8344 1906 1 0.17 Hypothetical protein MGC20255 MGC20255 Hs.334775AA037284 0.8596 1906 -1 0.07 Adenine phosphoribosyltransferase APRT Hs.28914R47829 0.5625 1907 -1 0.33 CD37 antigen CD37 Hs.153053AA004492 0.6995 1907 -1 0.2 Cytochrome P450 monooxygenase CYP-M Hs.352566H64625 0.7355 1909 -1 0.4 Coproporphyrinogen oxidase (coproporphyria, harderoporphyria) CPO Hs.89866AA005020 0.9103 1909 1 0.2 Protein tyrosine phosphatase, non-receptor type 1 PTPN1 Hs.155894N51951 0.44 1910 1 0.7 - - -H19953 0.5199 1910 1 0.6 - - Hs.220963R86233 0.4593 1912 1 0.73 Serum/glucocorticoid regulated kinase SGK Hs.296323H16602 0.4791 1912 1 0.8 - - Hs.356087N66243 0.4029 1913 -1 0.73 ESTs ESTs Hs.26575H14473 0.7599 1913 -1 0.4 Tetracycline transporter-like protein TETRAN Hs.157145W04705 0.6409 1914 -1 0.37 Hypothetical protein DKFZp667B1218 DKFZp667B1218Hs.151293AA052907 0.6409 1914 -1 0.5 Hypothetical protein DKFZP434G0310 DKFZP434G031Hs.334836AA054498 0.7114 1915 -1 0.27 Hypothetical protein DKFZp566J2046 DKFZP566J2046Hs.322482

AA001748 0.4029 1916 -1 0.8 Hypothetical protein FLJ11286 FLJ11286 Hs.12151R46554 0.4306 1916 -1 0.73 KIAA0930 protein KIAA0930 Hs.13255AA134115 0.8093 1916 -1 0.33 Sphingosine-1-phosphate lyase 1 SGPL1 Hs.186613H14891 0.4691 1917 1 0.47 Kinesin family member 3B KIF3B Hs.301206R25792 0.6876 1917 1 0.33 Malic enzyme 2, NAD(+)-dependent, mitochondrial ME2 Hs.75342R11669 0.4891 1918 1 0.67 Hypothetical protein LOC56912 LOC56912 Hs.334360H78351 0.4993 1918 -1 0.53 - - -R39441 0.6067 1918 -1 0.47 - - -R87739 0.4993 1922 -1 0.67 Transmembrane protein 1 TMEM1 Hs.94479N45225 0.5734 1923 1 0.47 Vesicle transport-related protein RA410 Hs.27023H75346 0.4891 1924 -1 0.8 ESTs ESTs Hs.294014N22158 0.5304 1924 -1 0.4 - - Hs.283072R94457 0.3939 1925 1 0.73 Guanine monphosphate synthetase GMPS Hs.5398AA044084 0.44 1925 1 0.8 Chromosome 12 open reading frame 5 C12orf5 Hs.24792H15247 0.44 1926 1 0.73 Lipase A, lysosomal acid, cholesterol esterase (Wolman disease) LIPA Hs.85226H17047 0.5955 1926 1 0.4 Zinc finger protein 133 (clone pHZ-13) ZNF133 Hs.78434N92372 0.5304 1927 1 0.6 Peroxiredoxin 4 PRDX4 Hs.83383AA047101 0.6641 1927 -1 0.43 Chromosome 5 open reading frame 6 C5orf6 Hs.102469R75874 0.4496 1929 1 0.73 KIAA1932 protein KIAA1932 Hs.306121R61690 0.5955 1930 1 0.5 Chondroitin sulfate proteoglycan 4 (melanoma-associated) CSPG4 Hs.9004W15599 0.4691 1931 -1 0.73 BCL2/adenovirus E1B 19kDa interacting protein 3 BNIP3 Hs.79428R76214 0.4891 1931 1 0.8 Protocadherin 16 dachsous-like (Drosophila) PCDH16 Hs.9658AA156795 0.4993 1931 1 0.53 ESTs ESTs Hs.62772T77424 0.4993 1932 1 0.57 FOXJ2 forkhead factor FHX Hs.120844N93517 0.5096 1932 1 0.73 - - Hs.67317R28325 0.7234 1932 1 0.33 Hypothetical protein MGC10500 MGC10500 Hs.271599R59315 0.4029 1936 -1 0.8 Polymerase (DNA directed), delta 3 POLD3 Hs.82502N71104 0.4496 1936 1 0.73 - - Hs.46506N30288 0.4496 1936 -1 0.67 Prefoldin 2 PFDN2 Hs.298229H15268 0.4593 1936 -1 0.67 Nectin-like protein 1 NECL1 Hs.6164AA053325 0.8218 1938 -1 0.2 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 1 ATP6V1G1 Hs.90336R73278 0.3426 1939 1 0.87 Intercellular adhesion molecule 3 ICAM3 Hs.99995W47502 0.7722 1939 1 0.33 Alpha glucosidase II alpha subunit G2AN Hs.76847R20820 0.3592 1940 1 0.8 ESTs ESTs Hs.171487H24136 0.4993 1940 -1 0.67 - - -N30140 0.4691 1942 -1 0.8 Protein kinase, AMP-activated, gamma 1 non-catalytic subunit PRKAG1 Hs.3136H53304 0.4029 1943 1 0.83 - - Hs.117530R23136 0.5199 1943 -1 0.63 Solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 SLC11A2 Hs.57435H29063 0.6876 1944 -1 0.37 Arginyl aminopeptidase (aminopeptidase B)-like 1 RNPEPL1 Hs.5345W39400 0.5096 1947 -1 0.8 Matrix metalloproteinase 11 (stromelysin 3) MMP11 Hs.155324R96053 0.7845 1947 1 0.2 Hypothetical protein LOC51320 LOC51320 Hs.12830AA039598 0.5096 1948 -1 0.53 Ribosomal protein S6 kinase, 90kDa, polypeptide 1 RPS6KA1 Hs.149957W02772 0.5096 1948 -1 0.6 Hypothetical protein FLJ23749 FLJ23749 Hs.180178AA029852 0.618 1948 1 0.47 Hypothetical protein FLJ20259 FLJ20259 Hs.9956H95137 0.4306 1949 -1 0.8 Map kinase phosphatase-like protein MK-STYX LOC51657 Hs.11615R54993 0.6067 1949 1 0.47 Chromosome 20 open reading frame 167 C20orf167 Hs.26213H88208 0.4029 1950 -1 0.8 Suppressor of var1, 3-like 1 (S. cerevisiae) SUPV3L1 Hs.106469W78793 0.4791 1950 1 0.6 Epidermal growth factor receptor pathway substrate 8 EPS8 Hs.2132H16558 0.4691 1951 -1 0.67 Myosin VA (heavy polypeptide 12, myoxin) MYO5A Hs.170157N/A1 0.7355 1951 1 0.4 - - -AA005328 0.4691 1952 -1 0.8 V-ski sarcoma viral oncogene homolog (avian) SKI Hs.2969AA046951 0.5096 1952 1 0.7 Insulinoma-associated protein IA-6 INSM2 Hs.62813H98666 0.44 1954 -1 0.77 Procollagen (type III) N-endopeptidase PCOLN3 Hs.183138H82747 0.5199 1954 1 0.53 ESTs ESTs Hs.295855AA045670 0.4993 1955 -1 0.7 Cell division cycle 34 CDC34 Hs.76932H10877 0.5199 1956 -1 0.67 Ankyrin repeat and SOCS box-containing 1 ASB1 Hs.153489H29620 0.5517 1956 1 0.4 Chromosome 6 open reading frame 33 C6orf33 Hs.239388W16434 0.618 1956 -1 0.47 Testis expressed sequence 27 TEX27 Hs.6120R86854 0.4993 1957 1 0.6 Chromosome 11 open reading frame 14 C11orf14 Hs.32017W58243 0.4496 1958 1 0.6 - - Hs.134158AA130080 0.4496 1958 -1 0.73 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 PSMD12 Hs.4295W20491 0.4891 1958 -1 0.67 TAR (HIV) RNA binding protein 2 TARBP2 Hs.326H65687 0.6524 1958 1 0.57 Hypothetical protein FLJ23263 FLJ23263 Hs.288716R75956 0.4791 1960 1 0.47 Chromosome 22 open reading frame 2 C22orf2 Hs.227637N66086 0.3763 1961 -1 0.8 - - Hs.350534H44002 0.3939 1961 1 0.8 - - -T54522 0.6409 1962 1 0.33 Breast cancer metastasis-suppressor 1 BRMS1 Hs.100426W63774 0.4212 1963 -1 0.73 H2A histone family, member X H2AFX Hs.147097R80587 0.541 1963 1 0.6 Protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform PPP2R2A Hs.179574N23296 0.4791 1964 1 0.8 Dynein, cytoplasmic, intermediate polypeptide 2 DNCI2 Hs.66881W51953 0.5199 1964 1 0.67 Tenascin XB TNXB Hs.169886N76065 0.5304 1964 1 0.6 Mitochondrial ribosomal protein S35 MRPS35 Hs.10724N27569 0.3677 1965 1 0.97 - - Hs.218707T87593 0.5625 1965 -1 0.8 ESTs ESTs Hs.111805H22698 1 1965 1 0.17 General transcription factor IIB GTF2B Hs.258561R64704 0.385 1966 1 0.93 Placental protein 13-like protein PPL13 Hs.24236R00553 0.4691 1966 -1 0.7 - - Hs.270347N66247 0.5096 1966 1 0.67 - - Hs.6390N75375 0.541 1966 -1 0.67 - - -AA203245 0.3677 1967 -1 0.8 - - -T92962 0.4891 1968 1 0.6 CD81 antigen (target of antiproliferative antibody 1) CD81 Hs.54457N71166 0.4993 1968 -1 0.53 Phosphatidylinositol glycan, class Q PIGQ Hs.18079N34875 0.8976 1968 -1 0.03 Hypothetical protein FLJ20373 FLJ20373 Hs.6631T83961 0.541 1969 1 0.6 - - -W72939 0.5625 1969 -1 0.4 KIAA0097 gene product KIAA0097 Hs.76989N91237 0.5625 1969 -1 0.6 Chloride intracellular channel 2 CLIC2 Hs.54570H93330 0.412 1971 -1 0.87 Solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulatory factor 1 SLC9A3R1 Hs.184276W46363 0.618 1971 -1 0.4 Host cell factor homolog LCP Hs.20597H78277 0.7969 1971 -1 0.33 Hypothetical protein DKFZp761D0211 DKFZP761D021Hs.322456N47851 0.4593 1972 -1 0.73 - - -R05370 0.5734 1972 1 0.4 - - Hs.233290H84316 0.6524 1972 -1 0.23 Neuroligin 3 NLGN3 Hs.47320T79597 0.6294 1973 1 0.47 - - -H10448 0.5096 1974 1 0.6 Cytochrome b5 reductase 1 (B5R.1) LOC51706 Hs.289113AA022903 0.6294 1974 1 0.4 Laminin, gamma 1 (formerly LAMB2) LAMC1 Hs.214982AA136799 0.5096 1975 -1 0.47 Growth arrest and DNA-damage-inducible, alpha GADD45A Hs.80409R72685 0.3939 1976 1 0.87 Similar to vaccinia virus HindIII K4L ORF HU-K4 Hs.74573W23595 0.412 1976 -1 0.93 HDCMA18P protein HDCMA18P Hs.278635R33249 0.3763 1977 1 0.87 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3 B4GALT3 Hs.321231R20019 0.6294 1977 -1 0.53 - - -

H62026 0.5096 1978 1 0.6 Superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) SOD1 Hs.75428R22724 0.6294 1978 1 0.33 Hypothetical protein BC011840 LOC93343 Hs.106597W88557 0.5096 1980 -1 0.77 TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa TAF10 Hs.89657T65557 0.5625 1980 1 0.6 Dual specificity phosphatase 6 DUSP6 Hs.180383R19166 0.4791 1981 -1 0.73 ESTs ESTs Hs.91401AA069570 0.7114 1981 1 0.13 Heat shock 27kDa protein 1 HSPB1 Hs.76067T77709 0.6409 1982 -1 0.4 Nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (p105) NFKB1 Hs.83428T83736 0.3939 1983 1 0.8 Hypothetical protein FLJ31121 FLJ31121 Hs.350194H81916 0.5955 1983 -1 0.6 Transcription termination factor, RNA polymerase II TTF2 Hs.142157H82880 0.7234 1983 1 0.27 Peptidylprolyl isomerase A (cyclophilin A) PPIA Hs.342389R69858 0.7845 1983 -1 0.07 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide YWHAH Hs.349530AA213820 0.4306 1984 1 0.8 - - Hs.256533R36505 0.4593 1984 1 0.8 ESTs ESTs Hs.271945R15444 0.4691 1984 -1 0.53 - - Hs.69476N34766 0.4993 1984 -1 0.67 Mannosidase, alpha, class 2A, member 2 MAN2A2 Hs.295605R25303 0.541 1984 -1 0.6 Hypothetical protein MGC10940 MGC10940 Hs.47986R70771 0.5199 1985 -1 0.67 Ubiquitin specific protease 11 USP11 Hs.171501H79770 0.4593 1986 -1 0.67 Ret finger protein RFP Hs.142653AA053306 0.5096 1986 -1 0.6 Polyglutamine binding protein 1 PQBP1 Hs.30570N78617 0.6409 1987 -1 0.3 Phosphodiesterase 5A, cGMP-specific PDE5A Hs.139271R89118 0.4691 1988 1 0.67 Alpha-fetoprotein AFP Hs.155421R35372 0.5096 1988 1 0.53 Tetracycline transporter-like protein TETRAN Hs.157145H16647 0.5096 1988 -1 0.67 Solute carrier family 27 (fatty acid transporter), member 4 SLC27A4 Hs.248953R44372 0.5199 1988 1 0.87 KIAA1322 protein KIAA1322 Hs.72242R55690 0.5844 1988 1 0.73 Ninein (GSK3B interacting protein) NIN Hs.44054N73756 0.5304 1989 1 0.6 KIAA0628 gene product KIAA0628 Hs.43133AA037760 0.4593 1990 1 0.8 Hypothetical protein MGC1203 MGC1203 Hs.17987R35019 0.5304 1990 1 0.67 - - Hs.24906H69656 0.6524 1990 1 0.4 Nuclear prelamin A recognition factor NARF Hs.256526R36697 0.6641 1990 1 0.47 START domain containing 3 STARD3 Hs.77628W37211 0.5625 1991 -1 0.4 S100 calcium binding protein A13 S100A13 Hs.14331W60229 0.5844 1991 1 0.47 Hypothetical protein FLJ20093 FLJ20093 Hs.172572R24513 0.9359 1991 -1 0.07 Low density lipoprotein receptor-related protein 6 LRP6 Hs.23672AA047471 0.6294 1992 1 0.4 Nucleolar protein GU2 GU2 Hs.7392W91913 0.4306 1993 -1 0.87 SNARE protein Ykt6 YKT6 Hs.296244H81266 0.5304 1995 -1 0.67 Retinol dehydrogenase 5 (11-cis and 9-cis) RDH5 Hs.172914W86640 0.541 1995 -1 0.47 Receptor (TNFRSF)-interacting serine-threonine kinase 1 RIPK1 Hs.296327R01226 0.8469 1995 1 0.4 - - Hs.348515R70391 0.5625 1996 1 0.47 Ribonuclease/angiogenin inhibitor RNH Hs.75108R83613 0.44 1997 -1 0.87 Cyclin G associated kinase GAK Hs.153227R63034 0.4791 1997 -1 0.47 Zinc finger protein 185 (LIM domain) ZNF185 Hs.16622AA056174 0.5844 1997 -1 0.53 KIAA0082 protein KIAA0082 Hs.154045AA055968 0.7355 1998 -1 0.47 Synuclein, gamma (breast cancer-specific protein 1) SNCG Hs.349470W90242 0.44 1999 1 0.67 Chromosome 14 open reading frame 1 C14orf1 Hs.15106AA031411 0.4496 1999 1 0.73 Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa PAFAH1B1 Hs.77318T88001 0.4891 1999 1 0.67 ESTs ESTs Hs.294105H00874 0.4891 2000 1 0.73 - - Hs.295789R45428 0.5625 2001 1 0.53 DnaJ (Hsp40) homolog, subfamily A, member 1 DNAJA1 Hs.94AA210772 0.6294 2001 1 0.4 Hypothetical protein FLJ22611 FLJ22611 Hs.27774AA028107 0.6524 2002 -1 0.33 HLA-B associated transcript 2 BAT2 Hs.25911N69470 0.5625 2003 1 0.6 Hypothetical protein FLJ10569 FLJ10569 Hs.5105R17445 0.5625 2004 1 0.4 Hypothetical protein MGC10854 MGC10854 Hs.22222W90600 0.5625 2004 1 0.6 CGI-92 protein COQ4 Hs.20159AA029895 0.7477 2004 1 0.2 Fibrillarin FBL Hs.99853W88447 0.3508 2005 -1 0.9 Cell growth regulatory with ring finger domain CGR19 Hs.59106T82265 0.3939 2005 1 1 Nudix (nucleoside diphosphate linked moiety X)-type motif 4 NUDT4 Hs.92381AA029848 0.44 2005 1 0.67 Excision repair cross-complementing rodent repair deficiency, complementation group 5 ERCC5 Hs.48576H15272 0.6294 2005 1 0.43 - - Hs.194478N24811 0.6409 2005 1 0.33 Rho GTPase activating protein 5 ARHGAP5 Hs.267831W47662 0.7722 2005 -1 0.53 Modulator recognition factor I MRF-1 Hs.920R61363 0.5304 2006 -1 0.67 - - Hs.117530H58459 0.5844 2007 1 0.53 Glycosyltransferase AD-017 AD-017 Hs.283737H15461 0.5955 2007 1 0.4 - - Hs.323409R77592 0.44 2008 1 0.67 Chromatin accessibility complex 1 CHRAC1 Hs.279704R24277 0.5625 2008 -1 0.73 RAB40C, member RAS oncogene family RAB40C Hs.31408R53547 0.5625 2009 1 0.47 Elongation factor for selenoprotein translation SELB Hs.6522R25090 0.7114 2009 1 0.33 - - -H78789 0.3677 2010 -1 0.8 KIAA0241 protein KIAA0241 Hs.150275AA040028 0.4593 2010 -1 0.67 Hypothetical protein BC014641 LOC129138 Hs.135259R19007 0.9103 2010 1 0.2 Lysosomal apyrase-like protein 1 LALP1 Hs.22604N69097 0.4791 2011 1 0.6 - - -W85877 0.385 2013 -1 0.93 PR/SET domain containing protein 07 SET07 Hs.111988R28059 0.4691 2013 -1 0.8 Breast carcinoma amplified sequence 2 BCAS2 Hs.22960N73898 0.5096 2014 1 0.67 - - Hs.220656R22945 0.5955 2016 -1 0.53 Hypothetical protein FLJ14511 FLJ14511 Hs.40919N64474 0.4212 2017 -1 0.8 Protein phosphatase 4, regulatory subunit 2 PPP4R2 Hs.356686H63542 0.7477 2017 -1 0.27 Upstream binding protein 1 (LBP-1a) UBP1 Hs.28423T97303 0.4891 2018 1 0.67 Signal sequence receptor, alpha (translocon-associated protein alpha) SSR1 Hs.250773N69412 1 2018 1 0.1 - - -T89503 0.4791 2019 1 0.8 Hypothetical protein FLJ14166 FLJ14166 Hs.14070W40179 0.5625 2019 1 0.67 APEX nuclease (multifunctional DNA repair enzyme) APEX Hs.73722T94105 0.8976 2019 -1 0.13 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 ABCC1 Hs.89433N92911 0.4691 2020 -1 0.57 Hypothetical protein dJ473B4 DJ473B4 Hs.57549W40265 0.7114 2020 -1 0.47 NEFA-interacting nuclear protein NIP30 NIP30 Hs.285017T95687 0.3677 2021 -1 0.87 RAP1, GTP-GDP dissociation stimulator 1 RAP1GDS1 Hs.7940AA036631 0.5517 2021 -1 0.53 Esophageal cancer related gene 4 protein ECRG4 Hs.43125H99843 0.6409 2021 1 0.4 Quinolinate phosphoribosyltransferase (nicotinate-nucleotide pyrophosphorylase (carboxylating)) QPRT Hs.8935N49027 0.3345 2022 -1 0.87 KIAA0460 protein KIAA0460 Hs.29956N78331 0.385 2023 -1 0.87 Activator of basal transcription 1 ABT1 Hs.109428R48805 0.4993 2023 -1 0.57 ESTs ESTs Hs.25577T85994 0.3508 2024 -1 0.93 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa NDUFB4 Hs.227750AA059052 0.541 2025 -1 0.53 ARP1 actin-related protein 1 homolog B, centractin beta (yeast) ACTR1B Hs.2477N44136 0.541 2025 -1 0.47 Kinesin family member 1B KIF1B Hs.375193H72512 0.3677 2026 1 0.73 HSPC023 protein HSPC023 Hs.279945R96393 0.5517 2027 -1 0.53 ESTs ESTs Hs.184721R76890 0.618 2027 1 0.6 KIAA1340 protein KIAA1340 Hs.51743R34571 0.4993 2028 -1 0.53 Hypothetical protein FLJ20136 FLJ20136 Hs.24817N71255 0.6758 2028 1 0.27 SAC2 suppressor of actin mutations 2-like (yeast) SACM2L Hs.169407R78728 0.618 2029 1 0.6 Kelch-like 5 (Drosophila) KLHL5 Hs.272239W90163 0.6294 2029 -1 0.33 RA-regulated nuclear matrix-associated protein RAMP Hs.126774

H26760 0.7477 2029 1 0.27 KIAA0375 gene product KIAA0375 Hs.26951R38335 0.4306 2030 -1 0.73 Ribonuclease H2, large subunit RNASEH2A Hs.25292R35559 0.4306 2030 -1 0.93 T-cell activation protein PGR1 Hs.285902N75331 0.4791 2030 -1 0.67 - - Hs.50600N20908 0.5304 2030 -1 0.47 Baculoviral IAP repeat-containing 6 (apollon) BIRC6 Hs.250646R19011 0.5625 2031 -1 0.73 - - -H19443 0.7355 2033 1 0.2 MAP/microtubule affinity-regulating kinase 2 MARK2 Hs.157199N67741 0.7969 2033 1 0.27 DKFZP586D0919 protein DKFZP586D091Hs.49378H49954 0.6067 2034 1 0.4 Hypothetical protein FLJ23469 FLJ23469 Hs.103833T72663 0.4306 2036 1 0.73 - - -W74647 0.4891 2037 -1 0.53 Melanoma inhibitory activity MIA Hs.279651T86470 0.4306 2038 1 0.53 - - -H75843 0.7114 2039 -1 0.27 Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed (fox derived); ribosomal protein S30 FAU Hs.177415N21349 0.5304 2042 -1 0.67 Protein kinase, cAMP-dependent, catalytic, alpha PRKACA Hs.77271W47099 0.4029 2043 -1 0.93 CGI-63 protein LOC51102 Hs.19513H77938 0.5625 2043 1 0.67 Eukaryotic translation termination factor 1 ETF1 Hs.77324AA044244 0.6067 2043 1 0.33 - - Hs.275038T86360 0.9231 2043 -1 0.07 ESTs ESTs Hs.15266H15020 0.3265 2045 -1 1 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) GCN1L1 Hs.75354N94610 0.4691 2045 1 0.73 Hypothetical protein BC010734 LOC147632 Hs.48821H83830 0.4029 2046 1 0.87 KIAA1096 protein KIAA1096 Hs.69559H45525 0.4891 2046 -1 0.73 Ras homolog gene family, member G (rho G) ARHG Hs.75082N64545 0.5844 2046 -1 0.6 Flightless I homolog (Drosophila) FLII Hs.83849AA151400 0.9231 2046 -1 0.07 - - Hs.379188H06635 0.541 2047 1 0.6 Integrin, alpha 6 ITGA6 Hs.227730H93017 0.9615 2047 -1 0.03 Enoyl Coenzyme A hydratase 1, peroxisomal ECH1 Hs.196176R14297 0.3508 2048 1 1 RAS-like, estrogen-regulated, growth-inhibitor RERG Hs.21594H56735 0.3592 2048 1 0.93 Hypothetical protein FLJ13611 FLJ13611 Hs.282958R48450 0.5096 2048 1 0.53 KIAA1055 protein KIAA1055 Hs.126084H23019 0.7234 2048 1 0.33 - - Hs.28005R18865 0.7599 2048 1 0.2 - - -AA011604 0.3763 2049 -1 0.73 - - Hs.278312AA037862 0.4691 2049 -1 0.73 Nucleotide-sugar transporter similar to C. elegans sqv-7 SQV7L Hs.90078N23302 0.5844 2049 1 0.53 Lysyl oxidase LOX Hs.102267W40409 0.8344 2050 1 0.2 Lysyl-tRNA synthetase KARS Hs.3100N63983 0.8849 2052 -1 0.07 O-linked mannose beta1,2-N-acetylglucosaminyltransferase FLJ20277 Hs.183860R69935 0.6409 2055 1 0.47 - - -R34732 0.7477 2055 -1 0.2 Cadherin 8, type 2 CDH8 Hs.79133H03214 0.8093 2055 -1 0.27 Hypothetical protein FLJ14681 FLJ14681 Hs.23317R31300 0.44 2056 1 0.8 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1 CDS1 Hs.152981AA045331 0.4496 2056 -1 0.67 ADP-ribosylation factor 4-like ARF4L Hs.183153N48309 0.5517 2056 1 0.6 Hypothetical protein MGC8721 MGC8721 Hs.279921W03282 0.6876 2056 -1 0.47 Dihydrofolate reductase DHFR Hs.83765R02669 0.4593 2057 1 0.8 Adaptor-related protein complex 3, beta 1 subunit AP3B1 Hs.155172R20548 0.5199 2057 1 0.67 ESTs ESTs Hs.21119R73881 0.8976 2057 1 0.17 ATP-binding cassette, sub-family D (ALD), member 3 ABCD3 Hs.76781AA029275 0.412 2058 -1 0.8 HTPAP protein HTPAP Hs.169341T82048 0.5517 2058 -1 0.53 Endothelial differentiation-related factor 1 EDF1 Hs.174050AA053311 0.6294 2058 -1 0.47 KIAA0233 gene product KIAA0233 Hs.79077H15158 0.7845 2059 -1 0.4 HSPC166 protein HSPC166 Hs.279836N66546 0.5844 2060 -1 0.27 KIAA0355 gene product KIAA0355 Hs.186840N93342 0.8218 2060 -1 0.17 BCL-6 interacting corepressor BCoR Hs.130732W03758 0.4593 2061 -1 0.73 - - Hs.141278W80729 0.5304 2061 -1 0.63 - - -AA128128 0.7845 2061 -1 0.27 V-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 YES1 Hs.194148W91912 0.7477 2062 -1 0.4 G protein-coupled receptor kinase-interactor 2 GIT2 Hs.57734AA136669 0.4029 2063 1 0.9 - - Hs.374535N68511 0.3426 2064 -1 0.93 Hypothetical protein FLJ12085 FLJ12085 Hs.48827H50774 0.8849 2064 1 0.07 Similar to S. cerevisiae Sec6p and R. norvegicus rsec6 SEC6 Hs.8088AA044631 0.5096 2065 1 0.73 - - -R80770 0.5734 2065 1 0.67 Hypothetical protein C40 C40 Hs.30819AA055329 0.7599 2065 -1 0.27 - - Hs.351561T79588 0.4496 2067 1 0.67 CCR4-NOT transcription complex, subunit 3 CNOT3 Hs.343571R77671 0.9743 2067 0 0 - - Hs.20787W68344 0.5517 2068 -1 0.6 Chromosome 7 open reading frame 3 C7orf3 Hs.334540AA039228 0.9487 2068 1 0.13 Farnesyltransferase, CAAX box, beta FNTB Hs.276H15178 0.4306 2070 -1 0.73 - - Hs.352358AA135644 0.4791 2070 -1 0.8 - - Hs.323511H89883 0.5096 2070 -1 0.67 KIAA0102 gene product KIAA0102 Hs.77665AA127218 0.5625 2070 1 0.67 ESTs ESTs Hs.71058T74721 0.44 2071 -1 0.8 ZYG homolog ZYG Hs.29285T58031 0.541 2073 1 0.63 - - Hs.344478W70006 0.7722 2073 1 0.13 Cell division cycle 25B CDC25B Hs.153752AA057495 0.4496 2074 -1 0.8 EGF-containing fibulin-like extracellular matrix protein 1 EFEMP1 Hs.76224T81752 0.5625 2074 -1 0.57 Gemin 5 GEMIN5 Hs.25882H19093 0.5517 2076 1 0.53 - - Hs.330310N63996 0.618 2077 1 0.27 ESTs ESTs Hs.289083N70759 0.4029 2078 -1 0.73 Zinc-finger protein DZIP1 DZIP1 Hs.60177R88085 0.541 2078 1 0.53 Quiescin Q6 QSCN6 Hs.77266AA010246 0.5955 2078 1 0.57 Hypothetical protein FLJ10890 FLJ10890 Hs.17283R75983 0.7845 2078 1 0.47 Serologically defined colon cancer antigen 28 SDCCAG28 Hs.84700AA031933 0.8218 2078 1 0.2 Estrogen-related receptor alpha ESRRA Hs.110849N59459 0.9103 2079 1 0.13 Muscleblind-like protein MBLL39 MBLL39 Hs.283609N/A1 0.4891 2080 -1 0.73 - - -AA040084 0.9743 2080 0 0 - - Hs.25144T86348 0.44 2081 1 0.93 Glycine amidinotransferase (L-arginine:glycine amidinotransferase) GATM Hs.75335AA210722 0.6294 2081 1 0.47 - - Hs.117920W39690 0.5625 2082 1 0.67 Dickkopf homolog 1 (Xenopus laevis) DKK1 Hs.40499N75518 0.5955 2082 1 0.4 Translocated promoter region (to activated MET oncogene) TPR Hs.169750N28966 0.618 2082 -1 0.6 Lysosomal-associated membrane protein 2 LAMP2 Hs.8262AA059245 0.5955 2084 1 0.67 ESTs ESTs Hs.32713R42028 0.5096 2085 -1 0.67 Nardilysin (N-arginine dibasic convertase) NRD1 Hs.4099N35011 0.5096 2085 -1 0.67 - - Hs.20797AA057305 0.412 2086 -1 0.87 - - -H02545 0.5517 2086 1 0.6 ESTs ESTs Hs.191170R75598 0.6641 2086 -1 0.27 Neuroblastoma, suppression of tumorigenicity 1 NBL1 Hs.76307R77518 0.44 2088 1 0.73 DKFZP434D1335 protein DKFZP434D133Hs.8258R52816 0.5625 2088 1 0.53 Reticulon 3 RTN3 Hs.252831N51733 0.618 2088 1 0.33 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1 CTDP1 Hs.4076W43007 0.7845 2089 1 0.13 Pregnancy specific beta-1-glycoprotein 5 PSG5 Hs.251850

H58438 0.7114 2090 -1 0.33 High-mobility group 20B HMG20B Hs.32317H26021 0.4791 2091 1 0.8 - - Hs.136235AA099404 0.5625 2091 -1 0.47 Hypothetical protein MGC22793 MGC22793 Hs.293937H15851 0.4593 2092 1 0.8 Hypothetical protein FLJ31821 FLJ31821 Hs.351575R60545 0.5844 2092 1 0.47 Similar to RIKEN cDNA 2610036L13 MGC16386 Hs.23044R28095 0.8596 2092 1 0.27 Solute carrier family 12 (potassium/chloride transporters), member 4 SLC12A4 Hs.10094H56543 0.6067 2093 1 0.47 MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein MCM3AP Hs.168481AA004506 0.6409 2093 1 0.4 LanC lantibiotic synthetase component C-like 2 (bacterial) LANCL2 Hs.134342N74655 0.6524 2094 1 0.13 ESTs ESTs Hs.35064R62751 0.412 2095 -1 0.8 Sjogren syndrome antigen A1 (52kDa, ribonucleoprotein autoantigen SS-A/Ro) SSA1 Hs.1042N24115 0.6294 2095 -1 0.4 - - Hs.323780R51840 0.6409 2095 1 0.6 - - -W32182 0.4496 2096 1 0.67 Hypothetical protein MGC2574 MGC2574 Hs.4253N55329 0.4691 2097 -1 0.73 Anaphase-promoting complex subunit 7 APC7 Hs.52763R25036 0.618 2097 1 0.6 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 NDST1 Hs.20894N53948 0.7477 2097 -1 0.27 - - Hs.176686AA058864 0.4496 2099 -1 0.73 Adenylosuccinate synthase ADSS Hs.90011AA069424 0.6995 2099 -1 0.33 ESTs ESTs Hs.20573AA115737 0.8218 2099 1 0.27 Solute carrier family 2 (facilitated glucose transporter), member 10 SLC2A10 Hs.305971N41921 0.4212 2100 -1 0.8 - - Hs.33264N34202 0.4306 2100 1 0.67 - - Hs.275732AA098907 0.5734 2100 1 0.6 Aminolevulinate, delta-, synthase 1 ALAS1 Hs.78712AA046915 0.6294 2100 -1 0.4 Eukaryotic translation initiation factor 3, subunit 5 epsilon, 47kDa EIF3S5 Hs.7811N22974 0.5625 2101 -1 0.27 Brain expressed, X-linked 1 BEX1 Hs.334370N32327 0.6524 2101 1 0.4 Cleavage and polyadenylation specific factor 5, 25 kDa CPSF5 Hs.9605R67271 0.7355 2101 1 0.3 Hypothetical protein FLJ13089 FLJ13089 Hs.285711W69443 0.44 2102 1 0.73 High-mobility group nucleosome binding domain 1 HMGN1 Hs.251064AA053850 0.7969 2102 -1 0.13 Nucleosome assembly protein 1-like 1 NAP1L1 Hs.302649N71548 0.5199 2104 -1 0.67 CDC42 binding protein kinase beta (DMPK-like) CDC42BPB Hs.12908R20384 0.5304 2105 1 0.6 Leucine carboxyl methyltransferase LCMT Hs.8054R96766 0.5625 2105 1 0.33 Sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A SEMA6A Hs.263395AA031836 0.5844 2105 -1 0.6 ESTs ESTs Hs.131714R51914 0.5955 2107 -1 0.4 CGI-87 protein LOC51112 Hs.5008R60261 0.7234 2107 1 0.2 Slingshot 2 SSH2 Hs.25127W45561 0.8976 2107 -1 0.2 Centromere protein B, 80kDa CENPB Hs.85004W47533 0.5734 2109 -1 0.5 A disintegrin and metalloproteinase domain 9 (meltrin gamma) ADAM9 Hs.2442T75241 0.7355 2109 -1 0.27 Plasminogen activator, urokinase receptor PLAUR Hs.179657H08236 0.4496 2110 1 0.93 KIAA1096 protein KIAA1096 Hs.69559T79552 0.541 2110 1 0.4 ESTs ESTs Hs.14585AA045760 0.618 2110 -1 0.4 Thyroid hormone receptor interactor 10 TRIP10 Hs.73999R25275 0.5096 2112 1 0.6 ESTs ESTs Hs.356211AA115291 0.7599 2113 -1 0.4 Epidermal growth factor receptor pathway substrate 15 EPS15 Hs.79095T74240 0.4593 2114 1 0.6 Heat shock 70kDa protein 1B HSPA1B Hs.274402H93344 0.5625 2114 -1 0.63 - - Hs.41877AA099734 0.4791 2115 -1 0.87 Ribosomal protein L36a-like RPL36AL Hs.336628R92111 0.6409 2115 -1 0.33 - - -R06046 0.7599 2115 -1 0.33 KIAA1143 protein KIAA1143 Hs.173042AA046082 0.541 2118 -1 0.63 - - -H96054 0.618 2118 -1 0.47 Glia maturation factor, beta GMFB Hs.151413R05817 0.5199 2119 1 0.67 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa NDUFA7 Hs.19561H25699 0.5734 2119 1 0.73 Opa-interacting protein 2 OIP2 Hs.274170H78385 0.4593 2120 -1 0.53 Huntingtin interacting protein 2 HIP2 Hs.155485N69433 0.6294 2120 -1 0.33 KIAA0212 gene product KIAA0212 Hs.154332H95277 0.4593 2121 1 0.67 - - Hs.16773H38961 0.5517 2122 1 0.6 ADP-ribosylation factor 3 ARF3 Hs.119177N68959 0.7114 2122 1 0.4 Adenylate cyclase 6 ADCY6 Hs.12373H19488 0.618 2123 1 0.6 - - Hs.194081N90171 0.7114 2125 -1 0.4 C-myc binding protein MYCBP Hs.78221H30857 0.4993 2126 1 0.6 MutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) MLH1 Hs.57301N98550 0.6995 2127 -1 0.53 TRAM-like protein KIAA0057 Hs.153954H10461 0.385 2128 -1 0.67 Tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2 TNKS2 Hs.280776R80974 0.5734 2128 -1 0.47 WEE1+ homolog (S. pombe) WEE1 Hs.75188N90030 0.4496 2129 1 0.73 - - -W90295 0.6409 2129 -1 0.33 Erbb2 interacting protein ERBB2IP Hs.8117R88887 0.6758 2129 1 0.23 FLJ00005 protein FLJ00005 Hs.367690T89676 0.6995 2130 1 0.2 Plasminogen activator, urokinase PLAU Hs.77274AA036972 0.8596 2130 -1 0.33 Pre-mRNA splicing factor 17 PRP17 Hs.116674N35908 0.7845 2131 -1 0.27 - - Hs.171553R83875 0.5096 2132 -1 0.73 ATP-binding cassette, sub-family B (MDR/TAP), member 10 ABCB10 Hs.1710W90777 0.7599 2132 -1 0.27 Interferon regulatory factor 2 IRF2 Hs.83795R67624 0.6409 2133 1 0.33 Erythrocyte membrane protein band 4.1-like 1 EPB41L1 Hs.26395N44874 0.4691 2134 1 0.6 Ubiquitin-protein isopeptide ligase (E3) KIAA0010 Hs.155287H93850 0.9103 2134 1 0.2 Extracellular link domain containing 1 XLKD1 Hs.17917R22904 0.5517 2135 -1 0.67 8D6 antigen 8D6A Hs.106196R93572 0.5734 2135 -1 0.6 - - -AA127936 0.6524 2135 -1 0.53 Ubiquitin-conjugating enzyme E2 variant 1 UBE2V1 Hs.75875R14138 0.6524 2135 1 0.23 - - -H06281 0.4891 2136 -1 0.6 Hypothetical protein FLJ10737 FLJ10737 Hs.261134N30278 0.6758 2136 1 0.4 KIAA0872 protein KIAA0872 Hs.40109N72504 0.8976 2137 1 0.2 Ferrochelatase (protoporphyria) FECH Hs.26AA039927 0.5625 2138 -1 0.53 - - Hs.356843N70221 0.6409 2138 -1 0.33 KIAA0500 protein KIAA0500 Hs.301478T58682 0.7845 2138 -1 0.33 Chromosome 1 open reading frame 16 C1orf16 Hs.15087AA037249 0.4691 2140 -1 0.8 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 ATP5C1 Hs.155433H79311 0.5304 2140 -1 0.57 - - -AA034977 0.618 2140 1 0.47 - - -AA147566 0.8469 2140 -1 0.27 - - -N36351 0.8596 2140 1 0.2 Connective tissue growth factor CTGF Hs.75511T72619 0.9231 2140 -1 0.2 - - Hs.373588AA034480 0.5734 2141 1 0.53 Mannose-6-phosphate receptor (cation dependent) M6PR Hs.75709R87681 0.7114 2141 1 0.5 MUF1 protein MUF1 Hs.172210W47525 0.5096 2142 -1 0.67 - - Hs.110771AA054757 0.5517 2142 1 0.53 Zinc finger protein 226 ZNF226 Hs.145956H44964 0.618 2145 1 0.33 FK506 binding protein 14, 22 kDa FKBP14 Hs.264636H64559 0.7114 2145 1 0.27 - - -N27190 0.5625 2146 1 0.47 Ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) UCHL3 Hs.77917AA010007 0.4691 2147 -1 0.8 - - Hs.222505R07284 0.7234 2147 1 0.4 Hypothetical protein SP329 SP329 Hs.19928H37821 0.5304 2148 1 0.53 - - -AA037306 0.7114 2148 1 0.53 - - Hs.169872

AA005304 0.541 2149 1 0.53 BTB (POZ) domain containing 3 BTBD3 Hs.7935R77688 0.5517 2149 1 0.6 HSPC003 protein HSPC003 Hs.351629AA029014 0.9103 2149 -1 0.13 ESTs ESTs Hs.58373AA029857 0.6995 2150 -1 0.27 RAD1 homolog (S. pombe) RAD1 Hs.7179H01255 0.6409 2151 1 0.33 Ceroid-lipofuscinosis, neuronal 5 CLN5 Hs.30213H00517 0.5304 2153 -1 0.63 Chromosome 21 open reading frame 63 C21orf63 Hs.30156H99841 0.9487 2153 0 0 V-ski sarcoma viral oncogene homolog (avian) SKI Hs.2969N75060 0.4306 2154 1 0.87 Coatomer protein complex, subunit beta COPB Hs.3059R52388 0.8218 2155 1 0.13 KIAA1363 protein KIAA1363 Hs.22941AA053299 0.8469 2155 -1 0.33 CD59 antigen p18-20 (antigen identified by monoclonal antibodies 16.3A5, EJ16, EJ30, EL32 and G344) CD59 Hs.278573N20641 0.4496 2156 1 0.8 Chromosome 5 open reading frame 5 C5orf5 Hs.82035AA045404 0.541 2156 1 0.47 Squamous cell carcinoma antigen recognized by T cell SART2 Hs.58636T97916 0.7114 2156 -1 0.53 ESTs ESTs Hs.191184N52670 0.5517 2157 1 0.73 Likely ortholog of mouse exportin 4 XPO4 Hs.117102AA005131 0.4691 2158 -1 0.67 - - Hs.37372N93225 0.541 2158 1 0.73 Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein ID2 Hs.180919N80287 0.5844 2158 1 0.47 KIAA1357 protein KIAA1357 Hs.170162AA056762 0.4593 2159 -1 0.8 - - -R54733 0.8596 2159 1 0.07 - - Hs.299119H68528 0.6294 2160 -1 0.37 Hypothetical protein FLJ32499 FLJ32499 Hs.27475N64620 0.4212 2162 -1 0.87 Ribosomal protein S6 kinase, 90kDa, polypeptide 2 RPS6KA2 Hs.301664R72184 0.5199 2162 -1 0.47 Hypothetical protein FLJ10948 FLJ10948 Hs.9670AA213820 0.5955 2162 1 0.33 - - Hs.256533T79185 0.412 2163 1 0.8 - - -N25294 0.6294 2163 -1 0.4 Collagen, type XVI, alpha 1 COL16A1 Hs.26208AA148720 0.8596 2164 -1 0.07 PTPL1-associated RhoGAP 1 PARG1 Hs.70983AA053141 0.8722 2164 -1 0.13 CGI-31 protein LOC51075 Hs.279861W69683 0.4593 2165 1 0.53 Nuclear factor (erythroid-derived 2)-like 1 NFE2L1 Hs.83469H80175 0.5199 2165 1 0.8 Radixin RDX Hs.263671H27730 0.4791 2166 1 0.87 Protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform PPP2R1B Hs.108705AA026748 0.8849 2166 -1 0.13 Phosphoinositide-3-kinase, class 2, alpha polypeptide PIK3C2A Hs.249235AA101919 0.4891 2167 1 0.73 Phosphofructokinase, muscle PFKM Hs.75160W07427 0.541 2167 -1 0.43 - - Hs.380100H65158 0.5955 2167 -1 0.47 Tumor susceptibility gene 101 TSG101 Hs.118910H05457 0.618 2168 1 0.4 - - -W91999 0.9615 2168 -1 0.17 Mitogen-activated protein kinase-activated protein kinase 5 MAPKAPK5 Hs.30327W90594 0.4593 2169 -1 0.87 Hypothetical protein FLJ21174 FLJ21174 Hs.194329H27334 0.5844 2169 1 0.4 Discoidin domain receptor family, member 1 DDR1 Hs.75562AA033875 0.6067 2169 1 0.47 Similar to yeast Upf3, variant A UPF3A Hs.274412AA128275 0.6067 2170 -1 0.47 - - -N77814 0.6758 2170 1 0.33 C-src tyrosine kinase CSK Hs.77793R70894 0.7234 2170 -1 0.27 TGFB-induced factor (TALE family homeobox) TGIF Hs.90077AA150894 0.5517 2171 -1 0.47 Guanine nucleotide binding protein 11 GNG11 Hs.83381N92357 0.4791 2175 -1 0.8 - - Hs.311977H23410 0.5955 2175 -1 0.53 CGG triplet repeat binding protein 1 CGGBP1 Hs.86041AA039454 0.7722 2175 -1 0.33 Split hand/foot malformation (ectrodactyly) type 3 SHFM3 Hs.24307H00836 0.44 2176 1 0.87 A kinase (PRKA) anchor protein 2 AKAP2 Hs.42322N78859 0.5199 2176 1 0.53 Myosin, light polypeptide 4, alkali; atrial, embryonic MYL4 Hs.356717R36593 0.412 2177 -1 0.93 Hypothetical protein FLJ20445 FLJ20445 Hs.343748R76434 0.8849 2177 1 0.13 Hypothetical protein FLJ31153 FLJ31153 Hs.350424R80191 1 2178 0 0 Microtubule-associated protein, RP/EB family, member 3 MAPRE3 Hs.172740R60395 0.4593 2179 -1 0.7 - - Hs.378718R22218 0.5955 2179 1 0.53 Hypothetical protein FLJ10983 FLJ10983 Hs.23363H52225 0.541 2180 -1 0.73 TGF beta receptor associated protein -1 TRAP-1 Hs.101766R66397 0.7969 2181 1 0.27 KH domain containing, RNA binding, signal transduction associated 1 KHDRBS1 Hs.119537R24223 0.7969 2181 1 0.13 Hypothetical protein FLJ21069 FLJ21069 Hs.341806N92723 0.8344 2181 -1 0.37 ARF GTPase-activating protein MRIP2 Hs.356559H42140 0.5734 2182 -1 0.6 - - Hs.12311H12056 0.6067 2182 -1 0.47 - - Hs.95734H92944 0.9743 2182 1 0.07 - - -H12745 0.7477 2183 1 0.13 Zinc finger protein 148 (pHZ-52) ZNF148 Hs.355866H14478 0.5199 2184 1 0.6 Seven in absentia homolog 1 (Drosophila) SIAH1 Hs.295923R62727 0.6641 2185 1 0.4 Ankyrin repeat, family A (RFXANK-like), 2 ANKRA2 Hs.239154R47922 0.9872 2185 0 0 Hypothetical protein FLJ22341 FLJ22341 Hs.25485R77735 0.4593 2187 1 0.87 Ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease) CLN2 Hs.20478W03747 0.6409 2187 -1 0.4 TBC1 domain family, member 5 TBC1D5 Hs.115740AA101861 0.9231 2189 -1 0.27 Heat shock transcription factor 4 HSF4 Hs.75486R71002 0.6294 2190 1 0.47 ESTs ESTs Hs.10957AA047157 0.4993 2191 1 0.7 Kangai 1 (suppression of tumorigenicity 6, prostate; CD82 antigen (R2 leukocyte antigen, antigen detected by monocKAI1 Hs.323949W38744 0.5844 2191 1 0.63 Homeodomain interacting protein kinase 3 HIPK3 Hs.30148H17401 0.5304 2192 1 0.67 Hypothetical protein HSPC232 HSPC232 Hs.281428AA028907 0.5517 2192 1 0.73 - - Hs.34447W68810 0.6067 2192 1 0.47 - - Hs.381134H98809 0.7722 2192 -1 0.27 Poly(A) binding protein, cytoplasmic 1 PABPC1 Hs.172182R78873 0.4306 2193 -1 0.73 ESTs ESTs Hs.29822R79545 0.5304 2193 1 0.6 WD-repeat protein HAN11 Hs.288283N95162 0.6067 2193 1 0.6 Cytochrome c oxidase subunit Va COX5A Hs.323834T91710 0.6524 2193 -1 0.47 Intersectin 2 ITSN2 Hs.166184AA035361 0.8976 2193 -1 0.2 Signal transducer and activator of transcription 1, 91kDa STAT1 Hs.21486H95498 0.4691 2194 1 0.67 ESTs ESTs Hs.42041N64388 0.8596 2194 -1 0.07 Nuclear receptor subfamily 4, group A, member 1 NR4A1 Hs.1119AA047076 0.9487 2194 0 0 Cytochrome b5 reductase b5R.2 LOC51700 Hs.22142R31356 0.7845 2195 1 0.2 RE1-silencing transcription factor REST Hs.227630N44670 0.5304 2196 1 0.53 Growth arrest-specific 6 GAS6 Hs.78501AA150973 0.4791 2197 1 0.73 Hypothetical protein MGC10812 MGC10812 Hs.4188H18934 0.5517 2197 1 0.5 Ribosomal large subunit pseudouridine synthase C like RLUCL Hs.101742R20008 0.7477 2197 -1 0.13 N-acetylglucosaminidase, alpha- (Sanfilippo disease IIIB) NAGLU Hs.50727N36780 0.7722 2197 -1 0.13 Carbonyl reductase 1 CBR1 Hs.88778H08451 0.7845 2197 -1 0.2 CDC-like kinase 1 CLK1 Hs.2083R17999 0.4791 2198 1 0.73 Hypothetical protein FLJ20371 FLJ20371 Hs.267566AA149233 0.5625 2198 -1 0.53 Prostaglandin E synthase PTGES Hs.146688W24560 0.5304 2199 -1 0.67 Pleiomorphic adenoma gene-like 2 PLAGL2 Hs.154104N21274 0.5199 2200 1 0.73 Nucleoporin 153kDa NUP153 Hs.211608W74233 0.4791 2202 1 0.87 Related RAS viral (r-ras) oncogene homolog RRAS Hs.9651H49312 0.5517 2202 1 0.6 Cytoplasmic linker 2 CYLN2 Hs.104717R88696 0.618 2202 1 0.5 Sialyltransferase 7D ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltraSIAT7D Hs.3972N68686 0.4691 2203 -1 0.87 Hypothetical protein FLJ10486 FLJ10486 Hs.173946N39367 0.5734 2205 -1 0.47 Hypothetical protein FLJ20085 FLJ20085 Hs.118964R43963 0.6409 2205 -1 0.53 Hypothetical protein DKFZp761A052 DKFZp761A052 Hs.184029R06151 0.6641 2205 1 0.47 Anaphase promoting complex subunit 5 ANAPC5 Hs.7101

AA203444 0.541 2206 1 0.63 COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) COPS5 Hs.198767AA099075 0.7114 2206 -1 0.33 Single stranded DNA binding protein 3 SSBP3 Hs.266914H53989 0.8344 2206 1 0.27 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 SMARCD2 Hs.250581N79754 0.4212 2207 -1 0.87 ElaC homolog 1 (E. coli) ELAC1 Hs.47572R00277 0.618 2207 1 0.33 GS15 LOC51272 Hs.300631R06572 0.8596 2207 0 0 Hypothetical protein MGC2550 MGC2550 Hs.169575N75008 0.8976 2207 1 0.2 DKFZP564K247 protein DKFZP564K247 Hs.7917N66238 0.5199 2208 -1 0.73 Matrix metalloproteinase 19 MMP19 Hs.154057R17784 0.8218 2208 -1 0.23 ESTs ESTs Hs.21757H09054 0.4691 2209 -1 0.67 DNA (cytosine-5-)-methyltransferase 1 DNMT1 Hs.77462R53574 0.541 2209 -1 0.73 Microtubule associated testis specific serine/threonine protein kinase MAST205 Hs.101474H13517 0.9231 2209 1 0.07 ADP-ribosylation factor-like 5 ARL5 Hs.342849AA037843 0.4691 2210 -1 0.73 Transmembrane 4 superfamily member tetraspan NET-7 NET-7 Hs.95583N91931 0.6067 2210 -1 0.3 NME7 NME7 Hs.274479N46097 0.4791 2211 1 0.8 Biphenyl hydrolase-like (serine hydrolase; breast epithelial mucin-associated antigen) BPHL Hs.351334H99854 0.5517 2211 -1 0.53 Superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) SOD1 Hs.75428R54762 0.5844 2211 -1 0.53 - - Hs.58582W74506 0.5844 2211 -1 0.67 Casein kinase 1, alpha 1 CSNK1A1 Hs.283738H21130 0.5955 2211 -1 0.33 Ran GTPase activating protein 1 RANGAP1 Hs.183800T84193 0.6876 2211 -1 0.33 - - Hs.290241AA044588 0.5955 2212 -1 0.4 Hypothetical protein FLJ11171 FLJ11171 Hs.72782H54691 0.618 2212 1 0.5 Rho guanine nucleotide exchange factor (GEF) 12 ARHGEF12 Hs.6582N30177 0.618 2212 1 0.53 - - Hs.25892H29536 0.8722 2212 -1 0.07 BBP-like protein 1 BLP1 Hs.7471N91458 0.4691 2213 1 0.73 T-cell activation WD repeat protein TA-WDRP Hs.175596R91253 0.5955 2213 1 0.4 ESTs ESTs Hs.34395N91148 0.4993 2214 -1 0.73 Transcription factor binding to IGHM enhancer 3 TFE3 Hs.274184AA058474 0.5096 2214 -1 0.67 Hypothetical protein DKFZp586C1924 DKFZp586C192 Hs.108338R31387 0.5517 2214 -1 0.6 - - -W81709 0.6524 2214 -1 0.4 Ornithine aminotransferase (gyrate atrophy) OAT Hs.75485H04946 0.4593 2215 1 0.8 Cytochrome c oxidase subunit Va COX5A Hs.323834H45501 0.4593 2215 1 0.8 Hypothetical protein MGC10558 MGC10558 Hs.119498R13073 0.5096 2216 1 0.6 Dual specificity phosphatase 7 DUSP7 Hs.296938N92996 0.6409 2217 1 0.37 Retinoblastoma binding protein 7 RBBP7 Hs.31314W60673 0.4691 2218 -1 0.77 Hypothetical protein FLJ21868 FLJ21868 Hs.46829N62934 0.7234 2218 1 0.33 ESTs ESTs Hs.348421AA045736 0.7599 2218 -1 0.37 KIAA1966 protein KIAA1966 Hs.158184AA135745 0.5734 2219 1 0.6 Calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma CAMK2G Hs.12436R10564 0.9359 2219 0 0 Sentrin/SUMO-specific protease 3 SENP3 Hs.118926H61812 0.5096 2220 -1 0.6 Cyclin-dependent kinase 4 CDK4 Hs.95577H03709 0.9487 2220 1 0.07 Hypothetical protein RP4-622L5 RP4-622L5 Hs.272299T90647 0.6876 2222 1 0.53 - - Hs.193649N47660 0.7845 2222 -1 0.47 Cyclin-dependent kinase inhibitor 1B (p27, Kip1) CDKN1B Hs.238990N73980 0.4306 2223 -1 0.8 Keratin 8 KRT8 Hs.242463N20321 0.9487 2223 1 0.13 Translocase of outer mitochondrial membrane 40 homolog (yeast) TOMM40 Hs.30928W57882 0.4593 2225 1 0.67 Pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4 PLEKHA4 Hs.9469H69334 0.4791 2225 -1 0.87 Pirin PIR Hs.279663AA059148 0.618 2225 1 0.53 KIAA1199 protein KIAA1199 Hs.50081R70930 0.6524 2225 1 0.53 Sialyltransferase 4C (beta-galactosidase alpha-2,3-sialytransferase) SIAT4C Hs.75268AA098888 0.4993 2226 -1 0.53 Eukaryotic translation termination factor 1 ETF1 Hs.77324AA042817 0.5199 2226 1 0.73 Calmodulin 2 (phosphorylase kinase, delta) CALM2 Hs.182278AA063138 0.5199 2226 -1 0.67 - - Hs.356659AA035378 0.541 2227 1 0.7 - - Hs.11700H46019 0.5199 2228 1 0.67 Hypothetical protein FLJ10201 FLJ10201 Hs.318127N33745 0.4691 2229 -1 0.73 KIAA0841 protein KIAA0841 Hs.7426H88063 0.6758 2229 -1 0.2 Chromosome 1 open reading frame 9 C1orf9 Hs.108636AA213556 0.9103 2229 -1 0.07 - - -T84264 0.6641 2231 1 0.43 RAP2B, member of RAS oncogene family RAP2B Hs.239527N89687 0.9743 2231 1 0.07 - - Hs.351597AA128013 0.7234 2233 -1 0.2 - - Hs.261335N21532 0.7845 2233 -1 0.2 - EST Hs.331630W07170 0.3939 2234 -1 1 Hepatitis B virus x interacting protein HBXIP Hs.80464N90203 0.6524 2234 -1 0.23 Hypothetical protein FLJ22347 FLJ22347 Hs.106004N59340 0.9872 2234 1 0.07 Progesterone-induced blocking factor 1 PIBF1 Hs.43913N31469 0.9231 2235 -1 0.13 NCK-associated protein 1 NCKAP1 Hs.278411R79393 0.412 2237 1 0.67 Hypothetical protein FLJ25785 FLJ25785 Hs.9070AA004838 0.5955 2238 -1 0.53 SOCS box-containing WD protein SWiP-1 WSB1 Hs.187991N73101 0.6409 2238 1 0.27 Solute carrier family 26 (sulfate transporter), member 2 SLC26A2 Hs.29981H99625 0.7355 2240 1 0.33 Histone acetyltransferase HBOA Hs.21907N30253 0.5844 2241 -1 0.53 - - -R13347 0.9615 2242 0 0 Kelch motif containing protein AB026190 Hs.106290N51791 0.5734 2244 -1 0.73 Hypothetical protein FLJ20296 FLJ20296 Hs.6603R40412 0.5199 2245 -1 0.63 Catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein) CTNND2 Hs.80220H19826 0.8344 2246 -1 0.33 Hippocalcin-like 1 HPCAL1 Hs.3618W39327 0.6995 2247 -1 0.2 LIM domain binding 1 LDB1 Hs.26002W47105 0.4496 2248 -1 0.6 ELL-related RNA polymerase II, elongation factor ELL2 Hs.98124W94116 0.4593 2248 -1 0.8 - - Hs.293656H51004 0.5625 2249 -1 0.53 - - -W45719 0.7477 2250 -1 0.47 PAP-1 binding protein PAPA-1 Hs.7709N52238 0.6067 2251 -1 0.53 Hypothetical protein FLJ20531 FLJ20531 Hs.23617R54933 0.7355 2251 -1 0.33 Peptidase D PEPD Hs.73947W84581 0.44 2252 -1 1 Hypothetical protein STRAIT11499 STRAIT11499 Hs.236556R98077 0.5734 2252 1 0.67 Anti-oxidant protein 2 (non-selenium glutathione peroxidase, acidic calcium-independent phospholipase A2) AOP2 Hs.120W01524 0.8093 2252 -1 0.33 Splicing factor, arginine/serine-rich 11 SFRS11 Hs.11482N32669 0.4593 2253 -1 0.8 RPA-binding trans-activator RBT1 Hs.169138W39129 0.6524 2253 1 0.27 Nucleobindin 1 NUCB1 Hs.172609H95787 0.7234 2254 -1 0.33 - - Hs.108745H61972 0.8093 2254 1 0.17 Protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) PIN4 Hs.11774H53723 0.9103 2254 -1 0.2 Putative nucleotide binding protein, estradiol-induced E2IG3 Hs.279923N93365 0.9872 2254 -1 0.13 Chromosome 21 open reading frame 2 C21orf2 Hs.153452N36397 0.4306 2255 -1 0.93 CLIP-170-related protein CLIPR-59 Hs.7357R07631 0.5955 2255 -1 0.63 ESTs ESTs Hs.268640W60489 0.5517 2256 1 0.67 ESTs ESTs Hs.12253AA127934 0.5734 2257 -1 0.6 Protein kinase, X-linked PRKX Hs.147996H52698 0.8849 2257 1 0.33 Diptheria toxin resistance protein required for diphthamide biosynthesis-like 2 (S. cerevisiae) DPH2L2 Hs.324830AA047407 0.6641 2258 -1 0.33 KIAA1600 protein KIAA1600 Hs.192619AA029709 0.541 2260 -1 0.6 Syntaxin 18 STX18 Hs.13406H38180 0.6067 2260 1 0.53 DKFZP434C212 protein DKFZP434C212Hs.172069N98261 0.6409 2260 1 0.4 Guanine nucleotide binding protein (G protein), beta polypeptide 2 GNB2 Hs.91299W89153 0.7355 2260 -1 0.2 GABA(A) receptor-associated protein-like 2 GABARAPL2 Hs.6518

R72865 0.7355 2260 -1 0.4 KIAA1285 protein KIAA1285 Hs.119175N39229 0.3677 2261 1 1 Hypothetical protein A-211C6.1 LOC57149 Hs.28607N20501 0.6409 2261 1 0.53 Bioref bioref Hs.5638R56276 0.4891 2262 1 0.87 - - -R20026 0.5734 2262 -1 0.53 ESTs ESTs Hs.326475W87936 0.618 2262 -1 0.43 ESTs ESTs Hs.14372AA029959 0.9743 2262 1 0.07 Regulator of G-protein signalling 16 RGS16 Hs.183601R20063 0.541 2263 1 0.6 Translocated promoter region (to activated MET oncogene) TPR Hs.169750N53292 0.6409 2264 -1 0.6 - - Hs.374344AA040886 0.8469 2264 1 0.07 ESTs ESTs Hs.11325N91448 0.9743 2264 0 0 Protease, serine, 23 SPUVE Hs.25338R77522 0.6409 2265 1 0.47 - - Hs.29643AA007586 0.4593 2266 1 0.67 - - Hs.103441N93367 0.5096 2266 1 0.67 Phosphorylase kinase, alpha 2 (liver) PHKA2 Hs.54941N76910 0.5199 2266 -1 0.47 Ribosomal protein L23a pseudogene 7 RPL23AP7 Hs.247828R48041 0.5625 2266 1 0.73 Glucosidase, alpha; acid (Pompe disease, glycogen storage disease type II) GAA Hs.1437R86973 0.6294 2266 1 0.27 Hypothetical protein DKFZp434P0531 DKFZp434P053 Hs.284181AA203694 0.6409 2266 1 0.4 Glucosidase, beta (bile acid) 2 GBA2 Hs.173422R69813 0.7114 2266 1 0.27 Hypothetical protein MGC4707 MGC4707 Hs.291003AA151197 0.4306 2267 1 0.8 Integrin, alpha 5 (fibronectin receptor, alpha polypeptide) ITGA5 Hs.149609AA150729 0.4791 2267 -1 0.8 Nuclear receptor co-repressor 2 NCOR2 Hs.287994T84624 0.5096 2267 1 0.63 Ets variant gene 6 (TEL oncogene) ETV6 Hs.169081W52903 0.6876 2268 -1 0.33 Hypothetical protein HSPC177 HSPC177 Hs.36237R24623 0.7234 2268 1 0.33 ATPase, H+ transporting, lysosomal interacting protein 2 ATP6IP2 Hs.183434R62318 0.7355 2268 1 0.27 - - Hs.283402W24852 0.8469 2268 -1 0.17 COX11 homolog, cytochrome c oxidase assembly protein (yeast) COX11 Hs.241515R89716 0.5199 2269 1 0.73 - - -T78085 0.5517 2270 1 0.67 - - Hs.133407R23251 0.5955 2270 1 0.53 Not56 (D. melanogaster)-like protein NOT56L Hs.153591W03009 0.5844 2271 -1 0.53 KIAA0472 protein KIAA0472 Hs.6874T78208 0.5625 2272 1 0.67 IQ motif containing GTPase activating protein 1 IQGAP1 Hs.1742N32281 0.6409 2272 1 0.47 DKFZP586G011 protein LAP1B Hs.234265T76974 0.9487 2272 1 0.1 Protein x 0004 LOC51184 Hs.284164H99886 0.541 2273 1 0.53 Nuclear receptor subfamily 4, group A, member 3 NR4A3 Hs.80561T89038 0.5734 2273 1 0.53 Insulin-like growth factor binding protein 7 IGFBP7 Hs.119206H86785 0.6758 2273 1 0.47 KIAA0874 protein KIAA0874 Hs.27973AA134754 0.9743 2273 -1 0.13 BCL2-associated athanogene 3 BAG3 Hs.15259H68373 0.5096 2274 1 0.6 Transcription factor CP2 TFCP2 Hs.154970H18495 0.5844 2274 1 0.6 ESTs ESTs Hs.8053N67802 0.618 2275 -1 0.7 KIAA0871 protein KIAA0871 Hs.7972AA045373 0.6409 2275 1 0.6 Transcription elongation factor A (SII)-like 1 TCEAL1 Hs.95243T87890 0.8093 2275 1 0.47 Hypothetical protein FLJ20772 FLJ20772 Hs.9925H96032 0.8344 2275 1 0.27 Hypothetical protein MGC11102 MGC11102 Hs.42129R36523 0.8344 2275 1 0.07 Neuropilin 2 NRP2 Hs.17778AA046451 0.9487 2275 1 0.07 - - Hs.165200T82117 0.4993 2276 1 0.67 ESTs ESTs Hs.191196N79725 0.6876 2276 1 0.5 Mitochondrial translational initiation factor 2 MTIF2 Hs.149894AA047100 0.8093 2276 -1 0.13 Hypothetical protein FLJ22584 FLJ22584 Hs.343551N63007 0.6067 2277 -1 0.53 Dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit DPM1 Hs.5085AA043545 0.7599 2277 -1 0.33 Procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2 PLOD2 Hs.41270AA099688 0.5199 2278 1 0.67 Melanoma differentiation associated protein-5 MDA5 Hs.293591H78279 0.8469 2279 1 0.2 - - Hs.295789N40437 0.6641 2280 -1 0.33 S-adenosylhomocysteine hydrolase-like 1 AHCYL1 Hs.4113AA031852 0.9231 2280 1 0.2 Synaptophysin-like protein SYPL Hs.80919AA031356 0.5304 2281 -1 0.73 Hypothetical protein MGC14288 MGC14288 Hs.181073N54932 0.5304 2281 -1 0.6 Hypothetical protein FLJ22875 FLJ22875 Hs.111222R45681 0.9743 2281 1 0.07 TRAF and TNF receptor-associated protein AD022 Hs.46847R65826 0.6294 2282 -1 0.4 Amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3 ALS2CR3 Hs.154248N80318 0.7234 2283 -1 0.33 - - Hs.42834N91368 0.6409 2284 1 0.6 ALL1-fused gene from chromosome 1q AF1Q Hs.75823AA009587 0.7722 2285 -1 0.33 Hypothetical protein MGC13183 MGC13183 Hs.59791H00903 0.6758 2286 1 0.47 SWAP-70 protein SWAP70 Hs.153026AA151625 0.4691 2287 1 0.6 IQ motif containing GTPase activating protein 1 IQGAP1 Hs.1742N58742 0.5304 2287 1 0.8 - - -R98094 0.4496 2289 1 0.73 2,3-bisphosphoglycerate mutase BPGM Hs.198365N/A2 0.618 2289 1 0.6 - - -H29572 0.8093 2289 -1 0.23 Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa PAFAH1B1 Hs.77318H90520 0.8218 2289 -1 0.13 Hypothetical protein MGC4643 MGC4643 Hs.226434W45590 0.5517 2290 1 0.6 Old astrocyte specifically induced substance OASIS Hs.13456N48159 0.4496 2291 1 0.73 CGI-148 protein LOC51030 Hs.6776N89705 0.618 2291 -1 0.53 Superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) SOD1 Hs.75428R11158 0.7234 2291 1 0.47 Nuclear localization signal deleted in velocardiofacial syndrome NLVCF Hs.19500R73076 0.8093 2291 1 0.27 - - Hs.356356R88993 0.4993 2292 -1 0.87 Vesicle trafficking protein SEC22C Hs.12942H68976 0.5096 2292 1 0.93 - - Hs.375009T97612 0.7477 2292 1 0.37 ESTs ESTs Hs.272066R63880 0.5304 2293 1 0.73 ESTs ESTs Hs.176220N34764 0.5844 2293 -1 0.37 - - Hs.245537R79187 0.7599 2293 -1 0.27 KIAA0101 gene product KIAA0101 Hs.81892AA039905 0.4891 2294 1 0.73 Myosin, heavy polypeptide 9, non-muscle MYH9 Hs.146550H51325 0.5096 2294 1 0.8 Kinesin family member 13B KIF13B Hs.15711H18581 0.5304 2294 1 0.73 CD164 antigen, sialomucin CD164 Hs.43910H39034 0.6641 2294 -1 0.33 Hypothetical protein PRO1489 PRO1489 Hs.197922W33160 0.5304 2295 1 0.57 Gene predicted from cDNA with a complete coding sequence KIAA0110 Hs.124R11714 0.7114 2295 -1 0.4 ESTs ESTs Hs.295334N95771 0.5304 2296 1 0.6 - - Hs.42173AA136883 0.5844 2297 -1 0.47 Poly(rC) binding protein 1 PCBP1 Hs.2853AA099373 0.6758 2297 1 0.27 Glycogen synthase 1 (muscle) GYS1 Hs.772W03485 0.5304 2298 1 0.8 MAD, mothers against decapentaplegic homolog 5 (Drosophila) MADH5 Hs.37501AA150253 0.5625 2298 -1 0.73 Similar to ecotropic viral integration site 5; Neuroblastoma stage 4S gene LOC115704 Hs.26870R55573 0.6409 2298 1 0.47 - - Hs.249365AA001116 0.6876 2298 1 0.4 Peroxisomal farnesylated protein PXF Hs.168670AA136693 0.5517 2299 1 0.57 Homolog of C. elegans smu-1 SMU-1 Hs.193128R34762 0.4593 2301 1 0.87 - - Hs.380911N81095 0.6067 2301 -1 0.6 High-mobility group box 3 HMGB3 Hs.19114H24175 0.6641 2301 1 0.47 Adaptor-related protein complex 1, mu 1 subunit AP1M1 Hs.3832W42620 0.5199 2302 1 0.67 RAB5B, member RAS oncogene family RAB5B Hs.77690H46579 0.5955 2302 -1 0.63 - - Hs.141269AA150275 0.7114 2302 1 0.27 - - Hs.355877N25135 0.8469 2302 -1 0.27 Suppression of tumorigenicity 7 like ST7L Hs.293483

N30715 0.541 2303 -1 0.87 ATP binding protein associated with cell differentiation APACD Hs.153884R16169 0.5625 2303 1 0.6 Stromal cell-derived factor 2 SDF2 Hs.118684H40074 0.5625 2303 1 0.53 ESTs ESTs Hs.21475W52156 0.6409 2303 -1 0.4 Oxytocin receptor OXTR Hs.2820AA134744 0.5625 2304 -1 0.53 TERF1 (TRF1)-interacting nuclear factor 2 TINF2 Hs.7797N32733 0.618 2304 1 0.47 - - -R34021 0.5734 2305 -1 0.53 High-mobility group nucleosome binding domain 1 HMGN1 Hs.251064H66591 0.5517 2306 -1 0.53 - - Hs.376349W56877 0.8976 2307 1 0.17 Up-regulated in liver cancer 1 UPLC1 Hs.44579AA058393 0.6641 2308 -1 0.4 - - Hs.40369R23664 0.9359 2308 0 0 Colon carcinoma related protein LOC51159 Hs.30343N44634 0.5517 2309 -1 0.7 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 ATP5C1 Hs.155433H92449 0.5844 2309 1 0.47 TRIAD3 protein TRIAD3 Hs.86228AA147653 0.7234 2309 1 0.5 Plastin 3 (T isoform) PLS3 Hs.4114N24445 0.8722 2309 -1 0.07 Synovial sarcoma, X breakpoint 4 SSX4 Hs.278632N52336 0.5844 2310 -1 0.67 Aryl-hydrocarbon receptor nuclear translocator 2 ARNT2 Hs.6111R62983 0.6524 2310 1 0.47 - - Hs.82276H23264 0.5734 2311 1 0.53 - - Hs.13781T87888 0.7599 2311 -1 0.4 KIAA1046 protein KIAA1046 Hs.89519H82166 0.4993 2312 -1 0.73 Sorting nexin 17 SNX17 Hs.278569N/A2 0.7114 2312 1 0.4 - - -W04635 0.618 2313 1 0.47 Sorbin and SH3 domain containing 1 SORBS1 Hs.108924N71996 0.9872 2313 1 0.07 Macrophage myristoylated alanine-rich C kinase substrate MACMARCKS Hs.75061N59622 0.5199 2315 1 0.53 Integral membrane protein 2A ITM2A Hs.17109W58007 0.6067 2315 1 0.53 KIAA0222 gene product KIAA0222 Hs.48450N39932 0.6758 2315 -1 0.4 Small protein effector 1 of Cdc42 SPEC1 Hs.22065W90343 0.5625 2316 -1 0.73 - - Hs.231637AA001104 0.6758 2318 1 0.33 Regulator of G-protein signalling 3 RGS3 Hs.82294H14471 0.44 2319 1 0.87 MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae) MCM6 Hs.155462AA043886 0.5199 2319 -1 0.77 Dystrobrevin binding protein 1 DTNBP1 Hs.43481W86390 0.6758 2319 1 0.4 Hermansky-Pudlak syndrome 4 HPS4 Hs.6657R53519 0.8093 2319 -1 0.17 Golgi associated, gamma adaptin ear containing, ARF binding protein 2 GGA2 Hs.155546H89832 0.4891 2321 -1 0.8 Centromere protein F, 350/400ka (mitosin) CENPF Hs.77204W31628 0.9103 2321 -1 0.17 - - Hs.118258AA032211 0.6067 2322 -1 0.53 ESTs ESTs Hs.118493W35335 0.6524 2322 -1 0.4 - - -R18833 0.6641 2323 1 0.2 - - Hs.268709W38465 0.5199 2324 -1 0.6 Developmentally regulated GTP binding protein 2 DRG2 Hs.78582N79530 0.6067 2324 -1 0.47 Clathrin, heavy polypeptide (Hc) CLTC Hs.178710R65635 0.6294 2324 -1 0.53 - - Hs.130352H10452 0.6995 2327 1 0.47 Insulin-like growth factor 1 receptor IGF1R Hs.239176AA044139 0.7114 2328 1 0.37 Hypothetical protein MGC4645 MGC4645 Hs.332381H99520 0.5517 2329 -1 0.37 Sialyltransferase 4C (beta-galactosidase alpha-2,3-sialytransferase) SIAT4C Hs.75268R76085 0.6758 2329 -1 0.27 Cytokine-inducible kinase CNK Hs.153640AA056734 0.8849 2329 1 0.1 KIAA1110 protein KIAA1110 Hs.22479W79682 0.7599 2330 1 0.13 ORF LOC51035 Hs.351296T99087 0.5844 2331 1 0.7 5-methyltetrahydrofolate-homocysteine methyltransferase MTR Hs.82283R24969 0.8218 2331 -1 0.3 Gamma-aminobutyric acid (GABA) A receptor, beta 1 GABRB1 Hs.89768N35505 0.6524 2332 -1 0.33 Ras homolog gene family, member E ARHE Hs.6838N38762 0.6294 2333 -1 0.47 Lymphoid enhancer-binding factor 1 LEF1 Hs.44865N81046 0.6641 2333 -1 0.47 - - -T70285 0.9359 2333 1 0.07 - - Hs.271940R37087 0.9359 2333 0 0 Similar to S. cerevisiae Sec6p and R. norvegicus rsec6 SEC6 Hs.8088H45110 0.9487 2333 0 0 Immediate early response 5 IER5 Hs.15725H43652 0.5517 2335 1 0.67 Conserved gene telomeric to alpha globin cluster CGTHBA Hs.19699H77990 0.5955 2335 1 0.6 - - Hs.28113R66182 0.7234 2336 1 0.5 Reticulocalbin 2, EF-hand calcium binding domain RCN2 Hs.79088W35163 0.8344 2336 1 0.27 Neuron navigator 2 NAV2 Hs.23467N62942 0.5304 2337 -1 0.8 Putative membrane protein LOC54499 Hs.93832H79853 0.5517 2338 -1 0.67 - - Hs.14355R79614 0.7845 2338 -1 0.27 KIAA0256 gene product KIAA0256 Hs.118978N39088 0.9103 2338 -1 0.1 - - Hs.356387R21462 0.4891 2339 -1 0.87 Rho-GTPase activating protein 10 ARHGAP10 Hs.11611R16987 0.6067 2339 1 0.47 Secretory protein SEC8 SEC8 Hs.107394H11043 0.9487 2339 1 0.07 Kinesin family member 3B KIF3B Hs.301206H42133 0.5199 2340 -1 0.87 Retinal short-chain dehydrogenase/reductase retSDR2 LOC51170 Hs.12150N93294 0.5844 2340 1 0.67 KIAA0076 gene product KIAA0076 Hs.51039R14788 0.6067 2341 1 0.57 - - Hs.293815R68288 0.5955 2342 -1 0.53 - - -R40457 0.5955 2342 1 0.53 - - -AA045796 0.8218 2342 1 0.27 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 SMARCB1 Hs.159971T97294 0.5517 2343 -1 0.6 BCL2-associated athanogene BAG1 Hs.41714H98830 0.541 2344 -1 0.73 Glucosamine-6-phosphate isomerase GNPI Hs.278500N24941 0.5096 2346 -1 0.67 - - Hs.20274R34387 0.7114 2346 1 0.47 Fatty acid amide hydrolase FAAH Hs.288828AA020869 0.6294 2348 1 0.47 Heterogeneous nuclear ribonucleoprotein C (C1/C2) HNRPC Hs.182447N39092 0.9615 2348 1 0.27 ESTs ESTs Hs.44940AA058463 0.5734 2349 1 0.6 - - -T97966 0.5304 2351 1 0.8 - - -AA002041 0.7355 2351 -1 0.4 Zinc finger protein 262 ZNF262 Hs.150390AA047136 0.9743 2351 0 0 - - Hs.355559H48733 0.5955 2352 -1 0.53 Interleukin enhancer binding factor 3, 90kDa ILF3 Hs.256583AA134825 0.6524 2352 -1 0.33 Solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 SLC7A6 Hs.10315N67453 0.7114 2352 -1 0.33 Cyclin-dependent kinase inhibitor 1A (p21, Cip1) CDKN1A Hs.179665H49219 0.7845 2352 1 0.17 Muscleblind-like (Drosophila) MBNL Hs.28578H02626 0.5096 2353 1 0.63 Annexin A6 ANXA6 Hs.118796R72158 0.541 2353 1 0.53 - - -N63947 0.5844 2353 1 0.6 Hypothetical protein FLJ21940 FLJ21940 Hs.104916N99984 1 2354 -1 0.03 Hypothetical protein FLJ36666 FLJ36666 Hs.7604H90408 0.5517 2355 -1 0.73 Hypothetical protein FLJ13910 FLJ13910 Hs.75277R52317 0.5844 2355 -1 0.6 Ras-like without CAAX 2 RIT2 Hs.47626H04791 0.7477 2355 -1 0.33 ESTs ESTs Hs.26490R20749 0.618 2356 1 0.53 - - -AA210782 0.8093 2356 -1 0.03 Signal transducer and activator of transcription 6, interleukin-4 induced STAT6 Hs.181015AA136694 0.5096 2358 1 0.73 KIAA0229 protein KIAA0229 Hs.20060AA045847 0.5096 2358 1 0.73 - - Hs.188361N59378 0.8469 2358 1 0.1 ESTs ESTs Hs.48372R09962 0.9231 2358 1 0.2 Hypothetical protein MGC2463 MGC2463 Hs.323634AA053851 0.6876 2359 -1 0.2 ESTs ESTs Hs.63063H67809 0.7477 2360 -1 0.33 U3 snoRNP-associated 55-kDa protein U3-55K Hs.153768

R68652 0.7477 2360 1 0.2 Adducin 1 (alpha) ADD1 Hs.183706R77960 0.7845 2360 -1 0.2 Ubiquitin specific protease 4 (proto-oncogene) USP4 Hs.77500N40830 0.9231 2360 1 0.13 Hypothetical protein FLJ25436 FLJ25436 Hs.29706AA031347 0.541 2361 -1 0.67 - - Hs.355548N30548 0.5734 2361 -1 0.67 Solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4 SLC25A4 Hs.2043H10350 0.618 2361 -1 0.53 Replication factor C (activator 1) 5, 36.5kDa RFC5 Hs.171075R80664 0.6758 2362 -1 0.47 Phosphoinositide-binding protein SR1 FENS-1 Hs.44743AA150246 0.6758 2362 1 0.4 Protein kinase Njmu-R1 NJMU-R1 Hs.9800R20140 0.8469 2362 1 0.07 Mitofusin 1 MFN1 Hs.197877R47773 0.541 2363 1 0.67 Gene with multiple splice variants near HD locus on 4p16.3 RES4-22 Hs.325987W23579 0.5955 2364 -1 0.43 ATP-dependent RNA helicase MGC2835 Hs.70582W92120 0.618 2364 1 0.67 Splicing factor, arginine/serine-rich, 46kD SRP46 Hs.155160N72982 0.6641 2366 1 0.47 Calpastatin CAST Hs.359682N51836 0.5625 2367 -1 0.67 - - Hs.50547N69552 0.6067 2367 -1 0.47 Similar to MOB-LAK LOC148932 Hs.97927N68107 0.5096 2368 1 0.8 3-hydroxy-3-methylglutaryl-Coenzyme A reductase HMGCR Hs.11899W52509 0.5734 2368 -1 0.67 Likely ortholog of yeast ARV1 ARV1 Hs.23360W84339 0.5844 2368 -1 0.8 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6 ATP5J Hs.73851N36401 0.6067 2368 1 0.4 Rad50-interacting protein 1 FLJ11785 Hs.44625H14485 0.8976 2368 -1 0.2 Phosphatidylinositol-4-phosphate 5-kinase, type II, beta PIP5K2B Hs.6335N62372 0.44 2369 1 0.9 Polynucleotide phosphorylase-like PNPASE Hs.356503AA142983 0.5096 2369 -1 0.6 Chloride intracellular channel 4 CLIC4 Hs.25035N93442 0.6294 2369 1 0.4 - - -N44886 0.5517 2370 1 0.73 MGC4170 protein MGC4170 Hs.7041AA137059 0.7477 2370 -1 0.33 Alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) ATRX Hs.96264AA047408 0.5517 2371 1 0.47 Family with sequence similarity 3, member A FAM3A Hs.289108AA053325 0.6524 2371 -1 0.47 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 1 ATP6V1G1 Hs.90336T78498 0.6995 2372 1 0.47 Hypothetical protein FLJ22569 FLJ22569 Hs.234355N25927 0.7722 2372 -1 0.33 - - Hs.374362R52397 0.6641 2373 1 0.5 Pumilio homolog 1 (Drosophila) PUM1 Hs.153834R28061 0.7599 2373 1 0.33 - - Hs.14846H04784 0.9359 2373 -1 0.13 RE1-silencing transcription factor REST Hs.227630AA203242 0.5844 2375 1 0.53 Ankyrin repeat and SOCS box-containing 13 ASB13 Hs.99603AA043764 0.7114 2376 1 0.47 Putative nucleic acid binding protein RY-1 RY1 Hs.54649AA002088 0.9487 2376 1 0.03 Pregnancy specific beta-1-glycoprotein 6 PSG6 Hs.252097R67585 0.9743 2376 1 0.07 ESTs ESTs Hs.268748R14822 0.6641 2377 1 0.6 RAN binding protein 1 RANBP1 Hs.24763R32384 0.6876 2377 1 0.4 Deoxyribonuclease I-like 1 DNASE1L1 Hs.77091N75031 0.4496 2378 -1 0.93 GDP dissociation inhibitor 2 GDI2 Hs.56845AA057300 0.6294 2378 1 0.53 Quinoid dihydropteridine reductase QDPR Hs.75438AA031859 0.9359 2378 1 0.2 Translocase of inner mitochondrial membrane 13 homolog (yeast) TIMM13 Hs.23410W90375 0.4593 2379 1 0.87 ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H ATP6V1H Hs.19575H29086 0.5734 2379 1 0.6 Myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila) MLL5 Hs.333300AA044634 0.9743 2379 0 0 Sirtuin silent mating type information regulation 2 homolog 1 (S. cerevisiae) SIRT1 Hs.31176R66676 0.6409 2380 -1 0.47 Ets variant gene 5 (ets-related molecule) ETV5 Hs.43697T53682 0.9487 2380 0 0 Gene predicted from cDNA with a complete coding sequence KIAA0110 Hs.124H19514 0.9359 2381 1 0.07 Frizzled homolog 10 (Drosophila) FZD10 Hs.31664R60915 0.5096 2382 -1 0.8 Growth suppressor 1 GROS1 Hs.10114T72589 0.8344 2382 1 0.13 Skeletal muscle and kidney enriched inositol phosphatase SKIP Hs.178347AA053319 0.6876 2383 1 0.33 - - Hs.167700R50511 0.6995 2383 -1 0.57 Hydroxysteroid (17-beta) dehydrogenase 1 HSD17B1 Hs.85279R25219 0.7355 2383 -1 0.33 - - Hs.175652R93707 0.9872 2383 0 0 Calmodulin 1 (phosphorylase kinase, delta) CALM1 Hs.177656T75267 0.7722 2384 -1 0.2 FK506 binding protein 12-rapamycin associated protein 1 FRAP1 Hs.338207AA045167 0.541 2385 -1 0.8 Hexokinase 2 HK2 Hs.198427H88535 0.6876 2385 -1 0.6 - - Hs.153527AA069568 0.6524 2387 1 0.73 CSRP2 binding protein CSRP2BP Hs.301532R94724 0.6409 2388 -1 0.47 Phytanoyl-CoA hydroxylase (Refsum disease) PHYH Hs.172887H46055 0.6758 2388 1 0.33 KIAA0725 protein KIAA0725 Hs.26450AA033652 0.8722 2389 1 0.33 ATP-dependent RNA helicase MGC2835 Hs.70582R91933 0.541 2390 1 0.53 C-Mpl binding protein LOC113251 Hs.26613AA132083 0.9743 2390 1 0.07 Hypothetical protein BC007384 LOC90378 Hs.140309AA046820 0.9103 2392 -1 0.07 - - Hs.345588AA099441 0.6409 2393 1 0.53 Nucleobindin 1 NUCB1 Hs.172609AA043893 0.6641 2393 -1 0.47 Neuroepithelial cell transforming gene 1 NET1 Hs.25155R48773 0.6995 2393 1 0.33 Nucleosome assembly protein 1-like 4 NAP1L4 Hs.78103N25598 0.6641 2394 -1 0.33 - - Hs.187908R18625 0.8849 2394 1 0.17 Proteasome (prosome, macropain) 26S subunit, ATPase, 3 PSMC3 Hs.250758T86146 0.6641 2395 1 0.33 ESTs ESTs Hs.16094W33065 0.7599 2395 -1 0.23 - - Hs.381204N24877 0.7969 2395 1 0.13 Ubiquitin specific protease 8 USP8 Hs.152818N72176 0.8469 2395 1 0.07 KIAA1046 protein KIAA1046 Hs.89519R91908 0.7722 2396 -1 0.3 Transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) TLE1 Hs.28935N59346 0.6409 2397 1 0.53 Protein tyrosine phosphatase, non-receptor type 12 PTPN12 Hs.62W56434 0.5304 2398 -1 0.7 ESTs ESTs Hs.201608H58462 0.618 2399 -1 0.57 Nucleolar protein family A, member 3 (H/ACA small nucleolar RNPs) NOLA3 Hs.14317N47468 0.7969 2399 -1 0.33 Zinc finger protein 281 ZNF281 Hs.59757H66836 0.5304 2401 1 0.8 - - Hs.224967AA033680 0.5734 2401 1 0.63 Hypothetical protein FLJ31657 FLJ31657 Hs.5518W47073 0.6524 2401 1 0.33 Solute carrier family 20 (phosphate transporter), member 1 SLC20A1 Hs.78452H27414 0.5844 2402 -1 0.6 Ring finger protein 20 RNF20 Hs.168095N25619 0.5955 2402 1 0.53 ESTs ESTs Hs.269036H38062 0.6067 2402 1 0.4 - - -R50031 0.6409 2402 -1 0.47 KIAA0602 protein KIAA0602 Hs.37656AA203636 0.7969 2402 1 0.27 - - Hs.132355T92153 0.4993 2403 1 0.8 - - -H84221 0.7599 2403 -1 0.2 High-glucose-regulated protein 8 HGRG8 Hs.20993R91950 0.6409 2404 -1 0.53 Cytochrome b-5 CYB5 Hs.83834R69570 0.9487 2404 -1 0.27 Oxysterol binding protein-like 3 OSBPL3 Hs.197955N26104 0.5517 2405 -1 0.67 O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl traOGT Hs.100293R56270 0.5517 2406 1 0.6 - - Hs.4817H23029 0.6641 2406 1 0.4 Protein inhibitor of activated STAT X PIASX-BETA Hs.111323T86626 0.8093 2406 -1 0.37 Connector enhancer of KSR-like (Drosophila kinase suppressor of ras) CNK1 Hs.16232R23132 0.8344 2406 -1 0.23 Cullin 1 CUL1 Hs.14541N29648 0.5955 2407 1 0.57 CD164 antigen, sialomucin CD164 Hs.43910AA007449 0.6067 2407 1 0.63 Spastic ataxia of Charlevoix-Saguenay (sacsin) SACS Hs.159492H22871 0.7599 2407 -1 0.33 Peptidase D PEPD Hs.73947AA203452 0.7722 2407 -1 0.33 - - -W23776 0.8469 2407 1 0.07 ENOS interacting protein NOSIP Hs.7236AA047447 0.9103 2407 1 0.27 - - Hs.201060

AA115529 0.6876 2408 -1 0.43 - - Hs.134202H50941 0.7114 2408 1 0.33 Interleukin enhancer binding factor 3, 90kDa ILF3 Hs.256583R14285 0.5734 2409 1 0.47 - - Hs.100261R48603 0.5734 2409 -1 0.6 - - -R06415 0.4691 2410 1 0.87 Friedreich ataxia FRDA Hs.95998N23988 0.8344 2410 1 0.27 RAB13, member RAS oncogene family RAB13 Hs.151536T84103 0.8722 2410 -1 0.07 - - Hs.377850N79378 0.6758 2411 -1 0.47 ESTs ESTs Hs.126688H08650 0.6067 2412 -1 0.47 Egl nine homolog 1 (C. elegans) EGLN1 Hs.6523R67381 0.6995 2412 -1 0.4 - - Hs.330716R37898 0.4891 2413 1 0.67 Interleukin 1 receptor accessory protein IL1RAP Hs.173880AA010048 0.5955 2413 1 0.53 Hypothetical protein FLJ11301 FLJ11301 Hs.301724H52696 0.7477 2414 1 0.27 Hypothetical protein FLJ10101 FLJ10101 Hs.334802H26657 0.6641 2415 -1 0.6 Smcx homolog, X chromosome (mouse) SMCX Hs.283429AA039528 0.6758 2415 -1 0.4 - - Hs.37858T83198 0.7234 2415 1 0.47 Putative receptor protein PMI Hs.15196R62468 0.7599 2415 1 0.27 Small nuclear RNA activating complex, polypeptide 2, 45kDa SNAPC2 Hs.78403H51540 0.9487 2415 -1 0.07 Hypothetical protein FLJ14641 FLJ14641 Hs.245326W85777 0.5304 2416 1 0.6 Kaptin (actin binding protein) KPTN Hs.25441H18810 0.5517 2416 -1 0.67 - - Hs.9961H50924 0.6641 2416 1 0.53 Hypothetical protein FLJ14800 FLJ14800 Hs.62119AA045171 0.7234 2416 -1 0.47 - - Hs.25930H05018 0.9872 2416 1 0.1 Hypothetical protein FLJ10379 FLJ10379 Hs.14229AA029810 0.9872 2416 0 0 - - Hs.79531R80226 0.5304 2417 1 0.53 ESTs ESTs Hs.105636R80601 0.6067 2419 1 0.53 Zinc finger protein 294 ZNF294 Hs.288773H20849 0.618 2419 1 0.53 Deformed epidermal autoregulatory factor 1 (Drosophila) DEAF1 Hs.6574N64500 0.6758 2419 -1 0.5 IDN3 protein IDN3 Hs.225767H09452 0.8469 2419 -1 0.13 Hypothetical protein MGC13007 MGC13007 Hs.332382R50785 0.9359 2419 0 0 Tubulin, gamma complex associated protein 6 TUBGCP6 Hs.336431H49289 0.9615 2419 0 0 Actin, alpha 2, smooth muscle, aorta ACTA2 Hs.195851W52072 0.5199 2420 1 0.6 Ribosomal protein L13 RPL13 Hs.180842T77765 0.7599 2420 1 0.33 Nudix (nucleoside diphosphate linked moiety X)-type motif 2 NUDT2 Hs.14142H16710 0.9872 2420 1 0.13 G protein-coupled receptor kinase 6 GPRK6 Hs.76297R87343 0.6524 2421 -1 0.6 Ubiquitin-conjugating enzyme UBC3B UBC3B Hs.11184N32331 0.7722 2421 1 0.23 Hypothetical protein FLJ14825 FLJ14825 Hs.334824H16467 0.7114 2422 -1 0.33 Sorting nexin 11 SNX11 Hs.15827R55337 0.7845 2422 1 0.23 - - Hs.310092R26320 0.5955 2424 1 0.6 Filamin B, beta (actin binding protein 278) FLNB Hs.81008T72638 0.5734 2425 -1 0.47 - - Hs.380756H08342 0.8218 2425 -1 0.07 - - -H69321 0.5734 2426 -1 0.47 Interleukin 14 IL14 Hs.83004N98333 1 2426 1 0.17 Ribosomal protein L7 RPL7 Hs.153W04612 0.5734 2427 -1 0.53 JM5 protein JM5 Hs.21753W04244 0.5844 2427 -1 0.73 ESTs ESTs Hs.49829H96934 0.6876 2427 -1 0.33 ESTs ESTs Hs.136246W72903 0.7355 2427 1 0.33 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin) DDX9 Hs.74578N51117 0.5734 2428 -1 0.67 ESTs ESTs Hs.110028T87547 0.5734 2428 -1 0.73 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 PSMD1 Hs.3887W42442 0.5625 2429 -1 0.67 Transcription factor binding to IGHM enhancer 3 TFE3 Hs.274184H67177 0.5734 2429 1 0.5 - - -N40301 0.9103 2429 -1 0.2 Cytoskeleton associated protein 2 CKAP2 Hs.24641H27352 0.9487 2429 -1 0.07 V-Ha-ras Harvey rat sarcoma viral oncogene homolog HRAS Hs.37003W58270 0.6067 2430 1 0.47 Karyopherin beta 2b, transportin TRN2 Hs.278378AA156866 0.6067 2431 1 0.7 Uncharacterized bone marrow protein BM045 BM045 Hs.8750R02729 0.6524 2431 -1 0.47 Wolf-Hirschhorn syndrome candidate 1 WHSC1 Hs.110457N46726 0.6758 2432 -1 0.33 KIAA0185 protein KIAA0185 Hs.239499R01336 0.9872 2432 -1 0.07 - - Hs.19150AA053984 0.7234 2433 -1 0.4 H2B histone family, member Q H2BFQ Hs.2178W92625 0.8596 2433 1 0.27 Interleukin enhancer binding factor 3, 90kDa ILF3 Hs.256583R49415 0.9231 2433 1 0.07 Hypothetical protein BC013576 LOC114928 Hs.348493H20778 0.8722 2434 1 0.2 Pregnancy-induced growth inhibitor OKL38 Hs.31773AA043926 0.9872 2434 1 0.13 Tumor necrosis factor receptor superfamily, member 1A TNFRSF1A Hs.159H51993 0.6524 2435 1 0.33 Hypothetical protein MGC3260 MGC3260 Hs.15514R79684 0.6995 2435 -1 0.4 KIAA1805 protein KIAA1805 Hs.294122N95177 0.6067 2436 1 0.67 Replication factor C (activator 1) 1, 145kDa RFC1 Hs.166563W40330 0.6758 2436 1 0.4 G1 to S phase transition 1 GSPT1 Hs.2707AA131634 0.8849 2436 0 0 - - Hs.8172N71478 0.8093 2437 -1 0.27 Glutamate dehydrogenase 1 GLUD1 Hs.77508R08498 0.6876 2439 -1 0.33 - - -H69584 0.9359 2439 1 0.07 - - -W68491 0.6409 2440 -1 0.33 KIAA0892 protein KIAA0892 Hs.112751R36127 0.5844 2441 -1 0.4 Filamin B, beta (actin binding protein 278) FLNB Hs.81008W52940 0.5517 2442 1 0.8 MIL1 protein MIL1 Hs.10267R73213 0.6641 2443 -1 0.27 RAB40B, member RAS oncogene family RAB40B Hs.302498W39234 0.8722 2443 1 0.27 Mitochondrial ribosomal protein L16 MRPL16 Hs.5080AA099397 0.8976 2443 -1 0.2 DEAD-box protein abstrakt ABS Hs.274317H85459 0.5625 2444 -1 0.53 Sortilin 1 SORT1 Hs.351872N26563 0.618 2444 -1 0.47 Second mitochondria-derived activator of caspase SMAC Hs.169611AA053856 0.6876 2444 -1 0.47 - - -H21122 0.8093 2444 1 0.33 Scaffold attachment factor B SAFB Hs.23978R00749 0.5517 2445 1 0.67 - - Hs.17240R89136 0.8596 2445 -1 0.23 - - -H05551 0.8596 2445 -1 0.27 Hypothetical protein FLJ34231 FLJ34231 Hs.30503N52230 0.4891 2446 1 0.8 Hypothetical protein H17 H17 Hs.16361AA102103 0.5844 2447 1 0.53 Stromal antigen 2 STAG2 Hs.8217AA203238 0.6067 2447 1 0.67 GLI-Kruppel family member GLI3 (Greig cephalopolysyndactyly syndrome) GLI3 Hs.72916AA099606 0.9615 2447 -1 0.07 - - Hs.24143N27205 0.9743 2447 -1 0.07 Hypothetical protein FLJ13855 FLJ13855 Hs.168232W04510 0.5734 2448 -1 0.73 TCF3 (E2A) fusion partner (in childhood Leukemia) TFPT Hs.233765H06950 0.6067 2448 -1 0.67 SMC4 structural maintenance of chromosomes 4-like 1 (yeast) SMC4L1 Hs.50758AA026235 0.7355 2448 -1 0.33 - - Hs.31447W03639 0.5734 2449 -1 0.6 Golgi autoantigen, golgin subfamily a, 2 GOLGA2 Hs.24049H69509 0.541 2450 -1 0.67 ATP-binding cassette, sub-family B (MDR/TAP), member 10 ABCB10 Hs.1710H93832 0.5955 2452 -1 0.47 Chromosome 20 open reading frame 16 C20orf16 Hs.92374H99483 0.7599 2452 -1 0.27 - - -AA047156 0.8722 2452 -1 0.2 ESTs ESTs Hs.323484N36861 0.9231 2452 1 0.1 ESTs ESTs Hs.42344N68372 0.9359 2452 1 0.07 - - -AA152215 0.5955 2453 1 0.6 Tubulin-specific chaperone d TBCD Hs.12570

AA043638 0.7355 2454 -1 0.3 Crystallin, zeta (quinone reductase) CRYZ Hs.83114AA203422 0.7722 2454 1 0.13 Splicing factor, arginine/serine-rich, 46kD SRP46 Hs.155160H82069 0.5955 2455 -1 0.6 Nuclear cap binding protein subunit 2, 20kDa NCBP2 Hs.240770W57806 0.6409 2455 -1 0.47 Unknown LOC51693 Hs.27445AA053859 0.6876 2455 -1 0.47 U2 small nuclear ribonucleoprotein auxiliary factor (65kD) U2AF65 Hs.7655W93973 0.9231 2455 -1 0.1 BCL2/adenovirus E1B 19kDa interacting protein 1 BNIP1 Hs.77572AA115563 0.6524 2456 -1 0.53 Histidyl-tRNA synthetase-like HARSL Hs.278507AA214455 0.7114 2457 -1 0.27 - - -T86617 0.8469 2457 -1 0.23 V-myb myeloblastosis viral oncogene homolog (avian)-like 2 MYBL2 Hs.179718N24178 0.8849 2457 -1 0.2 ESTs ESTs Hs.293676H97415 0.4993 2458 -1 0.87 TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa TAF6L Hs.131846R05624 0.6409 2458 -1 0.47 - - Hs.293993AA040160 0.4891 2459 -1 0.67 Hypothetical protein BC017335 LOC92715 Hs.292570N93284 0.7599 2459 -1 0.33 Hypothetical protein MGC5627 MGC5627 Hs.237971R56380 0.8218 2459 -1 0.3 - - Hs.356416W49783 0.7845 2460 1 0.07 - - Hs.13328AA054447 0.6641 2461 1 0.5 Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa PAFAH1B1 Hs.77318AA040162 0.6758 2461 -1 0.4 Calnexin CANX Hs.155560AA036785 0.8722 2462 -1 0.13 N-myristoyltransferase 2 NMT2 Hs.122647N75330 0.618 2463 -1 0.6 Ac-like transposable element ALTE Hs.9933R00701 0.6876 2463 -1 0.47 Abhydrolase domain containing 1 ABHD2 Hs.99364R40685 0.9231 2463 -1 0.13 SAC1 suppressor of actin mutations 1-like (yeast) SACM1L Hs.5867N26031 0.6409 2464 -1 0.6 ESTs ESTs Hs.43725AA011707 0.6524 2465 -1 0.2 Ras homolog gene family, member U ARHU Hs.20252AA029349 0.6876 2465 -1 0.47 - - -H63988 0.8976 2465 1 0.27 ESTs ESTs Hs.38264R32787 0.5096 2466 1 0.8 - - -N23299 0.618 2466 -1 0.53 KIAA0212 gene product KIAA0212 Hs.154332R27190 0.7355 2467 1 0.4 Placental growth factor, vascular endothelial growth factor-related protein PGF Hs.2894H53141 0.5625 2468 1 0.57 ESTs ESTs Hs.268917N70581 0.7114 2469 1 0.43 Centrin, EF-hand protein, 2 CETN2 Hs.82794N64002 0.6067 2470 1 0.6 Rap guanine nucleotide exchange factor RA-GEF-2 Hs.174795H69011 0.7355 2470 1 0.5 SKI-like SKIL Hs.38783H49479 0.4593 2471 -1 0.67 CCR4-NOT transcription complex, subunit 8 CNOT8 Hs.26703R72977 0.6409 2471 -1 0.57 RNA binding motif protein 8A RBM8A Hs.10283R21092 0.6409 2471 -1 0.53 Carbonic anhydrase I CA1 Hs.23118W58334 0.6758 2471 -1 0.3 Hydroxyacyl glutathione hydrolase HAGH Hs.155482W07491 0.7234 2471 1 0.33 - - Hs.58633N21505 0.5199 2472 -1 0.73 - - Hs.27048H03342 0.6524 2473 -1 0.53 Hypothetical protein FLJ21939 similar to 5-azacytidine induced gene 2 FLJ21939 Hs.164478N46615 0.6876 2473 -1 0.6 Similar to envelope protein LOC113386 Hs.132055R12705 0.6067 2474 1 0.4 Thyroid hormone receptor interactor 13 TRIP13 Hs.6566W52466 0.5517 2475 1 0.6 Carboxypeptidase A1 (pancreatic) CPA1 Hs.2879N63013 0.6641 2475 -1 0.33 Hypothetical protein FLJ13194 FLJ13194 Hs.288932W56037 0.4891 2477 -1 0.93 Ras homolog gene family, member H ARHH Hs.109918T96942 0.5844 2478 -1 0.4 Enoyl Coenzyme A hydratase, short chain, 1, mitochondrial ECHS1 Hs.76394W39596 0.8218 2478 1 0.27 Aldehyde dehydrogenase 1 family, member A1 ALDH1A1 Hs.76392H77998 0.6758 2479 -1 0.33 KIAA0310 gene product KIAA0310 Hs.5716H09565 0.4993 2480 1 0.8 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide YWHAG Hs.25001T81551 0.7722 2480 -1 0.27 - - Hs.380093R36586 0.5734 2481 -1 0.57 Phosphatidylinositol (4,5) bisphosphate 5-phosphatase homolog; phosphatidylinositol polyphosphate 5-phosphatase PPI5PIV Hs.25156H85860 0.7114 2481 1 0.37 - - -H64918 0.9743 2481 -1 0.03 Interferon-stimulated transcription factor 3, gamma 48kDa ISGF3G Hs.1706W86364 0.44 2482 -1 0.87 ESTs ESTs Hs.58819W60866 0.7355 2482 -1 0.33 - - Hs.57806N66260 0.8344 2482 1 0.27 MUS81 endonuclease MUS81 Hs.288798T66786 0.8469 2482 -1 0.07 ESTs ESTs Hs.12941N58497 0.8849 2482 -1 0.2 Translocated promoter region (to activated MET oncogene) TPR Hs.169750R80010 0.8976 2482 1 0.03 Nuclear matrix protein NXP-2 NXP-2 Hs.70359H38592 0.9359 2482 -1 0.07 ESTs ESTs Hs.32840H43498 0.4791 2483 -1 0.8 MAP/microtubule affinity-regulating kinase 1 MARK1 Hs.12808AA150965 0.7969 2483 1 0.13 KIAA1921 protein KIAA1921 Hs.348392W20441 0.7722 2484 1 0.17 KIAA0116 protein KIAA0116 Hs.182877N77380 0.6876 2485 1 0.53 ESTs ESTs Hs.19918AA047517 0.9231 2485 -1 0.07 VRK3 for vaccinia related kinase 3 LOC51231 Hs.98289W88941 0.9743 2485 0 0 Microspherule protein 1 MCRS1 Hs.25313AA041277 0.6524 2486 -1 0.43 - - -R34513 0.6641 2486 -1 0.53 KIAA1468 protein KIAA1468 Hs.23542W79028 0.6758 2486 1 0.33 Ribulose-5-phosphate-3-epimerase RPE Hs.125845N91882 0.6995 2486 1 0.4 Alpha2,3-sialyltransferase ST3GALVI Hs.34578AA041282 0.7234 2487 -1 0.33 - - -H10070 0.7355 2487 -1 0.27 KIAA0169 protein KIAA0169 Hs.374382AA134750 0.8722 2487 1 0.03 Hypothetical protein MGC10848 MGC10848 Hs.207443H52728 0.8849 2487 -1 0.13 Tripartite motif-containing 35 TRIM35 Hs.137732R19946 0.5844 2488 1 0.6 Stannin SNN Hs.76691W61377 0.6524 2488 -1 0.33 Aminolevulinate, delta-, dehydratase ALAD Hs.1227W86913 0.7599 2488 1 0.13 - - -H30017 0.7969 2488 1 0.33 Phosphoinositide-3-kinase, regulatory subunit, polypeptide 2 (p85 beta) PIK3R2 Hs.211586AA099226 0.9359 2488 1 0.07 - - Hs.356377AA009512 0.541 2489 -1 0.73 - - -R62341 0.7477 2489 1 0.47 Hypothetical protein FLJ35564 FLJ35564 Hs.374836N46949 0.8722 2489 1 0.2 - - -R21391 0.6294 2490 1 0.6 Hypothetical protein DKFZp564D0478 DKFZP564D047Hs.321214R34645 0.5517 2492 1 0.67 Kinesin family member 13A KIF13A Hs.146286N30559 0.5734 2492 1 0.77 - - -W15224 0.6409 2492 1 0.4 KIAA0819 protein KIAA0819 Hs.301866AA047454 0.7114 2492 -1 0.47 Zinc finger protein 76 (expressed in testis) ZNF76 Hs.29222AA044942 0.9872 2492 1 0.17 Eukaryotic translation initiation factor 4 gamma, 1 EIF4G1 Hs.211568R96178 0.4593 2494 -1 0.93 - - -N91541 0.6067 2494 1 0.4 Non-metastatic cells 1, protein (NM23A) expressed in NME1 Hs.118638T65350 0.6294 2494 1 0.4 WD repeat domain 13 WDR13 Hs.12142W24178 0.8093 2494 -1 0.3 IlvB (bacterial acetolactate synthase)-like ILVBL Hs.78880H25618 0.8976 2494 -1 0.27 Hypothetical protein HSPC177 HSPC177 Hs.36237AA150924 0.5844 2495 -1 0.67 Immunoglobulin (CD79A) binding protein 1 IGBP1 Hs.3631T65558 0.9103 2495 -1 0.17 Angiotensin II receptor-associated protein AGTRAP Hs.12854N36109 0.6294 2496 1 0.6 Macrophage myristoylated alanine-rich C kinase substrate MACMARCKS Hs.75061H44693 0.6758 2496 1 0.67 Hypothetical protein FLJ25604 FLJ25604 Hs.220745AA017362 0.8218 2496 -1 0.3 Glucose-6-phosphate dehydrogenase G6PD Hs.80206H81760 0.9487 2496 -1 0.17 - - Hs.40289T96894 0.9615 2496 1 0.07 ESTs ESTs Hs.181826

R13023 0.4496 2498 1 0.67 - - -AA152292 0.618 2498 1 0.67 Ovarian carcinoma immunoreactive antigen OCIA Hs.132071R66378 0.7845 2498 -1 0.17 RAB9A, member RAS oncogene family RAB9A Hs.330994R34172 0.6067 2499 1 0.53 - - Hs.22968H53718 0.6641 2499 1 0.53 - - -N45309 0.6758 2499 1 0.37 Prenylcysteine lyase PCL1 Hs.278627R61551 0.6294 2500 1 0.6 - - Hs.131798N50342 0.5625 2501 1 0.67 KIAA0725 protein KIAA0725 Hs.26450N95455 0.6876 2501 1 0.63 N-acetylgalactosaminidase, alpha- NAGA Hs.75372H75861 0.6995 2501 1 0.47 Apoptotic chromatin condensation inducer in the nucleus ACN Hs.227133AA042936 0.5844 2502 1 0.7 My015 My015 Hs.325531R60330 0.6524 2502 1 0.4 Procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-Danlos syndrome type VI) PLOD Hs.75093W89140 0.5517 2503 -1 0.67 ESTs ESTs Hs.14691H27907 0.6067 2503 -1 0.6 CDK5 regulatory subunit associated protein 2 CDK5RAP2 Hs.32360AA195213 0.7234 2503 -1 0.27 RAB2, member RAS oncogene family RAB2 Hs.78305R61381 0.7355 2503 1 0.4 Centromere protein B, 80kDa CENPB Hs.85004N21529 0.9487 2503 1 0.2 - - -N27488 0.7114 2504 1 0.43 Sarcolemma associated protein SLMAP Hs.4007N90234 0.7114 2505 -1 0.07 Glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase) GCAT Hs.54609AA044807 0.8093 2505 1 0.07 - - -H51648 0.6409 2506 1 0.53 Similar to RIKEN cDNA 4933424N09 gene MGC16943 Hs.248437AA045139 0.7477 2506 -1 0.2 Hypothetical protein FLJ12592 FLJ12592 Hs.23100R01695 0.4891 2507 -1 0.73 Dpy-30-like protein LOC84661 Hs.323401T95573 0.9103 2507 -1 0.07 Nuclear antigen Sp100 SP100 Hs.77617T71576 0.6409 2508 -1 0.4 Hypothetical protein MGC5309 MGC5309 Hs.13885R60231 0.8976 2508 1 0.13 KIAA1255 protein KIAA1255 Hs.351633N50632 0.6409 2510 -1 0.47 Leucine-rich and death domain containing LRDD Hs.123136H00874 0.7355 2511 -1 0.4 - - Hs.295789H41889 0.6409 2512 1 0.53 - - Hs.315270H17403 0.7599 2512 -1 0.13 Hypothetical protein FLJ22318 FLJ22318 Hs.22753H88020 0.8093 2512 -1 0.27 ESTs ESTs Hs.114271R22203 0.7234 2513 -1 0.37 Hypothetical protein FLJ10330 FLJ10330 Hs.342307AA147539 0.8469 2513 1 0.17 D-dopachrome tautomerase DDT Hs.180015N57645 0.9615 2513 1 0.07 ESTs ESTs Hs.380509AA055106 0.9872 2513 -1 0.17 Crystallin, zeta (quinone reductase)-like 1 CRYZL1 Hs.330208T97327 0.7234 2514 1 0.33 ESTs ESTs Hs.18041R54865 0.7845 2514 1 0.43 Hypothetical protein from EUROIMAGE 2021883 LOC56926 Hs.24983N34234 0.7845 2514 1 0.27 Esterase D/formylglutathione hydrolase ESD Hs.82193AA203115 0.6876 2515 -1 0.2 Organic cation transporter OKB1 OKB1 Hs.191996N26046 1 2515 -1 0.07 Solute carrier family 25 (mitochondrial deoxynucleotide carrier), member 19 SLC25A19 Hs.16786N29183 0.7355 2516 -1 0.47 - - Hs.289018R77727 0.7722 2516 1 0.27 Nucleolar protein family A, member 2 (H/ACA small nucleolar RNPs) NOLA2 Hs.23990R99156 0.7845 2516 -1 0.23 P53-regulated DDA3 DDA3 Hs.77550T95796 0.5955 2517 -1 0.6 Eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa EIF2B1 Hs.78592N89894 0.618 2518 -1 0.4 - - -N57249 0.7355 2519 1 0.3 Proteasome (prosome, macropain) subunit, beta type, 5 PSMB5 Hs.78596AA047678 0.7477 2519 -1 0.27 Death associated protein 3 DAP3 Hs.159627N25562 0.7969 2519 -1 0.13 Protein tyrosine kinase 9 PTK9 Hs.82643AA043760 0.9743 2519 -1 0.07 General transcription factor IIB GTF2B Hs.258561H52236 0.6409 2520 -1 0.4 Adducin 1 (alpha) ADD1 Hs.183706AA213442 0.6641 2520 1 0.47 ESTs ESTs Hs.148000R63060 0.7234 2520 1 0.4 - - -W46278 0.8849 2521 1 0.2 T-cell activation protein phosphatase 2C TA-PP2C Hs.13854AA126411 0.6524 2522 1 0.47 - - Hs.15806AA135742 0.6758 2522 1 0.4 ESTs ESTs Hs.270798R94867 0.5625 2523 1 0.53 Ring finger protein 1 RING1 Hs.35384R39419 0.6758 2523 -1 0.53 - - Hs.351152R18959 0.9487 2523 0 0 Hypothetical protein FLJ13111 FLJ13111 Hs.288382N95812 0.7722 2525 1 0.4 Insulin-like growth factor binding protein 6 IGFBP6 Hs.274313H98919 0.9487 2525 1 0.07 - - -T84763 0.9487 2525 1 0.13 - - Hs.284344N94831 0.541 2526 -1 0.8 KIAA0013 gene product ARHGAP11A Hs.172652W80994 0.5844 2527 -1 0.47 Nerve growth factor receptor (TNFRSF16) associated protein 1 NGFRAP1 Hs.381039AA035343 0.6641 2527 1 0.33 - - -W24882 0.7477 2527 -1 0.3 Hypothetical protein FLJ35779 FLJ35779 Hs.374991W67797 0.8218 2528 1 0.1 Laminin, alpha 5 LAMA5 Hs.11669R36886 0.6067 2529 1 0.73 Chromosome 20 open reading frame 104 C20orf104 Hs.301055H26561 0.7722 2529 -1 0.07 Serine/threonine kinase 11 interacting protein STK11IP Hs.22410AA045366 0.9615 2530 0 0 Plastin 3 (T isoform) PLS3 Hs.4114R17860 0.9743 2530 1 0.07 - - Hs.288361AA036798 0.5844 2531 -1 0.8 - - Hs.339024T75250 0.7599 2531 -1 0.3 COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis) COPS7B Hs.114432R47912 0.9231 2531 -1 0.27 - - Hs.17567W93292 0.7355 2532 1 0.43 Mitochondrial carrier homolog 2 MTCH2 Hs.279609AA035055 0.6409 2533 -1 0.47 - - Hs.374400AA063044 0.6524 2533 1 0.47 Hypothetical protein MGC4840 MGC4840 Hs.301872H75353 0.8722 2535 1 0.07 - - -T93605 0.5734 2536 -1 0.6 ESTs ESTs Hs.188627AA129971 0.6294 2536 -1 0.4 - - -R93296 0.7114 2538 1 0.33 - - -R55787 0.8093 2538 1 0.27 KIAA1069 protein KIAA1069 Hs.193143R46527 0.8344 2539 1 0.33 DKFZP434H132 protein DKFZP434H132Hs.17936AA059128 0.9615 2539 1 0.13 H2A histone family, member Y H2AFY Hs.75258H58225 0.5625 2541 -1 0.8 LIM and senescent cell antigen-like domains 1 LIMS1 Hs.112378H75745 0.8469 2541 1 0.13 Calcium homeostasis endoplasmic reticulum protein CHERP Hs.6430AA069527 1 2541 1 0.07 Tuftelin interacting protein 11 TFIP11 Hs.20225AA039596 0.6067 2542 -1 0.53 Hypothetical protein FLJ21308 FLJ21308 Hs.29977T85827 0.6524 2542 1 0.4 - - -R53645 0.6995 2542 1 0.53 - - Hs.378080T69771 0.7722 2542 -1 0.27 Hypothetical protein FLJ12716 FLJ12716 Hs.5354AA057144 0.8469 2542 -1 0.27 Slit homolog 3 (Drosophila) SLIT3 Hs.57929AA046623 0.8596 2542 1 0.07 Hypothetical protein FLJ10377 FLJ10377 Hs.274263N42162 0.5955 2543 -1 0.4 DC2 protein DC2 Hs.103180H68441 0.7845 2543 -1 0.2 Hypothetical protein FLJ14054 FLJ14054 Hs.13528H81680 0.6524 2544 1 0.33 Nucleolar protein ANKT ANKT Hs.279905T89566 0.6995 2544 -1 0.27 ESTs ESTs Hs.16586W02039 0.7969 2544 -1 0.47 Agouti signaling protein, nonagouti homolog (mouse) ASIP Hs.361642N90249 0.8722 2544 1 0.2 Protein phosphatase 1, regulatory subunit 10 PPP1R10 Hs.106019R72609 0.7114 2545 -1 0.4 - - Hs.5724R72799 0.8849 2546 1 0.23 HpaII tiny fragments locus 9C HTF9C Hs.63609

T79789 0.7969 2547 -1 0.37 ESTs ESTs Hs.154701N29880 0.6876 2548 1 0.33 Hypothetical protein DKFZp762O076 DKFZp762O076 Hs.21621R82950 0.6409 2549 -1 0.53 DKFZP434N093 protein DKFZP434N093Hs.33363W63553 0.6995 2549 1 0.4 Hypothetical protein BC001573 LOC134147 Hs.349344R59471 0.8469 2549 1 0.13 Protein phosphatase 2A, regulatory subunit B' (PR 53) PPP2R4 Hs.236963R83572 0.541 2550 -1 0.8 Hypothetical protein FLJ10154 FLJ10154 Hs.179972H43455 0.6067 2550 1 0.47 Hypothetical protein PP2447 PP2447 Hs.33026H50248 0.6067 2550 1 0.67 Prostate derived STE20-like kinase PSK PSK Hs.66141W30745 0.8218 2550 -1 0.4 Hypothetical protein DJ159A19.3 DJ159A19.3 Hs.10700H23344 0.7477 2551 1 0.33 - - Hs.356140AA203110 0.5304 2552 -1 0.67 Androgen-induced basic leucine zipper AIBZIP Hs.372924H09049 0.6409 2552 -1 0.47 Enolase 2, (gamma, neuronal) ENO2 Hs.146580AA004997 0.8469 2552 -1 0.13 Thyroid hormone receptor-associated protein (100 kDa) TRAP100 Hs.23106AA115345 0.9615 2553 1 0.13 Hypothetical protein DKFZp586F2423 DKFZP586F242 Hs.13659R80595 0.7845 2554 1 0.37 - - Hs.177781R50443 0.9231 2554 -1 0.1 - - -AA131322 0.5734 2555 -1 0.67 Tryptase beta 1 TPSB1 Hs.347933AA069569 0.6876 2555 1 0.53 Lecuine-rich acidic protein-like protein LANP-L Hs.71331R93500 0.7845 2556 1 0.4 - - Hs.34490N77027 0.8344 2556 -1 0.13 - - Hs.279607H81987 0.8218 2557 1 0.23 - - Hs.117907AA035226 0.7355 2558 -1 0.33 KIAA1542 protein KIAA1542 Hs.130541AA054758 0.9231 2558 -1 0.13 - - -H51348 0.618 2559 1 0.47 F-box only protein 25 FBXO25 Hs.81001W03020 0.6641 2559 -1 0.4 Calpain 3, (p94) CAPN3 Hs.40300H14840 0.7234 2559 -1 0.33 Hypothetical protein MGC2668 MGC2668 Hs.56851R76719 0.8218 2559 -1 0.07 Microtubule-associated protein 1 light chain 3 alpha MAP1LC3A Hs.134707T79536 0.5955 2560 1 0.53 - - -H00294 0.9231 2560 1 0.13 Hypothetical protein 628 LOC56270 Hs.181349R14556 0.5734 2561 -1 0.87 - - -R17132 0.5844 2561 1 0.53 HSPC055 protein HSPC055 Hs.179898R75740 0.7599 2561 -1 0.4 Hypothetical protein BC011880 LOC113444 Hs.27160W21172 0.8093 2561 -1 0.3 Growth arrest-specific 11 GAS11 Hs.54877H25911 0.8218 2561 -1 0.4 - - -R26327 0.9872 2561 1 0.03 - - Hs.374441W23773 0.5955 2562 -1 0.67 BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) BAP1 Hs.106674W44390 0.6641 2562 1 0.33 GM2 ganglioside activator protein GM2A Hs.289082H43564 0.5955 2563 -1 0.8 COX15 homolog, cytochrome c oxidase assembly protein (yeast) COX15 Hs.226581AA026227 0.6758 2563 1 0.53 - - -N79578 0.7355 2563 1 0.27 ClpP caseinolytic protease, ATP-dependent, proteolytic subunit homolog (E. coli) CLPP Hs.74362N80064 0.8469 2564 -1 0.2 Mitochondrial ribosomal protein S6 MRPS6 Hs.6945H44662 0.9487 2564 -1 0.07 Talin 1 TLN1 Hs.375001H63353 0.9872 2564 -1 0.2 Hypothetical protein HSPC242 HSPC242 Hs.25199R40588 0.6524 2565 1 0.4 - - Hs.21256N23806 0.6876 2565 -1 0.53 Similar to envelope protein LOC113386 Hs.132055N29497 0.8722 2565 1 0.33 - - Hs.43112AA099608 1 2565 -1 0.1 - - Hs.7037R31892 0.5625 2566 1 0.73 - - -N63584 0.7114 2566 1 0.33 Topoisomerase (DNA) II beta 180kDa TOP2B Hs.75248AA101775 0.9103 2566 -1 0.2 Methylcrotonoyl-Coenzyme A carboxylase 1 (alpha) MCCC1 Hs.47649AA114977 0.6409 2567 1 0.47 Glutaminyl-tRNA synthetase QARS Hs.79322T86632 0.8469 2567 1 0.13 - - -AA001250 0.7114 2570 -1 0.4 - - Hs.118913H14191 0.7845 2570 1 0.4 MMS19-like (MET18 homolog, S. cerevisiae) MMS19L Hs.288891AA194092 0.9872 2570 0 0 Leukocyte-associated Ig-like receptor 1 LAIR1 Hs.115808N71546 0.7599 2571 -1 0.27 Hypothetical protein FLJ20920 FLJ20920 Hs.288959H70778 0.8849 2571 -1 0.27 Cell division cycle associated 4 CDCA4 Hs.34045H90964 0.8849 2571 -1 0.17 Zinedin ZIN Hs.108665R53477 0.6067 2572 -1 0.6 - - Hs.4283AA001937 0.7355 2572 -1 0.2 ESTs ESTs Hs.59974N49891 0.8849 2572 -1 0.2 Hypothetical protein FLJ20748 FLJ20748 Hs.91973N69403 0.7722 2575 -1 0.2 - - Hs.48480R19920 0.5955 2577 -1 0.7 KIAA1464 protein KIAA1464 Hs.6343AA146850 0.8218 2577 1 0.13 - - -AA152298 0.7355 2578 1 0.4 KIAA0800 gene product KIAA0800 Hs.118738AA011350 0.7722 2578 1 0.23 Similar to phosphoserine/threonine/tyrosine interaction protein; STNS (alternatively spliced intron of Styx) LOC122792 Hs.224818N21144 0.7845 2578 -1 0.13 Transcription factor binding to IGHM enhancer 3 TFE3 Hs.274184AA150604 0.8093 2578 -1 0.3 Calmodulin 3 (phosphorylase kinase, delta) CALM3 Hs.334330R24294 0.8218 2578 -1 0.13 Citron (rho-interacting, serine/threonine kinase 21) CIT Hs.15767W58039 0.5734 2579 -1 0.63 Regulator of G-protein signalling 10 RGS10 Hs.82280T92286 0.7477 2579 1 0.33 Ral guanine nucleotide exchange factor RalGPS1A RALGPS1A Hs.374518AA039863 0.7234 2580 -1 0.47 Prolylcarboxypeptidase (angiotensinase C) PRCP Hs.75693N99051 0.8469 2580 1 0.27 RNA binding motif, single stranded interacting protein 1 RBMS1 Hs.241567N75343 0.8849 2580 -1 0.13 Polymerase (DNA directed), delta 2, regulatory subunit 50kDa POLD2 Hs.74598R01093 0.5955 2581 1 0.53 Lymphocyte adaptor protein LNK Hs.13131W37775 0.7477 2581 1 0.33 - - -AA053908 0.9359 2581 -1 0.07 - - Hs.59847N46377 0.6995 2582 1 0.33 Beta-galactose-3-O-sulfotransferase, 4 GAL3ST-4 Hs.44856AA035766 0.5199 2583 1 0.87 Spermidine/spermine N1-acetyltransferase SAT Hs.28491H06742 0.6876 2583 1 0.6 Oxysterol binding protein-like 9 OSBPL9 Hs.21938H69318 0.8093 2583 1 0.13 A disintegrin and metalloproteinase domain 10 ADAM10 Hs.172028T72646 0.6067 2584 1 0.47 - - -AA039915 0.7477 2584 -1 0.27 Serum response factor (c-fos serum response element-binding transcription factor) SRF Hs.155321N46534 0.8093 2585 1 0.27 Hypothetical protein FLJ10738 FLJ10738 Hs.5457AA047337 0.8218 2585 1 0.17 TATA element modulatory factor 1 TMF1 Hs.267632AA059073 0.618 2586 1 0.6 - - -AA135338 0.6995 2586 -1 0.4 ESTs ESTs Hs.132947N74005 0.5517 2587 1 0.73 Bromodomain and PHD finger containing, 3 BRPF3 Hs.246795N42424 0.6641 2587 -1 0.53 RAB3 GTPase-ACTIVATING PROTEIN RAB3GAP Hs.227881W24084 0.5517 2588 -1 0.73 Major histocompatibility complex, class I, B HLA-B Hs.77961AA131505 0.7114 2589 -1 0.47 HSPCO34 protein LOC51668 Hs.46967H15905 0.541 2591 -1 0.8 KIAA0191 protein KIAA0191 Hs.12413N70628 0.8344 2591 -1 0.2 Polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa POLR2K Hs.351475R37666 0.9359 2591 1 0.27 Radical fringe homolog (Drosophila) RFNG Hs.12862H27729 0.8344 2592 -1 0.2 AD038 LOC85026 Hs.22164AA028141 0.6995 2593 -1 0.27 Pogo transposable element with ZNF domain POGZ Hs.107088AA047792 0.7355 2593 -1 0.33 Regulator of G-protein signalling 1 RGS1 Hs.75256W25045 0.8976 2593 1 0.13 General transcription factor IIIA GTF3A Hs.75113R82340 0.6409 2595 1 0.6 Pyruvate dehydrogenase complex, lipoyl-containing component X; E3-binding protein PDX1 Hs.351622T79657 0.7722 2595 1 0.27 ESTs ESTs Hs.14598

W23577 0.7114 2596 -1 0.47 Polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa POLR2J Hs.80475AA044734 0.8849 2596 -1 0.33 ADP-ribosylation factor 3 ARF3 Hs.119177H15988 0.6876 2597 1 0.43 - - Hs.27048R62469 0.9615 2597 1 0.13 Cylindromatosis (turban tumor syndrome) CYLD Hs.18827R65748 0.6876 2599 1 0.3 - - -N33136 0.8093 2600 1 0.03 Translin TSN Hs.75066AA194219 0.9231 2600 0 0 - - -H23930 0.9872 2600 0 0 Lipin 1 LPIN1 Hs.81412N32385 0.6995 2601 -1 0.53 Hypothetical protein FLJ14249 similar to HS1 binding protein 3 FLJ14249 Hs.125520W93024 0.9359 2601 -1 0.07 - - Hs.373695H20174 0.9487 2601 -1 0.2 Adenosine monophosphate deaminase 2 (isoform L) AMPD2 Hs.82927T83724 0.8469 2602 -1 0.2 Growth arrest-specific 2 like 1 GAS2L1 Hs.322852AA056554 0.9103 2602 -1 0.2 Cold shock domain protein A CSDA Hs.198726T66839 0.9359 2602 0 0 Hypothetical protein FLJ11806 FLJ11806 Hs.323443R25755 0.6524 2603 1 0.6 ESTs ESTs Hs.106131W88496 0.6524 2603 -1 0.47 Zizimin1 zizimin1 Hs.8021R64681 0.9231 2603 -1 0.2 SPPL3 SPPL3 Hs.21143W57808 0.6995 2604 -1 0.4 H2A histone family, member J H2AFJ Hs.36727R07644 0.6294 2605 1 0.63 RuvB-like 1 (E. coli) RUVBL1 Hs.272822N43796 0.9103 2605 -1 0.07 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 ATP6V0D1 Hs.106876R80525 0.6876 2606 1 0.33 Nucleoporin Nup37 Nup37 Hs.5152H60417 0.8849 2606 0 0 - - Hs.20000H10415 0.6524 2607 -1 0.47 Likely ortholog of mouse Rw1 RW1 Hs.75912R18698 0.8344 2607 1 0.27 Hypothetical protein DKFZp761B1514 DKFZp761B1514Hs.177537N89829 0.9872 2607 -1 0.13 - - Hs.293653T67153 0.6409 2608 1 0.53 Inner mitochondrial membrane peptidase 2 like IMMP2L Hs.89576H91044 0.7114 2608 1 0.27 Mitogen-activated protein kinase phosphatase x MKPX Hs.29106H94706 0.8218 2608 1 0.2 - - Hs.349150N24920 0.9103 2608 -1 0.17 Angiogenin, ribonuclease, RNase A family, 5 ANG Hs.332764N23942 0.6524 2610 -1 0.33 MEP50 protein MEP50 Hs.11039H90219 0.6876 2610 -1 0.4 Inositol(myo)-1(or 4)-monophosphatase 1 IMPA1 Hs.171776H47450 0.7845 2610 -1 0.27 - - -N36913 0.6409 2612 1 0.47 Hypothetical protein DKFZp762N1910 DKFZp762N191 Hs.321717N70129 0.5955 2613 -1 0.6 - - -N47636 0.8849 2613 -1 0.27 Hypothetical protein DC42 DC42 Hs.72805W78808 0.6758 2614 -1 0.53 AFG3 ATPase family gene 3-like 1 (yeast) AFG3L1 Hs.337620R06463 0.6876 2614 1 0.53 Heat shock protein 75 TRAP1 Hs.182366H81783 0.7114 2614 -1 0.37 ESTs ESTs Hs.40290AA046245 0.7845 2614 -1 0.13 Osteoblast specific factor 2 (fasciclin I-like) OSF-2 Hs.136348N21334 0.7722 2615 1 0.27 Abl-interactor 2 ABI-2 Hs.343575R54961 0.8344 2615 1 0.27 PHD zinc finger protein XAP135 XAP135 Hs.7759R38029 0.9359 2615 -1 0.13 Acidic (leucine-rich) nuclear phosphoprotein 32 family, member A ANP32A Hs.285013T47502 0.5955 2616 -1 0.57 PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein PCQAP Hs.8657AA133495 0.7477 2616 1 0.47 Triggering receptor expressed on myeloid cells 2 TREM2 Hs.44234W23753 0.7355 2617 1 0.17 Phosphoprotein enriched in astrocytes 15 PEA15 Hs.194673N39216 0.5955 2619 1 0.73 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 CDS2 Hs.24812H52694 0.7969 2619 -1 0.3 WAP four-disulfide core domain 1 WFDC1 Hs.36688R47930 0.8849 2619 1 0.23 Hypothetical protein 669 LOC56267 Hs.180378N77716 0.9743 2619 -1 0.13 Low molecular mass ubiquinone-binding protein (9.5kD) QP-C Hs.3709R33011 0.541 2620 1 0.67 Suppressor of cytokine signaling 5 SOCS5 Hs.169836W86198 0.6294 2620 -1 0.6 Yeast Sec31p homolog KIAA0905 Hs.70266R15788 0.8218 2620 1 0.33 - - -N90754 0.8596 2620 -1 0.2 HP43.8KD protein HP43.8KD Hs.332841T95296 0.618 2621 1 0.57 - - -N80703 0.6995 2621 -1 0.33 Chromosome 20 open reading frame 20 C20orf20 Hs.143954H61827 0.7114 2621 -1 0.07 KIAA1882 protein MGC4737 Hs.157240AA115477 0.6294 2622 1 0.67 General transcription factor IIF, polypeptide 1, 74kDa GTF2F1 Hs.68257H14800 0.7234 2622 1 0.27 - - -H25007 0.5734 2624 1 0.73 - - Hs.188757R94555 0.8469 2624 -1 0.17 Collagen, type IV, alpha 2 COL4A2 Hs.75617R92201 0.9615 2625 1 0.13 Similar to RIKEN cDNA 1810055D05 LOC131118 Hs.349177W57807 0.7234 2627 1 0.3 Xylosylprotein beta1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I) B4GALT7 Hs.54702W31152 0.8596 2627 -1 0.27 Hypothetical protein MGC33177 DMR Hs.55209T97149 0.7969 2628 -1 0.2 KIAA1533 protein KIAA1533 Hs.83575N73731 0.8344 2628 1 0.33 ESTs ESTs Hs.269183H15212 0.44 2629 1 0.73 Transducer of ERBB2, 2 TOB2 Hs.4994H08264 0.9103 2629 -1 0.03 Splicing factor 3b, subunit 4, 49kDa SF3B4 Hs.25797AA005130 0.8596 2630 -1 0.2 Chromosome 7 open reading frame 2 C7orf2 Hs.107537N35502 0.6409 2631 -1 0.4 Hypothetical protein FLJ22626 FLJ22626 Hs.5565R36571 0.7355 2632 1 0.33 Neuroglobin NGB Hs.274363N89889 0.6641 2633 -1 0.33 - - -T84053 0.8093 2633 -1 0.33 WAS protein family, member 2 WASF2 Hs.288908W87414 0.541 2634 1 0.67 HLA-B associated transcript 1 BAT1 Hs.55296W31052 0.6876 2635 1 0.4 Hypothetical protein FLJ12592 FLJ12592 Hs.23100N35107 0.7114 2635 1 0.33 HSPC019 protein HSPC019 Hs.163724N93437 0.7477 2635 -1 0.47 Paired immunoglobulin-like receptor beta PILR(BETA) Hs.349256N46331 0.7599 2636 -1 0.27 KIAA0675 gene product KIAA0675 Hs.165662AA026354 0.9487 2636 0 0 - - -W74528 0.9615 2636 -1 0.17 Calcium channel, voltage-dependent, beta 1 subunit CACNB1 Hs.635R21449 0.5955 2637 -1 0.63 Heterogeneous nuclear ribonucleoprotein K HNRPK Hs.129548AA035448 0.6409 2637 -1 0.53 - - -R99867 0.618 2638 1 0.53 G protein-binding protein CRFG CRFG Hs.215766N21347 0.9872 2638 1 0.13 Hypothetical protein MGC31963 MGC31963 Hs.293984R66021 0.6758 2639 -1 0.47 - - Hs.378493R10692 0.7845 2639 -1 0.17 Hypothetical protein DKFZp762E1312 DKFZp762E1312Hs.104859N91376 0.8849 2639 -1 0.27 KIAA0247 gene product KIAA0247 Hs.82426N28519 0.9103 2640 1 0.13 Papillomavirus regulatory factor PRF-1 LOC55893 Hs.27410R82447 0.6294 2641 -1 0.6 E3 ubiquitin ligase SMURF1 SMURF1 Hs.119120H11041 0.7234 2641 1 0.2 Putative secreted protein ZSIG11 ZSIG11 Hs.279785N53706 0.6067 2643 -1 0.47 Zinc finger protein ZNF-U69274 Hs.301956H15055 0.6876 2644 -1 0.4 DNA segment, single copy probe LNS-CAI/LNS-CAII (deleted in polyposis D5S346 Hs.178112N25320 0.7355 2645 -1 0.4 Ceroid-lipofuscinosis, neuronal 6, late infantile, variant CLN6 Hs.43654H50403 0.5955 2646 1 0.57 Hypothetical protein FLJ20793 FLJ20793 Hs.96900N68917 0.8596 2646 1 0.13 P53 regulated PA26 nuclear protein PA26 Hs.14125AA054459 0.9359 2646 1 0.07 DKFZP564O1863 protein DKFZP564O186Hs.173074T79577 0.7969 2647 -1 0.07 KIAA0653 protein, B7-like protein B7H2 Hs.14155H19822 0.8596 2647 -1 0.1 Leucyl-tRNA synthetase, mitochondrial LARS2 Hs.2450R60660 0.7599 2648 1 0.2 ESTs ESTs Hs.116828H14054 0.8218 2648 1 0.27 Beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) B3GAT3 Hs.26492R22308 0.9103 2649 -1 0.13 Nuclear phosphoprotein similar to S. cerevisiae PWP1 PWP1 Hs.172589

AA033662 0.9615 2649 1 0.13 Jun dimerization protein 2 JDP2 Hs.154095N26998 0.6524 2650 -1 0.53 - - Hs.247240R71903 0.7845 2650 1 0.4 Pygopus 2 PYGO2 Hs.356579R88426 0.8469 2651 -1 0.27 Ran GTPase activating protein 1 RANGAP1 Hs.183800R48777 0.8218 2653 -1 0.27 S100 calcium binding protein A1 S100A1 Hs.292707R88135 0.8976 2653 -1 0.2 Ribonuclease P (30kD) RPP30 Hs.139120H47934 0.6758 2654 1 0.53 Hypothetical protein MGC12760 MGC12760 Hs.333402H77475 0.6409 2655 -1 0.53 - - Hs.13766AA034296 0.6524 2657 -1 0.4 - - Hs.288613N66544 0.6758 2657 -1 0.4 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 PSMD4 Hs.148495R14784 0.6995 2657 1 0.37 ESTs ESTs Hs.268773N67658 0.7114 2657 1 0.47 - - Hs.10949H82876 0.7355 2658 1 0.4 ESTs ESTs Hs.374415AA149810 0.9487 2658 0 0 Hypothetical protein MGC29463 MGC29463 Hs.6473W33123 0.8469 2659 1 0.27 ADP-ribosylation factor-like 3 ARL3 Hs.182215H99883 0.5955 2661 1 0.6 KIAA0828 protein KIAA0828 Hs.4984H89743 0.618 2661 -1 0.53 Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) LSS Hs.93199T85637 0.6409 2661 1 0.73 Hypothetical protein MGC10993 MGC10993 Hs.12199H45196 0.5844 2663 1 0.8 Rho/rac guanine nucleotide exchange factor (GEF) 2 ARHGEF2 Hs.337774T93907 0.618 2663 1 0.4 - - -AA098909 0.7969 2663 -1 0.23 KIAA0564 protein KIAA0564 Hs.151385W31173 0.5955 2664 1 0.6 Hypothetical protein FLJ10326 FLJ10326 Hs.262823N59843 0.6876 2664 -1 0.47 Hypothetical protein MGC2217 MGC2217 Hs.323164AA150265 0.7969 2664 -1 0.3 Reticulocalbin 1, EF-hand calcium binding domain RCN1 Hs.167791R80244 0.9103 2664 0 0 BTB and CNC homology 1, basic leucine zipper transcription factor 1 BACH1 Hs.154276H26015 0.8344 2665 1 0.3 ESTs ESTs Hs.372352N77915 0.9231 2666 -1 0.27 - - -R48321 0.6876 2667 -1 0.43 KIAA0450 gene product KIAA0450 Hs.170156H42375 0.6995 2667 1 0.57 Hypothetical protein FLJ10211 FLJ10211 Hs.380134R76960 0.7234 2667 1 0.4 Nei like 2 (E. coli) NEIL2 Hs.293818T93888 0.9231 2667 1 0.1 - - -R38371 0.9359 2667 -1 0.07 - - Hs.9691H90078 0.9743 2668 -1 0.07 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 ABCC5 Hs.108660R13247 0.6641 2669 1 0.47 Lysosomal-associated membrane protein 2 LAMP2 Hs.8262W52943 0.7599 2669 -1 0.23 Dudulin 2 FLJ10829 Hs.57655W32939 0.9743 2669 0 0 Zinc finger protein-like 1 ZFPL1 Hs.155165H62445 0.618 2671 -1 0.67 - - -H45175 0.6409 2672 1 0.47 Zinc finger protein 36, C3H type-like 1 ZFP36L1 Hs.85155R42549 0.8093 2672 1 0.27 Seizure related 6 homolog (mouse) SEZ6 Hs.21837R05747 0.8469 2672 -1 0.33 Ust3 ust3 Hs.19102AA028065 0.8722 2672 0 0 Zinc finger protein 36, C3H type-like 2 ZFP36L2 Hs.78909R85333 0.618 2673 1 0.73 - - Hs.373513R74405 0.6876 2673 1 0.47 - - Hs.185018AA147618 0.9103 2673 -1 0.07 - - Hs.71848AA069413 0.6995 2674 1 0.47 Hypothetical protein FLJ22709 FLJ22709 Hs.347130R81509 0.8218 2674 1 0.13 Splicing factor, arginine/serine-rich 11 SFRS11 Hs.11482AA146955 0.618 2675 -1 0.67 Hypothetical protein FLJ20519 FLJ20519 Hs.79457H23263 0.9487 2675 1 0.03 Spir-1 protein Spir-1 Hs.16758N48315 0.618 2676 -1 0.67 Hypothetical protein MGC2452 MGC2452 Hs.275711N29771 0.7114 2676 1 0.53 Three prime repair exonuclease 2 TREX2 Hs.251398R34109 0.7234 2676 1 0.33 Mitochondrial ribosomal protein L18 MRPL18 Hs.23038H16242 0.8344 2676 1 0.33 Serologically defined colon cancer antigen 16 SDCCAG16 Hs.271926N30606 0.6067 2677 1 0.5 Cyclin H CCNH Hs.514T78071 0.6641 2677 1 0.53 Hypothetical protein DKFZp667M2411 DKFZp667M241Hs.190488AA047760 0.6995 2677 -1 0.47 Phosphodiesterase 6G, cGMP-specific, rod, gamma PDE6G Hs.1857N33230 0.7722 2677 1 0.5 High-mobility group 20A HMG20A Hs.69594R97034 0.541 2678 -1 0.67 Serine hydroxymethyltransferase 1 (soluble) SHMT1 Hs.8889R25517 0.8093 2678 1 0.33 - - -W52394 0.9743 2679 -1 0.17 Activating transcription factor 4 (tax-responsive enhancer element B67) ATF4 Hs.181243N72694 0.6876 2680 1 0.3 - - -H47562 0.9359 2680 1 0.03 Mitochondrial ribosomal protein L11 MRPL11 Hs.152738N63997 0.5625 2681 -1 0.7 - - Hs.373497T77393 0.8849 2681 1 0.27 Hypothetical protein FLJ20297 FLJ20297 Hs.94491AA115252 0.5734 2682 -1 0.67 ESTs ESTs Hs.28805AA151307 0.9103 2682 1 0.07 Guanine nucleotide binding protein (G protein), beta polypeptide 2 GNB2 Hs.91299N27136 0.9103 2682 1 0.03 Karyopherin alpha 3 (importin alpha 4) KPNA3 Hs.3886R02725 0.9743 2682 0 0 Similar to TLH29 protein precursor LOC122509 Hs.19414R85986 0.6524 2683 1 0.47 - - -R12118 0.8093 2683 -1 0.27 Heparan sulfate 6-O-sulfotransferase 1 HS6ST1 Hs.6363H79411 0.8344 2684 0 0 CDC10 cell division cycle 10 homolog (S. cerevisiae) CDC10 Hs.184326AA046006 0.9487 2684 -1 0.1 - - Hs.271541AA011654 1 2684 -1 0.07 KIAA1458 protein KIAA1458 Hs.27263AA053137 0.8596 2686 1 0.07 Nasopharyngeal carcinoma susceptibility protein LZ16 Hs.42390H09083 0.9487 2686 0 0 TNF receptor-associated factor 2 TRAF2 Hs.373508W46374 0.7599 2687 -1 0.27 - - Hs.24435R64518 0.8596 2687 1 0.13 - - Hs.16979W42414 0.7722 2688 1 0.47 MAD, mothers against decapentaplegic homolog 3 (Drosophila) MADH3 Hs.288261H83414 0.5734 2689 1 0.8 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa NDUFB6 Hs.109646W78920 0.5955 2689 -1 0.6 DNA directed RNA polymerase II polypeptide J-related gene POLR2J2 Hs.375569R50785 0.6409 2689 1 0.4 Tubulin, gamma complex associated protein 6 TUBGCP6 Hs.336431AA137081 0.9103 2689 -1 0.13 Adaptor-related protein complex 1, mu 1 subunit AP1M1 Hs.3832H40871 0.5955 2690 1 0.73 Hypothetical protein MGC30022 MGC30022 Hs.179852AA025089 0.6067 2690 -1 0.67 Voltage-dependent anion channel 1 VDAC1 Hs.149155N63417 0.5517 2691 1 0.6 Beta-site APP-cleaving enzyme 2 BACE2 Hs.271411H16567 0.6524 2691 -1 0.6 Hypothetical protein FLJ20195 FLJ20195 Hs.286261H82877 0.8344 2691 1 0.2 Testes development-related NYD-SP21 NYD-SP21 Hs.28514H16544 0.8596 2691 1 0.13 Autocrine motility factor receptor AMFR Hs.80731W16436 0.6758 2692 -1 0.4 Protein kinase (cAMP-dependent, catalytic) inhibitor gamma PKIG Hs.3407H57134 0.8218 2693 -1 0.27 - - -AA029240 0.9743 2694 1 0.2 Ligase III, DNA, ATP-dependent LIG3 Hs.100299H49229 0.8218 2695 -1 0.27 Hypothetical protein FLJ20040 FLJ20040 Hs.61960W78857 0.6524 2696 1 0.47 - - Hs.339722R64104 0.9103 2696 1 0.2 - - -R66559 1 2696 -1 0.1 Nuclear receptor binding factor-2 NRBF-2 Hs.27181N48062 1 2696 -1 0.07 - - Hs.13809N54967 0.6995 2697 1 0.33 Hypothetical protein BM-002 BM-002 Hs.367646R10991 0.8849 2697 0 0 MAD2 mitotic arrest deficient-like 1 (yeast) MAD2L1 Hs.79078N48174 0.8469 2699 0 0 KIAA0332 protein KIAA0332 Hs.7976N51711 0.618 2700 1 0.63 Hypothetical protein DKFZp761D0614 DKFZp761D061 Hs.25320N75806 0.9231 2701 -1 0.07 ESTs ESTs Hs.109697

T79631 0.9359 2701 1 0.07 ESTs ESTs Hs.374458R18171 0.7355 2702 -1 0.3 Shroom-related protein ShrmL Hs.278628W23711 0.7355 2703 1 0.4 Core-binding factor, runt domain, alpha subunit 2; translocated to, 2 CBFA2T2 Hs.153934H08387 0.8469 2703 1 0.2 Ubiquitin specific protease 3 USP3 Hs.251636R00205 0.8976 2703 1 0.13 KIAA0595 protein KIAA0595 Hs.146957N70615 0.9743 2703 0 0 RAB40A, member RAS oncogene family RAB40A Hs.27453H10327 0.5517 2704 -1 0.67 - - Hs.374418R45617 0.6758 2704 1 0.6 DNA segment, single copy probe LNS-CAI/LNS-CAII (deleted in polyposis D5S346 Hs.178112H88042 0.7355 2704 -1 0.2 - - -R22600 0.8093 2704 1 0.13 Testis enhanced gene transcript (BAX inhibitor 1) TEGT Hs.74637R88526 0.7114 2705 1 0.43 Scotin SCOTIN Hs.24220W92517 0.6876 2706 -1 0.47 Actin binding LIM protein 1 ABLIM1 Hs.158203AA127641 0.7234 2706 -1 0.47 ESTs ESTs Hs.193657H79753 0.8722 2707 1 0.27 Death-associated protein DAP Hs.75189W01227 0.6294 2708 1 0.47 Hepatoma-derived growth factor (high-mobility group protein 1-like) HDGF Hs.89525AA054690 0.7355 2710 -1 0.47 Epithelial protein lost in neoplasm beta EPLIN Hs.10706N31020 0.9359 2710 -1 0.07 KIAA0102 gene product KIAA0102 Hs.77665N35485 0.8218 2711 1 0.4 MAD1 mitotic arrest deficient-like 1 (yeast) MAD1L1 Hs.7345R49920 0.8722 2713 -1 0.27 Pilin-like transcription factor PILB Hs.279754H21078 0.9231 2714 -1 0.2 Makorin, ring finger protein, 2 MKRN2 Hs.279474H53894 0.9743 2714 -1 0.07 Cyclin D-type binding-protein 1 CCNDBP1 Hs.36794N24593 0.9743 2714 -1 0.13 - - Hs.170538AA116112 0.9743 2716 0 0 Mitochondrial ribosomal protein L39 MRPL39 Hs.167130N32770 0.6758 2717 -1 0.47 Likely ortholog of mouse metal response element binding transcription factor 2 M96 Hs.31016N63640 0.7477 2718 -1 0.4 - - Hs.39911H73724 0.9487 2718 -1 0.2 Cyclin-dependent kinase 6 CDK6 Hs.38481AA135928 0.7355 2719 -1 0.4 Frequenin homolog (Drosophila) FREQ Hs.301760N93559 0.5844 2721 1 0.53 Tyrosine kinase 2 TYK2 Hs.75516H59174 0.6995 2721 1 0.47 Hypothetical protein MGC19556 MGC19556 Hs.334787W32156 0.7599 2721 1 0.47 Hypothetical protein MGC3329 MGC3329 Hs.25005N69471 0.9359 2722 0 0 Protein phosphatase 1, regulatory (inhibitor) subunit 11 PPP1R11 Hs.82887W60890 0.6758 2723 1 0.63 RAB2, member RAS oncogene family RAB2 Hs.78305AA115748 0.7477 2724 1 0.47 Interferon-related developmental regulator 1 IFRD1 Hs.7879W03106 0.7845 2724 -1 0.2 Mitogen-activated protein kinase kinase kinase kinase 5 MAP4K5 Hs.246970H45128 0.9615 2724 1 0.07 - - Hs.293441R99528 0.541 2725 1 0.67 UDP-glucuronate decarboxylase 1 UXS1 Hs.288158T86070 0.8722 2727 1 0.17 Myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila) MLL5 Hs.333300H91088 0.9359 2727 -1 0.17 - - -H78466 0.7234 2729 -1 0.4 Chromosome 4 open reading frame 1 C4orf1 Hs.270956H10406 0.8218 2729 -1 0.13 Profilin 2 PFN2 Hs.91747N30436 0.8849 2730 1 0.43 - - Hs.11556AA130374 0.6409 2732 -1 0.67 - - -AA036978 0.8849 2732 -1 0.07 Chromosome 20 open reading frame 27 C20orf27 Hs.274422N40633 0.5625 2733 -1 0.8 AD031 protein AD031 Hs.44004AA043987 0.6995 2733 1 0.53 Parvin, alpha PARVA Hs.44077N93576 0.7599 2733 -1 0.2 Hypothetical protein MGC2477 MGC2477 Hs.9061T97814 0.8344 2734 1 0.33 Arrestin, beta 2 ARRB2 Hs.18142R61384 0.5955 2738 -1 0.53 ATPase, Cu++ transporting, alpha polypeptide (Menkes syndrome) ATP7A Hs.606AA047424 0.8849 2738 -1 0.2 - - -H67332 0.9743 2738 1 0.13 GTP binding protein 1 GTPBP1 Hs.283677W15154 0.9487 2739 -1 0.4 - - -H39829 0.6758 2740 1 0.47 Protein kinase C-like 1 PRKCL1 Hs.2499H73128 0.9872 2740 1 0.07 Integrin, beta 5 ITGB5 Hs.149846AA037207 0.7845 2741 -1 0.33 KIAA1668 protein KIAA1668 Hs.8535W23818 0.8093 2742 1 0.4 Nm23-phosphorylated unknown substrate MGC15437 Hs.55067R19138 0.9359 2742 1 0.13 Activated p21cdc42Hs kinase ACK1 Hs.153937H93919 0.6067 2743 -1 0.67 Glutamate-cysteine ligase, catalytic subunit GCLC Hs.151393T51718 0.7234 2744 -1 0.33 Hypothetical protein FLJ13263 FLJ13263 Hs.288768N89673 0.9615 2744 0 0 Peroxisome proliferative activated receptor, gamma, coactivator 1 PPARGC1 Hs.198468AA136884 0.6067 2745 -1 0.57 Hypothetical protein FLJ21924 FLJ21924 Hs.143509N52493 0.7234 2745 1 0.6 Hypothetical protein FLJ21432 FLJ21432 Hs.334854N32330 0.7599 2745 1 0.3 DAZ associated protein 2 DAZAP2 Hs.75416R72173 0.8218 2745 1 0.4 - - -W37843 0.5096 2746 1 0.67 Vacuolar protein sorting 11 (yeast) VPS11 Hs.234282H00619 0.6409 2746 1 0.47 - - Hs.349261N50674 0.9743 2746 1 0.07 - - Hs.311051R52005 0.6995 2747 -1 0.47 Retinoblastoma-associated factor 600 RBAF600 Hs.297641AA147503 0.8093 2747 -1 0.27 Homolog of yeast ribosome biogenesis regulatory protein RRS1 RRS1 Hs.71827W72029 0.6876 2748 1 0.57 E2F transcription factor 1 E2F1 Hs.96055AA130140 0.8093 2748 -1 0.2 SnRNP assembly defective 1 homolog SAD1 Hs.12820N36071 0.8722 2748 -1 0.27 - - Hs.28890H04790 0.8722 2748 -1 0.17 KIAA1855 protein KIAA1855 Hs.343820R18812 0.9487 2748 1 0.2 Reticulon 1 RTN1 Hs.99947H29672 0.8722 2750 -1 0.2 Protein arginine N-methyltransferase 6 PRMT6 Hs.26006H38928 0.5844 2751 1 0.53 DKFZP566B183 protein DKFZP566B183 Hs.12305T66873 0.6524 2751 -1 0.6 26S proteasome-associated pad1 homolog POH1 Hs.178761AA045286 0.7477 2751 -1 0.37 Hypothetical protein FLJ10206 FLJ10206 Hs.55014R45115 0.9359 2752 -1 0.13 Thyroid hormone receptor interactor 12 TRIP12 Hs.138617AA044181 0.6758 2753 -1 0.47 Enabled homolog (Drosophila) ENAH Hs.14838W06830 0.8596 2753 -1 0.2 MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae) MCM5 Hs.77171T52361 0.8976 2753 1 0.07 DKFZP434P1750 protein DKFZP434P175 Hs.7274N62356 0.7969 2755 1 0.27 Eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa EIF2S1 Hs.151777AA027065 0.8093 2755 -1 0.4 LIS1-interacting protein NUDE1, rat homolog NUDE1 Hs.263925N45518 0.9359 2755 -1 0.07 NCK-associated protein 1 NCKAP1 Hs.278411W87505 0.7599 2757 1 0.27 CGI-62 protein LOC51101 Hs.118821T91049 0.9872 2757 0 0 - - -H00227 0.5955 2758 1 0.73 YY1 associated protein YAP Hs.18851T96994 0.8218 2759 1 0.33 - - Hs.17240N28653 0.8469 2760 -1 0.23 Cornichon-like CNIL Hs.201673AA011676 0.7114 2761 1 0.13 G protein-coupled receptor 44 GPR44 Hs.299567AA149278 0.9103 2761 -1 0.2 D15F37 (pseudogene) MN7 Hs.286132N72077 0.5625 2762 1 0.67 - - Hs.196716H91631 0.6876 2762 1 0.27 Hypothetical protein MGC15416 MGC15416 Hs.41514AA040920 0.8218 2764 1 0.43 Chromosome 3p21.1 gene sequence HUMAGCGB Hs.84162N73287 0.9743 2764 -1 0.07 Death-associated protein 6 DAXX Hs.336916AA039602 0.7969 2768 1 0.13 Hypothetical protein HSPC216 HSPC216 Hs.13525AA147535 0.8344 2768 -1 0.33 Retinoic acid induced 1 RAI1 Hs.110953T83097 0.8218 2770 -1 0.27 Hypothetical protein 384D8_6 384D8-2 Hs.180903R76797 0.8722 2770 1 0.2 Ubiquitin specific protease 21 USP21 Hs.8015N/A1 0.8849 2770 1 0.2 - - -

N66548 0.6409 2771 1 0.6 Stearoyl-CoA desaturase (delta-9-desaturase) SCD Hs.119597N35773 0.7355 2772 -1 0.27 Laminin, beta 1 LAMB1 Hs.82124N68307 0.8344 2772 -1 0.07 - - Hs.381077T81697 0.8596 2772 1 0.2 DKFZP434M154 protein DKFZP434M154Hs.154680R52852 0.8722 2772 1 0.13 - - Hs.355780T47536 0.9231 2772 -1 0.13 Hypothetical protein MGC16924 MGC16924 Hs.85752W58007 0.9359 2772 -1 0.27 KIAA0222 gene product KIAA0222 Hs.48450R17562 0.9359 2772 1 0.07 - - Hs.239666R54944 0.6409 2773 -1 0.53 Interleukin 18 binding protein IL18BP Hs.325978H25541 0.9359 2773 1 0.07 STRIN protein STRIN Hs.180403R50524 0.9487 2774 -1 0.2 Ferritin, heavy polypeptide 1 FTH1 Hs.62954N58885 0.6524 2775 1 0.47 - - -W04300 0.8344 2775 -1 0.27 Similar to hypothetical protein MGC13138 LOC146542 Hs.301463AA028143 0.7599 2778 1 0.5 Hypothetical protein FLJ22329 FLJ22329 Hs.367653H29296 0.7234 2779 -1 0.37 Development and differentiation enhancing factor 2 DDEF2 Hs.12802W95000 0.8218 2780 -1 0.4 Cell division cycle 25C CDC25C Hs.656W03130 0.8093 2781 -1 0.27 ESTs ESTs Hs.118191R27192 0.6641 2783 1 0.53 Putative intramembrane cleaving protease SPPL2A Hs.28980N56656 0.9231 2783 1 0.13 Highly charged protein D13S106E Hs.151236N20225 0.8093 2784 -1 0.2 Polymerase (RNA) II (DNA directed) polypeptide A, 220kDa POLR2A Hs.171880W92307 0.8093 2784 -1 0.2 Interleukin enhancer binding factor 2, 45kDa ILF2 Hs.75117T85305 0.9103 2785 -1 0.13 - - -N73706 0.8469 2786 -1 0.2 ESTs ESTs Hs.177366N92284 0.6876 2787 1 0.53 Phospholipid transfer protein PLTP Hs.283007R35343 0.9359 2787 -1 0.03 Hypothetical protein BC016683 LOC139231 Hs.24968AA010018 0.6876 2788 1 0.27 Hypothetical protein FLJ22353 FLJ22353 Hs.22157N43952 0.7114 2788 -1 0.27 - - Hs.236443N20054 0.7355 2788 -1 0.3 - - Hs.20325R31924 0.8344 2788 -1 0.2 Hepatoma-derived growth factor (high-mobility group protein 1-like) HDGF Hs.89525H58066 0.9487 2788 -1 0.07 HSPC037 protein LOC51659 Hs.108196N47180 0.9872 2789 -1 0.07 Membrane interacting protein of RGS16 MIR16 Hs.107014W52111 0.6294 2790 1 0.67 - - -R79550 0.7355 2790 1 0.4 Lysosomal-associated protein transmembrane 4 alpha LAPTM4A Hs.111894AA041284 0.8722 2790 -1 0.27 GDP dissociation inhibitor 1 GDI1 Hs.74576AA037618 0.9743 2790 1 0.1 - - Hs.109731AA045253 0.541 2792 1 0.67 ESTs ESTs Hs.161566T87589 0.6876 2792 1 0.6 Coagulation factor VIII-associated (intronic transcript) F8A Hs.83363AA156866 0.7969 2792 1 0.27 Uncharacterized bone marrow protein BM045 BM045 Hs.8750W85875 0.7477 2794 1 0.47 CHMP1.5 protein CHMP1.5 Hs.380932W87701 0.5844 2795 1 0.73 KIAA0981 protein KIAA0981 Hs.158135W56563 0.9487 2795 1 0.03 Mitochondrial ribosomal protein S28 MRPS28 Hs.55097N70558 0.6758 2796 -1 0.4 Potassium inwardly-rectifying channel, subfamily J, member 8 KCNJ8 Hs.102308AA213820 0.6758 2796 1 0.6 - - Hs.256533T97275 0.6876 2796 -1 0.33 Histone H2A.F/Z variant H2AV Hs.301005AA034006 0.9872 2796 -1 0.07 ESTs ESTs Hs.133537AA150683 0.9231 2797 0 0 Hypothetical protein FLJ10849 FLJ10849 Hs.8768AA115115 0.7722 2798 1 0.33 Pyruvate dehydrogenase (lipoamide) beta PDHB Hs.979H12016 0.8849 2798 1 0.27 Hypothetical protein FLJ21839 FLJ21839 Hs.348708R55733 0.8469 2799 -1 0.27 - - Hs.26454H50029 0.8596 2799 1 0.13 Ubiquitin-conjugating enzyme E2 variant 1 UBE2V1 Hs.75875T83125 0.9615 2801 -1 0.1 - - -AA046861 0.7234 2802 1 0.33 Procollagen C-endopeptidase enhancer PCOLCE Hs.202097R50087 0.9872 2802 0 0 GREB1 protein GREB1 Hs.193914R08828 0.6524 2804 -1 0.6 Pyruvate kinase, liver and RBC PKLR Hs.95990AA054497 0.8093 2804 0 0 AND-1 protein AND-1 Hs.72160T84334 0.8469 2804 1 0.27 Thymidine kinase 2, mitochondrial TK2 Hs.274701AA056650 0.7599 2805 1 0.27 - - Hs.380129AA142943 0.7234 2806 -1 0.4 Docking protein 1, 62kDa (downstream of tyrosine kinase 1) DOK1 Hs.103854R80193 0.6294 2808 1 0.53 Zinc finger protein 261 ZNF261 Hs.9568N75316 0.8469 2808 -1 0.13 DKFZP727C091 protein DKFZP727C091Hs.43141R20006 0.7355 2809 1 0.4 ESTs ESTs Hs.12899H81249 0.8849 2809 1 0.17 - - -AA057261 0.6524 2810 -1 0.4 KIAA0240 protein KIAA0240 Hs.196275H12628 0.6641 2811 1 0.47 KIAA1237 protein KIAA1237 Hs.10491H37900 0.7355 2811 1 0.53 Rhodopsin (opsin 2, rod pigment) (retinitis pigmentosa 4, autosomal dominant) RHO Hs.247565AA131823 0.7969 2811 -1 0.27 - - Hs.272198H18946 0.8344 2811 1 0.27 Leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 LILRB2 Hs.22405R13172 0.6995 2812 1 0.37 Nuclear receptor co-repressor 1 NCOR1 Hs.144904H13238 0.8976 2812 1 0.2 B-cell CLL/lymphoma 3 BCL3 Hs.31210R22985 0.7599 2815 -1 0.33 RCD1 required for cell differentiation1 homolog (S. pombe) RQCD1 Hs.293687N73289 0.8976 2815 1 0.13 - - -H51489 0.9615 2815 -1 0.2 Plexin B3 PLXNB3 Hs.380742T81049 0.6995 2816 -1 0.6 Ubinuclein 1 UBN1 Hs.21479R50656 0.7969 2816 1 0.33 Protein phosphatase 1, regulatory (inhibitor) subunit 12C PPP1R12C Hs.235975N33054 0.6876 2817 -1 0.23 - - Hs.339654H03490 0.8722 2817 -1 0.27 Hypothetical protein FLJ10563 FLJ10563 Hs.265960R98556 0.9615 2818 -1 0.03 Cytochrome b-5 CYB5 Hs.83834N47247 0.7845 2819 -1 0.33 - - -AA057856 0.8722 2819 -1 0.1 ESTs ESTs Hs.63344R11847 0.6409 2820 1 0.87 - - -R22957 0.6641 2820 1 0.47 Hypothetical protein PP1628 PP1628 Hs.7159N57515 0.6876 2821 1 0.47 - - Hs.46627AA040149 0.7355 2821 1 0.33 - - Hs.348989H47418 0.6995 2824 -1 0.47 - - -R69789 0.8469 2824 -1 0.07 Hypothetical protein MGC4701 MGC4701 Hs.116771W05039 0.6995 2825 1 0.2 HLA class II region expressed gene KE2 HKE2 Hs.356468AA069532 0.7722 2825 -1 0.27 - - Hs.287955R98467 0.8722 2825 1 0.13 Hypothetical protein FLJ14668 FLJ14668 Hs.334644W90103 0.6876 2826 -1 0.67 Heterogeneous nuclear ribonucleoprotein A1 HNRPA1 Hs.249495AA156867 0.8093 2826 1 0.23 WW domain-containing protein 1 WWP1 Hs.355977H06932 0.8093 2827 -1 0.13 Mitochondrial ribosomal protein L20 MRPL20 Hs.182698H18310 0.9231 2827 1 0.07 Ecotropic viral integration site 5 EVI5 Hs.179747R61624 0.7599 2828 1 0.53 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 35 DDX35 Hs.7174T66845 0.7969 2828 1 0.47 Tax interaction protein 1 TIP-1 Hs.12956H50385 0.8344 2828 1 0.27 Calsenilin, presenilin binding protein, EF hand transcription factor CSEN Hs.13228H26401 0.6409 2829 1 0.67 Serine/arginine repetitive matrix 2 SRRM2 Hs.197114N26050 0.7599 2829 -1 0.5 Polymyositis/scleroderma autoantigen 1, 75kDa PMSCL1 Hs.91728H50621 0.9487 2830 -1 0.03 - - Hs.71523N74558 0.7599 2831 -1 0.53 Suppression of tumorigenicity 7 ST7 Hs.5814N51083 0.7234 2832 1 0.4 Hypothetical protein FLJ11159 FLJ11159 Hs.27021

R67127 0.8469 2833 1 0.2 Hypothetical protein FLJ12666 FLJ12666 Hs.23767AA126874 0.9487 2833 0 0 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide YWHAH Hs.349530N33237 0.6876 2835 1 0.43 Processing of precursors 1 POP1 Hs.170114W01923 0.7477 2835 1 0.47 A kinase (PRKA) anchor protein 2 AKAP2 Hs.42322R55296 0.7969 2836 1 0.47 Promyelocytic leukemia PML Hs.89633AA010929 0.9743 2836 -1 0.03 N-methylpurine-DNA glycosylase MPG Hs.79396W58638 0.9872 2836 1 0.13 - - -AA053216 0.8596 2837 -1 0.07 Zinc finger protein 363 ZNF363 Hs.48297AA055757 0.5955 2838 -1 0.67 Cysteine and glycine-rich protein 2 CSRP2 Hs.10526H96198 0.6758 2839 -1 0.47 Heterogeneous nuclear ribonucleoprotein H1 (H) HNRPH1 Hs.245710N90919 0.7845 2839 -1 0.4 - - -W51783 0.8849 2840 0 0 Argininosuccinate lyase ASL Hs.61258T99307 0.7355 2842 -1 0.5 Zinc finger protein 384 ZNF384 Hs.103315N21520 0.9743 2842 1 0.07 Hypothetical protein BC008632 LOC90632 Hs.31917R23635 0.7114 2843 -1 0.43 - - -H51376 0.8722 2843 1 0.33 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 PSMD11 Hs.90744H43546 0.8976 2843 1 0.2 ESTs ESTs Hs.30258W94575 0.8976 2845 -1 0.1 Cathepsin H CTSH Hs.288181AA035135 0.6758 2846 1 0.3 - - -W72933 0.8976 2846 -1 0.2 Splicing factor, arginine/serine-rich 1 (splicing factor 2, alternate splicing factor) SFRS1 Hs.73737R95735 0.7355 2847 -1 0.47 Hypothetical protein FLJ25804 FLJ25804 Hs.373547H57851 0.7599 2847 1 0.27 Homo sapiens, clone MGC:29471 IMAGE:4329216, mRNA, complete cds RAB24 Hs.16258H09667 0.7234 2848 1 0.43 - - -H12586 0.9359 2848 -1 0.07 Nuclear cap binding protein subunit 1, 80kDa NCBP1 Hs.89563AA203304 0.9872 2849 -1 0.2 CGI-130 protein LOC51020 Hs.32826AA045081 0.7355 2851 1 0.43 Hypothetical protein FLJ21742 FLJ21742 Hs.306809AA064765 0.8976 2851 -1 0.23 Chromosome 11 hypothetical protein ORF3 LOC56851 Hs.4245N57339 0.7114 2852 1 0.27 Hypothetical protein FLJ11240 FLJ11240 Hs.339833N44917 0.9743 2853 -1 0.03 - - Hs.324504N94435 0.5734 2855 1 0.83 LYST-interacting protein LIP8 LIP8 Hs.348012R65812 0.8469 2855 -1 0.2 Enabled homolog (Drosophila) ENAH Hs.14838N66159 0.5844 2856 1 0.73 Cytochrome c oxidase subunit VIc COX6C Hs.351875W39250 0.7234 2856 1 0.53 Hairy homolog (Drosophila) HRY Hs.250666N26062 0.7234 2856 1 0.4 WD40 protein Ciao1 CIAO1 Hs.12109R12657 0.9103 2856 1 0.07 Platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa PAFAH1B3 Hs.6793R20746 0.9359 2856 -1 0.1 Chloride channel 7 CLCN7 Hs.80768N29672 0.8218 2857 -1 0.33 V-fos FBJ murine osteosarcoma viral oncogene homolog FOS Hs.25647N93133 0.8344 2857 1 0.2 Promyelocytic leukemia PML Hs.89633N78868 0.7969 2858 -1 0.27 KIAA1049 protein KIAA1049 Hs.227835AA193555 0.8218 2858 1 0.33 - - Hs.365589N36089 0.8849 2858 -1 0.07 Yes-associated protein 1, 65kDa YAP1 Hs.84520T83773 0.8218 2859 -1 0.2 Hypothetical protein HSPC216 HSPC216 Hs.13525H93830 0.9231 2859 -1 0.13 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 ATP5G1 Hs.80986AA036785 0.6995 2860 -1 0.3 N-myristoyltransferase 2 NMT2 Hs.122647R88064 0.7234 2860 1 0.4 Transcription factor-like 1 TCFL1 Hs.2430N21286 0.8596 2860 -1 0.33 - - -R06175 0.8093 2861 -1 0.47 BCL2/adenovirus E1B 19kDa interacting protein 3 BNIP3 Hs.79428R36140 0.5734 2862 -1 0.73 - - -AA149634 0.8218 2863 1 0.33 - - Hs.182545T93849 0.8976 2864 -1 0.13 Zinc finger protein 185 (LIM domain) ZNF185 Hs.16622AA149232 0.7114 2865 -1 0.53 - - Hs.103411AA055185 0.8849 2866 -1 0.27 Splicing factor, arginine/serine-rich 4 SFRS4 Hs.76122W39328 0.7845 2867 -1 0.33 Hypothetical transmembrane protein SBBI54 SBBI54 Hs.116708T83291 0.8849 2867 1 0.07 ESTs ESTs Hs.220624N90643 0.7234 2868 1 0.33 Membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen) MCP Hs.83532N24957 0.8218 2868 -1 0.13 Chromosome 21 open reading frame 6 C21orf6 Hs.34136R89801 0.7599 2870 1 0.33 Hypothetical protein BC001584 LOC124245 Hs.93670W02088 0.7722 2870 1 0.33 - - -H49993 0.8469 2871 1 0.13 Neuron navigator 2 NAV2 Hs.23467T51710 0.9487 2871 -1 0.23 Endoglin (Osler-Rendu-Weber syndrome 1) ENG Hs.76753H87240 0.9487 2874 1 0.13 Neural precursor cell expressed, developmentally down-regulated 8 NEDD8 Hs.75512R71155 0.9615 2874 0 0 RalA binding protein 1 RALBP1 Hs.75447H45746 0.6995 2875 -1 0.47 - - -W40184 0.8849 2875 1 0.3 Solute carrier family 25 (mitochondrial carrier, Aralar), member 12 SLC25A12 Hs.179866N50057 0.8976 2875 -1 0.13 Cytokine induced protein 29 kDa CIP29 Hs.63908AA039862 0.8976 2875 1 0.13 MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein MCM3AP Hs.168481R90757 0.9231 2875 -1 0.1 Likely ortholog of mouse rabphilin 3A RPH3A Hs.21239N22715 0.9615 2875 0 0 Glutathione peroxidase 4 (phospholipid hydroperoxidase) GPX4 Hs.2706R71264 0.7114 2876 -1 0.53 - - Hs.16798R17859 0.7969 2876 1 0.2 DKFZP434C131 protein DKFZP434C131Hs.7978W78946 0.8722 2876 1 0.17 Electron-transfer-flavoprotein, alpha polypeptide (glutaric aciduria II) ETFA Hs.169919W47132 0.8849 2876 -1 0.07 Amyotrophic lateral sclerosis 2 (juvenile) ALS2 Hs.27669N20261 0.9872 2876 -1 0.13 - - Hs.26418R18594 0.8722 2877 -1 0.33 Hypothetical protein MGC2817 MGC2817 Hs.159406AA149643 0.9103 2877 1 0.07 Egl nine homolog 1 (C. elegans) EGLN1 Hs.6523H95396 0.6995 2878 1 0.53 Elongation factor-2 kinase EEF2K Hs.259855H87107 0.8344 2879 -1 0.37 Ring finger protein 5 RNF5 Hs.216354R71048 0.6641 2880 1 0.6 Glycolipid transfer protein GLTP Hs.381256H47578 0.6524 2881 -1 0.47 Ring finger protein 34 RNF34 Hs.316809AA101787 0.6641 2881 1 0.53 Hypothetical protein FLJ20442 FLJ20442 Hs.55505R25268 0.8976 2882 1 0.27 Uracil-DNA glycosylase UNG Hs.78853N20844 0.9872 2882 1 0.07 Heat shock 70kDa protein 1A HSPA1A Hs.8997N30286 0.6995 2883 -1 0.53 DKFZP564A043 protein DKFZP564A043 Hs.271623R47739 0.8093 2883 -1 0.13 KIAA1332 protein KIAA1332 Hs.62767R22272 0.6294 2884 1 0.73 ESTs ESTs Hs.355658H11639 0.8596 2884 1 0.33 SH2-B homolog SH2B Hs.15744AA136692 0.7845 2885 1 0.33 Transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) TLE3 Hs.287362R01143 0.9872 2885 1 0.07 Solute carrier family 35 (UDP-galactose transporter), member 2 SLC35A2 Hs.21899R70183 0.8218 2887 1 0.13 Nuclear receptor coactivator 6 interacting protein NCOA6IP Hs.179909H14586 0.9231 2887 0 0 - - -T83745 0.9487 2887 1 0.13 Polymerase (RNA) II (DNA directed) polypeptide D POLR2D Hs.194638W80603 0.8093 2889 -1 0.47 - - Hs.380051R80399 0.8849 2889 1 0.27 Dishevelled, dsh homolog 3 (Drosophila) DVL3 Hs.174044AA134572 0.6995 2890 -1 0.53 - - -AA001326 0.7845 2890 -1 0.2 Ariadne homolog 2 (Drosophila) ARIH2 Hs.241558AA142976 0.9743 2890 -1 0.1 - - Hs.177781N54249 0.9487 2891 -1 0.2 - - -R79034 0.7599 2893 -1 0.43 - - Hs.79204AA028907 0.9231 2893 1 0.07 - - Hs.34447W90498 0.7234 2894 -1 0.53 Sjogren syndrome antigen B (autoantigen La) SSB Hs.83715

R54439 0.7477 2895 -1 0.4 ESTs ESTs Hs.26119N59805 0.9231 2898 -1 0.07 Cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa CSTF1 Hs.172865R18971 0.6995 2899 1 0.4 Hypothetical protein DKFZp586I021 DKFZp586I021 Hs.181077R76505 0.8976 2899 1 0.2 - - Hs.325825AA037661 0.7477 2901 -1 0.6 - - -H11855 0.8093 2902 -1 0.27 ELK1, member of ETS oncogene family ELK1 Hs.181128H66467 0.8218 2902 -1 0.27 F-box only protein 8 FBXO8 Hs.76917AA045318 0.6641 2903 -1 0.7 Holocytochrome c synthase (cytochrome c heme-lyase) HCCS Hs.211571H30899 0.8093 2903 1 0.37 - - -N91912 0.6294 2904 1 0.6 Phospholipase A2, group XII PLA2G12 Hs.25206N33087 0.6641 2904 1 0.47 Myosin regulatory light chain interacting protein MIR Hs.20072AA045732 0.7722 2904 1 0.2 LOC147184 LOC147184 Hs.13740T84134 0.9103 2904 1 0.07 Hydroxymethylbilane synthase HMBS Hs.82609N49737 0.9487 2904 -1 0.1 DKFZp434K114 protein DKFZp434K114 Hs.6107N36881 0.9231 2906 -1 0.3 Hypothetical protein FLJ38968 FLJ38968 Hs.356496H96724 0.618 2907 1 0.73 Disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) DAB2 Hs.81988AA121546 0.7969 2907 1 0.13 Hypothetical protein PRO0971 PRO0971 Hs.152316R71483 0.6409 2908 1 0.6 Transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) TFAP2A Hs.334334N95764 0.8469 2908 1 0.33 Chromosome 20 open reading frame 77 C20orf77 Hs.27192AA034388 0.8344 2909 1 0.33 Sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphor SEMA4B Hs.9598N62067 0.9487 2909 -1 0.03 IQ motif containing GTPase activating protein 1 IQGAP1 Hs.1742N41539 0.9743 2910 1 0.13 Sp1 transcription factor SP1 Hs.2021N26672 0.7722 2911 1 0.33 CD83 antigen (activated B lymphocytes, immunoglobulin superfamily) CD83 Hs.79197AA115560 0.8093 2911 -1 0.17 - - Hs.63368N20098 0.8722 2911 1 0.07 CD151 antigen CD151 Hs.75564N62554 0.9487 2911 -1 0.07 Hypothetical protein FLJ39514 FLJ39514 Hs.48565N69121 0.9231 2912 0 0 HSPC159 protein HSPC159 Hs.372208R96346 0.9487 2912 1 0.17 - - Hs.374127AA043812 0.8344 2913 -1 0.27 Sentrin/SUMO-specific protease SENP1 Hs.66450R45007 0.9231 2913 -1 0.23 Adaptor-related protein complex 3, delta 1 subunit AP3D1 Hs.75056T96991 0.9103 2914 -1 0.13 Thioredoxin reductase 1 TXNRD1 Hs.13046R56894 0.8218 2915 -1 0.2 ESTs ESTs Hs.26010R51985 0.7599 2916 1 0.27 Uncharacterized hypothalamus protein HT008 HT008 Hs.16206W84774 1 2916 -1 0.07 - - Hs.17643N21080 0.7599 2917 -1 0.2 PAX transcription activation domain interacting protein 1 like PAXIP1L Hs.173854R96651 0.8596 2917 -1 0.2 ATX1 antioxidant protein 1 homolog (yeast) ATOX1 Hs.279910N29418 0.8976 2917 1 0.07 - - Hs.44024W56823 0.6995 2918 -1 0.33 Paired basic amino acid cleaving enzyme (furin, membrane associated receptor protein) PACE Hs.59242AA004891 0.7355 2920 1 0.53 Ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) UBE2H Hs.372758N30185 0.8849 2920 1 0.07 Hypothetical protein FLJ11252 FLJ11252 Hs.23495H79188 0.7599 2922 -1 0.33 Excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum DERCC2 Hs.99987T92329 0.7599 2925 -1 0.07 - - Hs.193969T99317 0.8469 2926 -1 0.2 - - Hs.5250R18757 0.8596 2926 -1 0.33 - - Hs.13702H90824 0.9615 2926 1 0.03 Sec23 homolog A (S. cerevisiae) SEC23A Hs.272927H65168 0.9615 2926 -1 0.33 Solute carrier family 12 (sodium/potassium/chloride transporters), member 2 SLC12A2 Hs.110736R16206 1 2926 1 0.13 - - -AA054551 0.7845 2928 1 0.37 - - -AA047406 0.9615 2930 1 0.07 Translocase of outer mitochondrial membrane 70 homolog A (yeast) TOMM70A Hs.21198W85779 0.6876 2932 -1 0.6 Zinc finger protein 133 (clone pHZ-13) ZNF133 Hs.78434AA040123 0.8849 2932 1 0.27 Solute carrier family 27 (fatty acid transporter), member 4 SLC27A4 Hs.248953N25873 0.9359 2933 1 0.07 Chromosome 20 open reading frame 36 C20orf36 Hs.184628AA001216 0.7722 2934 1 0.2 Paxillin PXN Hs.102497R86031 0.9231 2934 -1 0.07 Hypothetical protein FLJ22060 FLJ22060 Hs.29403N51785 0.9615 2934 0 0 - - Hs.380911AA039738 0.8218 2935 -1 0.33 KIAA0697 protein KIAA0697 Hs.12329W21604 0.7969 2936 1 0.33 Novel putative protein similar to YIL091C yeast hypothetical 84 kD protein from SGA1-KTR7 DJ434O14.5 Hs.194754N24561 0.9743 2936 -1 0.13 - - Hs.290880T92003 0.8722 2937 -1 0.33 - - -N39446 0.8093 2938 -1 0.33 E1A binding protein p300 EP300 Hs.25272T87532 0.9487 2938 -1 0.1 ESTs ESTs Hs.10739H20790 0.7477 2939 1 0.2 - - Hs.352590AA069271 0.6067 2940 -1 0.7 IK cytokine, down-regulator of HLA II IK Hs.8024AA045281 0.8722 2940 1 0.17 Phosphoprotein associated with glycosphingolipid-enriched microdomains PAG Hs.266175AA135332 0.7722 2941 -1 0.33 ESTs ESTs Hs.71608R67214 0.8218 2941 -1 0.17 MAD, mothers against decapentaplegic homolog 4 (Drosophila) MADH4 Hs.75862R28340 0.9615 2941 -1 0.07 MYC-associated zinc finger protein (purine-binding transcription factor) MAZ Hs.7647R72784 0.8976 2943 1 0.33 Cysteinyl-tRNA synthetase CARS Hs.159604H40716 0.7114 2944 1 0.67 ESTs ESTs Hs.121518AA029551 0.7599 2944 -1 0.47 ESTs ESTs Hs.61373W68734 0.9231 2945 1 0.2 Uncharacterized hematopoietic stem/progenitor cells protein MDS028 MDS028 Hs.29647AA194896 0.9231 2945 1 0.2 Peroxisomal membrane protein 3, 35kDa (Zellweger syndrome) PXMP3 Hs.180612H62739 0.7845 2946 1 0.5 - - Hs.14824R20853 0.8722 2946 -1 0.23 KIAA1320 protein KIAA1320 Hs.117414R88266 0.9231 2946 -1 0.07 Glutamate receptor, ionotropic, N-methyl D-aspartate 1 GRIN1 Hs.105AA194047 0.7114 2948 1 0.47 Mitogen-activated protein kinase kinase 7 MAP2K7 Hs.110299R39875 1 2948 0 0 - - -AA045734 0.6876 2950 1 0.6 GS15 LOC51272 Hs.300631R22511 0.7355 2950 -1 0.4 LAG1 longevity assurance homolog 2 (S. cerevisiae) LASS2 Hs.285976H87111 0.7845 2952 1 0.3 Hypothetical protein FLJ11011 FLJ11011 Hs.21275N44758 0.8093 2954 -1 0.33 KIAA1036 protein KIAA1036 Hs.155182AA151305 0.9872 2954 1 0.07 DNA directed RNA polymerase II polypeptide J-related gene POLR2J2 Hs.375569H75644 0.8596 2956 -1 0.17 Hypothetical protein BC016005 LOC129642 Hs.356547AA047130 0.9743 2957 -1 0.07 - - -N58356 0.9743 2957 -1 0.13 HSPC009 protein HSPC009 Hs.16059AA026571 0.6995 2958 -1 0.47 Hypothetical protein FLJ21415 FLJ21415 Hs.120170H28503 0.6995 2958 1 0.5 - - -AA011675 0.8849 2958 1 0.23 Adaptor-related protein complex 1, sigma 1 subunit AP1S1 Hs.57600T84975 0.9872 2958 -1 0.03 TRAF4 associated factor 1 FLJ14502 Hs.181466T86612 0.9743 2959 -1 0.07 ESTs ESTs Hs.16228N48306 0.8976 2960 -1 0.2 PC4 and SFRS1 interacting protein 2 PSIP2 Hs.82110AA010162 0.6876 2961 -1 0.53 Frizzled homolog 1 (Drosophila) FZD1 Hs.94234AA035519 0.7355 2961 -1 0.33 Chromosome 2 open reading frame 3 C2orf3 Hs.184175N71041 0.8976 2961 1 0.2 RNA polymerase I 16 kDa subunit LOC51082 Hs.106127T81175 0.7845 2962 1 0.33 - - Hs.355957W56002 0.7969 2962 0 0 Acetyl-Coenzyme A acyltransferase 1 (peroxisomal 3-oxoacyl-Coenzyme A thiolase) ACAA1 Hs.166160R74460 0.7722 2963 1 0.47 CGI-45 protein LOC51094 Hs.5298H23260 0.6409 2964 1 0.67 NDRG family member 3 NDRG3 Hs.355855N62518 0.8849 2964 1 0.07 CD22 antigen CD22 Hs.171763W90588 0.9872 2964 1 0.07 Synaptogyrin 1 SYNGR1 Hs.6139

H41939 0.8093 2966 1 0.33 Discoidin domain receptor family, member 1 DDR1 Hs.75562R25121 0.8976 2966 -1 0.23 Uncharacterized hypothalamus protein HCDASE LOC55862 Hs.239218H01569 0.8976 2968 1 0.13 ESTs ESTs Hs.30237AA053136 0.8722 2970 -1 0.27 KIAA1982 protein KIAA1982 Hs.22969N76293 0.9103 2970 1 0.27 Diaphanous homolog 1 (Drosophila) DIAPH1 Hs.26584W78864 0.9872 2970 -1 0.2 Mouse Mammary Turmor Virus Receptor homolog 1 MTVR1 Hs.18686H77388 0.8344 2971 -1 0.33 - - Hs.356560AA047077 1 2971 -1 0.27 Amylase, alpha 2B; pancreatic AMY2B Hs.335493H89087 0.8218 2973 1 0.13 - - -H83499 0.9359 2974 -1 0.4 Endothelin converting enzyme 1 ECE1 Hs.288203AA033871 0.9487 2974 1 0.03 Methionine adenosyltransferase II, alpha MAT2A Hs.77502T96595 0.9872 2975 1 0.07 ESTs ESTs Hs.302270R92361 0.9359 2976 1 0.07 ESTs ESTs Hs.34576H39075 0.9231 2978 1 0.17 Calcium/calmodulin-dependent protein kinase kinase 2, beta CAMKK2 Hs.108708AA045470 0.8849 2980 1 0.27 Keratin 10 (epidermolytic hyperkeratosis; keratosis palmaris et plantaris) KRT10 Hs.99936N45602 0.7114 2981 -1 0.4 - - Hs.250824R12426 0.8093 2981 1 0.27 - - -N70267 0.7477 2982 -1 0.33 Integral membrane protein 2B ITM2B Hs.239625H49485 0.7114 2983 -1 0.57 Cytochrome c oxidase subunit VIIb COX7B Hs.75752T95320 0.8344 2985 1 0.27 ESTs ESTs Hs.90953R99052 0.7845 2986 -1 0.33 Biliverdin reductase B (flavin reductase (NADPH)) BLVRB Hs.76289N69648 0.9872 2986 -1 0.07 - - Hs.269135W92124 0.9359 2987 1 0.2 Hypothetical protein MGC12981 MGC12981 Hs.104203R11709 0.8093 2988 -1 0.23 Fatty-acid-Coenzyme A ligase, long-chain 6 FACL6 Hs.14945W47372 0.9743 2989 -1 0.1 Zinc finger protein 36, C3H type-like 2 ZFP36L2 Hs.78909H02835 0.8344 2990 1 0.13 G1 to S phase transition 1 GSPT1 Hs.2707H49493 0.7722 2991 -1 0.07 - - -AA047053 0.8976 2991 -1 0.03 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2 ATP6V1B2 Hs.1697H62940 0.8596 2992 1 0.33 - - -N24725 0.5844 2993 1 0.87 Small nuclear ribonucleoprotein polypeptide B'' SNRPB2 Hs.82575R02110 0.7234 2994 1 0.53 XPMC2 protein LOC57109 Hs.235376H59207 0.9103 2994 1 0.2 SudD suppressor of bimD6 homolog (A. nidulans) SUDD Hs.209061N36412 0.8596 2995 -1 0.13 Dynein, cytoplasmic, light intermediate polypeptide 2 DNCLI2 Hs.194625W94862 0.9487 2995 1 0.07 Adenosine deaminase, RNA-specific ADAR Hs.7957R54646 0.7114 2996 -1 0.53 F-box and leucine-rich repeat protein 6 FBXL6 Hs.12271AA011565 0.9359 2996 1 0.13 Squamous cell carcinoma antigen recognised by T cells 3 SART3 Hs.116875R76996 0.7355 2997 -1 0.5 Lamin B receptor LBR Hs.152931N40607 0.7477 2998 -1 0.33 Alpha2,3-sialyltransferase ST3GALVI Hs.34578R16440 0.7969 2998 -1 0.33 AD024 protein AD024 Hs.21137T83266 0.7355 3000 1 0.43 Tetraspan 3 TSPAN-3 Hs.100090W85949 0.8976 3000 1 0.07 - - Hs.339808N48314 0.8976 3000 -1 0.07 Hermansky-Pudlak syndrome 4 HPS4 Hs.6657H19104 0.7722 3001 1 0.3 - - Hs.23406R10029 0.7845 3001 1 0.4 ESTs ESTs Hs.20516AA136788 0.9487 3001 0 0 - - -N48895 0.7114 3002 -1 0.53 F-box DNA helicase 1 FBH1 Hs.6193N63284 0.6524 3005 -1 0.6 Putative protein O-mannosyltransferase POMT2 Hs.132989H20004 0.8469 3005 -1 0.27 WD repeat domain 8 WDR8 Hs.31714H11243 0.8469 3007 1 0.4 Bromodomain containing 1 BRD1 Hs.127950R45475 0.8469 3007 1 0.13 Phosphodiesterase 8B PDE8B Hs.78106N39255 0.6876 3009 1 0.6 Butyrophilin, subfamily 3, member A2 BTN3A2 Hs.87497AA005268 0.6876 3011 -1 0.6 Chromosome 21 open reading frame 91 C21orf91 Hs.49391AA131302 0.7477 3011 -1 0.47 - - Hs.71404H50895 0.7599 3011 1 0.6 Microtubule-associated protein 4 MAP4 Hs.239298AA005195 0.8093 3011 1 0.13 Serine/threonine kinase 36 (fused homolog, Drosophila) STK36 Hs.26996AA045063 0.8344 3013 -1 0.07 Presenilin 2 (Alzheimer disease 4) PSEN2 Hs.25363R93490 0.8469 3013 1 0.2 Cleavage and polyadenylation specific factor 4, 30kDa CPSF4 Hs.6351W68077 0.8218 3014 1 0.47 Single-stranded DNA binding protein SSBP1 Hs.923R63807 0.7722 3015 1 0.4 CGI-85 protein CGI-85 Hs.267448AA034995 0.6294 3016 1 0.53 ESTs ESTs Hs.293819R38638 0.8849 3016 1 0.27 - - Hs.5064W93811 0.9231 3016 -1 0.07 Killer cell lectin-like receptor subfamily B, member 1 KLRB1 Hs.169824W17370 0.7845 3018 1 0.4 Mitochondrial elongation factor G EFG1 Hs.274543R93735 0.8093 3019 -1 0.33 ESTs ESTs Hs.35193W05091 0.8344 3019 -1 0.33 Wilms' tumour 1-associating protein WTAP Hs.119R59179 0.7599 3020 1 0.43 Nucleolar protein 3 (apoptosis repressor with CARD domain) NOL3 Hs.278439R95136 0.7599 3023 1 0.5 - - -T83467 0.9872 3023 -1 0.13 Inositol 1,4,5-trisphosphate 3-kinase B ITPKB Hs.78877N29558 0.7845 3024 -1 0.4 - - Hs.293865R01798 0.7845 3026 1 0.27 LATS, large tumor suppressor, homolog 2 (Drosophila) LATS2 Hs.19074N42817 0.6995 3028 -1 0.4 Cytochrome c oxidase subunit VIc COX6C Hs.351875R09452 0.7355 3028 -1 0.53 Hypothetical protein FLJ10460 FLJ10460 Hs.14347N59563 0.8218 3028 1 0.07 Cyclin D-type binding-protein 1 CCNDBP1 Hs.36794H10407 0.8722 3029 1 0.27 KIAA0515 protein KIAA0515 Hs.108945AA026250 0.8469 3031 1 0.27 - - -R71120 0.7234 3032 -1 0.33 KIAA0831 protein KIAA0831 Hs.103000R28033 0.9231 3032 -1 0.2 Protein tyrosine phosphatase, non-receptor type 18 (brain-derived) PTPN18 Hs.278597H80498 0.9743 3032 -1 0.2 KIAA0286 protein KIAA0286 Hs.14912W16435 0.7114 3034 -1 0.37 PXR2b protein PXR2b Hs.46780W45538 0.8849 3034 1 0.27 KIAA0062 protein KIAA0062 Hs.89868H18558 0.6758 3036 1 0.47 Transcription factor A, mitochondrial TFAM Hs.75133H28623 0.5517 3037 1 0.87 Cellular repressor of E1A-stimulated genes CREG Hs.5710N68460 0.7845 3037 1 0.2 - - Hs.27038AA040028 0.8093 3038 1 0.47 Hypothetical protein BC014641 LOC129138 Hs.135259T74462 0.7969 3040 1 0.33 Transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) TAP1 Hs.352018AA045741 0.7477 3041 1 0.47 Hypothetical protein FLJ14251 FLJ14251 Hs.281462R96334 0.8469 3041 1 0.4 - - -R55942 0.9231 3043 -1 0.03 - - Hs.4267H03230 0.9615 3043 -1 0.1 - - -AA039246 0.7477 3046 1 0.37 Transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila) TLE2 Hs.332173R88035 0.8596 3046 1 0.07 Centrosomal protein 2 CEP2 Hs.27910AA099589 0.9615 3047 1 0.13 GDP dissociation inhibitor 2 GDI2 Hs.56845AA004785 0.8849 3053 -1 0.2 Annexin A5 ANXA5 Hs.300711R97943 0.6758 3054 1 0.73 Zinc finger protein 26 (KOX 20) ZNF26 Hs.26432R14266 0.9872 3055 -1 0.03 - - -T87298 0.9231 3056 -1 0.27 - - -W05762 0.8596 3057 -1 0.17 Hypothetical protein MGC24447 MGC24447 Hs.353161R17223 0.9359 3057 -1 0.13 - - -AA099910 1 3057 1 0.07 Glutamyl aminopeptidase (aminopeptidase A) ENPEP Hs.291T93794 0.7969 3058 -1 0.1 - - -

H19718 0.8344 3058 -1 0.23 Glutamate receptor, ionotrophic, AMPA 4 GRIA4 Hs.163697R51286 0.7599 3059 -1 0.2 Integrin cytoplasmic domain-associated protein 1 ICAP-1A Hs.173274R79455 0.8469 3063 -1 0.2 Activating transcription factor 1 ATF1 Hs.36908N63501 0.7477 3065 -1 0.47 YY1 transcription factor YY1 Hs.97496N93147 0.9103 3065 -1 0.33 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 2 MLLT2 Hs.114765AA069444 0.9615 3066 0 0 Dicer1, Dcr-1 homolog (Drosophila) DICER1 Hs.87889H66409 0.9743 3067 -1 0.13 ESTs ESTs Hs.108275W85878 0.8218 3068 -1 0.4 Transcription factor 19 (SC1) TCF19 Hs.249184W87377 0.9231 3068 -1 0.3 DNA segment, numerous copies, expressed probes (GS1 gene) DXF68S1E Hs.78991R46282 0.7355 3069 -1 0.4 - - -H82739 0.9487 3070 0 0 - - Hs.40411H30821 0.8344 3073 1 0.2 SUMO-1-specific protease SUSP1 Hs.27197H26525 0.7234 3075 1 0.37 LATS, large tumor suppressor, homolog 2 (Drosophila) LATS2 Hs.19074H58724 0.7477 3078 1 0.4 - - Hs.374462AA136159 0.8722 3078 1 0.07 Microsomal glutathione S-transferase 1 MGST1 Hs.355733R50205 0.7477 3079 -1 0.53 - - -N36659 0.8976 3085 1 0.13 Neuron navigator 1 NAV1 Hs.6298N45646 0.8218 3087 -1 0.27 - - -W85892 0.7114 3088 1 0.47 BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae) BTAF1 Hs.180930H89628 0.6758 3090 -1 0.73 Solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive) SLC9A1 Hs.170222W38743 0.7355 3090 -1 0.27 Olfactomedin 2 OLFM2 Hs.169743H50914 0.8722 3090 -1 0.33 Endothelin converting enzyme 1 ECE1 Hs.288203H29623 0.8976 3091 1 0.13 Bullous pemphigoid antigen 1, 230/240kDa BPAG1 Hs.198689AA035325 0.7845 3092 1 0.27 Insulin receptor substrate 2 IRS2 Hs.143648N93577 0.9103 3092 -1 0.13 Hypothetical protein HSPC251 HSPC251 Hs.54971T79632 0.7234 3094 1 0.5 ESTs ESTs Hs.189716H61388 0.8218 3095 1 0.23 Fragile X mental retardation, autosomal homolog 1 FXR1 Hs.82712AA069421 0.9872 3096 -1 0.03 - - -AA137064 0.7355 3097 1 0.47 Cerebral cell adhesion molecule LOC51148 Hs.23954W16753 0.618 3098 -1 0.7 - - Hs.198552T50061 0.9743 3099 0 0 - - -R25543 0.9103 3101 1 0.13 - - Hs.23133H75387 0.8976 3102 1 0.23 - - -AA136976 0.8722 3106 1 0.2 KIAA1023 protein KIAA1023 Hs.21361T83953 0.8722 3106 1 0.17 Similar to arginyl-tRNA synthetase LOC57038 Hs.15395N44176 0.7969 3109 1 0.2 Hypothetical protein MGC2865 MGC2865 Hs.94814R67239 0.9103 3109 0 0 Bromodomain adjacent to zinc finger domain, 2A BAZ2A Hs.277401N90240 0.7969 3110 -1 0.3 Spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2) SCA2 Hs.76253N29574 0.8849 3110 -1 0.17 Rag D protein RAGD Hs.238679N64639 0.7234 3111 -1 0.27 Dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related) DUSP3 Hs.181046H52254 0.8218 3111 1 0.13 - - Hs.356708AA055190 0.8722 3111 1 0.27 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 15 DDX15 Hs.5683H85625 0.9487 3111 1 0.2 Checkpoint suppressor 1 CHES1 Hs.211773N31674 0.9872 3112 -1 0.03 Amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3 ALS2CR3 Hs.154248AA131782 0.7114 3113 1 0.37 - - Hs.182314AA046822 0.7969 3113 -1 0.4 ESTs ESTs Hs.61272R61688 0.8344 3113 1 0.27 ATP-binding cassette, sub-family A (ABC1), member 2 ABCA2 Hs.94806H15341 0.8596 3114 1 0.2 Phosphoribosyl pyrophosphate synthetase 2 PRPS2 Hs.2910T80020 0.7234 3115 1 0.47 Microtubule-associated protein 4 MAP4 Hs.239298R90939 0.8344 3115 1 0.37 ESTs ESTs Hs.34180W33060 0.8093 3116 -1 0.4 Sialyltransferase 4B (beta-galactosidase alpha-2,3-sialytransferase) SIAT4B Hs.343628W31151 0.9487 3116 1 0.07 DNA segment on chromosome X and Y (unique) 155 expressed sequence DXYS155E Hs.21595AA134770 0.8849 3118 1 0.13 Zinc finger protein 24 (KOX 17) ZNF24 Hs.183593H65280 0.8596 3121 1 0.27 ESTs ESTs Hs.38348N27137 0.7234 3124 -1 0.6 Catechol-O-methyltransferase COMT Hs.240013N54731 0.7234 3125 -1 0.47 Protein kinase C and casein kinase substrate in neurons 2 PACSIN2 Hs.18842H67335 0.8722 3125 1 0.27 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa NDUFA10 Hs.198271AA041346 0.6758 3127 -1 0.63 M-phase phosphoprotein 6 MPHOSPH6 Hs.152720T93603 0.7599 3127 1 0.4 Tumor protein D52-like 1 TPD52L1 Hs.16611H19984 0.7969 3128 1 0.4 Stromal membrane-associated protein SMAP1 Hs.373517N70264 0.9487 3129 1 0.07 Phosphatidylcholine transfer protein PCTP Hs.285218AA099036 0.8093 3130 1 0.2 Astrotactin 2 ASTN2 Hs.30898W31553 0.9103 3130 -1 0.13 Choline kinase-like CHKL Hs.154886W45316 0.7114 3132 1 0.4 XPMC2 protein LOC57109 Hs.235376W70217 0.9487 3133 0 0 Catechol-O-methyltransferase COMT Hs.240013H21758 0.7355 3134 -1 0.4 - - Hs.375003AA043235 0.7234 3138 1 0.33 Novel putative protein similar to YIL091C yeast hypothetical 84 kD protein from SGA1-KTR7 DJ434O14.5 Hs.194754R13742 0.7599 3138 1 0.4 - - -AA193346 0.7355 3139 -1 0.53 Phosphatidylinositol glycan, class S PIGS Hs.347950H62319 0.8469 3139 -1 0.13 - - Hs.133526AA126383 0.9103 3145 1 0.33 Neuropilin 2 NRP2 Hs.17778W69209 0.9231 3146 1 0.2 Phosphatidylinositol glycan, class H PIGH Hs.177R32813 0.6995 3147 -1 0.4 Hypothetical protein MGC2668 MGC2668 Hs.56851R91278 0.9231 3147 -1 0.13 - - -N46251 0.7969 3148 1 0.2 Phafin 2 FLJ13187 Hs.29724N32508 0.9103 3148 -1 0.17 G-protein gamma-12 subunit LOC55970 Hs.8107R05881 0.8849 3149 1 0.07 KIAA0971 protein KIAA0971 Hs.84429W04797 0.8469 3150 -1 0.2 Dystrobrevin binding protein 1 DTNBP1 Hs.43481H89361 0.8722 3150 -1 0.13 Mesoderm development candidate 1 MESDC1 Hs.290356W88446 0.9359 3153 1 0.2 Natural killer-tumor recognition sequence NKTR Hs.241493W92260 0.6876 3154 1 0.5 RAB11A, member RAS oncogene family RAB11A Hs.75618H85608 0.7969 3154 1 0.27 Protein phosphatase 1, regulatory (inhibitor) subunit 2 PPP1R2 Hs.267819N69956 0.9231 3154 -1 0.27 - - Hs.148676H88030 0.7845 3157 -1 0.17 Splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila) SFRS10 Hs.30035T71616 0.9615 3158 0 0 Eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa EIF2S1 Hs.151777AA026113 0.6524 3159 -1 0.67 Hypothetical protein FLJ10252 FLJ10252 Hs.53913N55327 0.8596 3159 -1 0.4 Geminin, DNA replication inhibitor GMNN Hs.234896N90291 0.9359 3160 0 0 DKFZP564J0863 protein DKFZP564J0863Hs.333403R70132 0.8218 3161 -1 0.3 - - Hs.378751AA029861 0.8849 3163 1 0.07 Beclin 1 (coiled-coil, myosin-like BCL2 interacting protein) BECN1 Hs.12272W49616 0.9103 3164 -1 0.2 Villin 2 (ezrin) VIL2 Hs.155191N57339 0.6758 3170 -1 0.57 Hypothetical protein FLJ11240 FLJ11240 Hs.339833W90099 0.7114 3173 1 0.53 Neuroepithelial cell transforming gene 1 NET1 Hs.25155T99195 0.8344 3174 1 0.47 - - Hs.18593R72114 0.8722 3174 -1 0.27 Melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor) MC1R Hs.380388AA027125 0.9359 3175 -1 0.03 Hypothetical protein FLJ10385 FLJ10385 Hs.30922AA029484 0.9487 3175 1 0.13 DKFZP727M111 protein DKFZP727M111Hs.4849AA114872 0.9743 3176 1 0.03 Aconitase 1, soluble ACO1 Hs.154721N59525 0.8596 3177 -1 0.33 CDC16 cell division cycle 16 homolog (S. cerevisiae) CDC16 Hs.1592AA041283 0.9231 3180 -1 0.27 Unc-51-like kinase 1 (C. elegans) ULK1 Hs.47061

R18905 0.8218 3181 1 0.3 Centaurin, delta 1 CENTD1 Hs.22572AA043739 0.8596 3182 1 0.4 - - Hs.96513R12692 0.8596 3185 1 0.2 Sterol-C4-methyl oxidase-like SC4MOL Hs.239926N94263 1 3186 0 0 Thyroid hormone receptor interactor 10 TRIP10 Hs.73999AA037833 1 3187 0 0 Hypothetical protein MGC20496 MGC20496 Hs.12106W47349 0.7355 3188 -1 0.47 KIAA0592 protein KIAA0592 Hs.13273N92358 0.7845 3195 -1 0.07 Hypothetical protein FLJ22029 FLJ22029 Hs.285243H07882 0.8596 3195 -1 0.2 KIAA0586 gene product KIAA0586 Hs.77724T86363 0.7355 3196 1 0.43 - - -R49516 0.8344 3199 -1 0.13 ESTs ESTs Hs.6653AA156458 0.8596 3199 -1 0.03 Spastic paraplegia 7, paraplegin (pure and complicated autosomal recessive) SPG7 Hs.296847R08892 0.9103 3199 0 0 Hypothetical protein MGC4692 MGC4692 Hs.13561N95539 0.6995 3201 1 0.6 Hypothetical protein BC001563 LOC123016 Hs.55158W46869 0.8469 3202 -1 0.13 - - Hs.356699H42051 0.7477 3203 -1 0.57 Early growth response 1 EGR1 Hs.326035R88822 0.9487 3203 -1 0.07 - - Hs.26249R93692 0.8722 3208 -1 0.07 Vaccinia related kinase 2 VRK2 Hs.82771W07077 0.8849 3209 1 0.27 Hematopoietic PBX-interacting protein HPIP Hs.8068R47941 0.9359 3209 1 0.03 Hypothetical protein BC018453 LOC129531 Hs.14222W89013 0.9103 3210 1 0.17 Tripartite motif-containing 26 TRIM26 Hs.1287N23528 0.8218 3212 1 0.47 Arginyl aminopeptidase (aminopeptidase B) RNPEP Hs.283667R78346 0.7599 3214 -1 0.27 - - -R12233 0.7722 3214 -1 0.33 NY-REN-24 antigen LOC58509 Hs.128425R13232 0.9743 3216 1 0.07 Hypothetical protein MGC5601 MGC5601 Hs.64211R21804 0.7114 3217 -1 0.57 - - -W38337 0.8344 3217 -1 0.47 - - -T79503 0.9231 3217 -1 0.2 - - -N42535 0.6876 3221 1 0.53 Hypothetical protein BC008647 LOC91875 Hs.102480H09552 0.8596 3222 1 0.33 Hypothetical protein FLJ20272 FLJ20272 Hs.26090H77668 0.9487 3224 1 0.07 Aryl hydrocarbon receptor AHR Hs.170087N48661 1 3224 -1 0.07 KIAA1604 protein KIAA1604 Hs.209464W15364 0.9359 3226 -1 0.2 B-cell CLL/lymphoma 7A BCL7A Hs.211563H99877 0.9743 3227 1 0.03 - - Hs.380785H47565 0.9872 3232 1 0.07 NS1-binding protein NS1-BP Hs.197298R12961 0.9872 3233 1 0.2 Hypothetical protein DKFZp434B044 DKFZP434B044 Hs.262958AA045109 0.9615 3234 -1 0.27 Chromosome 7 open reading frame 11 C7orf11 Hs.66666N36138 0.8849 3235 1 0.13 3-hydroxy-3-methylglutaryl-Coenzyme A reductase HMGCR Hs.11899R41603 0.9103 3235 1 0.33 Secretogranin II (chromogranin C) SCG2 Hs.75426T48696 0.7234 3242 -1 0.47 Putative nuclear protein ORF1-FL49 ORF1-FL49 Hs.323512W45086 0.6995 3243 -1 0.33 Multidrug resistance-associated protein 7 SIMRP7 Hs.55879H80179 0.9231 3247 1 0.1 DKFZP586N0721 protein DKFZP586N072Hs.99843H69302 0.7845 3249 -1 0.33 Cyclin-dependent kinase (CDC2-like) 10 CDK10 Hs.77313H09314 0.9359 3250 -1 0.03 Protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform PPP2CA Hs.91773H98717 0.6876 3252 -1 0.33 Small nuclear ribonucleoprotein polypeptide C SNRPC Hs.1063T94446 1 3252 0 0 Protein tyrosine phosphatase, non-receptor type substrate 1 PTPNS1 Hs.156114AA069400 0.8849 3253 1 0.13 Hypothetical protein MGC10974 MGC10974 Hs.111099N99946 0.7969 3256 -1 0.3 Mesoderm development candidate 2 MESDC2 Hs.78871N34169 0.7969 3256 -1 0.47 Neurofibromin 2 (bilateral acoustic neuroma) NF2 Hs.902N30186 0.8596 3256 0 0 Hypothetical protein FLJ21615 FLJ21615 Hs.44159AA039526 0.9103 3256 1 0.17 Rabconnectin-3 RC3 Hs.13264AA042813 0.7599 3257 -1 0.27 Olfactory receptor, family 7, subfamily E, member 38 pseudogene OR7E38P Hs.120017T47567 0.9487 3257 0 0 - - -N56703 0.7722 3258 -1 0.37 CGI-145 protein LOC51028 Hs.146324AA134876 0.7969 3262 1 0.3 - - Hs.71523R68008 0.7969 3263 -1 0.27 Fucosidase, alpha-L- 1, tissue FUCA1 Hs.576AA047443 0.9231 3263 1 0.2 LIM domain containing preferred translocation partner in lipoma LPP Hs.180398H88088 0.9359 3263 1 0.17 Serine/threonine kinase 3 (STE20 homolog, yeast) STK3 Hs.166684H12862 0.7477 3265 -1 0.47 Protein inhibitor of activated STAT protein PIASy PIASY Hs.105779H70040 0.9743 3265 0 0 TIGA1 TIGA1 Hs.12082W44398 0.9615 3267 -1 0.07 Function unknown protein 1 FLJ10648 Hs.379758H20185 0.7845 3268 1 0.33 Hypothetical protein CAB56184 CAB56184 Hs.241575N64112 0.8344 3269 -1 0.33 CAAX box 1 CXX1 Hs.250708N24096 0.9743 3273 -1 0.07 - - -T72401 0.7355 3275 -1 0.53 Chromosome 8 open reading frame 4 C8orf4 Hs.283683AA044645 0.9872 3277 1 0.1 Hypothetical protein FLJ21127 FLJ21127 Hs.351440H00173 0.8218 3279 -1 0.33 SH3-domain GRB2-like endophilin B2 SH3GLB2 Hs.30002N73088 0.9872 3279 1 0.03 Ataxin 2 related protein A2LP Hs.43509N31840 0.7599 3282 1 0.33 - - Hs.206710T79456 0.8976 3285 -1 0.27 - - -W47153 0.9359 3287 -1 0.1 Polymerase I and transcript release factor PTRF Hs.29759N99506 0.9103 3289 -1 0.13 Rag D protein RAGD Hs.238679R31243 0.8722 3293 1 0.33 Multiple endocrine neoplasia I MEN1 Hs.240443H01172 0.8976 3295 1 0.2 Golgi reassembly stacking protein 2, 55kDa GORASP2 Hs.6880N29455 0.9743 3301 0 0 - - -AA029575 0.8976 3307 1 0.07 KIAA0697 protein KIAA0697 Hs.12329H28583 0.7845 3309 1 0.53 - - Hs.31396R14521 0.6995 3316 -1 0.6 Spectrin SH3 domain binding protein 1 SSH3BP1 Hs.24752N25817 0.7114 3316 -1 0.53 Spermidine/spermine N1-acetyltransferase SAT Hs.28491R83176 0.8469 3317 -1 0.2 Hypothetical protein FLJ11753 FLJ11753 Hs.62348R08418 0.618 3319 -1 0.73 KIAA0674 protein KIAA0674 Hs.14799R73991 0.8722 3320 1 0.27 KIAA1160 protein KIAA1160 Hs.33122AA028185 0.9359 3323 1 0.1 Sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase) SPR Hs.301540W86967 0.8596 3325 1 0.1 KIAA1450 protein KIAA1450 Hs.83243W86915 0.8469 3326 1 0.13 PHD protein Jade-1 Jade-1 Hs.238246AA150384 0.8093 3327 -1 0.33 KIAA0144 gene product KIAA0144 Hs.8127N71529 0.8722 3327 1 0.27 - - Hs.183779AA129848 0.8849 3327 1 0.2 Exosome component Rrp41 FLJ20591 Hs.343589H85464 0.8596 3328 -1 0.23 Deleted in split-hand/split-foot 1 region DSS1 Hs.333495R55009 0.9872 3336 1 0.07 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 GNAI2 Hs.77269N80932 0.9615 3338 1 0.07 - - -N46186 0.8344 3343 -1 0.27 Clone FLB4739 LOC51218 Hs.294083N75497 0.8976 3344 1 0.27 RAB1A, member RAS oncogene family RAB1A Hs.3642N80021 0.9743 3345 -1 0.03 Origin recognition complex, subunit 4-like (yeast) ORC4L Hs.55055H90564 0.9615 3346 -1 0.13 - - Hs.41423H61134 0.8093 3347 1 0.27 Solute carrier family 6 (neurotransmitter transporter, creatine), member 8 SLC6A8 Hs.187958W89149 0.9487 3349 -1 0.2 - - -N31738 0.7722 3351 1 0.47 Hypothetical protein MGC20262 MGC20262 Hs.351871W90593 0.9487 3354 -1 0.1 Ubiquitin-like 4 UBL4 Hs.76480AA001813 0.8976 3355 -1 0.27 KIAA0052 protein KIAA0052 Hs.278608R21970 0.7477 3362 -1 0.47 General transcription factor IIH, polypeptide 2, 44kDa GTF2H2 Hs.191356

Supporting Table 4 - Mann-Whitney P-values for the NRAS classification and for all 5041 quality filtered genes.

Mann-Whitney P-value: The P-value from the NRAS status analysis using 60 samples (the sample with an NRAS deletion was excluded from the analysis). = genes also present in the BRAFMann-Whitney genelist at P <0.01

*for sequence verification of Clone ID's on chip, please refer to the manufacter's website http:/www.microarrays.ca/support/glists.htmlOriginal Clone ID on Chip*

Mann-Whitney P-value

Original Gene Name* Original Gene Symbol*

Original Unigene cluster*

R60317* 0.000416 Dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase cDLD Hs.74635W31471* 0.000525 Hypothetical protein DKFZp547A023 DKFZp547A023 Hs.23921H12076* 0.000525 Dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase cDLD Hs.74635W88806* 0.00066 Uroporphyrinogen III synthase (congenital erythropoietic porphyria) UROS Hs.75593T83153* 0.001033 Dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase cDLD Hs.74635N74698 0.001484 ESTs ESTs Hs.114536N48742 0.00171 Hypothetical protein FLJ12788 FLJ12788 Hs.20242AA034917* 0.002261 Chaperonin containing TCP1, subunit 3 (gamma) CCT3 Hs.1708R45681 0.002422 TRAF and TNF receptor-associated protein AD022 Hs.46847W42423* 0.002594 Cyclin-dependent kinase 2 CDK2 Hs.19192H78795* 0.00297 Heart and neural crest derivatives expressed 2 HAND2 Hs.36029T66745 0.00297 Mitochondrial glutamate carrier 1 GC1 Hs.99486R25990 0.003177 Telomeric repeat binding factor (NIMA-interacting) 1 TERF1 Hs.194562W67797* 0.00363 Laminin, alpha 5 LAMA5 Hs.11669H08027 0.00363 - - Hs.288963T91050* 0.00363 KIAA1586 protein KIAA1586 Hs.180663AA029847 0.003877 Cyclin fold protein 1 CFP1 Hs.6820AA128825 0.003877 Arylsulfatase B ARSB Hs.1256AA058632 0.003877 Kinesin family member 1B KIF1B Hs.375193W60492 0.004419 Amino-terminal enhancer of split AES Hs.244W04736 0.004715 Hypothetical protein MGC40107 MGC40107 Hs.94316W46396* 0.004715 Dihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenaDLAT Hs.115285AA029775 0.005029 Lung cancer candidate FUS1 Hs.8186R68168 0.005029 MRNA decapping enzyme DCPS Hs.279900R52017 0.005029 Uncharacterized bone marrow protein BM036 BM036 Hs.7731R01529 0.005029 Interferon (alpha, beta and omega) receptor 2 IFNAR2 Hs.86958R27996* 0.005714 Signal sequence receptor, alpha (translocon-associated protein alpha) SSR1 Hs.250773R93361* 0.006482 - - -T79507 0.0069 Erythropoietin receptor EPOR Hs.127826T80625* 0.0069 Prohibitin PHB Hs.75323W58440 0.0069 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 B4GALT1 Hs.198248R34801 0.0069 TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 1TAF2 Hs.122752H25840 0.007808 V-crk sarcoma virus CT10 oncogene homolog (avian) CRK Hs.343220R06281* 0.007808 KIAA0349 protein KIAA0349 Hs.15303N/A2* 0.007808 - - -H85870* 0.007808 - - -H87044 0.008302 Translocase of inner mitochondrial membrane 22 homolog (yeast) TIMM22 Hs.87595N90242 0.008302 Glyoxylate reductase/hydroxypyruvate reductase GRHPR Hs.155742AA099341* 0.008823 Golgi-specific brefeldin A resistance factor 1 GBF1 Hs.155499H58331 0.008823 Glucose regulated protein, 58kDa GRP58 Hs.289101R49336* 0.008823 SKI-interacting protein SNW1 Hs.79008W42674 0.008823 FK506 binding protein 14, 22 kDa FKBP14 Hs.264636R56010 0.008823 HIRA interacting protein 3 HIRIP3 Hs.26484N56712 0.009373 PWP2 periodic tryptophan protein homolog (yeast) PWP2H Hs.79380R19317* 0.009373 - - -H03098 0.009373 - - -AA136073 0.009953 Hypothetical protein FLJ36888 FLJ36888 Hs.103845W58640 0.009953 SECIS binding protein 2 SBP2 Hs.288141R76298 0.010566 Heat shock transcription factor 1 HSF1 Hs.1499R54764 0.010566 KIAA1295 protein KIAA1295 Hs.26204R98866 0.010566 Proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule m PRG2 Hs.99962AA043510 0.011212 Nm23-phosphorylated unknown substrate MGC15437 Hs.55067R42536 0.011212 Dachshund homolog (Drosophila) DACH Hs.63931H87204 0.011892 Cyclin-dependent kinase 5 CDK5 Hs.166071AA193317 0.011892 - - Hs.356786H15638 0.012609 Solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11SLC25A11 Hs.184877R52086 0.012609 Hypothetical protein FLJ31657 FLJ31657 Hs.5518H57791 0.012609 - - -N72115 0.012609 Cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) CDKN2C Hs.4854R54062 0.012609 Crn, crooked neck-like 1 (Drosophila) CRNKL1 Hs.268281R53336 0.012609 Ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding proteRAC3 Hs.45002H28872 0.012609 Aspartyl-tRNA synthetase DARS Hs.80758H46056 0.013364 Radixin RDX Hs.263671H45103 0.014158 Attractin ATRN Hs.194019T99761 0.014158 Programmed cell death 8 (apoptosis-inducing factor) PDCD8 Hs.18720H08441 0.014158 Protein tyrosine phosphatase, receptor type, A PTPRA Hs.26045H01504 0.014994 - - -N29673 0.014994 Hypoxia up-regulated 1 HYOU1 Hs.277704H64252 0.014994 Acyl-Coenzyme A dehydrogenase family, member 8 ACAD8 Hs.14791R08328 0.015873 Nucleoporin 133kDa NUP133 Hs.12457AA028144 0.015873 BCS1-like (yeast) BCS1L Hs.150922H03208 0.015873 Mitotic control protein dis3 homolog DIS3 Hs.323346W02274 0.016797 - - -H70044 0.016797 Calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma CAMK2G Hs.12436H57853 0.016797 CGI-43 protein LOC51622 Hs.289112AA005389 0.017768 DKFZP727G051 protein DKFZP727G051 Hs.119960H59065 0.017768 - - -W88821 0.017768 - - Hs.288924N80145 0.018788 ESTs ESTs Hs.50873W02772 0.018788 Hypothetical protein FLJ23749 FLJ23749 Hs.180178AA056378 0.018788 Alveolar soft part sarcoma chromosome region, candidate 1 ASPSCR1 Hs.298351W20391 0.018788 Kinesin-like 2 KNSL2 Hs.20830H04804 0.018788 ESTs ESTs Hs.374236W87530 0.018788 Hypothetical protein FLJ32919 FLJ32919 Hs.293224R68948 0.018788 Calumenin CALU Hs.7753R22893 0.019858 Synaptosomal-associated protein, 23kDa SNAP23 Hs.184376W03395 0.019858 Elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 ELOVL1 Hs.25597R79632 0.019858 Family with sequence similarity 3, member C FAM3C Hs.29882AA047468 0.019858 - - Hs.127824N79584 0.019858 CK2 interacting protein 1; HQ0024c protein CKIP-1 Hs.173380H20531 0.020982 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4 B3GALT4 Hs.21495AA058623 0.020982 Proteasome (prosome, macropain) subunit, beta type, 1 PSMB1 Hs.75748

R80585 0.020982 CD2-associated protein CD2AP Hs.374340R43738 0.020982 UDP-glucose ceramide glucosyltransferase-like 2 UGCGL2 Hs.22983H96308 0.02216 - - Hs.58210W19663 0.02216 KIAA0103 gene product KIAA0103 Hs.154387H44964 0.02216 FK506 binding protein 14, 22 kDa FKBP14 Hs.264636W46792 0.02216 Transcription factor Dp-2 (E2F dimerization partner 2) TFDP2 Hs.19131H17025 0.02216 Phosphotidylinositol transfer protein, beta PITPNB Hs.7370AA101859 0.023396 Endosulfine alpha ENSA Hs.111680H72283 0.023396 KIAA0265 protein KIAA0265 Hs.192966T82149 0.023396 - - Hs.252873AA149232 0.023396 - - Hs.103411R65863 0.023396 Ring finger protein 13 RNF13 Hs.6900H15697 0.023396 Propionyl Coenzyme A carboxylase, beta polypeptide PCCB Hs.63788AA028145 0.023396 Tissue inhibitor of metalloproteinase 3 (Sorsby fundus dystrophy, pseudoinflamTIMP3 Hs.245188AA001333 0.024691 Fusion, derived from t(12;16) malignant liposarcoma FUS Hs.99969H30637 0.024691 ESTs ESTs Hs.27362R01627 0.024691 Major histocompatibility complex, class II, DQ beta 1 HLA-DQB1 Hs.73931AA114976 0.024691 Tenascin XB TNXB Hs.169886AA128472 0.024691 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypepGNAI3 Hs.73799W68614 0.024691 DnaJ (Hsp40) homolog, subfamily B, member 12 DNAJB12 Hs.7960N22841 0.024691 Hypothetical protein MGC17943 MGC17943 Hs.106390H16449 0.024691 Staufen, RNA binding protein (Drosophila) STAU Hs.6113R44861 0.026048 Hypothetical protein FLJ10637 FLJ10637 Hs.22595AA043503 0.026048 Down-regulator of transcription 1, TBP-binding (negative cofactor 2) DR1 Hs.16697H11233 0.026048 CGI-203 protein CGI-203 Hs.184860W91979 0.026048 24-dehydrocholesterol reductase DHCR24 Hs.75616N63962 0.026048 Component of oligomeric golgi complex 5 COG5 Hs.239631AA046615 0.026048 Interleukin 2 receptor, beta IL2RB Hs.75596H30227 0.027468 Putative mitochondrial solute carrier MRS3/4 Hs.326104N34758 0.027468 Chromosome 2 open reading frame 6 C2orf6 Hs.196437N66208 0.027468 Protein phosphatase 1, regulatory (inhibitor) subunit 8 PPP1R8 Hs.356590H29620 0.027468 Chromosome 6 open reading frame 33 C6orf33 Hs.239388R33452 0.027468 Protein O-fucosyltransferase 1 POFUT1 Hs.178292H44523 0.027468 KIAA0370 protein KIAA0370 Hs.70500AA055948 0.027468 Rho-associated, coiled-coil containing protein kinase 2 ROCK2 Hs.58617N44485 0.028955 - - Hs.13809N33577 0.028955 - - Hs.24359W74601 0.028955 Phosphotidylinositol transfer protein PITPN Hs.79709R69581 0.028955 PRO1914 protein PRO1914 Hs.5327W42634 0.028955 Fibroblast activation protein, alpha FAP Hs.418H38584 0.028955 - - -N51027 0.028955 Hypothetical protein FLJ10420 FLJ10420 Hs.289087AA047569 0.030511 Hypothetical protein FLJ10597 FLJ10597 Hs.90375R55180 0.030511 Muskelin 1, intracellular mediator containing kelch motifs MKLN1 Hs.288791AA151211 0.030511 Bone morphogenetic protein 1 BMP1 Hs.1274R52949 0.030511 - - Hs.25978H20379 0.030511 Breakpoint cluster region protein, uterine leiomyoma, 2 BCRP2 Hs.284294AA055938 0.030511 Laminin, alpha 4 LAMA4 Hs.78672AA161069 0.030511 E1B-55kDa-associated protein 5 E1B-AP5 Hs.155218R23374 0.032138 Hypothetical protein FLJ10462 FLJ10462 Hs.100895H02889 0.032138 Inositol(myo)-1(or 4)-monophosphatase 1 IMPA1 Hs.171776R52301 0.032138 - - Hs.302182N93443 0.032138 Ubiquitin protein ligase UBE3B Hs.17639H68373 0.032138 Transcription factor CP2 TFCP2 Hs.154970N50369 0.032138 Nijmegen breakage syndrome 1 (nibrin) NBS1 Hs.25812R54089 0.032138 Solute carrier family 19 (folate transporter), member 1 SLC19A1 Hs.84190H14291 0.032138 Amyloid beta (A4) precursor-like protein 1 APLP1 Hs.74565AA142987 0.032138 DKFZP586I111 protein DKFZP586I111 Hs.227429R28281 0.032138 - - -R13936 0.033839 Deoxyhypusine synthase DHPS Hs.79064H10355 0.033839 Transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) TCEB2 Hs.172772N44132 0.033839 Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein ID2 Hs.180919AA136060 0.033839 Hypothetical protein MGC16202 MGC16202 Hs.246914R02822 0.033839 - - Hs.243901T99676 0.033839 Hypothetical protein MGC40405 MGC40405 Hs.193482N41035 0.033839 - - Hs.378848W42446 0.033839 NICE-5 protein HSA243666 Hs.337078N41921 0.035616 - - Hs.33264N99127 0.035616 Hypothetical protein MGC5540 MGC5540 Hs.267400R91819 0.035616 Phosphoinositide-3-kinase, regulatory subunit, polypeptide 2 (p85 beta) PIK3R2 Hs.211586R20373 0.035616 Transmembrane trafficking protein TMP21 Hs.74137AA047382 0.035616 Clathrin, light polypeptide (Lcb) CLTB Hs.380749R55182 0.035616 - - Hs.374526N54855 0.035616 ESTs ESTs Hs.269340R55959 0.035616 KIAA1091 protein KIAA1091 Hs.26797W52888 0.035616 Serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 1 SERPINB1 Hs.183583N93458 0.037472 Ubiquinol-cytochrome c reductase core protein II UQCRC2 Hs.173554N93218 0.037472 Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein ID2 Hs.180919T84046 0.037472 - - Hs.372951H23246 0.037472 Hypothetical protein FLJ13433 FLJ13433 Hs.23259H18868 0.037472 Ribonucleotide reductase M2 B (TP53 inducible) RRM2B Hs.94262N59182 0.037472 - - Hs.311002W60763 0.037472 Thyroid hormone receptor-associated protein, 240 kDa subunit TRAP240 Hs.11861R32834 0.037472 CLLL7 protein FLJ10716 Hs.24129R61759 0.037472 - - Hs.8078H28105 0.037472 Small nuclear ribonucleoprotein polypeptide N SNRPN Hs.48375N79531 0.037472 Hypothetical protein MGC2714 MGC2714 Hs.74284AA059276 0.03941 Hypothetical protein MGC13010 MGC13010 Hs.332040R45198 0.03941 Hypothetical protein CDA08 CDA08 Hs.23047AA004355 0.03941 Mitochondrial ribosomal protein S31 MRPS31 Hs.154655H97357 0.03941 - - Hs.227699T96379 0.03941 Protein phosphatase 2, regulatory subunit B (B56), delta isoform PPP2R5D Hs.118244AA041262 0.03941 KIAA1228 protein KIAA1228 Hs.306867R52958 0.03941 Calcium channel, voltage-dependent, gamma subunit 4 CACNG4 Hs.331904N36349 0.03941 ESTs ESTs Hs.374577AA136615 0.03941 V-yes-1 Yamaguchi sarcoma viral related oncogene homolog LYN Hs.80887H99068 0.03941 - - Hs.101810T80951 0.03941 Replication protein A1, 70kDa RPA1 Hs.84318N98296 0.03941 Hypothetical protein FLJ10808 FLJ10808 Hs.59838T97640 0.041432 - - -

AA136060 0.041432 Hypothetical protein MGC16202 MGC16202 Hs.246914H41751 0.041432 General transcription factor IIF, polypeptide 1, 74kDa GTF2F1 Hs.68257N70020 0.041432 - - Hs.272034T97034 0.041432 KIAA0877 protein KIAA0877 Hs.11217H62189 0.041432 Elongator protein 2 ELP2 Hs.8739N71552 0.041432 Hypothetical protein DKFZp434D1428 DKFZp434D1428 Hs.321775N63825 0.041432 Ras homolog gene family, member G (rho G) ARHG Hs.75082T81712 0.041432 Defensin, alpha 1, myeloid-related sequence DEFA1 Hs.274463W45178 0.043542 DIP13 beta DIP13B Hs.107882R70784 0.043542 MCT-1 protein MCT-1 Hs.102696R88098 0.043542 Myosin IC MYO1C Hs.286226AA133960 0.043542 Ubiquitin-conjugating enzyme E2A (RAD6 homolog) UBE2A Hs.80612N20579 0.043542 Proteasome (prosome, macropain) 26S subunit, ATPase, 2 PSMC2 Hs.61153N73284 0.043542 KIAA1089 protein KIAA1089 Hs.4990AA039447 0.043542 Suppressor of fused homolog (Drosophila) SUFU Hs.21431R84453 0.043542 DKFZP586F1524 protein DKFZP586F1524 Hs.241543R60241 0.043542 Hypothetical protein FLJ21908 FLJ21908 Hs.26750W87615 0.043542 Isoprenylcysteine carboxyl methyltransferase ICMT Hs.183212H09093 0.043542 Gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase) GGH Hs.78619R23132 0.043542 Cullin 1 CUL1 Hs.14541N25614 0.043542 - - Hs.270725AA001144 0.045741 Similar to RIKEN cDNA 5730528L13 gene MGC17337 Hs.78531W63752 0.045741 DnaJ (Hsp40) homolog, subfmaily B, member 1 DNAJB1 Hs.82646T81806 0.045741 - - -H03409 0.045741 Alg5, S. cerevisiae, homolog of ALG5 Hs.227933R01105 0.045741 ATP-binding cassette, sub-family E (OABP), member 1 ABCE1 Hs.12013AA101823 0.045741 Elastin microfibril interface located protein EMILIN Hs.63348R63546 0.045741 KIAA1728 protein KIAA1728 Hs.252748R60451 0.045741 N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase LOC51172 Hs.21334W78867 0.045741 Agrin AGRN Hs.273330W61184 0.045741 ATPase, Class VI, type 11B ATP11B Hs.75478H38160 0.045741 Hypothetical protein FLJ10769 FLJ10769 Hs.8083AA150891 0.045741 SET domain-containing protein 7 SET7 Hs.78521H87272 0.045741 RAB2, member RAS oncogene family RAB2 Hs.78305R00170 0.045741 Bifunctional apoptosis regulator BFAR Hs.168159W93272 0.045741 Diphosphate dimethylallyl diphosphate isomerase 2 IDI2 Hs.9270N64618 0.045741 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast) BUB3 Hs.40323R19946 0.048033 Stannin SNN Hs.76691N21545 0.048033 KIAA1033 protein KIAA1033 Hs.12144AA150896 0.048033 Hypothetical protein MGC13090 MGC13090 Hs.333389W68453 0.048033 Hypothetical protein FLJ10468 FLJ10468 Hs.48855H29672 0.048033 Protein arginine N-methyltransferase 6 PRMT6 Hs.26006R34648 0.048033 Cell adhesion molecule with homology to L1CAM (close homolog of L1) CHL1 Hs.210863H79622 0.048033 ESTs ESTs Hs.13751H62026 0.048033 Superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) SOD1 Hs.75428R37087 0.048033 Similar to S. cerevisiae Sec6p and R. norvegicus rsec6 SEC6 Hs.8088R13127 0.048033 Suppressor of potassium transport defect 3 SKD3 Hs.21263N21648 0.050421 MpV17 transgene, murine homolog, glomerulosclerosis MPV17 Hs.75659N27828 0.050421 Sentrin/SUMO-specific protease SENP7 Hs.30443R31858 0.050421 Kaiso ZNF-kaiso Hs.143604H13698 0.050421 CGI-83 protein LOC51110 Hs.118554N79042 0.050421 - - -R79439 0.050421 ADP-ribosylation factor-like 1 ARL1 Hs.242894AA031950 0.050421 Hypothetical protein FLJ22688 FLJ22688 Hs.288800AA046359 0.050421 Protein predicted by clone 23882 HSU79303 Hs.82482T77239 0.050421 - - -H38541 0.050421 CCR4-NOT transcription complex, subunit 3 CNOT3 Hs.343571R56756 0.050421 Hypothetical protein FLJ20422 FLJ20422 Hs.26570W88468 0.050421 Hypothetical protein MGC20781 MGC20781 Hs.237536N63044 0.052908 Hypothetical protein FLJ20048 FLJ20048 Hs.116470W93121 0.052908 KIAA0355 gene product KIAA0355 Hs.186840AA059052 0.052908 ARP1 actin-related protein 1 homolog B, centractin beta (yeast) ACTR1B Hs.2477W03386 0.052908 - - Hs.29808R34632 0.052908 Zinc finger, DHHC domain containing 6 ZDHHC6 Hs.22353H19181 0.052908 Ureidopropionase, beta UPB1 Hs.126926AA099692 0.052908 Epsilon-tubulin LOC51175 Hs.34851R91050 0.052908 Endoplasmic reticulum resident protein 44 kDa ERp44 Hs.154023R59415 0.052908 - - -R33031 0.052908 Adaptor-related protein complex 3, sigma 2 subunit AP3S2 Hs.154782R76088 0.052908 Ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) UCHL3 Hs.77917H00297 0.052908 CGI-100 protein LOC50999 Hs.348996H17078 0.052908 Core-binding factor, runt domain, alpha subunit 2; translocated to, 2 CBFA2T2 Hs.153934N58012 0.052908 - - -R62721 0.052908 Small inducible cytokine subfamily E, member 1 (endothelial monocyte-activati SCYE1 Hs.333513AA148416 0.052908 Hypothetical protein FLJ14917 FLJ14917 Hs.154706T77388 0.052908 Hypothetical protein FLJ38045 FLJ38045 Hs.170226R91793 0.052908 ESTs ESTs Hs.369100N93130 0.052908 Glutamate-cysteine ligase, modifier subunit GCLM Hs.89709N20259 0.052908 Hypothetical protein MGC2840 similar to a putative glucosyltransferase MGC2840 Hs.155356H16834 0.055497 Amyloid beta (A4) precursor protein-binding, family A, member 2 binding protei APBA2BP Hs.324104AA121306 0.055497 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 KDELR1 Hs.78040AA132083 0.055497 Hypothetical protein BC007384 LOC90378 Hs.140309AA131255 0.055497 AD24 protein AD24 Hs.74899N38855 0.055497 Enhancer of invasion 10 HEI10 Hs.107003R17665 0.055497 COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) COPS5 Hs.198767W68408 0.055497 24-dehydrocholesterol reductase DHCR24 Hs.75616N29496 0.055497 ESTs ESTs Hs.44041H66700 0.055497 Hypothetical protein FLJ20758 FLJ20758 Hs.274248N78968 0.055497 Diphtheria toxin receptor (heparin-binding epidermal growth factor-like growth f DTR Hs.799AA041401 0.055497 ESTs ESTs Hs.57967H70682 0.055497 Propionyl Coenzyme A carboxylase, alpha polypeptide PCCA Hs.80741AA135452 0.05819 CGG triplet repeat binding protein 1 CGGBP1 Hs.86041N78845 0.05819 Hypothetical protein FLJ20542 FLJ20542 Hs.6449N46185 0.05819 ESTs ESTs Hs.165084H90879 0.05819 Hypothetical protein MGC8974 MGC8974 Hs.40094H90534 0.05819 Adaptor-related protein complex 4, beta 1 subunit AP4B1 Hs.28298AA039649 0.05819 Hypothetical protein FLJ10743 FLJ10743 Hs.3376R62540 0.05819 ATPase, Cu++ transporting, beta polypeptide (Wilson disease) ATP7B Hs.84999AA033545 0.05819 TIA1 cytotoxic granule-associated RNA binding protein-like 1 TIAL1 Hs.182741T85141 0.05819 Golgi coiled coil 1 GCC1 Hs.4783

H63197 0.05819 KIAA0251 protein KIAA0251 Hs.343566N39233 0.05819 - - Hs.44976W68490 0.05819 TAF9-like RNA polymerase II, TATA box binding protein (TBP)-associated fact TAF9L Hs.171723R26222 0.05819 - - Hs.379149R77690 0.060991 Epidermal growth factor receptor pathway substrate 8-related protein 1 EPS8R1 Hs.28907AA044429 0.060991 Tho2 THO2 Hs.16411AA059311 0.060991 Collagen, type VI, alpha 2 COL6A2 Hs.159263N72916 0.060991 Ubiquitin specific protease 12 USP12 Hs.42400AA011515 0.060991 KIAA0451 gene product KIAA0451 Hs.18586R34925 0.060991 Phospholipase D1, phophatidylcholine-specific PLD1 Hs.82587H19093 0.060991 - - Hs.330310H78941 0.060991 Thioesterase, adipose associated THEA Hs.234786R62973 0.060991 Hypothetical protein MGC4796 MGC4796 Hs.21396W31441 0.060991 UDP-N-acetylglucosamine-2-epimerase/N-acetylmannosamine kinase GNE Hs.5920W44535 0.060991 Neurochondrin NCDN Hs.94653W85901 0.060991 Eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa EIF2S2 Hs.12163T99083 0.060991 CSE1 chromosome segregation 1-like (yeast) CSE1L Hs.90073W31524 0.060991 - - Hs.95262R71560 0.063903 - - -AA039246 0.063903 Transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila) TLE2 Hs.332173W32156 0.063903 Hypothetical protein MGC3329 MGC3329 Hs.25005AA142937 0.063903 Claudin 10 CLDN10 Hs.26126R38922 0.063903 High-mobility group protein 2-like 1 HMG2L1 Hs.92260H69320 0.063903 Vesicle docking protein p115 P115 Hs.325948H84793 0.063903 - - -N51855 0.063903 ADP-ribosyltransferase (NAD+; poly(ADP-ribose) polymerase)-like 2 ADPRTL2 Hs.24284H04610 0.063903 Splicing factor 3a, subunit 1, 120kDa SF3A1 Hs.334691T81080 0.063903 - - -N34884 0.063903 NIF3 NGG1 interacting factor 3-like 1 (S. pombe) NIF3L1 Hs.21943N73741 0.063903 Hypothetical protein DKFZp761P1121 DKFZp761P1121 Hs.350243N93962 0.066928 Mitochondrial ribosomal protein L43 MRPL43 Hs.151945N90788 0.066928 Annexin A4 ANXA4 Hs.77840N59231 0.066928 Pyruvate carboxylase PC Hs.89890N66251 0.066928 - - -H90247 0.066928 - - Hs.356089R53566 0.066928 - - Hs.184779AA056090 0.066928 - - -T79937 0.066928 Cutaneous T-cell lymphoma tumor antigen se70-2 SE70-2 Hs.39140R51121 0.066928 KIAA1880 protein KIAA1880 Hs.100256AA135740 0.066928 ESTs ESTs Hs.135270AA056695 0.066928 Tight junction protein 2 (zona occludens 2) TJP2 Hs.75608R34696 0.066928 - - -T96901 0.066928 - - -N63458 0.066928 Sialyltransferase 6 (N-acetyllacosaminide alpha 2,3-sialyltransferase) SIAT6 Hs.48793R14667 0.070071 Zinc finger protein of the cerebellum 4 ZIC4 Hs.326796R45618 0.070071 Hypothetical protein FLJ20498 FLJ20498 Hs.97925R76215 0.070071 - - Hs.182723H44888 0.070071 - - Hs.57483AA099137 0.070071 Clathrin, light polypeptide (Lca) CLTA Hs.104143W37210 0.070071 Hypothetical protein MGC40361 MGC40361 Hs.284170N23517 0.070071 Heterogeneous nuclear ribonucleoprotein F HNRPF Hs.808R32829 0.070071 KIAA1327 protein KIAA1327 Hs.106204AA033605 0.070071 CD2 antigen (cytoplasmic tail) binding protein 2 CD2BP2 Hs.202677R93621 0.070071 Eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa EIF2S2 Hs.12163T83255 0.070071 Zinc finger protein 106 ZFP106 Hs.15220R69571 0.070071 CDA14 LOC51290 Hs.26813AA001141 0.070071 Heparan sulfate proteoglycan 2 (perlecan) HSPG2 Hs.211573AA056755 0.070071 Peroxisomal proliferator-activated receptor A interacting complex 285 PRIC285 Hs.151714W81586 0.070071 Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog FGR Hs.1422N76056 0.073333 ARP1 actin-related protein 1 homolog B, centractin beta (yeast) ACTR1B Hs.2477H87736 0.073333 - - -H95186 0.073333 - - Hs.378739R93685 0.073333 Werner helicase interacting protein WHIP Hs.236828W90083 0.073333 Hypothetical protein BC013587 LOC219738 Hs.94943H79507 0.073333 - - -R36452 0.073333 ESTs ESTs Hs.300817R60159 0.073333 Topoisomerase (DNA) I TOP1 Hs.317N28014 0.073333 BRCA1 associated protein BRAP Hs.122764AA147003 0.073333 - - Hs.356291R76897 0.073333 Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) UBE2D3 Hs.118797R51991 0.073333 Similar to ubiquitin binding protein UBPH Hs.3459R25036 0.073333 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 NDST1 Hs.20894T99677 0.073333 CGI-105 protein LOC51011 Hs.279932AA150728 0.073333 ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 3 ADPRTL3 Hs.271742R37665 0.073333 Pescadillo homolog 1, containing BRCT domain (zebrafish) PES1 Hs.13501R62636 0.073333 ESTs ESTs Hs.107060N55329 0.073333 Anaphase-promoting complex subunit 7 APC7 Hs.52763R99213 0.076719 Diacylglycerol O-acyltransferase homolog 1 (mouse) DGAT1 Hs.288627H95383 0.076719 Death effector domain containing DEDD Hs.169681R50640 0.076719 DKFZP564C186 protein DKFZP564C186 Hs.134200H95311 0.076719 - - Hs.13431R36089 0.076719 Nuclear receptor subfamily 2, group F, member 6 NR2F6 Hs.239752N28293 0.076719 Autism-related protein 1 KIAA0442 Hs.32168H53827 0.076719 ESTs ESTs Hs.36822AA137082 0.076719 - - Hs.351869R18145 0.076719 ESTs ESTs Hs.22381R13232 0.076719 Hypothetical protein MGC5601 MGC5601 Hs.64211W15337 0.076719 ESTs ESTs Hs.297784R35798 0.076719 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 ABCC4 Hs.139336W04706 0.076719 Hypothetical protein FLJ10300 FLJ10300 Hs.42233AA099381 0.076719 COX15 homolog, cytochrome c oxidase assembly protein (yeast) COX15 Hs.226581H30017 0.076719 Phosphoinositide-3-kinase, regulatory subunit, polypeptide 2 (p85 beta) PIK3R2 Hs.211586AA115939 0.076719 Capping protein (actin filament) muscle Z-line, alpha 2 CAPZA2 Hs.75546N36070 0.080231 Hypothetical protein DKFZp564A176 DKFZp564A176 Hs.322844H89739 0.080231 ESTs ESTs Hs.114280T69771 0.080231 Hypothetical protein FLJ12716 FLJ12716 Hs.5354N51836 0.080231 - - Hs.50547W61360 0.080231 Hypothetical protein MGC15563 MGC15563 Hs.64552T66879 0.080231 Hypothetical protein LOC54103 LOC54103 Hs.12969R59926 0.080231 Paired basic amino acid cleaving enzyme (furin, membrane associated receptoPACE Hs.59242

R20749 0.080231 - - -N73986 0.080231 ESTs ESTs Hs.50408R35167 0.080231 BAI1-associated protein 2 BAIAP2 Hs.7936H49062 0.080231 Hypothetical protein FLJ22056 FLJ22056 Hs.24956N43952 0.080231 - - Hs.236443AA031411 0.080231 Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa PAFAH1B1 Hs.77318N53295 0.080231 Ribosomal protein L39-like RPL39L Hs.132748H12056 0.080231 - - Hs.95734H50517 0.080231 Gamma-aminobutyric acid (GABA) B receptor, 1 GABBR1 Hs.167017N21289 0.080231 Melanoma cell adhesion molecule MCAM Hs.211579R76085 0.080231 Cytokine-inducible kinase CNK Hs.153640H37983 0.080231 Sphingomyelin phosphodiesterase 1, acid lysosomal (acid sphingomyelinase) SMPD1 Hs.77813N44152 0.080231 Hypothetical protein HSPC196 HSPC196 Hs.22546W76572 0.083873 Nudix (nucleoside diphosphate linked moiety X)-type motif 1 NUDT1 Hs.388AA101835 0.083873 - - Hs.374524AA131584 0.083873 DKFZP564O0463 protein DKFZP564O0463 Hs.273344N89775 0.083873 - - Hs.379753R48805 0.083873 ESTs ESTs Hs.25577AA150894 0.083873 Guanine nucleotide binding protein 11 GNG11 Hs.83381R19063 0.083873 - - -N52646 0.083873 KIAA0144 gene product KIAA0144 Hs.8127N90947 0.083873 - - -H20850 0.083873 Thioredoxin 2 TXN2 Hs.211929AA194129 0.083873 Hypothetical protein FLJ13102 FLJ13102 Hs.225160H28168 0.083873 Centaurin, gamma 3 CENTG3 Hs.286084H20726 0.083873 Casein kinase 2, beta polypeptide CSNK2B Hs.165843W47644 0.083873 Transmembrane 4 superfamily member 7 TM4SF7 Hs.26518T50083 0.083873 ESTs ESTs Hs.22247W58432 0.083873 Microtubule-associated protein 4 MAP4 Hs.239298R83313 0.083873 Polymerase (RNA) II (DNA directed) polypeptide A, 220kDa POLR2A Hs.171880R70694 0.083873 ESTs ESTs Hs.29126N75350 0.083873 Gastrin-releasing peptide GRP Hs.1473H56543 0.083873 MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated proMCM3AP Hs.168481N45541 0.083873 Adenosine kinase ADK Hs.94382AA047101 0.083873 Chromosome 5 open reading frame 6 C5orf6 Hs.102469H38504 0.087647 DKFZP566I1024 protein DKFZP566I1024 Hs.279696R70167 0.087647 Hypothetical protein MDS025 MDS025 Hs.154938N25611 0.087647 ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) ACTR1A Hs.153961N20908 0.087647 Baculoviral IAP repeat-containing 6 (apollon) BIRC6 Hs.250646N75042 0.087647 V-rel reticuloendotheliosis viral oncogene homolog A, nuclear factor of kappa li RELA Hs.75569W48561 0.087647 - - -H05096 0.087647 ESTs ESTs Hs.138417AA149810 0.087647 Hypothetical protein MGC29463 MGC29463 Hs.6473W47128 0.087647 Cyclin-dependent kinase 9 (CDC2-related kinase) CDK9 Hs.150423R31115 0.087647 Polymerase (RNA) mitochondrial (DNA directed) POLRMT Hs.153880R37498 0.087647 V-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protRALB Hs.348024AA043906 0.087647 ESTs ESTs Hs.367688H01638 0.087647 Hypothetical protein FLJ23518 FLJ23518 Hs.112250R27100 0.087647 Hypothetical protein FLJ10826 FLJ10826 Hs.24809N45674 0.087647 KIAA0759 protein KIAA0759 Hs.7285R87411 0.087647 Growth arrest-specific 7 GAS7 Hs.226133N21353 0.087647 - - -N46097 0.087647 Biphenyl hydrolase-like (serine hydrolase; breast epithelial mucin-associated a BPHL Hs.351334R06463 0.087647 Heat shock protein 75 TRAP1 Hs.182366T79066 0.087647 Hypothetical protein FLJ10460 FLJ10460 Hs.14347W86900 0.087647 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 B4GALT2 Hs.206713T88726 0.087647 Hypothetical protein FLJ20313 FLJ20313 Hs.126721N46505 0.087647 Hypothetical protein FLJ13273 FLJ13273 Hs.126119AA054518 0.087647 Sm protein F LSM6 Hs.42438T83725 0.087647 KIAA1255 protein KIAA1255 Hs.351633R81509 0.087647 Splicing factor, arginine/serine-rich 11 SFRS11 Hs.11482N41672 0.087647 Adenylyl cyclase-associated protein CAP Hs.104125W78880 0.087647 Hypothetical protein MGC14697 MGC14697 Hs.171625N79538 0.091557 - - Hs.380093R39286 0.091557 Citron (rho-interacting, serine/threonine kinase 21) CIT Hs.15767R56028 0.091557 - - Hs.293407R96161 0.091557 - - -R17720 0.091557 ESTs ESTs Hs.13287W84735 0.091557 Protein inhibitor of activated STAT3 PIAS3 Hs.76578AA011556 0.091557 - - Hs.49136AA147647 0.091557 Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa PAFAH1B1 Hs.77318W04515 0.091557 Syntaphilin SNPH Hs.323833AA041349 0.091557 Macrophage erythroblast attacher MAEA Hs.20815N66214 0.091557 Aminopeptidase puromycin sensitive NPEPPS Hs.293007T83371 0.091557 - - Hs.296979R76958 0.091557 Muscleblind-like protein MBLL39 MBLL39 Hs.283609T94447 0.091557 Cortical thymocyte receptor (X. laevis CTX) like CTXL Hs.112377R20713 0.091557 - - -H10318 0.091557 HLA-B associated transcript 4 BAT4 Hs.247478N62283 0.095606 Translocating chain-associating membrane protein TRAM Hs.4147H26559 0.095606 TGFB1-induced anti-apoptotic factor 1 TIAF1 Hs.75822N28568 0.095606 Signal sequence receptor, alpha (translocon-associated protein alpha) SSR1 Hs.250773W65276 0.095606 Hypothetical protein FLJ10900 FLJ10900 Hs.16277R59224 0.095606 MBD2 (methyl-CpG-binding protein)-interacting zinc finger protein MIZF Hs.7987T81553 0.095606 - - -R78627 0.095606 - - Hs.23240R77994 0.095606 Zinc finger protein 313 ZNF313 Hs.10590AA032037 0.095606 Ubiquitin-conjugating enzyme E2A (RAD6 homolog) UBE2A Hs.80612H06584 0.095606 Tetratricopeptide repeat domain 3 TTC3 Hs.118174H06739 0.095606 Collagen, type V, alpha 2 COL5A2 Hs.82985W03282 0.095606 Dihydrofolate reductase DHFR Hs.83765N91237 0.095606 Chloride intracellular channel 2 CLIC2 Hs.54570AA035451 0.095606 - - Hs.295963W35315 0.095606 - - Hs.381207H61972 0.095606 Protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) PIN4 Hs.11774AA054948 0.095606 - - Hs.61307R80010 0.099798 Nuclear matrix protein NXP-2 NXP-2 Hs.70359H60436 0.099798 Hypothetical protein FLJ10422 FLJ10422 Hs.267905R55020 0.099798 - - -N93937 0.099798 Amyloid beta precursor protein (cytoplasmic tail) binding protein 2 APPBP2 Hs.84084

R01912 0.099798 Ubiquitin specific protease 7 (herpes virus-associated) USP7 Hs.78683N30724 0.099798 - - Hs.350364H98666 0.099798 Procollagen (type III) N-endopeptidase PCOLN3 Hs.183138AA131302 0.099798 - - Hs.71404H94763 0.099798 SH3-domain GRB2-like endophilin B1 SH3GLB1 Hs.136309AA150604 0.099798 Calmodulin 3 (phosphorylase kinase, delta) CALM3 Hs.334330R05282 0.099798 ESTs ESTs Hs.272116R20006 0.099798 ESTs ESTs Hs.12899N71709 0.099798 DC11 protein DC11 Hs.42785R16127 0.099798 - - Hs.121575W04611 0.099798 Hypothetical protein FLJ22794 FLJ22794 Hs.19525W47619 0.099798 2'-5'-oligoadenylate synthetase 3, 100kDa OAS3 Hs.56009R18948 0.099798 Cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa CRSP2 Hs.21586H26012 0.099798 - - Hs.102558AA029361 0.099798 - - Hs.31841H58362 0.099798 Adaptor-related protein complex 2, beta 1 subunit AP2B1 Hs.74626R36709 0.099798 Over-expressed breast tumor protein OBTP Hs.347297H85577 0.099798 Hypothetical protein FLJ11273 FLJ11273 Hs.3542AA010318 0.099798 Striatin, calmodulin binding protein STRN Hs.258538AA203394 0.099798 ESTs ESTs Hs.365593R59227 0.099798 KIAA0365 gene product KIAA0365 Hs.190452R69953 0.099798 - - Hs.27552R12025 0.099798 Bifunctional apoptosis regulator BFAR Hs.168159N71166 0.099798 Phosphatidylinositol glycan, class Q PIGQ Hs.18079H78351 0.104134 - - -T79604 0.104134 Hypothetical protein DKFZp434F2322 DKFZp434F2322 Hs.144633T51260 0.104134 Hexosaminidase A (alpha polypeptide) HEXA Hs.119403H14441 0.104134 - - -R64091 0.104134 ESTs ESTs Hs.28482T79660 0.104134 - - Hs.14600AA037763 0.104134 WAS protein family, member 2 WASF2 Hs.288908H94541 0.104134 Chromosome 20 open reading frame 64 C20orf64 Hs.282990H40649 0.104134 Hypothetical protein FLJ20628 FLJ20628 Hs.32356N49880 0.104134 RAS p21 protein activator (GTPase activating protein) 1 RASA1 Hs.758H29534 0.104134 ESTs ESTs Hs.22248H18491 0.104134 - - Hs.268701R07486 0.104134 ESTs ESTs Hs.18920R48249 0.104134 - - Hs.301885R06151 0.104134 Anaphase promoting complex subunit 5 ANAPC5 Hs.7101AA011361 0.104134 Soc-2 suppressor of clear homolog (C. elegans) SHOC2 Hs.104315N69540 0.104134 - - Hs.351310H50240 0.104134 - - Hs.250879N74427 0.104134 ESTs ESTs Hs.222413N23976 0.104134 Dystroglycan 1 (dystrophin-associated glycoprotein 1) DAG1 Hs.76111R32855 0.104134 - - -H68440 0.104134 Phosphatidylinositol-4-phosphate 5-kinase, type I, beta PIP5K1B Hs.78406H13699 0.104134 ESTs ESTs Hs.171575R60825 0.104134 Mitogen-activated protein kinase 9 MAPK9 Hs.246857AA036810 0.108619 LIM domains containing 1 LIMD1 Hs.48469T83937 0.108619 Hypothetical protein FLJ31638 FLJ31638 Hs.14832R38809 0.108619 ESTs ESTs Hs.13420N70500 0.108619 KIAA0842 protein KIAA0842 Hs.74569N/A2 0.108619 - - -H93167 0.108619 KIAA0332 protein KIAA0332 Hs.7976H01598 0.108619 Translocating chain-associating membrane protein TRAM Hs.4147N99911 0.108619 SNARE associated protein snapin SNAPAP Hs.32018T78059 0.108619 Protein associated with PRK1 AWP1 Hs.83954N42335 0.108619 Hypothetical protein FLJ20452 FLJ20452 Hs.351327T88721 0.108619 Epithelial membrane protein 2 EMP2 Hs.29191R53574 0.108619 Microtubule associated testis specific serine/threonine protein kinase MAST205 Hs.101474H26555 0.108619 Protein phosphatase 1, regulatory subunit 7 PPP1R7 Hs.36587AA055989 0.108619 - - Hs.285050AA069400 0.108619 Hypothetical protein MGC10974 MGC10974 Hs.111099AA037600 0.108619 Chromosome condensation 1 CHC1 Hs.84746N63319 0.108619 Protein tyrosine phosphatase, receptor type, A PTPRA Hs.26045H70971 0.108619 - - -H44128 0.108619 Eukaryotic translation elongation factor 1 alpha 1 EEF1A1 Hs.181165AA027986 0.108619 Protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform PPP2CB Hs.80350H48016 0.108619 - - -AA010396 0.108619 - - Hs.58210N54827 0.108619 KIAA0471 gene product KIAA0471 Hs.242271W91913 0.113255 SNARE protein Ykt6 YKT6 Hs.296244H61357 0.113255 Tumor protein p53 (Li-Fraumeni syndrome) TP53 Hs.1846N49623 0.113255 Hypothetical protein AL133206 LOC64744 Hs.7750R42549 0.113255 Seizure related 6 homolog (mouse) SEZ6 Hs.21837AA010355 0.113255 ESTs ESTs Hs.187568H30821 0.113255 SUMO-1-specific protease SUSP1 Hs.27197AA045207 0.113255 Actin related protein 2/3 complex, subunit 5, 16kDa ARPC5 Hs.82425W03747 0.113255 TBC1 domain family, member 5 TBC1D5 Hs.115740AA142983 0.113255 Chloride intracellular channel 4 CLIC4 Hs.25035N42278 0.113255 ADP-ribosylation-like factor 6 interacting protein 2 ARL6IP2 Hs.27099R54957 0.113255 - - Hs.356757H83019 0.113255 Ribosomal protein S27 (metallopanstimulin 1) RPS27 Hs.195453H99486 0.113255 LIM and SH3 protein 1 LASP1 Hs.334851N39367 0.118046 Hypothetical protein FLJ20085 FLJ20085 Hs.118964N52744 0.118046 HSPC043 protein HSPC043 Hs.46624N80064 0.118046 Mitochondrial ribosomal protein S6 MRPS6 Hs.6945N20541 0.118046 Cadherin 1, type 1, E-cadherin (epithelial) CDH1 Hs.194657R59009 0.118046 KIAA0052 protein KIAA0052 Hs.278608H19953 0.118046 - - Hs.220963T67217 0.118046 Hypothetical protein MGC3207 MGC3207 Hs.372737AA031913 0.118046 - - Hs.351573N39229 0.118046 Hypothetical protein A-211C6.1 LOC57149 Hs.28607AA203245 0.118046 - - -AA116112 0.118046 Mitochondrial ribosomal protein L39 MRPL39 Hs.167130N20373 0.118046 - - -AA028107 0.118046 HLA-B associated transcript 2 BAT2 Hs.25911R86231 0.118046 PC326 protein PC326 Hs.279882N47346 0.118046 G-protein gamma-12 subunit LOC55970 Hs.8107R12704 0.118046 - - -

AA044632 0.118046 - - -R24816 0.118046 KIAA0056 protein KIAA0056 Hs.13421R80587 0.118046 Protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoforPPP2R2A Hs.179574W15360 0.118046 Epidermal growth factor receptor pathway substrate 8-related protein 1 EPS8R1 Hs.28907W67895 0.118046 Small EDRK-rich factor 1A (telomeric) SERF1A Hs.32567AA005154 0.118046 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNDDX9 Hs.74578R72548 0.118046 Serine/threonine kinase 11 interacting protein STK11IP Hs.22410N64474 0.118046 Protein phosphatase 4, regulatory subunit 2 PPP4R2 Hs.356686AA129727 0.118046 RAB5C, member RAS oncogene family RAB5C Hs.479W52156 0.118046 Oxytocin receptor OXTR Hs.2820R52844 0.118046 - - Hs.356786AA033874 0.118046 - - Hs.12035R07295 0.122995 Sterol O-acyltransferase (acyl-Coenzyme A: cholesterol acyltransferase) 1 SOAT1 Hs.14553R52021 0.122995 - - -H53288 0.122995 BCL2-associated athanogene 4 BAG4 Hs.194726N24676 0.122995 Chaperonin containing TCP1, subunit 4 (delta) CCT4 Hs.79150R14321 0.122995 NEL-like 1 (chicken) NELL1 Hs.21602H58642 0.122995 Hypothetical protein FLJ23499 FLJ23499 Hs.17546AA043504 0.122995 Inositol polyphosphate phosphatase-like 1 INPPL1 Hs.75339R76434 0.122995 Hypothetical protein FLJ31153 FLJ31153 Hs.350424AA046915 0.122995 Eukaryotic translation initiation factor 3, subunit 5 epsilon, 47kDa EIF3S5 Hs.7811H78789 0.122995 KIAA0241 protein KIAA0241 Hs.150275H18242 0.122995 Neighbor of A-kinase anchoring protein 95 NAKAP95 Hs.96200R79616 0.122995 Thioredoxin domain containing TXNDC Hs.24766H52225 0.122995 TGF beta receptor associated protein -1 TRAP-1 Hs.101766W01227 0.122995 Hepatoma-derived growth factor (high-mobility group protein 1-like) HDGF Hs.89525T85094 0.122995 Hypothetical protein FLJ20725 FLJ20725 Hs.15467T84822 0.122995 TAR (HIV) RNA binding protein 1 TARBP1 Hs.151518R76096 0.122995 Hypothetical protein FLJ20502 FLJ20502 Hs.23956AA031501 0.122995 Adaptor-related protein complex 3, mu 1 subunit AP3M1 Hs.298442H51373 0.122995 - - -R12879 0.122995 KIAA1336 protein KIAA1336 Hs.145365W44318 0.122995 Mitogen-activated protein kinase 1 MAPK1 Hs.324473H27344 0.128104 Hypothetical protein MGC5338 MGC5338 Hs.99598AA116099 0.128104 Melanoma antigen, family D, 2 MAGED2 Hs.4943R71648 0.128104 CDC2-related protein kinase 7 CRK7 Hs.278346W15390 0.128104 Bone morphogenetic protein receptor, type IA BMPR1A Hs.2534H10430 0.128104 Hypothetical protein FLJ21939 similar to 5-azacytidine induced gene 2 FLJ21939 Hs.164478R89716 0.128104 - - -R18742 0.128104 KIAA1896 protein KIAA1896 Hs.5476N24364 0.128104 Hypothetical protein FLJ13154 FLJ13154 Hs.25303H44662 0.128104 Talin 1 TLN1 Hs.375001N28014 0.128104 BRCA1 associated protein BRAP Hs.122764T39460 0.128104 Protein phosphatase 1, catalytic subunit, alpha isoform PPP1CA Hs.183994T80880 0.128104 ESTs ESTs Hs.268957T87890 0.128104 Hypothetical protein FLJ20772 FLJ20772 Hs.9925N43008 0.128104 Nuclear antigen Sp100 SP100 Hs.77617N24178 0.128104 ESTs ESTs Hs.293676T98538 0.128104 Adaptor-related protein complex 3, beta 1 subunit AP3B1 Hs.155172H39913 0.128104 - - Hs.144532R16551 0.128104 - - -AA149828 0.128104 Gm117 gm117 Hs.26226N24276 0.128104 Transaldolase 1 TALDO1 Hs.77290N62816 0.128104 Hypothetical protein FLJ11236 FLJ11236 Hs.10441AA005369 0.128104 KIAA1270 protein KIAA1270 Hs.197668AA011400 0.128104 Dipeptidylpeptidase 9 DPP9 Hs.237617R72846 0.128104 Branched chain alpha-ketoacid dehydrogenase kinase BCKDK Hs.20644W33047 0.128104 - - Hs.348976H51915 0.128104 - - Hs.180372R59109 0.128104 A kinase (PRKA) anchor protein (yotiao) 9 AKAP9 Hs.58103AA058864 0.128104 Adenylosuccinate synthase ADSS Hs.90011R24577 0.128104 Arginine-glutamic acid dipeptide (RE) repeats RERE Hs.194369R86309 0.128104 Vacuolar protein sorting 35 (yeast) VPS35 Hs.355901N66247 0.128104 - - Hs.6390T70741 0.133376 - - Hs.293476N51855 0.133376 ADP-ribosyltransferase (NAD+; poly(ADP-ribose) polymerase)-like 2 ADPRTL2 Hs.24284T79625 0.133376 ESTs ESTs Hs.14064H91623 0.133376 - - -T66828 0.133376 Hypothetical protein FLJ36748 FLJ36748 Hs.64313AA134744 0.133376 TERF1 (TRF1)-interacting nuclear factor 2 TINF2 Hs.7797AA015841 0.133376 Guanine nucleotide binding protein (G protein), gamma transducing activity pol GNGT1 Hs.73112H12615 0.133376 Hypothetical protein FLJ11273 FLJ11273 Hs.3542N30514 0.133376 Adenylosuccinate synthase ADSS Hs.90011R40685 0.133376 SAC1 suppressor of actin mutations 1-like (yeast) SACM1L Hs.5867W02149 0.133376 Cell division cycle 2-like 1 (PITSLRE proteins) CDC2L1 Hs.214291H72512 0.133376 HSPC023 protein HSPC023 Hs.279945H53141 0.133376 ESTs ESTs Hs.268917AA114842 0.133376 Tripartite motif-containing 3 TRIM3 Hs.321576R47985 0.133376 - - Hs.378970R93168 0.133376 Immune associated nucleotide 4 like 1 (mouse) IAN4L1 Hs.26194AA037078 0.133376 B7-H1 protein B7-H1 Hs.97269AA056541 0.133376 D component of complement (adipsin) DF Hs.155597R34439 0.133376 - - Hs.290270R13546 0.133376 Endothelial differentiation, sphingolipid G-protein-coupled receptor, 1 EDG1 Hs.154210T79589 0.133376 Transmembrane protease, serine 4 TMPRSS4 Hs.63325N92570 0.133376 Uncharacterized bone marrow protein BM042 BM042 Hs.324136N31020 0.133376 KIAA0102 gene product KIAA0102 Hs.77665R19117 0.133376 ESTs ESTs Hs.169142AA099636 0.133376 KIAA1039 protein KIAA1039 Hs.301552H92328 0.133376 Hypothetical protein FLJ10874 FLJ10874 Hs.30318H93330 0.133376 Solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulatory factoSLC9A3R1 Hs.184276T78109 0.133376 - - Hs.296322AA046321 0.133376 Utrophin (homologous to dystrophin) UTRN Hs.286161W31430 0.133376 Membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigMCP Hs.83532H44309 0.133376 Solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 SLC25A1 Hs.111024H15059 0.133376 KIAA0582 protein KIAA0582 Hs.79507H30717 0.133376 GRB2-associated binding protein 2 GAB2 Hs.30687N50315 0.133376 Pre-mRNA splicing SR protein rA4 KIAA1172 Hs.125134H89743 0.138815 Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) LSS Hs.93199AA135338 0.138815 ESTs ESTs Hs.132947

W91999 0.138815 Mitogen-activated protein kinase-activated protein kinase 5 MAPKAPK5 Hs.30327H09315 0.138815 Proprotein convertase subtilisin/kexin type 7 PCSK7 Hs.32978N55592 0.138815 Ubiquitin specific protease 20 USP20 Hs.5452AA054477 0.138815 - - Hs.25391W92270 0.138815 Fc fragment of IgG, low affinity IIa, receptor for (CD32) FCGR2A Hs.78864N90432 0.138815 Hypothetical protein FLJ10706 FLJ10706 Hs.273193T66206 0.138815 VCY2 interacting protein 1 VCY2IP1 Hs.66048H80862 0.138815 Hypothetical protein KIAA1259 KIAA1259 Hs.40193R18817 0.138815 ESTs ESTs Hs.22550AA044639 0.138815 - - -N52681 0.138815 Golgi complex associated protein 1, 60kDa GOCAP1 Hs.6831AA026902 0.138815 GDP-fucose transporter 1 FLJ11320 Hs.12211W52914 0.138815 - - Hs.188212T86392 0.138815 Dynein, cytoplasmic, heavy polypeptide 1 DNCH1 Hs.7720N91510 0.138815 Hypothetical protein from EUROIMAGE 2107395 LOC58492 Hs.38004W52509 0.138815 Likely ortholog of yeast ARV1 ARV1 Hs.23360W42543 0.138815 Hexosaminidase A (alpha polypeptide) HEXA Hs.119403H02545 0.138815 ESTs ESTs Hs.191170H26567 0.138815 Bone morphogenetic protein 1 BMP1 Hs.1274R52317 0.138815 Ras-like without CAAX 2 RIT2 Hs.47626W04602 0.138815 Hypothetical protein FLJ11807 FLJ11807 Hs.285813R39701 0.144423 - - -AA150253 0.144423 Similar to ecotropic viral integration site 5; Neuroblastoma stage 4S gene LOC115704 Hs.26870R35157 0.144423 Diacylglycerol kinase, delta 130kDa DGKD Hs.115907N63417 0.144423 Beta-site APP-cleaving enzyme 2 BACE2 Hs.271411R55335 0.144423 - - -H08480 0.144423 MDS024 protein MDS024 Hs.286122R21391 0.144423 Hypothetical protein DKFZp564D0478 DKFZP564D0478 Hs.321214R66029 0.144423 Bromodomain adjacent to zinc finger domain, 1A BAZ1A Hs.8858AA053876 0.144423 DKFZP586M1523 protein DKFZP586M1523 Hs.22981R53661 0.144423 Phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog PDE4D Hs.172081N70581 0.144423 Centrin, EF-hand protein, 2 CETN2 Hs.82794H60417 0.144423 - - Hs.20000T58682 0.144423 Chromosome 1 open reading frame 16 C1orf16 Hs.15087H43827 0.144423 V-myc myelocytomatosis viral oncogene homolog (avian) MYC Hs.79070R31649 0.144423 Huntingtin interacting protein 2 HIP2 Hs.155485T96407 0.144423 - - -R71903 0.144423 Pygopus 2 PYGO2 Hs.356579N39088 0.144423 - - Hs.356387H12151 0.144423 Phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synt GART Hs.82285H66118 0.144423 - - Hs.285520H43477 0.144423 PCF11p homolog PCF11 Hs.123654T81220 0.144423 - - -W02280 0.144423 - - Hs.374582T79825 0.144423 - EST Hs.332668H38180 0.144423 DKFZP434C212 protein DKFZP434C212 Hs.172069N27557 0.144423 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 PSMD9 Hs.5648R70779 0.150204 - - Hs.352579N31589 0.150204 Type I sigma receptor SR-BP1 Hs.24447W05850 0.150204 Emopamil binding protein (sterol isomerase) EBP Hs.75105R74477 0.150204 Microtubule-associated proteins 1A/1B light chain 3 MAP1A/1BLC3 Hs.121849N79069 0.150204 - - -H82057 0.150204 - - Hs.372741N35002 0.150204 Dom-3 homolog Z (C. elegans) DOM3Z Hs.153299AA099585 0.150204 Phosphodiesterase 7B PDE7B Hs.283016R77592 0.150204 Chromatin accessibility complex 1 CHRAC1 Hs.279704AA044954 0.150204 Tight junction protein 2 (zona occludens 2) TJP2 Hs.75608N95573 0.150204 TBP-like 1 TBPL1 Hs.13993N24689 0.150204 - - Hs.372542R11580 0.150204 Formin binding protein 3 FNBP3 Hs.107213W47347 0.150204 Hypothetical protein FLJ11198 FLJ11198 Hs.91251H20507 0.150204 Similar to ecotropic viral integration site 5; Neuroblastoma stage 4S gene LOC115704 Hs.26870H45525 0.150204 Ras homolog gene family, member G (rho G) ARHG Hs.75082AA040372 0.150204 Proline-rich protein HaeIII subfamily 1 PRH1 Hs.278469H44002 0.150204 - - -AA149043 0.150204 Type I transmembrane protein Fn14 FN14 Hs.10086R51894 0.150204 Replication factor C (activator 1) 1, 145kDa RFC1 Hs.166563H59130 0.150204 Sec23 homolog B (S. cerevisiae) SEC23B Hs.173497AA053340 0.150204 - - Hs.109212T85558 0.150204 ESTs ESTs Hs.332720N49211 0.150204 HEMK homolog 7kb HEMK Hs.46907R94457 0.150204 Guanine monphosphate synthetase GMPS Hs.5398R78049 0.150204 DKFZP566I1024 protein DKFZP566I1024 Hs.279696H90964 0.150204 Zinedin ZIN Hs.108665N53897 0.150204 - - Hs.58966AA102103 0.150204 Stromal antigen 2 STAG2 Hs.8217R51179 0.150204 - - -W68672 0.150204 RAB, member of RAS oncogene family-like 2B RABL2B Hs.355874R80399 0.150204 Dishevelled, dsh homolog 3 (Drosophila) DVL3 Hs.174044H86108 0.150204 RAB11A, member RAS oncogene family RAB11A Hs.75618N63795 0.150204 ESTs ESTs Hs.355467W04510 0.156159 TCF3 (E2A) fusion partner (in childhood Leukemia) TFPT Hs.233765H47425 0.156159 Proteolipid protein 2 (colonic epithelium-enriched) PLP2 Hs.77422R64137 0.156159 ESTs ESTs Hs.108887T78085 0.156159 - - Hs.133407R51031 0.156159 - - Hs.349283AA029451 0.156159 Transcription factor 7-like 2 (T-cell specific, HMG-box) TCF7L2 Hs.348412N79912 0.156159 Guanine nucleotide binding protein (G protein), beta polypeptide 1 GNB1 Hs.215595R69062 0.156159 Lipidosin BG1 Hs.277543AA194944 0.156159 - - -AA135731 0.156159 ESTs ESTs Hs.71428T65042 0.156159 - - -R15444 0.156159 - - Hs.69476R73223 0.156159 TGFB1-induced anti-apoptotic factor 1 TIAF1 Hs.75822N34765 0.156159 - - -H50906 0.156159 Stannin SNN Hs.76691N74700 0.156159 Similar to Caenorhabditis elegans protein C42C1.9 KEO4 Hs.285818W46553 0.156159 Hypothetical protein FLJ38984 FLJ38984 Hs.112023N67453 0.156159 Cyclin-dependent kinase inhibitor 1A (p21, Cip1) CDKN1A Hs.179665N91450 0.156159 - - Hs.141003

W37878 0.156159 - - Hs.294142T86389 0.156159 ESTs ESTs Hs.100640T70340 0.156159 General transcription factor IIIC, polypeptide 3, 102kDa GTF3C3 Hs.90847W47525 0.156159 - - Hs.110771H86876 0.156159 Heparan sulfate (glucosamine) 3-O-sulfotransferase 1 HS3ST1 Hs.40968AA001906 0.156159 Thyroid hormone receptor-associated protein, 240 kDa subunit TRAP240 Hs.11861N36912 0.156159 KIAA1737 protein KIAA1737 Hs.22452R79688 0.156159 - - -AA135452 0.156159 CGG triplet repeat binding protein 1 CGGBP1 Hs.86041W33066 0.156159 Mitochondrial ribosomal protein L9 MRPL9 Hs.288936N29139 0.156159 V-jun sarcoma virus 17 oncogene homolog (avian) JUN Hs.78465N68626 0.162291 Splicing factor 1 SF1 Hs.180677H52752 0.162291 Heat shock 70kDa protein 9B (mortalin-2) HSPA9B Hs.3069AA034317 0.162291 Candidate tumor suppressor protein LOC57107 Hs.16608T82117 0.162291 ESTs ESTs Hs.191196AA043530 0.162291 - - Hs.99841AA047464 0.162291 RAN binding protein 2 RANBP2 Hs.199179H29857 0.162291 Transducer of ERBB2, 1 TOB1 Hs.178137R52104 0.162291 Gemin 5 GEMIN5 Hs.25882AA211825 0.162291 - - -N81096 0.162291 KIAA0614 protein KIAA0614 Hs.7314T97303 0.162291 Signal sequence receptor, alpha (translocon-associated protein alpha) SSR1 Hs.250773T84264 0.162291 RAP2B, member of RAS oncogene family RAP2B Hs.239527R94499 0.162291 Guanine nucleotide binding protein (G protein), beta 5 GNB5 Hs.155090H21130 0.162291 Ran GTPase activating protein 1 RANGAP1 Hs.183800N92911 0.162291 Hypothetical protein dJ473B4 DJ473B4 Hs.57549N80149 0.162291 - - Hs.323017N40831 0.162291 Microsomal glutathione S-transferase 3 MGST3 Hs.111811T91993 0.162291 ESTs ESTs Hs.347475N48163 0.162291 Hypothetical protein MGC13186 MGC13186 Hs.16034T72620 0.162291 ESTs ESTs Hs.117915R42028 0.162291 Nardilysin (N-arginine dibasic convertase) NRD1 Hs.4099R51134 0.162291 ESTs ESTs Hs.378118R12948 0.162291 NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa NDUFV1 Hs.7744N30285 0.162291 FUS interacting protein (serine-arginine rich) 1 FUSIP1 Hs.3530W37084 0.162291 Hypothetical protein FLJ14743 FLJ14743 Hs.169577AA036794 0.162291 Hypothetical protein MGC3162 MGC3162 Hs.95196R52048 0.168603 Upstream regulatory element binding protein 1 UREB1 Hs.3383AA035361 0.168603 Signal transducer and activator of transcription 1, 91kDa STAT1 Hs.21486N24030 0.168603 Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma IKBKG Hs.43505N99984 0.168603 Hypothetical protein FLJ36666 FLJ36666 Hs.7604N53193 0.168603 Polymerase (DNA directed), epsilon POLE Hs.166846AA134529 0.168603 DKFZP566D193 protein DKFZP566D193 Hs.106909W47014 0.168603 Ts translation elongation factor, mitochondrial TSFM Hs.340959N64399 0.168603 Oxysterol binding protein-like 1A OSBPL1A Hs.252716N63791 0.168603 - - Hs.355772N95498 0.168603 - - Hs.109007AA046956 0.168603 DAZ associated protein 1 DAZAP1 Hs.65588R25877 0.168603 Hypothetical protein FLJ10511 FLJ10511 Hs.106768H79508 0.168603 - - -W42880 0.168603 Tripartite motif-containing 8 TRIM8 Hs.54580W15295 0.168603 BCL2-associated athanogene 5 BAG5 Hs.5443AA056486 0.168603 - - -T78498 0.168603 Hypothetical protein FLJ22569 FLJ22569 Hs.234355W44956 0.168603 2,4-dienoyl CoA reductase 1, mitochondrial DECR1 Hs.81548W86191 0.168603 Pseudouridylate synthase 1 PUS1 Hs.23723H10385 0.168603 - - Hs.374535H19719 0.168603 Gemin 5 GEMIN5 Hs.25882T95699 0.168603 Chromosome 11 hypothetical protein ORF4 LOC56834 Hs.25274AA034128 0.168603 - - -N49757 0.168603 Polymerase (DNA directed), mu POLM Hs.46964H15122 0.168603 Sex comb on midleg homolog 1 SCMH1 Hs.57475H12660 0.168603 Sarcolemma associated protein SLMAP Hs.4007AA128183 0.168603 Meningioma expressed antigen 5 (hyaluronidase) MGEA5 Hs.5734N66188 0.168603 Splicing factor, arginine/serine-rich 2 SFRS2 Hs.73965N24109 0.168603 Annexin A11 ANXA11 Hs.75510T77481 0.168603 LIS1-interacting protein NUDEL; endooligopeptidase A NUDEL Hs.3850R54733 0.168603 - - Hs.299119N35485 0.168603 MAD1 mitotic arrest deficient-like 1 (yeast) MAD1L1 Hs.7345N93186 0.175098 Heme oxygenase (decycling) 2 HMOX2 Hs.284279AA148461 0.175098 Hypothetical protein LOC51315 LOC51315 Hs.5721W38730 0.175098 Poly(rC) binding protein 2 PCBP2 Hs.63525R27762 0.175098 CGI-141 protein LOC51026 Hs.62275R75976 0.175098 - - Hs.373548H00846 0.175098 Chromosome 11 hypothetical protein ORF4 LOC56834 Hs.25274T97206 0.175098 Hypothetical protein FLJ10747 FLJ10747 Hs.189782AA150265 0.175098 Reticulocalbin 1, EF-hand calcium binding domain RCN1 Hs.167791AA054495 0.175098 - - -R80243 0.175098 X-box binding protein 1 XBP1 Hs.149923R25983 0.175098 N-ethylmaleimide-sensitive factor NSF Hs.108802W04808 0.175098 - - Hs.16346R45681 0.175098 TRAF and TNF receptor-associated protein AD022 Hs.46847W31443 0.175098 Hypothetical protein MGC14433 MGC14433 Hs.83572R49537 0.175098 Met proto-oncogene (hepatocyte growth factor receptor) MET Hs.285754N20172 0.175098 Tumor protein p53 binding protein, 2 TP53BP2 Hs.44585R06442 0.175098 TP53 target gene 1 TP53TG1 Hs.274329R83448 0.175098 - - Hs.331666AA040043 0.175098 Protocadherin 20 PCDH20 Hs.132892N49756 0.175098 - - Hs.348978H58445 0.175098 Nucleoporin 98kDa NUP98 Hs.112255R71157 0.175098 Hypothetical protein FLJ10759 FLJ10759 Hs.15921AA128582 0.175098 Translocase of inner mitochondrial membrane 44 homolog (yeast) TIMM44 Hs.123178R05441 0.175098 MT-protocadherin KIAA1775 Hs.137556H28053 0.175098 Down-regulated by Ctnnb1, a DRCTNNB1A Hs.85603H19387 0.175098 Malic enzyme 2, NAD(+)-dependent, mitochondrial ME2 Hs.75342AA034009 0.175098 Outer dense fibre of sperm tails 2 ODF2 Hs.129055R16169 0.175098 Stromal cell-derived factor 2 SDF2 Hs.118684R01226 0.175098 - - Hs.348515N93807 0.175098 - EST Hs.144224W89140 0.175098 ESTs ESTs Hs.14691

R89847 0.175098 ESTs ESTs Hs.175979N/A2 0.175098 - - -R09452 0.181778 Hypothetical protein FLJ10460 FLJ10460 Hs.14347W87791 0.181778 - - -W33139 0.181778 Hypothetical protein dJ122O8.2 DJ122O8.2 Hs.268115AA045048 0.181778 Sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmeSEMA5B Hs.61384R79614 0.181778 KIAA0256 gene product KIAA0256 Hs.118978N90523 0.181778 Methionyl-tRNA formyltransferase, mitochondrial MtFMT Hs.54627AA047388 0.181778 Hepatitis C virus core-binding protein 6 HCBP6 Hs.283674N79649 0.181778 C21orf19-like protein LOC51072 Hs.20814W86640 0.181778 Receptor (TNFRSF)-interacting serine-threonine kinase 1 RIPK1 Hs.296327W07372 0.181778 MBIP protein MBIP Hs.16755AA029551 0.181778 ESTs ESTs Hs.61373R32270 0.181778 Epithelial membrane protein 2 EMP2 Hs.29191H61812 0.181778 Cyclin-dependent kinase 4 CDK4 Hs.95577H16567 0.181778 Hypothetical protein FLJ20195 FLJ20195 Hs.286261H56735 0.181778 Hypothetical protein FLJ13611 FLJ13611 Hs.282958N72125 0.181778 - - -AA029926 0.181778 - - Hs.351292W85882 0.181778 Hypothetical protein FLJ10349 FLJ10349 Hs.19333H74312 0.181778 Phosphatidic acid phosphatase type 2B PPAP2B Hs.173717R20808 0.181778 POP7 (processing of precursor, S. cerevisiae) homolog RPP20 Hs.18747N92371 0.181778 Hypothetical protein, clone 24751 CL24751 Hs.29344N36898 0.181778 Similar to rat nuclear ubiquitous casein kinase 2 NUCKS Hs.118064H28667 0.181778 Sterile alpha motif and leucine zipper containing kinase AZK ZAK Hs.115175R14138 0.181778 - - -W37346 0.181778 DIPB protein HSA249128 Hs.14512R39264 0.181778 Mitotic phosphoprotein 44 LOC129401 Hs.180591AA005328 0.181778 V-ski sarcoma viral oncogene homolog (avian) SKI Hs.2969N49027 0.181778 KIAA0460 protein KIAA0460 Hs.29956AA044942 0.181778 Eukaryotic translation initiation factor 4 gamma, 1 EIF4G1 Hs.211568R07187 0.181778 Ornithine decarboxylase antizyme 2 OAZ2 Hs.74563N22700 0.181778 Hypothetical protein FLJ12584 FLJ12584 Hs.288897N26378 0.181778 Glycerol kinase GK Hs.1466R81830 0.181778 Zinc finger protein 217 ZNF217 Hs.155040T96991 0.181778 Thioredoxin reductase 1 TXNRD1 Hs.13046H48501 0.181778 SCN Circadian Oscillatory Protein (SCOP) SCOP Hs.38176N43897 0.181778 Integrin beta 4 binding protein ITGB4BP Hs.5215R21092 0.181778 Carbonic anhydrase I CA1 Hs.23118N25348 0.181778 V-ets erythroblastosis virus E26 oncogene homolog 1 (avian) ETS1 Hs.18063H03156 0.181778 Glutamine-fructose-6-phosphate transaminase 1 GFPT1 Hs.1674N36043 0.181778 Hypothetical protein FLJ10597 FLJ10597 Hs.90375R44195 0.181778 DiGeorge syndrome critical region gene DGSI; likely ortholog of mouse expres DGSI Hs.154879N26506 0.188645 Ribosomal protein S17 RPS17 Hs.5174W56563 0.188645 Mitochondrial ribosomal protein S28 MRPS28 Hs.55097R56535 0.188645 ESTs ESTs Hs.106672W40367 0.188645 3-hydroxy-3-methylglutaryl-Coenzyme A reductase HMGCR Hs.11899R32216 0.188645 P53-induced protein PIGPC1 PIGPC1 Hs.303125R51914 0.188645 CGI-87 protein LOC51112 Hs.5008W21221 0.188645 RNA binding motif protein 4 RBM4 Hs.42826R84726 0.188645 Adenosine A1 receptor ADORA1 Hs.77867H43602 0.188645 Chondroitin 4-O-sulfotransferase 2 C4S-2 Hs.25204AA121308 0.188645 TRNA isopentenylpyrophosphate transferase IPT Hs.356554N47654 0.188645 KIAA0140 gene product KIAA0140 Hs.156016R94724 0.188645 Phytanoyl-CoA hydroxylase (Refsum disease) PHYH Hs.172887AA037833 0.188645 Hypothetical protein MGC20496 MGC20496 Hs.12106H93335 0.188645 Zinc finger protein, subfamily 1A, 4 (Eos) ZNFN1A4 Hs.302031N32331 0.188645 Hypothetical protein FLJ14825 FLJ14825 Hs.334824AA011595 0.188645 Zinc finger protein 38 ZNF38 Hs.20082H89571 0.188645 - - -T93107 0.188645 - - Hs.110771H57824 0.188645 ESTs ESTs Hs.128746R35007 0.188645 - - -AA045373 0.188645 Transcription elongation factor A (SII)-like 1 TCEAL1 Hs.95243N30854 0.188645 Lectin, mannose-binding, 1 LMAN1 Hs.287912H14085 0.188645 Transmembrane 4 superfamily member tetraspan NET-5 NET-5 Hs.129826W68622 0.188645 Coatomer protein complex, subunit alpha COPA Hs.75887R93042 0.188645 - - -T78883 0.188645 ESTs ESTs Hs.268596N74995 0.188645 RAB35, member RAS oncogene family RAB35 Hs.94308R01143 0.188645 Solute carrier family 35 (UDP-galactose transporter), member 2 SLC35A2 Hs.21899N29706 0.195701 Hypothetical protein FLJ10587 FLJ10587 Hs.7296AA047130 0.195701 - - -N39397 0.195701 Brain acyl-CoA hydrolase BACH Hs.8679W94116 0.195701 - - Hs.293656AA045664 0.195701 Uncharacterized hematopoietic stem/progenitor cells protein MDS031 MDS031 Hs.110853N36138 0.195701 3-hydroxy-3-methylglutaryl-Coenzyme A reductase HMGCR Hs.11899N75060 0.195701 Coatomer protein complex, subunit beta COPB Hs.3059AA005173 0.195701 Hypothetical protein FLJ21144 FLJ21144 Hs.59584H08264 0.195701 Splicing factor 3b, subunit 4, 49kDa SF3B4 Hs.25797N30054 0.195701 - - -N70152 0.195701 CGI-99 protein LOC51637 Hs.110803AA203242 0.195701 Ankyrin repeat and SOCS box-containing 13 ASB13 Hs.99603AA053304 0.195701 Hypothetical protein BC017169 LOC91137 Hs.75639AA149177 0.195701 Autoantigen RCD-8 Hs.75682AA203387 0.195701 Trophinin associated protein (tastin) TROAP Hs.171955R45669 0.195701 MORF-related gene 15 MRG15 Hs.6353R22904 0.195701 8D6 antigen 8D6A Hs.106196T91747 0.195701 ESTs ESTs Hs.268612H93200 0.195701 ESTs ESTs Hs.269052R47941 0.195701 Hypothetical protein BC018453 LOC129531 Hs.14222N21528 0.195701 Leucine rich repeat (in FLII) interacting protein 2 LRRFIP2 Hs.57672W63553 0.195701 Hypothetical protein BC001573 LOC134147 Hs.349344W05750 0.195701 Protein containing CXXC domain 2 PCCX2 Hs.199009H45307 0.195701 Dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 DYRK4 Hs.17154N45679 0.195701 Likely ortholog of mouse variant polyadenylation protein CSTF-64 CSTF2T Hs.21992AA043812 0.195701 Sentrin/SUMO-specific protease SENP1 Hs.66450AA120761 0.195701 E74-like factor 1 (ets domain transcription factor) ELF1 Hs.154365R51937 0.195701 LIM domain kinase 2 LIMK2 Hs.278027R76834 0.195701 Hypothetical protein FLJ10392 FLJ10392 Hs.20887

H92499 0.195701 ESTs ESTs Hs.289083R73278 0.195701 Intercellular adhesion molecule 3 ICAM3 Hs.99995AA047258 0.195701 TNF receptor-associated factor 5 TRAF5 Hs.29736N66246 0.195701 Activating transcription factor 6 ATF6 Hs.5813W31281 0.195701 - - Hs.182036N58731 0.195701 - - -AA057338 0.195701 General transcription factor IIH, polypeptide 1, 62kDa GTF2H1 Hs.89578H00239 0.195701 ATP-binding cassette, sub-family F (GCN20), member 2 ABCF2 Hs.153612H01676 0.195701 Hypothetical protein BC002494 LOC92579 Hs.294005N24671 0.202949 CGI-111 protein LOC51015 Hs.11085H20342 0.202949 - - Hs.173699H52953 0.202949 Hypothetical protein MGC20255 MGC20255 Hs.334775N36282 0.202949 ESTs ESTs Hs.356537H68838 0.202949 Nuclear receptor subfamily 2, group C, member 1 NR2C1 Hs.108301T94596 0.202949 Vacuolar protein sorting 26 (yeast) VPS26 Hs.67052H29296 0.202949 Development and differentiation enhancing factor 2 DDEF2 Hs.12802H49981 0.202949 - - Hs.113994W86967 0.202949 KIAA1450 protein KIAA1450 Hs.83243W74523 0.202949 Aldo-keto reductase family 1, member A1 (aldehyde reductase) AKR1A1 Hs.89529R39865 0.202949 Jerky homolog (mouse) JRK Hs.142296W15280 0.202949 Chromosome 9 open reading frame 5 C9orf5 Hs.86412H40662 0.202949 - - -T96118 0.202949 - - Hs.226313R23473 0.202949 Hypothetical protein FLJ20624 FLJ20624 Hs.52256T86315 0.202949 Ribonuclease, RNase A family, 2 (liver, eosinophil-derived neurotoxin) RNASE2 Hs.728R15291 0.202949 - - -T98251 0.202949 - - Hs.288581R83037 0.202949 Hypothetical protein FLJ20008 FLJ20008 Hs.14235R12743 0.202949 KIAA1131 protein KIAA1131 Hs.210850H95278 0.202949 Phosphogluconate dehydrogenase PGD Hs.75888N34004 0.202949 Signal transducer and activator of transcription 6, interleukin-4 induced STAT6 Hs.181015R72314 0.202949 - - -AA031347 0.202949 - - Hs.355548W07487 0.202949 KIAA0870 protein KIAA0870 Hs.18166AA037447 0.202949 Acid phosphatase 1, soluble ACP1 Hs.75393AA149333 0.202949 Actinin, alpha 1 ACTN1 Hs.119000W70111 0.202949 Alcohol dehydrogenase 5 (class III), chi polypeptide ADH5 Hs.78989H03230 0.202949 - - -R20384 0.202949 Leucine carboxyl methyltransferase LCMT Hs.8054AA047077 0.202949 Amylase, alpha 2B; pancreatic AMY2B Hs.335493N36411 0.202949 ESTs ESTs Hs.44754AA039284 0.202949 Hypothetical protein FLJ10290 FLJ10290 Hs.25516T77328 0.202949 Similar to HYPOTHETICAL 34.0 KDA PROTEIN ZK795.3 IN CHROMOSOME MGC19606 Hs.91579H88464 0.202949 KIAA0560 gene product KIAA0560 Hs.129952R20347 0.202949 Hypothetical protein FLJ22386 FLJ22386 Hs.22795T97612 0.202949 ESTs ESTs Hs.272066N33225 0.202949 ESTs ESTs Hs.237749R99867 0.202949 G protein-binding protein CRFG CRFG Hs.215766AA037624 0.210391 Hypothetical protein MGC5242 MGC5242 Hs.77365N36888 0.210391 DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae) DCLRE1A Hs.1560R42203 0.210391 Mitochondrial ribosomal protein S27 MRPS27 Hs.122669H51393 0.210391 Transient receptor potential cation channel, subfamily V, member 2 TRPV2 Hs.279746AA131747 0.210391 Scribble SCRIB Hs.239784H94177 0.210391 High-mobility group nucleosomal binding domain 2 HMGN2 Hs.181163W39400 0.210391 Matrix metalloproteinase 11 (stromelysin 3) MMP11 Hs.155324R11158 0.210391 Nuclear localization signal deleted in velocardiofacial syndrome NLVCF Hs.19500AA043893 0.210391 Neuroepithelial cell transforming gene 1 NET1 Hs.25155AA002041 0.210391 Zinc finger protein 262 ZNF262 Hs.150390H24644 0.210391 - - -W86818 0.210391 Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-a IKBKAP Hs.31323N21227 0.210391 Brain protein I3 BRI3 Hs.75922H07938 0.210391 Hypothetical protein FLJ21044 similar to Rbig1 FLJ21044 Hs.25477H78210 0.210391 Uridine kinase-like 1 URKL1 Hs.39850AA203552 0.210391 - - Hs.193007N21529 0.210391 - - -H96259 0.210391 Similar to putative transmembrane protein; homolog of yeast Golgi membrane LOC90522 Hs.334725N32500 0.210391 ESTs ESTs Hs.170277T83198 0.210391 Putative receptor protein PMI Hs.15196R40412 0.210391 Catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-r CTNND2 Hs.80220H03273 0.210391 PEST-containing nuclear protein PCNP Hs.283728AA133495 0.210391 Triggering receptor expressed on myeloid cells 2 TREM2 Hs.44234H71793 0.210391 X-box binding protein 1 XBP1 Hs.149923AA054499 0.210391 - - Hs.143885H15212 0.210391 Transducer of ERBB2, 2 TOB2 Hs.4994R32023 0.210391 Golgi autoantigen, golgin subfamily a, 5 GOLGA5 Hs.241572H15131 0.210391 - - Hs.4866R99528 0.210391 UDP-glucuronate decarboxylase 1 UXS1 Hs.288158N23942 0.210391 MEP50 protein MEP50 Hs.11039W04612 0.210391 JM5 protein JM5 Hs.21753R26509 0.210391 Platelet-derived growth factor receptor, beta polypeptide PDGFRB Hs.76144AA043739 0.218028 - - Hs.96513H50774 0.218028 Similar to S. cerevisiae Sec6p and R. norvegicus rsec6 SEC6 Hs.8088H02832 0.218028 Hypothetical protein FLJ23476 FLJ23476 Hs.46736R18971 0.218028 Hypothetical protein DKFZp586I021 DKFZp586I021 Hs.181077H11807 0.218028 CTP synthase CTPS Hs.251871W63760 0.218028 Coilin COIL Hs.966R71176 0.218028 Slingshot 3 SSH-3 Hs.29173N33439 0.218028 Eukaryotic translation elongation factor 2 EEF2 Hs.75309AA045053 0.218028 Pleiotrophin (heparin binding growth factor 8, neurite growth-promoting factor 1PTN Hs.44W90154 0.218028 DKFZP434B168 protein DKFZP434B168 Hs.48604AA047760 0.218028 Phosphodiesterase 6G, cGMP-specific, rod, gamma PDE6G Hs.1857N80155 0.218028 - - Hs.18672T87767 0.218028 ESTs ESTs Hs.16439R80587 0.218028 Protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoforPPP2R2A Hs.179574N78617 0.218028 Phosphodiesterase 5A, cGMP-specific PDE5A Hs.139271AA034395 0.218028 Protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1 PIN1 Hs.161362AA054300 0.218028 Kelch-like 4 (Drosophila) KLHL4 Hs.49075R05817 0.218028 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa NDUFA7 Hs.19561H44437 0.218028 - - Hs.324342AA130297 0.218028 - - Hs.379757

AA133962 0.218028 PRO0149 protein PRO0149 Hs.64056W47177 0.218028 GCN5 general control of amino-acid synthesis 5-like 1 (yeast) GCN5L1 Hs.94672T69784 0.218028 Fragile X mental retardation, autosomal homolog 2 FXR2 Hs.52788AA041277 0.218028 - - -T85009 0.218028 Hypothetical protein FLJ32203 FLJ32203 Hs.351706N92759 0.218028 Cytoskeleton-associated protein 4 CKAP4 Hs.74368N74712 0.218028 Similar to RIKEN cDNA 3110001D03 gene (M. musculus) MGC4730 Hs.7517AA046886 0.218028 Hypothetical protein FLJ20473 FLJ20473 Hs.9096N68160 0.218028 Hypothetical protein FLJ23306 FLJ23306 Hs.5890R41834 0.218028 KIAA1116 protein KIAA1116 Hs.227602H83706 0.218028 ESTs ESTs Hs.141358W56402 0.218028 Musashi homolog 2 (Drosophila) MSI2 Hs.173179AA044402 0.218028 Hypothetical protein FLJ11749 FLJ11749 Hs.22897AA149853 0.218028 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domainCITED4 Hs.355820N64271 0.218028 - - -AA053221 0.218028 Seven in absentia homolog 2 (Drosophila) SIAH2 Hs.20191AA127818 0.218028 - - -R50300 0.218028 Hypothetical protein DKFZp434N1923 DKFZP434N1923 Hs.295866H90643 0.218028 - - -R69610 0.218028 B-cell receptor-associated protein BAP29 BAP29 Hs.27135W58698 0.218028 - - Hs.63236R50403 0.218028 Chromosome 20 open reading frame 188 C20orf188 Hs.168073AA010033 0.218028 CDNA FLJ00103 FLJ00103 Hs.380465R76960 0.218028 Nei like 2 (E. coli) NEIL2 Hs.293818H19443 0.218028 MAP/microtubule affinity-regulating kinase 2 MARK2 Hs.157199R10284 0.218028 Hyaluronan-mediated motility receptor (RHAMM) HMMR Hs.72550R28109 0.218028 Single stranded DNA binding protein 4 SSBP4 Hs.324618N92254 0.218028 Splicing factor, arginine/serine-rich 2 SFRS2 Hs.73965R68213 0.218028 AD026 protein AD026 Hs.28847AA029240 0.218028 Ligase III, DNA, ATP-dependent LIG3 Hs.100299N24303 0.218028 - - -R52828 0.225862 Retinoic acid induced 14 RAI14 Hs.15165H19488 0.225862 - - Hs.194081AA193393 0.225862 Hypothetical protein FLJ20294 FLJ20294 Hs.7995AA036798 0.225862 - - Hs.339024W90281 0.225862 Sprouty homolog 2 (Drosophila) SPRY2 Hs.18676N40345 0.225862 Ras homolog gene family, member J ARHJ Hs.243010H62739 0.225862 - - Hs.14824H83003 0.225862 Immunoglobulin superfamily, member 1 IGSF1 Hs.22111T82265 0.225862 Nudix (nucleoside diphosphate linked moiety X)-type motif 4 NUDT4 Hs.92381AA043334 0.225862 Small nuclear RNA activating complex, polypeptide 3, 50kDa SNAPC3 Hs.164915R63807 0.225862 CGI-85 protein CGI-85 Hs.267448H02915 0.225862 Trans-activated by hepatitis C virus core protein 1 TAHCCP1 Hs.118087H03532 0.225862 Discs, large (Drosophila) homolog 5 DLG5 Hs.170290AA028124 0.225862 - - Hs.61472N98333 0.225862 Ribosomal protein L7 RPL7 Hs.153AA011445 0.225862 Caspase 3, apoptosis-related cysteine protease CASP3 Hs.74552AA005395 0.225862 - - Hs.187564H82518 0.225862 Ribokinase RBSK Hs.11916R54445 0.225862 HSPC189 protein HSPC189 Hs.20768R20548 0.225862 ESTs ESTs Hs.21119R16301 0.225862 - - -T75394 0.225862 Eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa EIF2B3 Hs.283627AA047135 0.225862 Ribonuclease/angiogenin inhibitor RNH Hs.75108R18453 0.225862 - - -AA033982 0.225862 - - Hs.110059R67103 0.225862 Bone morphogenetic protein 6 BMP6 Hs.285671H13047 0.225862 F-box only protein 22 FBXO22 Hs.369030H98836 0.225862 Sac domain-containing inositol phosphatase 3 SAC3 Hs.10037N36387 0.225862 ESTs ESTs Hs.93813W88726 0.225862 Metaxin 1 MTX1 Hs.247551AA040370 0.225862 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 CDS2 Hs.24812T67521 0.225862 U2 small nuclear ribonucleoprotein auxiliary factor, small subunit 2 U2AF1RS2 Hs.171909T77393 0.225862 Hypothetical protein FLJ20297 FLJ20297 Hs.94491R51977 0.225862 KIAA1402 protein KIAA1402 Hs.86392N77716 0.225862 Low molecular mass ubiquinone-binding protein (9.5kD) QP-C Hs.3709R76008 0.225862 RAB11B, member RAS oncogene family RAB11B Hs.239018AA010187 0.225862 Pericentrin 2 (kendrin) PCNT2 Hs.15896N32221 0.225862 Solute carrier family 12 (potassium/chloride transporters), member 6 SLC12A6 Hs.4876W04645 0.233895 ESTs ESTs Hs.322915AA043235 0.233895 Novel putative protein similar to YIL091C yeast hypothetical 84 kD protein fromDJ434O14.5 Hs.194754AA150244 0.233895 Aspartylglucosaminidase AGA Hs.207776H16646 0.233895 Hypothetical protein PP591 PP591 Hs.118666H23211 0.233895 Hypothetical protein MGC3077 MGC3077 Hs.288649H23370 0.233895 RAB22A, member RAS oncogene family RAB22A Hs.288968H51540 0.233895 Hypothetical protein FLJ14641 FLJ14641 Hs.245326R60330 0.233895 Procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-DPLOD Hs.75093H72575 0.233895 Ninein (GSK3B interacting protein) NIN Hs.44054R87919 0.233895 KIAA0370 protein KIAA0370 Hs.70500H58459 0.233895 Glycosyltransferase AD-017 AD-017 Hs.283737H48031 0.233895 Tankyrase 1 binding protein 1, 182kDa TNKS1BP1 Hs.9645N69464 0.233895 Hypothetical protein FLJ22087 FLJ22087 Hs.17230N59340 0.233895 Progesterone-induced blocking factor 1 PIBF1 Hs.43913T75481 0.233895 Ras responsive element binding protein 1 RREB1 Hs.171942W61013 0.233895 V-abl Abelson murine leukemia viral oncogene homolog 1 ABL1 Hs.146355W32939 0.233895 Zinc finger protein-like 1 ZFPL1 Hs.155165AA046217 0.233895 - - Hs.293821H60343 0.233895 Hypothetical protein LOC57143 LOC57143 Hs.15251N53940 0.233895 Hypothetical protein MGC20481 MGC20481 Hs.324127T72646 0.233895 - - -H26015 0.233895 ESTs ESTs Hs.372352H51325 0.233895 Kinesin family member 13B KIF13B Hs.15711R72283 0.233895 Hypothetical protein FLJ12089 FLJ12089 Hs.11896W87755 0.233895 ESTs ESTs Hs.269571N48161 0.233895 Upstream transcription factor 2, c-fos interacting USF2 Hs.93649R92201 0.233895 Similar to RIKEN cDNA 1810055D05 LOC131118 Hs.349177H15848 0.233895 - - Hs.31388W05126 0.233895 - - Hs.18949N29497 0.233895 - - Hs.43112R66525 0.233895 - - Hs.99804

W52126 0.233895 - - -AA069413 0.233895 Hypothetical protein FLJ22709 FLJ22709 Hs.347130AA044737 0.233895 Flotillin 2 FLOT2 Hs.184488R67585 0.233895 ESTs ESTs Hs.268748T96535 0.233895 Zinc finger protein 278 ZNF278 Hs.27801R24934 0.233895 - - Hs.356564R75921 0.233895 Serologically defined breast cancer antigen 84 SDBCAG84 Hs.169992AA059202 0.233895 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransGALNT7 Hs.246315T89038 0.242129 Insulin-like growth factor binding protein 7 IGFBP7 Hs.119206R51875 0.242129 Breakpoint cluster region BCR Hs.234799N66473 0.242129 - - Hs.249247N42428 0.242129 Ribosomal protein S24 RPS24 Hs.180450AA004836 0.242129 Hypothetical nuclear factor SBBI22 LOC57117 Hs.26323AA149240 0.242129 Similar to DNA-directed RNA polymerase I (135 kDa) Rpo1-2 Hs.86337T82048 0.242129 Endothelial differentiation-related factor 1 EDF1 Hs.174050AA131821 0.242129 Proteasome (prosome, macropain) subunit, beta type, 2 PSMB2 Hs.1390W88446 0.242129 Natural killer-tumor recognition sequence NKTR Hs.241493R70785 0.242129 Chromosome 8 open reading frame 2 C8orf2 Hs.125849T79713 0.242129 SET binding factor 1 SBF1 Hs.112049W84581 0.242129 Hypothetical protein STRAIT11499 STRAIT11499 Hs.236556N39320 0.242129 DKFZP564I052 protein DKFZP564I052 Hs.5364AA101775 0.242129 Methylcrotonoyl-Coenzyme A carboxylase 1 (alpha) MCCC1 Hs.47649AA007350 0.242129 Similar to yeast BET3 (S. cerevisiae) BET3 Hs.288013R12622 0.242129 FtsJ homolog 2 (E. coli) FTSJ2 Hs.279877H18113 0.242129 - - Hs.379038H29484 0.242129 Sjogren syndrome antigen B (autoantigen La) SSB Hs.83715AA031576 0.242129 - - Hs.143812R25698 0.242129 - - -AA099154 0.242129 Cell division cycle 34 CDC34 Hs.76932H00845 0.242129 Mitochondrial ribosomal protein L33 MRPL33 Hs.14454AA043506 0.242129 CCAAT/enhancer binding protein (C/EBP), delta CEBPD Hs.76722R72217 0.242129 Acetyl-Coenzyme A carboxylase beta ACACB Hs.183857AA047156 0.242129 ESTs ESTs Hs.323484W58375 0.242129 Solute carrier family 2 (facilitated glucose transporter), member 1 SLC2A1 Hs.169902H50481 0.242129 Dishevelled associated activator of morphogenesis 2 DAAM2 Hs.100113T49898 0.242129 Bladder cancer associated protein BLCAP Hs.5300H08978 0.242129 Calcium channel, voltage-dependent, beta 3 subunit CACNB3 Hs.250712R62439 0.242129 - - -N20501 0.242129 Bioref bioref Hs.5638N30140 0.242129 Protein kinase, AMP-activated, gamma 1 non-catalytic subunit PRKAG1 Hs.3136H26200 0.242129 - - Hs.121001N31721 0.242129 DKFZP434N161 protein DKFZP434N161 Hs.284208N95811 0.242129 Williams Beuren syndrome chromosome region 22 WBSCR22 Hs.155020N91148 0.242129 Transcription factor binding to IGHM enhancer 3 TFE3 Hs.274184W48875 0.242129 Ras association (RalGDS/AF-6) domain family 1 RASSF1 Hs.26931AA063424 0.242129 DKFZP586D0623 protein DKFZP586D0623 Hs.44468W96076 0.242129 Immediate early protein ETR101 Hs.737H80498 0.242129 KIAA0286 protein KIAA0286 Hs.14912R36523 0.242129 Neuropilin 2 NRP2 Hs.17778R40176 0.242129 Chemokine (C-X-C motif) ligand 14 CXCL14 Hs.24395T78823 0.242129 Hypothetical protein MGC5149 MGC5149 Hs.284741N72764 0.242129 - - -R05889 0.242129 Chromosome 1 open reading frame 2 C1orf2 Hs.19554R17839 0.250564 Wolf-Hirschhorn syndrome candidate 2 WHSC2 Hs.21771R56392 0.250564 Discoidin domain receptor family, member 1 DDR1 Hs.75562R86128 0.250564 Nucleoporin-like protein 1 NLP_1 Hs.168352N92370 0.250564 6-pyruvoyl-tetrahydropterin synthase/dimerization cofactor of hepatocyte nucle PCBD Hs.3192T72626 0.250564 Hypothetical protein DJ971N18.2 DJ971N18.2 Hs.169358W57953 0.250564 V-raf-1 murine leukemia viral oncogene homolog 1 RAF1 Hs.349650W79028 0.250564 Ribulose-5-phosphate-3-epimerase RPE Hs.125845N95578 0.250564 - - Hs.5855R46262 0.250564 Hypothetical protein MGC17515 MGC17515 Hs.350549N66238 0.250564 Matrix metalloproteinase 19 MMP19 Hs.154057H98614 0.250564 Zinc finger homeobox 1b ZFHX1B Hs.34871R51840 0.250564 - - -T86358 0.250564 - - Hs.193931N33745 0.250564 KIAA0841 protein KIAA0841 Hs.7426W67706 0.250564 Natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receNPR2 Hs.78518H90918 0.250564 KIAA0368 protein KIAA0368 Hs.3852AA193264 0.250564 ESTs ESTs Hs.85875R14520 0.250564 ESTs ESTs Hs.137129H09002 0.250564 ESTs ESTs Hs.170267H80753 0.250564 Chromodomain helicase DNA binding protein 1 CHD1 Hs.22670R14308 0.250564 - - Hs.107242W74647 0.250564 Melanoma inhibitory activity MIA Hs.279651H87311 0.250564 Excision repair cross-complementing rodent repair deficiency, complementationERCC1 Hs.59544H21773 0.250564 - - Hs.31845R85666 0.250564 KIAA1634 protein KIAA1634 Hs.49169W73717 0.250564 V-raf-1 murine leukemia viral oncogene homolog 1 RAF1 Hs.349650N76007 0.250564 - - Hs.141648H03490 0.250564 Hypothetical protein FLJ10563 FLJ10563 Hs.265960R76214 0.250564 Protocadherin 16 dachsous-like (Drosophila) PCDH16 Hs.9658R40254 0.250564 Hypothetical protein DKFZp434L0718 DKFZP434L0718 Hs.59236N95462 0.250564 ATP-binding cassette, sub-family F (GCN20), member 2 ABCF2 Hs.153612W39284 0.250564 Pumilio homolog 1 (Drosophila) PUM1 Hs.153834AA203686 0.250564 Retinoid X receptor, alpha RXRA Hs.20084N33201 0.250564 Cullin 4B CUL4B Hs.155976N23380 0.250564 Hypothetical protein MGC33602 MGC33602 Hs.274415H00122 0.250564 - - -R25107 0.250564 Protein phosphatase methylesterase-1 PME-1 Hs.63304H83025 0.250564 ESTs ESTs Hs.151692H59215 0.250564 Solute carrier family 25, member 13 (citrin) SLC25A13 Hs.9599H83024 0.250564 Phosphatidylethanolamine N-methyltransferase PEMT Hs.15192AA029848 0.250564 Excision repair cross-complementing rodent repair deficiency, complementationERCC5 Hs.48576R12039 0.250564 Chromosome 21 open reading frame 108 C21orf108 Hs.18759H06405 0.259203 PCTAIRE protein kinase 1 PCTK1 Hs.171834R20008 0.259203 N-acetylglucosaminidase, alpha- (Sanfilippo disease IIIB) NAGLU Hs.50727R52542 0.259203 IMP (inosine monophosphate) dehydrogenase 1 IMPDH1 Hs.850AA055757 0.259203 Cysteine and glycine-rich protein 2 CSRP2 Hs.10526T78200 0.259203 Hypothetical protein HSPC213 HSPC213 Hs.170219

AA007570 0.259203 KIAA0682 gene product KIAA0682 Hs.7482R45617 0.259203 DNA segment, single copy probe LNS-CAI/LNS-CAII (deleted in polyposis D5S346 Hs.178112H89834 0.259203 Hypothetical protein BC000919 LOC90736 Hs.33020R54426 0.259203 - - Hs.96716H51684 0.259203 PDZ domain protein (Drosophila inaD-like) INADL Hs.321197R46328 0.259203 Trinucleotide repeat containing 5 TNRC5 Hs.56828W45590 0.259203 Old astrocyte specifically induced substance OASIS Hs.13456N20310 0.259203 - - -W21078 0.259203 Exosome component Rrp46 RRP46 Hs.283741AA043365 0.259203 Origin recognition complex, subunit 4-like (yeast) ORC4L Hs.55055R59448 0.259203 Aryl hydrocarbon receptor nuclear translocator-like ARNTL Hs.74515N90789 0.259203 Membrane component, chromosome 11, surface marker 1 M11S1 Hs.278672H85554 0.259203 V-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog KRAS2 Hs.351221H09565 0.259203 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, g YWHAG Hs.25001AA026571 0.259203 Hypothetical protein FLJ21415 FLJ21415 Hs.120170H03878 0.259203 Eukaryotic translation initiation factor 4 gamma, 2 EIF4G2 Hs.183684H10393 0.259203 Hypothetical protein FLJ13117 FLJ13117 Hs.152982T79536 0.259203 - - -AA055314 0.259203 RAB14, member RAS oncogene family RAB14 Hs.5807AA136693 0.259203 Homolog of C. elegans smu-1 SMU-1 Hs.193128N90030 0.259203 - - -R54777 0.259203 - - Hs.374908R45200 0.259203 YME1-like 1 (S. cerevisiae) YME1L1 Hs.206521R22904 0.259203 8D6 antigen 8D6A Hs.106196N25253 0.259203 Chromosome 5 open reading frame 8 C5orf8 Hs.75864N26104 0.259203 O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamin OGT Hs.100293R54424 0.259203 Glutamate dehydrogenase 1 GLUD1 Hs.77508N41933 0.259203 KIAA0409 protein KIAA0409 Hs.5158N74019 0.259203 KIAA0265 protein KIAA0265 Hs.192966H77633 0.259203 Polymerase (RNA) II (DNA directed) polypeptide B, 140kDa POLR2B Hs.296014R24223 0.259203 Hypothetical protein FLJ21069 FLJ21069 Hs.341806AA004785 0.259203 Annexin A5 ANXA5 Hs.300711AA047380 0.259203 Like-glycosyltransferase LARGE Hs.25220H11708 0.259203 Mitogen-activated protein kinase kinase 4 MAP2K4 Hs.75217W78864 0.259203 Mouse Mammary Turmor Virus Receptor homolog 1 MTVR1 Hs.18686AA047640 0.259203 Dolichyl-phosphate mannosyltransferase polypeptide 3 DPM3 Hs.110477N64620 0.259203 Ribosomal protein S6 kinase, 90kDa, polypeptide 2 RPS6KA2 Hs.301664R73412 0.259203 NS1-associated protein 1 NSAP1 Hs.46801N46171 0.259203 Hypothetical protein FLJ32001 FLJ32001 Hs.288742W85843 0.259203 - - Hs.101282W78924 0.259203 HSPC142 protein HSPC142 Hs.6468AA046861 0.259203 Procollagen C-endopeptidase enhancer PCOLCE Hs.202097H05551 0.259203 Hypothetical protein FLJ34231 FLJ34231 Hs.30503R60752 0.259203 NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme QNDUFS1 Hs.8248AA045904 0.259203 6-pyruvoyltetrahydropterin synthase PTS Hs.366W93024 0.259203 - - Hs.373695T98615 0.268045 Mitogen-activated protein kinase kinase kinase 10 MAP3K10 Hs.30223R77347 0.268045 Peptidyl-prolyl isomerase G (cyclophilin G) PPIG Hs.77965R02587 0.268045 ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) ACTR1A Hs.153961H17385 0.268045 Hypothetical protein DKFZp564D1378 DKFZP564D1378 Hs.318401N31736 0.268045 Hypothetical protein FLJ25211 FLJ25211 Hs.44269W47352 0.268045 Ribosomal protein S6 kinase, 70kDa, polypeptide 2 RPS6KB2 Hs.103081H95277 0.268045 - - Hs.16773H16519 0.268045 Dolichyl-diphosphooligosaccharide-protein glycosyltransferase DDOST Hs.34789AA045668 0.268045 TRIAD3 protein TRIAD3 Hs.86228AA041347 0.268045 Hypothetical protein FLJ13984 FLJ13984 Hs.135146H09771 0.268045 - - -N72697 0.268045 Hypothetical protein FLJ10604 FLJ10604 Hs.26516N93365 0.268045 Chromosome 21 open reading frame 2 C21orf2 Hs.153452H87034 0.268045 Bicaudal D homolog 1 (Drosophila) BICD1 Hs.164975N95771 0.268045 - - Hs.42173AA121538 0.268045 Homer, neuronal immediate early gene, 3 HOMER-3 Hs.166146W56877 0.268045 Up-regulated in liver cancer 1 UPLC1 Hs.44579AA029810 0.268045 - - Hs.79531AA035055 0.268045 - - Hs.374400H07105 0.268045 Dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 DYRK2 Hs.173135AA128128 0.268045 V-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 YES1 Hs.194148R39199 0.268045 Notch homolog 2 (Drosophila) NOTCH2 Hs.8121H43652 0.268045 Conserved gene telomeric to alpha globin cluster CGTHBA Hs.19699W58197 0.268045 Amyloid beta (A4) precursor-like protein 2 APLP2 Hs.279518AA035766 0.268045 Spermidine/spermine N1-acetyltransferase SAT Hs.28491R31309 0.268045 MAP-kinase activating death domain MADD Hs.82548N47551 0.268045 - - -AA010057 0.268045 Thyroid hormone receptor interactor 11 TRIP11 Hs.85092R89136 0.268045 - - -R51281 0.268045 Anaphase-promoting complex 1; meiotic checkpoint regulator MCPR Hs.40137AA043061 0.268045 - - Hs.352417AA004997 0.268045 Thyroid hormone receptor-associated protein (100 kDa) TRAP100 Hs.23106AA147549 0.268045 KIAA1999 protein KIAA1999 Hs.9343AA056558 0.268045 Tight junction protein 2 (zona occludens 2) TJP2 Hs.75608N93133 0.268045 Promyelocytic leukemia PML Hs.89633W88496 0.268045 Zizimin1 zizimin1 Hs.8021R74161 0.268045 Phosphorylase, glycogen; liver (Hers disease, glycogen storage disease type VPYGL Hs.771AA152304 0.268045 ADP-ribosylation factor 3 ARF3 Hs.119177R91365 0.268045 G protein-coupled receptor kinase-interactor 2 GIT2 Hs.57734AA129720 0.268045 - - Hs.286241R80595 0.268045 - - Hs.177781N44917 0.268045 - - Hs.324504H93017 0.268045 Enoyl Coenzyme A hydratase 1, peroxisomal ECH1 Hs.196176N76065 0.268045 Mitochondrial ribosomal protein S35 MRPS35 Hs.10724N45464 0.268045 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, suSMARCAL1 Hs.16933AA053145 0.268045 Coronin, actin binding protein, 1C CORO1C Hs.17377AA142967 0.268045 Uncharacterized hematopoietic stem/progenitor cells protein MDS029 MDS029 Hs.43549N27463 0.268045 CCAAT-box-binding transcription factor CBF2 Hs.184760H39920 0.268045 - - -AA098888 0.268045 Eukaryotic translation termination factor 1 ETF1 Hs.77324N53948 0.268045 - - Hs.176686N48162 0.268045 P53-regulated DDA3 DDA3 Hs.77550N42184 0.268045 Hypothetical protein BC013073 LOC92703 Hs.17481R62209 0.268045 - - Hs.120785

R65635 0.277093 - - Hs.130352AA039598 0.277093 Ribosomal protein S6 kinase, 90kDa, polypeptide 1 RPS6KA1 Hs.149957R13125 0.277093 Similar to CG4995 gene product LOC153328 Hs.129539H79753 0.277093 Death-associated protein DAP Hs.75189R31564 0.277093 Prenylcysteine lyase PCL1 Hs.278627H66475 0.277093 Homolog of rat nadrin RICH1 Hs.14169AA047407 0.277093 KIAA1600 protein KIAA1600 Hs.192619W02086 0.277093 Sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinSMPD2 Hs.55235W60936 0.277093 Tripartite motif-containing 8 TRIM8 Hs.54580N74625 0.277093 - - -N94608 0.277093 Interferon gamma receptor 2 (interferon gamma transducer 1) IFNGR2 Hs.177559T80623 0.277093 - - -W55890 0.277093 RNA processing factor 1 RPF1 Hs.287863H17401 0.277093 Hypothetical protein HSPC232 HSPC232 Hs.281428AA029590 0.277093 NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) NHP2L1 Hs.182255T79552 0.277093 ESTs ESTs Hs.14585H52061 0.277093 Hypothetical protein FLJ22313 FLJ22313 Hs.30211T77325 0.277093 Polycystic kidney disease 2 (autosomal dominant) PKD2 Hs.82001R76349 0.277093 Ran binding protein 11 LOC51194 Hs.13109T97533 0.277093 ESTs ESTs Hs.193125R14307 0.277093 Low density lipoprotein receptor-related protein 4 LRP4 Hs.4930N34756 0.277093 Sorting nexin 4 SNX4 Hs.267812W32998 0.277093 - - Hs.355841R98094 0.277093 2,3-bisphosphoglycerate mutase BPGM Hs.198365N24941 0.277093 - - Hs.20274AA142968 0.277093 NS1-associated protein 1 NSAP1 Hs.46801AA046891 0.277093 Defender against cell death 1 DAD1 Hs.82890H14838 0.277093 Defender against cell death 1 DAD1 Hs.82890AA043477 0.277093 Zinc finger protein 36, C3H type, homolog (mouse) ZFP36 Hs.343586R55277 0.277093 KIAA1143 protein KIAA1143 Hs.173042N49523 0.277093 DKFZP434C128 protein DKFZP434C128 Hs.222909W85949 0.277093 - - Hs.339808N39021 0.277093 Solute carrier family 20 (phosphate transporter), member 1 SLC20A1 Hs.78452R43082 0.277093 - - Hs.41974R73076 0.277093 - - Hs.356356H11043 0.277093 Kinesin family member 3B KIF3B Hs.301206H17492 0.277093 DnaJ (Hsp40) homolog, subfamily B, member 2 DNAJB2 Hs.77768N39932 0.277093 Small protein effector 1 of Cdc42 SPEC1 Hs.22065H75530 0.277093 V-crk sarcoma virus CT10 oncogene homolog (avian) CRK Hs.343220N39954 0.277093 - - Hs.109012T77765 0.277093 Nudix (nucleoside diphosphate linked moiety X)-type motif 2 NUDT2 Hs.14142AA036798 0.277093 - - Hs.339024N75204 0.277093 - - Hs.107410W74536 0.277093 Advanced glycosylation end product-specific receptor AGER Hs.184H55914 0.277093 - - -R24623 0.277093 ATPase, H+ transporting, lysosomal interacting protein 2 ATP6IP2 Hs.183434AA053007 0.277093 Putative receptor protein PMI Hs.15196H50403 0.277093 Hypothetical protein FLJ20793 FLJ20793 Hs.96900H23410 0.286347 CGG triplet repeat binding protein 1 CGGBP1 Hs.86041H14478 0.286347 Seven in absentia homolog 1 (Drosophila) SIAH1 Hs.295923T51729 0.286347 Regulator of G-protein signalling 14 RGS14 Hs.9347N98535 0.286347 Chromosome 20 open reading frame 7 C20orf7 Hs.44296R49516 0.286347 ESTs ESTs Hs.6653W38442 0.286347 Acidic 82 kDa protein mRNA HSU15552 Hs.85769R71483 0.286347 Transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) TFAP2A Hs.334334AA121519 0.286347 - - -R50868 0.286347 Hypothetical protein FLJ23861 FLJ23861 Hs.380669H15871 0.286347 Nicotinamide nucleotide transhydrogenase NNT Hs.18136AA045063 0.286347 Presenilin 2 (Alzheimer disease 4) PSEN2 Hs.25363N78857 0.286347 - - Hs.82171H56935 0.286347 Hypothetical protein MGC32124 MGC32124 Hs.284163H41939 0.286347 Discoidin domain receptor family, member 1 DDR1 Hs.75562R84594 0.286347 Suppressor of G2 allele of SKP1, S. cerevisiae, homolog of SGT1 Hs.5169R66559 0.286347 Nuclear receptor binding factor-2 NRBF-2 Hs.27181R32376 0.286347 Syntaxin 3A STX3A Hs.82240AA028073 0.286347 - - -N47180 0.286347 Membrane interacting protein of RGS16 MIR16 Hs.107014AA054447 0.286347 Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa PAFAH1B1 Hs.77318H39162 0.286347 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltranAGPAT1 Hs.240534W38759 0.286347 - - Hs.356739AA047337 0.286347 TATA element modulatory factor 1 TMF1 Hs.267632N63013 0.286347 Hypothetical protein FLJ13194 FLJ13194 Hs.288932AA040149 0.286347 - - Hs.348989T74342 0.286347 - - -AA146955 0.286347 Hypothetical protein FLJ20519 FLJ20519 Hs.79457R47801 0.286347 Protein inhibitor of activated STAT3 PIAS3 Hs.76578R37031 0.286347 G protein-coupled receptor 108 GPR108 Hs.167641T76961 0.286347 ESTs ESTs Hs.268586AA128013 0.286347 - - Hs.261335AA046086 0.286347 CDC-like kinase 1 CLK1 Hs.2083W56088 0.286347 Ethanolamine kinase EKI1 Hs.120439R13742 0.286347 - - -AA132039 0.286347 - - Hs.43266T87998 0.286347 ESTs ESTs Hs.16414T95320 0.286347 ESTs ESTs Hs.90953AA045109 0.286347 Chromosome 7 open reading frame 11 C7orf11 Hs.66666W93379 0.286347 NIMA (never in mitosis gene a)-related kinase 2 NEK2 Hs.153704H16710 0.286347 G protein-coupled receptor kinase 6 GPRK6 Hs.76297R76505 0.286347 - - Hs.325825H73971 0.286347 ESTs ESTs Hs.53455R07576 0.286347 L(3)mbt-like (Drosophila) L3MBTL Hs.119021H91044 0.286347 Mitogen-activated protein kinase phosphatase x MKPX Hs.29106H83363 0.286347 Translocase of inner mitochondrial membrane 10 homolog (yeast) TIMM10 Hs.355993AA115252 0.286347 ESTs ESTs Hs.28805N55283 0.286347 KIAA0469 gene product KIAA0469 Hs.7764T95061 0.286347 Matrix metalloproteinase 19 MMP19 Hs.154057AA034109 0.286347 Misshapen/NIK-related kinase MINK Hs.112028R83247 0.286347 Galactosidase, beta 1 GLB1 Hs.79222H44375 0.286347 Regulatory factor X-associated ankyrin-containing protein RFXANK Hs.296776W15154 0.286347 - - -

N47456 0.295807 KH domain containing, RNA binding, signal transduction associated 1 KHDRBS1 Hs.119537N54113 0.295807 Progesterone receptor membrane component 1 PGRMC1 Hs.90061H04791 0.295807 ESTs ESTs Hs.26490R36627 0.295807 POU transcription factor 10/11/2002 Hs.227115AA128271 0.295807 Regulatory factor X, 5 (influences HLA class II expression) RFX5 Hs.166891AA053322 0.295807 - - -H85213 0.295807 - - Hs.30909R34766 0.295807 Dipeptidylpeptidase III DPP3 Hs.22880W81033 0.295807 Sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3 SULT1A3 Hs.274614N73879 0.295807 - - Hs.109553N42666 0.295807 Preimplantation protein 3 PREI3 Hs.107942R12730 0.295807 Ocular development-associated gene ODAG Hs.21145H77593 0.295807 CDA017 protein CDA017 Hs.39780H47934 0.295807 Hypothetical protein MGC12760 MGC12760 Hs.333402R59435 0.295807 HCCA2 protein HCCA2 Hs.19223H02290 0.295807 SEC10-like 1 (S. cerevisiae) SEC10L1 Hs.29494R93690 0.295807 Hydroxysteroid (17-beta) dehydrogenase 4 HSD17B4 Hs.75441W04643 0.295807 Solute carrier family 17 (anion/sugar transporter), member 5 SLC17A5 Hs.117865AA036785 0.295807 N-myristoyltransferase 2 NMT2 Hs.122647T66763 0.295807 Hypothetical protein MGC4276 similar to CG8198 MGC4276 Hs.177776T78441 0.295807 KIAA0553 protein KIAA0553 Hs.105749N70274 0.295807 CGI-87 protein LOC51112 Hs.5008R21785 0.295807 Nucleoporin 155kDa NUP155 Hs.23255T84742 0.295807 Prenylcysteine lyase PCL1 Hs.278627AA041284 0.295807 GDP dissociation inhibitor 1 GDI1 Hs.74576AA135742 0.295807 ESTs ESTs Hs.270798R18790 0.295807 - - -N63584 0.295807 Topoisomerase (DNA) II beta 180kDa TOP2B Hs.75248N66546 0.295807 KIAA0355 gene product KIAA0355 Hs.186840T78696 0.295807 GS3955 protein GS3955 Hs.155418N34887 0.295807 Ubiquitin protein ligase E3A (human papilloma virus E6-associated protein, AngUBE3A Hs.180686AA053216 0.295807 Zinc finger protein 363 ZNF363 Hs.48297AA026235 0.295807 - - Hs.31447AA193346 0.295807 Phosphatidylinositol glycan, class S PIGS Hs.347950T86348 0.295807 Glycine amidinotransferase (L-arginine:glycine amidinotransferase) GATM Hs.75335R50246 0.295807 - - Hs.351469T78280 0.295807 Histone acetyltransferase 1 HAT1 Hs.13340N71361 0.295807 ESTs ESTs Hs.50019AA099441 0.295807 Nucleobindin 1 NUCB1 Hs.172609W32102 0.295807 UDP-glucose pyrophosphorylase 2 UGP2 Hs.77837N72995 0.295807 Neuroblastoma, suppression of tumorigenicity 1 NBL1 Hs.76307R50524 0.305474 Ferritin, heavy polypeptide 1 FTH1 Hs.62954W03006 0.305474 Myristoylated alanine-rich protein kinase C substrate MARCKS Hs.75607N73090 0.305474 Homolog of yeast MAF1 MAF1 Hs.324157AA031625 0.305474 S-adenosylhomocysteine hydrolase AHCY Hs.172673H88463 0.305474 Lysophospholipase I LYPLA1 Hs.12540R37666 0.305474 Radical fringe homolog (Drosophila) RFNG Hs.12862W90163 0.305474 RA-regulated nuclear matrix-associated protein RAMP Hs.126774T91994 0.305474 - - Hs.188626H89655 0.305474 Hypothetical protein FLJ10607 similar to glucosamine-phosphate N-acetyltransFLJ10607 Hs.27931AA056174 0.305474 KIAA0082 protein KIAA0082 Hs.154045H69011 0.305474 SKI-like SKIL Hs.38783N25612 0.305474 Papillomavirus regulatory factor PRF-1 LOC55893 Hs.27410H77636 0.305474 CD68 antigen CD68 Hs.246381R13362 0.305474 - - Hs.262716AA034352 0.305474 MADS box transcription enhancer factor 2, polypeptide A (myocyte enhancer faMEF2A Hs.182280W32115 0.305474 Cryptochrome 1 (photolyase-like) CRY1 Hs.151573H40871 0.305474 Hypothetical protein MGC30022 MGC30022 Hs.179852H78287 0.305474 Myosin ID MYO1D Hs.39871R93296 0.305474 - - -R62468 0.305474 Small nuclear RNA activating complex, polypeptide 2, 45kDa SNAPC2 Hs.78403R48777 0.305474 S100 calcium binding protein A1 S100A1 Hs.292707R42554 0.305474 T-box, brain, 1 TBR1 Hs.210862H89477 0.305474 Cyclin D3 CCND3 Hs.83173AA059201 0.305474 Ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) UBE2E3 Hs.4890AA053137 0.305474 Nasopharyngeal carcinoma susceptibility protein LZ16 Hs.42390R93707 0.305474 Calmodulin 1 (phosphorylase kinase, delta) CALM1 Hs.177656R54993 0.305474 Chromosome 20 open reading frame 167 C20orf167 Hs.26213AA055863 0.305474 Cytoskeleton-associated protein 4 CKAP4 Hs.74368R89061 0.305474 Hypothetical protein MGC12909 MGC12909 Hs.33862AA005168 0.305474 Zinc finger protein 7 (KOX 4, clone HF.16) ZNF7 Hs.2076R19512 0.305474 Regulator of G-protein signalling 19 RGS19 Hs.22698N63830 0.305474 - - Hs.6127T84669 0.305474 HP1-BP74 HP1-BP74 Hs.142442AA056394 0.305474 Carbonic anhydrase IX CA9 Hs.63287R64104 0.305474 - - -N58885 0.305474 - - -AA151396 0.305474 Poly(A) binding protein, nuclear 1 PABPN1 Hs.117176H14471 0.305474 MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (SMCM6 Hs.155462AA058815 0.305474 Hypothetical protein BC000919 LOC90736 Hs.33020AA005070 0.305474 Hypothetical protein FLJ10890 FLJ10890 Hs.17283N69471 0.305474 Protein phosphatase 1, regulatory (inhibitor) subunit 11 PPP1R11 Hs.82887AA203238 0.305474 GLI-Kruppel family member GLI3 (Greig cephalopolysyndactyly syndrome) GLI3 Hs.72916AA043201 0.305474 - - Hs.179891W23575 0.305474 Phosphofructokinase, platelet PFKP Hs.99910H30688 0.305474 - - -W47547 0.305474 Adenylate cyclase 9 ADCY9 Hs.20196W39129 0.305474 Nucleobindin 1 NUCB1 Hs.172609AA055106 0.305474 Crystallin, zeta (quinone reductase)-like 1 CRYZL1 Hs.330208N44670 0.305474 Growth arrest-specific 6 GAS6 Hs.78501H92968 0.305474 - - -N29889 0.305474 UBX domain containing 2 UBXD2 Hs.77495AA054486 0.305474 V-raf-1 murine leukemia viral oncogene homolog 1 RAF1 Hs.349650H90824 0.305474 Sec23 homolog A (S. cerevisiae) SEC23A Hs.272927R43963 0.315348 Hypothetical protein DKFZp761A052 DKFZp761A052 Hs.184029W93096 0.315348 - - -W93648 0.315348 CD47 antigen (Rh-related antigen, integrin-associated signal transducer) CD47 Hs.82685R71145 0.315348 KIAA1577 protein KIAA1577 Hs.13913AA044646 0.315348 HSPC126 protein HSPC126 Hs.181112T74721 0.315348 ZYG homolog ZYG Hs.29285

T70285 0.315348 - - Hs.271940AA045457 0.315348 - - Hs.288862H28138 0.315348 HLA-B associated transcript 1 BAT1 Hs.55296W37617 0.315348 Transmembrane 7 superfamily member 1 (upregulated in kidney) TM7SF1 Hs.15791N28908 0.315348 - - Hs.356659R85053 0.315348 Glucosidase, beta; acid (includes glucosylceramidase) GBA Hs.282997N25817 0.315348 Spermidine/spermine N1-acetyltransferase SAT Hs.28491N95821 0.315348 KIAA0768 protein LEC3 Hs.21917R56270 0.315348 - - Hs.4817R67127 0.315348 Hypothetical protein FLJ12666 FLJ12666 Hs.23767R09420 0.315348 Hypothetical protein FLJ20397 FLJ20397 Hs.272688R56276 0.315348 - - -H97415 0.315348 TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated TAF6L Hs.131846R78728 0.315348 Kelch-like 5 (Drosophila) KLHL5 Hs.272239N74713 0.315348 - - -N58114 0.315348 E2F transcription factor 4, p107/p130-binding E2F4 Hs.108371R34109 0.315348 Mitochondrial ribosomal protein L18 MRPL18 Hs.23038H62271 0.315348 D11lgp1e-like LGP1 Hs.38039W47105 0.315348 ELL-related RNA polymerase II, elongation factor ELL2 Hs.98124AA150731 0.315348 - - Hs.374418H03079 0.315348 Hypothetical protein FLJ21156 FLJ21156 Hs.26058H94111 0.315348 Tyrosylprotein sulfotransferase 2 TPST2 Hs.26350N92087 0.315348 Cyclin-dependent kinase inhibitor 3 (CDK2-associated dual specificity phosphaCDKN3 Hs.84113AA134115 0.315348 Sphingosine-1-phosphate lyase 1 SGPL1 Hs.186613T39635 0.315348 ESTs ESTs Hs.345204W60229 0.315348 Hypothetical protein FLJ20093 FLJ20093 Hs.172572N43796 0.315348 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 ATP6V0D1 Hs.106876H53894 0.315348 Cyclin D-type binding-protein 1 CCNDBP1 Hs.36794W06829 0.315348 - - Hs.356718H81847 0.315348 Calpain 3, (p94) CAPN3 Hs.40300AA135667 0.315348 Early development regulator 2 (polyhomeotic 2 homolog) EDR2 Hs.165263R78183 0.315348 Pre-B-cell leukemia transcription factor 2 PBX2 Hs.93728H00554 0.315348 Putative G-protein coupled receptor GPCR41 FLJ11856 Hs.6459AA016242 0.315348 Splicing factor, arginine/serine-rich 2 SFRS2 Hs.73965R32925 0.315348 - - -AA009678 0.315348 - - -R59179 0.315348 Nucleolar protein 3 (apoptosis repressor with CARD domain) NOL3 Hs.278439AA045670 0.315348 Cell division cycle 34 CDC34 Hs.76932N62491 0.315348 Folate hydrolase (prostate-specific membrane antigen) 1 FOLH1 Hs.1915N68522 0.315348 Transforming growth factor, beta 3 TGFB3 Hs.2025N90643 0.315348 Membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigMCP Hs.83532AA055457 0.315348 Down syndrome critical region gene 2 DSCR2 Hs.5198AA045637 0.315348 Ubiquinol-cytochrome c reductase (6.4kD) subunit UQCR Hs.8372N29455 0.315348 - - -T87794 0.315348 - - -N70759 0.315348 Zinc-finger protein DZIP1 DZIP1 Hs.60177H75274 0.315348 Solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 SLC1A4 Hs.323878N56633 0.315348 Syntaxin 12 STX12 Hs.106823H56686 0.315348 Serine/arginine repetitive matrix 1 SRRM1 Hs.18192R22600 0.315348 Testis enhanced gene transcript (BAX inhibitor 1) TEGT Hs.74637R18621 0.315348 - - -AA203625 0.315348 Vacuolar protein sorting 4A (yeast) VPS4A Hs.234839R77520 0.32543 Mannose-P-dolichol utilization defect 1 MPDU1 Hs.6710H47495 0.32543 Hypothetical protein MGC15504 MGC15504 Hs.13810N64639 0.32543 Dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related) DUSP3 Hs.181046N25320 0.32543 Ceroid-lipofuscinosis, neuronal 6, late infantile, variant CLN6 Hs.43654N95545 0.32543 Interleukin 11 IL11 Hs.1721R68381 0.32543 - - -R11709 0.32543 Fatty-acid-Coenzyme A ligase, long-chain 6 FACL6 Hs.14945H67348 0.32543 - - Hs.61976R15336 0.32543 KIAA0673 protein KIAA0673 Hs.106487W38635 0.32543 Protein kinase C substrate 80K-H PRKCSH Hs.1432AA056554 0.32543 Cold shock domain protein A CSDA Hs.198726T87973 0.32543 - - Hs.332988N51196 0.32543 - - -R61690 0.32543 Chondroitin sulfate proteoglycan 4 (melanoma-associated) CSPG4 Hs.9004AA215407 0.32543 - - Hs.349755N95418 0.32543 FK506 binding protein 8, 38kDa FKBP8 Hs.173464T80795 0.32543 - - -R34261 0.32543 Solute carrier family 5 (sodium-dependent vitamin transporter), member 6 SLC5A6 Hs.321579R34626 0.32543 ESTs ESTs Hs.6795R35358 0.32543 Hypothetical protein FLJ20011 FLJ20011 Hs.334647T66786 0.32543 ESTs ESTs Hs.12941R23189 0.32543 ESTs ESTs Hs.172610AA130098 0.32543 - - Hs.44829N79378 0.32543 ESTs ESTs Hs.126688R32384 0.32543 Deoxyribonuclease I-like 1 DNASE1L1 Hs.77091N94471 0.32543 Small membrane protein 1 SMP1 Hs.107979AA035651 0.32543 ESTs ESTs Hs.143813N27996 0.32543 Hypothetical protein MGC26818 MGC26818 Hs.23765R88696 0.32543 Sialyltransferase 7D ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-aceSIAT7D Hs.3972AA213556 0.32543 - - -R60613 0.32543 General transcription factor II, i GTF2I Hs.278589R51348 0.32543 - - -W16436 0.32543 Protein kinase (cAMP-dependent, catalytic) inhibitor gamma PKIG Hs.3407AA053851 0.32543 ESTs ESTs Hs.63063W30745 0.32543 Hypothetical protein DJ159A19.3 DJ159A19.3 Hs.10700W86198 0.32543 Yeast Sec31p homolog KIAA0905 Hs.70266T80249 0.32543 Carnitine deficiency-associated gene expressed in ventricle 1 CDV-1 Hs.333120H74279 0.32543 Hypothetical protein DKFZp547B1713 DKFZp547B1713 Hs.349262W49768 0.32543 Interferon, alpha-inducible protein (clone IFI-6-16) G1P3 Hs.265827R25543 0.32543 - - Hs.23133N41715 0.32543 Hypothetical protein FLJ11294 FLJ11294 Hs.107000N90250 0.32543 ESTs ESTs Hs.94881R56622 0.32543 ESTs ESTs Hs.274728AA039526 0.32543 Rabconnectin-3 RC3 Hs.13264N90844 0.32543 Alcohol dehydrogenase 5 (class III), chi polypeptide ADH5 Hs.78989H80760 0.32543 Hypothetical protein BM-009 BM-009 Hs.92918H18154 0.32543 RAB5B, member RAS oncogene family RAB5B Hs.77690W23773 0.32543 BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) BAP1 Hs.106674

T99087 0.32543 5-methyltetrahydrofolate-homocysteine methyltransferase MTR Hs.82283T85855 0.32543 Hypothetical protein FLJ10209 FLJ10209 Hs.58589R36970 0.32543 Sec22 homolog SEC22A Hs.183655N62381 0.32543 Fring LOC117584 Hs.172694W25036 0.32543 Hypothetical protein BC009925 LOC113246 Hs.9634T89040 0.32543 CDw92 antigen CDW92 Hs.179902AA057305 0.32543 - - -AA131302 0.32543 - - Hs.71404N47249 0.32543 - - Hs.28264AA102088 0.32543 Tripartite motif-containing 37 TRIM37 Hs.8164R64704 0.32543 Placental protein 13-like protein PPL13 Hs.24236R05370 0.32543 - - Hs.233290H20185 0.32543 Hypothetical protein CAB56184 CAB56184 Hs.241575H68976 0.32543 - - Hs.375009AA027815 0.32543 KIAA1311 protein KIAA1311 Hs.61441W32961 0.32543 ESTs ESTs Hs.271125H99854 0.32543 Superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) SOD1 Hs.75428W85877 0.335719 PR/SET domain containing protein 07 SET07 Hs.111988N31736 0.335719 Hypothetical protein FLJ25211 FLJ25211 Hs.44269N98550 0.335719 TRAM-like protein KIAA0057 Hs.153954N95539 0.335719 Hypothetical protein BC001563 LOC123016 Hs.55158H27334 0.335719 Discoidin domain receptor family, member 1 DDR1 Hs.75562R91253 0.335719 ESTs ESTs Hs.34395H04946 0.335719 Cytochrome c oxidase subunit Va COX5A Hs.323834N29771 0.335719 Three prime repair exonuclease 2 TREX2 Hs.251398T78019 0.335719 - - Hs.5461W67427 0.335719 Prolylcarboxypeptidase (angiotensinase C) PRCP Hs.75693T54522 0.335719 Breast cancer metastasis-suppressor 1 BRMS1 Hs.100426N75343 0.335719 Polymerase (DNA directed), delta 2, regulatory subunit 50kDa POLD2 Hs.74598N95603 0.335719 Excision repair cross-complementing rodent repair deficiency, complementationERCC3 Hs.77929T76974 0.335719 Protein x 0004 LOC51184 Hs.284164N30185 0.335719 Hypothetical protein FLJ11252 FLJ11252 Hs.23495H63676 0.335719 Optic atrophy 1 (autosomal dominant) OPA1 Hs.147946N43952 0.335719 - - Hs.236443N33089 0.335719 CGI-128 protein LOC51647 Hs.9825H18273 0.335719 Bernardinelli-Seip congenital lipodystrophy 2 (seipin) BSCL2 Hs.293981R98462 0.335719 Likely ortholog of mouse Abl-philin 2 APH2 Hs.76662N63416 0.335719 - - Hs.82719N51465 0.335719 ESTs ESTs Hs.46476N78331 0.335719 Activator of basal transcription 1 ABT1 Hs.109428AA132089 0.335719 Hypothetical protein FLJ20522 FLJ20522 Hs.35406AA055220 0.335719 Cell death regulator aven LOC57099 Hs.63168W47502 0.335719 Alpha glucosidase II alpha subunit G2AN Hs.76847R75956 0.335719 Chromosome 22 open reading frame 2 C22orf2 Hs.227637R71650 0.335719 MUM2 protein MUM2 Hs.24379W04705 0.335719 Hypothetical protein DKFZp667B1218 DKFZp667B1218 Hs.151293H50522 0.335719 Proteasome (prosome, macropain) inhibitor subunit 1 (PI31) PSMF1 Hs.75925AA203694 0.335719 Glucosidase, beta (bile acid) 2 GBA2 Hs.173422AA031672 0.335719 Dual specificity phosphatase 12 DUSP12 Hs.44229AA053311 0.335719 KIAA0233 gene product KIAA0233 Hs.79077N27544 0.335719 Cell division cycle 27 CDC27 Hs.172405T72663 0.335719 - - -R88034 0.335719 Hypothetical protein MGC3101 MGC3101 Hs.301394H10444 0.335719 Era G-protein-like 1 (E. coli) ERAL1 Hs.3426T89586 0.335719 - - -T86070 0.335719 Myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila) MLL5 Hs.333300AA151290 0.335719 Double ring-finger protein, Dorfin DORFIN Hs.48320N92363 0.335719 Ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) UBE2I Hs.84285N94263 0.335719 Thyroid hormone receptor interactor 10 TRIP10 Hs.73999N35502 0.335719 Hypothetical protein FLJ22626 FLJ22626 Hs.5565W85875 0.335719 CHMP1.5 protein CHMP1.5 Hs.380932R12051 0.335719 - - Hs.264915H73751 0.335719 Mitogen-activated protein kinase kinase kinase 6 MAP3K6 Hs.194694R13215 0.335719 Protocadherin 19 PCDH19 Hs.4993N91929 0.346215 Hypothetical protein FLJ12799 FLJ12799 Hs.22549H03870 0.346215 Chromosome 20 open reading frame 18 C20orf18 Hs.247280H20147 0.346215 Chromosome 20 open reading frame 154 C20orf154 Hs.88959W48584 0.346215 Procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alp P4HA2 Hs.3622AA047443 0.346215 LIM domain containing preferred translocation partner in lipoma LPP Hs.180398T86448 0.346215 - - -W73052 0.346215 Ring-box 1 RBX1 Hs.279919AA036785 0.346215 N-myristoyltransferase 2 NMT2 Hs.122647N33086 0.346215 - - -W04300 0.346215 Similar to hypothetical protein MGC13138 LOC146542 Hs.301463R13247 0.346215 Lysosomal-associated membrane protein 2 LAMP2 Hs.8262R52397 0.346215 Pumilio homolog 1 (Drosophila) PUM1 Hs.153834H51270 0.346215 Ubiquitously transcribed tetratricopeptide repeat gene, X chromosome UTX Hs.13980N22974 0.346215 Brain expressed, X-linked 1 BEX1 Hs.334370W52394 0.346215 Activating transcription factor 4 (tax-responsive enhancer element B67) ATF4 Hs.181243T72619 0.346215 - - Hs.373588N70129 0.346215 - - -W52940 0.346215 MIL1 protein MIL1 Hs.10267H12750 0.346215 - - -H97136 0.346215 CGI-41 protein LOC51093 Hs.5056R64592 0.346215 - - -R22957 0.346215 Hypothetical protein PP1628 PP1628 Hs.7159R49227 0.346215 - - Hs.13702N31674 0.346215 Amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3 ALS2CR3 Hs.154248H15268 0.346215 Nectin-like protein 1 NECL1 Hs.6164R88035 0.346215 Centrosomal protein 2 CEP2 Hs.27910W86860 0.346215 Nuclear VCP-like NVL Hs.58927AA047163 0.346215 Hypothetical protein DKFZp434C0328 DKFZp434C0328 Hs.24583AA045741 0.346215 Hypothetical protein FLJ14251 FLJ14251 Hs.281462R26005 0.346215 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa NDUFB7 Hs.661T99317 0.346215 - - Hs.5250W32039 0.346215 Hypothetical protein dJ37E16.5 DJ37E16.5 Hs.5790R31383 0.346215 Hypothetical protein FLJ31131 FLJ31131 Hs.23853H93264 0.346215 - - Hs.283378T84975 0.346215 TRAF4 associated factor 1 FLJ14502 Hs.181466R54946 0.346215 - - -

H18767 0.346215 - - -AA034977 0.346215 - - -AA099587 0.346215 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31 DDX31 Hs.69331T85465 0.346215 ESTs ESTs Hs.268613R47829 0.346215 CD37 antigen CD37 Hs.153053AA044180 0.346215 - - Hs.373497R92869 0.346215 - - Hs.356340T96894 0.346215 ESTs ESTs Hs.181826W02781 0.346215 Chromosome 12 open reading frame 4 C12orf4 Hs.296198N25135 0.346215 Suppression of tumorigenicity 7 like ST7L Hs.293483T79577 0.346215 KIAA0653 protein, B7-like protein B7H2 Hs.14155AA032065 0.346215 Hypothetical protein BC002942 BC002942 Hs.150540AA047053 0.346215 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2 ATP6V1B2 Hs.1697AA131566 0.346215 Fatty-acid-Coenzyme A ligase, long-chain 2 FACL2 Hs.154890N48198 0.346215 Zinc finger protein 151 (pHZ-67) ZNF151 Hs.33532AA099327 0.346215 General transcription factor IIA, 2, 12kDa GTF2A2 Hs.76362N93437 0.346215 Paired immunoglobulin-like receptor beta PILR(BETA) Hs.349256T65350 0.346215 WD repeat domain 13 WDR13 Hs.12142AA024810 0.346215 S100 calcium binding protein A10 (annexin II ligand, calpactin I, light polypeptidS100A10 Hs.119301AA129763 0.346215 Hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/en HADHB Hs.146812H30702 0.346215 Protein phosphatase 2A, regulatory subunit B' (PR 53) PPP2R4 Hs.236963H87240 0.346215 Neural precursor cell expressed, developmentally down-regulated 8 NEDD8 Hs.75512R96334 0.346215 - - -N47468 0.346215 Zinc finger protein 281 ZNF281 Hs.59757AA114872 0.346215 Aconitase 1, soluble ACO1 Hs.154721H95221 0.356918 Hypothetical protein MGC12972 MGC12972 Hs.13972N30234 0.356918 Tripartite motif-containing 33 TRIM33 Hs.287414H03214 0.356918 Hypothetical protein FLJ14681 FLJ14681 Hs.23317R38345 0.356918 Transcriptional intermediary factor 1 TIF1 Hs.183858W03130 0.356918 ESTs ESTs Hs.118191W90498 0.356918 Sjogren syndrome antigen B (autoantigen La) SSB Hs.83715R14266 0.356918 - - -N24364 0.356918 Hypothetical protein FLJ13154 FLJ13154 Hs.25303AA026227 0.356918 - - -N42817 0.356918 Cytochrome c oxidase subunit VIc COX6C Hs.351875R71158 0.356918 Catenin (cadherin-associated protein), delta 1 CTNND1 Hs.166011H00874 0.356918 - - Hs.295789AA115514 0.356918 MAX interacting protein 1 MXI1 Hs.118630R68212 0.356918 - - -W05762 0.356918 Hypothetical protein MGC24447 MGC24447 Hs.353161R73881 0.356918 ATP-binding cassette, sub-family D (ALD), member 3 ABCD3 Hs.76781N64510 0.356918 - - Hs.350475R19114 0.356918 ESTs ESTs Hs.22634W15429 0.356918 - - Hs.102951W52072 0.356918 Ribosomal protein L13 RPL13 Hs.180842N34679 0.356918 - - Hs.9042T94382 0.356918 - - -W45565 0.356918 Vacuolar protein sorting protein 18 VPS18 Hs.23876N34328 0.356918 KIAA1641 protein KIAA1641 Hs.44566N93055 0.356918 Interferon, gamma-inducible protein 30 IFI30 Hs.14623R37626 0.356918 - - Hs.6630H14087 0.356918 LDL receptor adaptor protein ARH Hs.184482R69288 0.356918 ESTs ESTs Hs.268693T58031 0.356918 - - Hs.344478N93342 0.356918 BCL-6 interacting corepressor BCoR Hs.130732H43176 0.356918 Calcium homeostasis endoplasmic reticulum protein CHERP Hs.6430R51495 0.356918 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa NDUFB8 Hs.198273R61132 0.356918 KIAA0943 protein Apg4B Hs.352535T93603 0.356918 Tumor protein D52-like 1 TPD52L1 Hs.16611AA017362 0.356918 Glucose-6-phosphate dehydrogenase G6PD Hs.80206H71225 0.356918 KIAA1673 KIAA1673 Hs.301444AA194896 0.356918 Peroxisomal membrane protein 3, 35kDa (Zellweger syndrome) PXMP3 Hs.180612AA152294 0.356918 Presenilin 2 (Alzheimer disease 4) PSEN2 Hs.25363AA035052 0.356918 Ornithine aminotransferase (gyrate atrophy) OAT Hs.75485AA150384 0.356918 KIAA0144 gene product KIAA0144 Hs.8127N32281 0.356918 DKFZP586G011 protein LAP1B Hs.234265H89293 0.356918 - - Hs.108646W49707 0.356918 Steroid receptor RNA activator 1 SRA1 Hs.32587R88190 0.356918 Solute carrier family 5 (sodium/glucose cotransporter), member 2 SLC5A2 Hs.356900R87400 0.356918 Butyrophilin, subfamily 2, member A1 BTN2A1 Hs.169963N79577 0.356918 Hypothetical protein MGC4368 MGC4368 Hs.9732H53723 0.356918 Putative nucleotide binding protein, estradiol-induced E2IG3 Hs.279923H11041 0.356918 Putative secreted protein ZSIG11 ZSIG11 Hs.279785N90919 0.356918 - - -AA195759 0.356918 ESTs ESTs Hs.142104AA043838 0.356918 Cleavage and polyadenylation specific factor 6, 68kDa CPSF6 Hs.64542R77671 0.356918 - - Hs.20787H95380 0.356918 Hydroxysteroid (17-beta) dehydrogenase 7 HSD17B7 Hs.187579R39529 0.356918 Homolog of yeast long chain polyunsaturated fatty acid elongation enzyme 2 HELO1 Hs.250175W04542 0.356918 Hepatocellular carcinoma-associated protein HCA4 HCA4 Hs.94011N99506 0.356918 Rag D protein RAGD Hs.238679T78071 0.356918 Hypothetical protein DKFZp667M2411 DKFZp667M2411 Hs.190488H15272 0.356918 - - Hs.194478AA063138 0.356918 - - Hs.356659AA044234 0.356918 Inositol 1,4,5-trisphosphate 3-kinase C ITPKC Hs.21453H08432 0.356918 RNA, U transporter 1 RNUT1 Hs.21577H02835 0.356918 G1 to S phase transition 1 GSPT1 Hs.2707H78069 0.356918 For protein disulfide isomerase-related PDIR Hs.76901R62925 0.356918 - - Hs.285193AA044021 0.356918 Cyclin C CCNC Hs.118442R75598 0.356918 Neuroblastoma, suppression of tumorigenicity 1 NBL1 Hs.76307H64918 0.367827 Interferon-stimulated transcription factor 3, gamma 48kDa ISGF3G Hs.1706AA134754 0.367827 BCL2-associated athanogene 3 BAG3 Hs.15259R14323 0.367827 MDN1, midasin homolog (yeast) MDN1 Hs.76730W93342 0.367827 Hypothetical protein FLJ22127 FLJ22127 Hs.59457W38744 0.367827 Homeodomain interacting protein kinase 3 HIPK3 Hs.30148R76797 0.367827 Ubiquitin specific protease 21 USP21 Hs.8015AA043767 0.367827 Runt-related transcription factor 1 (acute myeloid leukemia 1; aml1 oncogene) RUNX1 Hs.129914N64112 0.367827 CAAX box 1 CXX1 Hs.250708N89705 0.367827 Superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) SOD1 Hs.75428

AA147653 0.367827 Plastin 3 (T isoform) PLS3 Hs.4114R01093 0.367827 Lymphocyte adaptor protein LNK Hs.13131N43796 0.367827 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 ATP6V0D1 Hs.106876N25756 0.367827 - - -N55023 0.367827 HSPC150 protein similar to ubiquitin-conjugating enzyme HSPC150 Hs.5199N32277 0.367827 - - -N21347 0.367827 Hypothetical protein MGC31963 MGC31963 Hs.293984H50621 0.367827 - - Hs.71523H78277 0.367827 Hypothetical protein DKFZp761D0211 DKFZP761D0211 Hs.322456R36593 0.367827 Hypothetical protein FLJ20445 FLJ20445 Hs.343748W85813 0.367827 Cleavage and polyadenylation specific factor 1, 160kDa CPSF1 Hs.83727AA035000 0.367827 - - -W88723 0.367827 Peptidyl prolyl isomerase H (cyclophilin H) PPIH Hs.9880W45561 0.367827 Centromere protein B, 80kDa CENPB Hs.85004H96619 0.367827 Seven in absentia homolog 1 (Drosophila) SIAH1 Hs.295923H38062 0.367827 - - -H11855 0.367827 ELK1, member of ETS oncogene family ELK1 Hs.181128N46534 0.367827 Hypothetical protein FLJ10738 FLJ10738 Hs.5457AA044119 0.367827 - - Hs.103441N52230 0.367827 Hypothetical protein H17 H17 Hs.16361AA149278 0.367827 D15F37 (pseudogene) MN7 Hs.286132N95196 0.367827 Deoxyribonuclease II, lysosomal DNASE2 Hs.118243AA031503 0.367827 CGI-20 protein LOC51608 Hs.107387AA031933 0.367827 Estrogen-related receptor alpha ESRRA Hs.110849AA195600 0.367827 Follistatin FST Hs.9914AA040638 0.367827 KIAA1554 protein KIAA1554 Hs.17767AA011688 0.367827 ATP-dependant interferon responsive ADIR Hs.26267N41297 0.367827 ESTs ESTs Hs.355658H02918 0.367827 Hypothetical protein MGC2941 MGC2941 Hs.288217R14811 0.367827 ESTs ESTs Hs.380463AA053317 0.367827 Bromodomain adjacent to zinc finger domain, 2B BAZ2B Hs.8383H40373 0.367827 S164 protein S164 Hs.180789H08650 0.367827 Egl nine homolog 1 (C. elegans) EGLN1 Hs.6523H96054 0.367827 Glia maturation factor, beta GMFB Hs.151413AA045167 0.367827 Hexokinase 2 HK2 Hs.198427W57808 0.367827 H2A histone family, member J H2AFJ Hs.36727N22132 0.367827 - - Hs.310359N79772 0.367827 Mitochondrial ribosomal protein S10 MRPS10 Hs.380887AA131579 0.367827 Platelet-derived growth factor receptor, beta polypeptide PDGFRB Hs.76144R71156 0.367827 Programmed cell death 7 PDCD7 Hs.143253AA115477 0.367827 General transcription factor IIF, polypeptide 1, 74kDa GTF2F1 Hs.68257W47334 0.367827 Hypothetical protein MGC5560 MGC5560 Hs.233150AA203444 0.367827 COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) COPS5 Hs.198767H20195 0.367827 Chromosome 12 open reading frame 10 C12orf10 Hs.15760N59460 0.367827 Hypothetical protein FLJ14824 FLJ14824 Hs.22399N43819 0.367827 KIAA0036 gene product KIAA0036 Hs.169387AA099226 0.367827 - - Hs.356377AA127687 0.367827 - - -H51993 0.367827 Hypothetical protein MGC3260 MGC3260 Hs.15514W03639 0.367827 Golgi autoantigen, golgin subfamily a, 2 GOLGA2 Hs.24049R61381 0.367827 Centromere protein B, 80kDa CENPB Hs.85004T81540 0.367827 Nucleoporin 62kDa NUP62 Hs.9877R92833 0.367827 - - Hs.285519H07904 0.367827 Hypothetical protein FLJ38045 FLJ38045 Hs.170226R41613 0.367827 ESTs ESTs Hs.22514R01695 0.367827 Dpy-30-like protein LOC84661 Hs.323401T70331 0.367827 - - -N35859 0.367827 Phosphodiesterase 7A PDE7A Hs.21857W37211 0.367827 S100 calcium binding protein A13 S100A13 Hs.14331N74710 0.367827 Signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 STAM Hs.153487AA007448 0.378941 Retinoblastoma binding protein 4 RBBP4 Hs.16003N70221 0.378941 KIAA0500 protein KIAA0500 Hs.301478T65558 0.378941 Angiotensin II receptor-associated protein AGTRAP Hs.12854W57882 0.378941 Pleckstrin homology domain containing, family A (phosphoinositide binding spePLEKHA4 Hs.9469AA005304 0.378941 BTB (POZ) domain containing 3 BTBD3 Hs.7935H11052 0.378941 Kinesin family member 3C KIF3C Hs.21611R34667 0.378941 Hypothetical protein DKFZP434G1411 DKFZP434G1411 Hs.3837N23299 0.378941 KIAA0212 gene product KIAA0212 Hs.154332R68921 0.378941 Exportin 1 (CRM1 homolog, yeast) XPO1 Hs.79090AA056734 0.378941 KIAA1110 protein KIAA1110 Hs.22479R71002 0.378941 ESTs ESTs Hs.10957T96994 0.378941 - - Hs.17240N66159 0.378941 Cytochrome c oxidase subunit VIc COX6C Hs.351875N75806 0.378941 ESTs ESTs Hs.109697R94555 0.378941 Collagen, type IV, alpha 2 COL4A2 Hs.75617W31628 0.378941 - - Hs.118258AA149493 0.378941 - - -AA136884 0.378941 Hypothetical protein FLJ21924 FLJ21924 Hs.143509W78859 0.378941 Emopamil binding related protein, delta8-delta7 sterol isomerase related protei EBRP Hs.298490R69765 0.378941 Target of myb1 (chicken) TOM1 Hs.9482T92246 0.378941 Hypothetical protein FLJ20265 FLJ20265 Hs.7099AA069532 0.378941 - - Hs.287955AA040219 0.378941 Nuclear transcription factor Y, gamma NFYC Hs.168157W85899 0.378941 Cytidine monophosphate N-acetylneuraminic acid synthetase CMAS Hs.12492N90203 0.378941 Hypothetical protein FLJ22347 FLJ22347 Hs.106004N71038 0.378941 Wiskott-Aldrich syndrome-like WASL Hs.170065H16828 0.378941 Cyclic AMP phosphoprotein, 19 kD ARPP-19 Hs.7351H30758 0.378941 Glucose phosphate isomerase GPI Hs.279789R86031 0.378941 Hypothetical protein FLJ22060 FLJ22060 Hs.29403R21859 0.378941 Microfibrillar-associated protein 2 MFAP2 Hs.83551H00836 0.378941 A kinase (PRKA) anchor protein 2 AKAP2 Hs.42322T97294 0.378941 BCL2-associated athanogene BAG1 Hs.41714R76588 0.378941 - - -H99841 0.378941 V-ski sarcoma viral oncogene homolog (avian) SKI Hs.2969T93794 0.378941 - - -R14822 0.378941 RAN binding protein 1 RANBP1 Hs.24763AA055986 0.378941 Chromosome 20 open reading frame 80 C20orf80 Hs.10726R12050 0.378941 KIAA0014 gene product KIAA0014 Hs.155650H89883 0.378941 KIAA0102 gene product KIAA0102 Hs.77665H82877 0.378941 Testes development-related NYD-SP21 NYD-SP21 Hs.28514

H45501 0.378941 Hypothetical protein MGC10558 MGC10558 Hs.119498R01094 0.378941 Likely ortholog of mouse brain protein 17 BRP17 Hs.375161N32620 0.378941 CGI-36 protein LOC51078 Hs.182986R17312 0.378941 SON DNA binding protein SON Hs.92909AA036871 0.378941 DnaJ (Hsp40) homolog, subfamily A, member 2 DNAJA2 Hs.21189H19945 0.378941 Syntaxin 5A STX5A Hs.302300AA203452 0.378941 - - -N69475 0.378941 Mitochondrial ribosomal protein L48 MRPL48 Hs.82389H51834 0.378941 Tetratricopeptide repeat domain 1 TTC1 Hs.7733R98517 0.378941 H1 histone family, member 2 H1F2 Hs.7644R67271 0.378941 Hypothetical protein FLJ13089 FLJ13089 Hs.285711N90240 0.378941 Spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, a SCA2 Hs.76253AA053908 0.378941 - - Hs.59847H89995 0.378941 - - -W68697 0.378941 Hypothetical protein FLJ10998 FLJ10998 Hs.78110H79188 0.378941 Excision repair cross-complementing rodent repair deficiency, complementationERCC2 Hs.99987N23137 0.378941 M-phase phosphoprotein 9 MPHOSPH9 Hs.351230AA037284 0.378941 Adenine phosphoribosyltransferase APRT Hs.28914R13557 0.378941 Replication protein A2, 32kDa RPA2 Hs.79411N21653 0.390259 Synovial sarcoma translocation, chromosome 18 SS18 Hs.153221T79632 0.390259 ESTs ESTs Hs.189716H26288 0.390259 Hypothetical protein FLJ13448 FLJ13448 Hs.288945N64500 0.390259 IDN3 protein IDN3 Hs.225767W47326 0.390259 - - Hs.194051R94106 0.390259 - - -H45907 0.390259 - - -W94646 0.390259 Integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alphaITGAE Hs.851R79455 0.390259 Activating transcription factor 1 ATF1 Hs.36908H04766 0.390259 - - -AA026113 0.390259 Hypothetical protein FLJ10252 FLJ10252 Hs.53913W35163 0.390259 Neuron navigator 2 NAV2 Hs.23467AA150397 0.390259 - - -R32522 0.390259 Endothelial zinc finger protein 2 EZF-2 Hs.24545R69789 0.390259 Hypothetical protein MGC4701 MGC4701 Hs.116771AA026136 0.390259 Proteasome (prosome, macropain) subunit, alpha type, 6 PSMA6 Hs.74077AA043899 0.390259 - - -N21532 0.390259 - EST Hs.331630H29063 0.390259 Arginyl aminopeptidase (aminopeptidase B)-like 1 RNPEPL1 Hs.5345AA126902 0.390259 UBX domain containing 1 UBXD1 Hs.11081W17221 0.390259 Hypothetical protein MGC2217 MGC2217 Hs.323164T98946 0.390259 Hypothetical protein FLJ12707 FLJ12707 Hs.16157AA055190 0.390259 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 15 DDX15 Hs.5683R50163 0.390259 Hypothetical protein similar to beta-transducin family FLJ10458 Hs.85570AA150817 0.390259 Thioredoxin TXN Hs.76136H01255 0.390259 Ceroid-lipofuscinosis, neuronal 5 CLN5 Hs.30213R14816 0.390259 - - -AA057144 0.390259 Slit homolog 3 (Drosophila) SLIT3 Hs.57929N63983 0.390259 O-linked mannose beta1,2-N-acetylglucosaminyltransferase FLJ20277 Hs.183860R80802 0.390259 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 KDELR1 Hs.78040N42803 0.390259 - - Hs.356063N64488 0.390259 Putative homeodomain transcription factor 1 PHTF1 Hs.123637R20140 0.390259 Mitofusin 1 MFN1 Hs.197877N54526 0.390259 KIAA1979 protein KIAA1979 Hs.352638W47002 0.390259 Non-metastatic cells 2, protein (NM23B) expressed in NME2 Hs.275163T66788 0.390259 Component of oligomeric golgi complex 4 COG4 Hs.108779AA156867 0.390259 WW domain-containing protein 1 WWP1 Hs.355977T96934 0.390259 Exportin 5 XPO5 Hs.9805N95293 0.390259 SPPL2b SPPL2B Hs.284161AA053325 0.390259 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 1 ATP6V1G1 Hs.90336N35067 0.390259 Cell division cycle 2-like 5 (cholinesterase-related cell division controller) CDC2L5 Hs.59498R77688 0.390259 HSPC003 protein HSPC003 Hs.351629H17934 0.390259 Hypothetical protein MGC11287 similar to ribosomal protein S6 kinase , MGC11287 Hs.194286AA007586 0.390259 - - Hs.103441R85986 0.390259 - - -R34732 0.390259 Cadherin 8, type 2 CDH8 Hs.79133R22724 0.390259 Hypothetical protein BC011840 LOC93343 Hs.106597N48615 0.390259 GS3955 protein GS3955 Hs.155418T95724 0.390259 Solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15SLC25A15 Hs.78457R68008 0.390259 Fucosidase, alpha-L- 1, tissue FUCA1 Hs.576N34324 0.390259 Lactotransferrin LTF Hs.105938R25792 0.390259 Malic enzyme 2, NAD(+)-dependent, mitochondrial ME2 Hs.75342H11052 0.390259 Kinesin family member 3C KIF3C Hs.21611W80729 0.390259 - - -N36397 0.390259 CLIP-170-related protein CLIPR-59 Hs.7357N31840 0.390259 - - Hs.206710R18713 0.390259 HLA-B associated transcript 8 BAT8 Hs.75196H89827 0.390259 RAS p21 protein activator (GTPase activating protein) 3 (Ins(1,3,4,5)P4-bindingGAP1IP4BP Hs.119274H08185 0.390259 Hypothetical protein BC004409 LOC92170 Hs.301693AA135334 0.390259 TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110k TAF1C Hs.153022AA127936 0.390259 Ubiquitin-conjugating enzyme E2 variant 1 UBE2V1 Hs.75875R66397 0.401781 KH domain containing, RNA binding, signal transduction associated 1 KHDRBS1 Hs.119537AA099134 0.401781 Hypoxia up-regulated 1 HYOU1 Hs.277704AA044433 0.401781 - - Hs.279607AA098907 0.401781 Aminolevulinate, delta-, synthase 1 ALAS1 Hs.78712N52238 0.401781 Hypothetical protein FLJ20531 FLJ20531 Hs.23617H50924 0.401781 Hypothetical protein FLJ14800 FLJ14800 Hs.62119R77598 0.401781 Hypothetical protein FLJ22530 FLJ22530 Hs.14570N64621 0.401781 Regulator of G-protein signalling 19 interacting protein 1 RGS19IP1 Hs.6454R77518 0.401781 DKFZP434D1335 protein DKFZP434D1335 Hs.8258T66813 0.401781 - EST Hs.12947AA058463 0.401781 - - -R28236 0.401781 Hypothetical protein MGC12217 MGC12217 Hs.288193R79545 0.401781 WD-repeat protein HAN11 Hs.288283T86807 0.401781 Serine/threonine kinase 19 STK19 Hs.444R26327 0.401781 - - Hs.374441R06415 0.401781 Friedreich ataxia FRDA Hs.95998H84220 0.401781 MIC2 like 1 MIC2L1 Hs.169388AA151197 0.401781 Integrin, alpha 5 (fibronectin receptor, alpha polypeptide) ITGA5 Hs.149609AA151232 0.401781 Hypothetical protein MGC15677 MGC15677 Hs.71941R98516 0.401781 H2B histone family, member G H2BFG Hs.182137

T84038 0.401781 POU domain, class 2, transcription factor 1 POU2F1 Hs.182237H29536 0.401781 BBP-like protein 1 BLP1 Hs.7471R63880 0.401781 ESTs ESTs Hs.176220N26998 0.401781 - - Hs.247240AA099522 0.401781 Hypothetical protein FLJ11565 FLJ11565 Hs.61763H00120 0.401781 - - -R88980 0.401781 - - Hs.285165W87505 0.401781 CGI-62 protein LOC51101 Hs.118821R56894 0.401781 ESTs ESTs Hs.26010AA032039 0.401781 Hypothetical protein FLJ13102 FLJ13102 Hs.225160N27205 0.401781 Hypothetical protein FLJ13855 FLJ13855 Hs.168232N75331 0.401781 - - Hs.50600T94446 0.401781 Protein tyrosine phosphatase, non-receptor type substrate 1 PTPNS1 Hs.156114N80280 0.401781 Actinin, alpha 2 ACTN2 Hs.83672N32508 0.401781 G-protein gamma-12 subunit LOC55970 Hs.8107R96053 0.401781 Hypothetical protein LOC51320 LOC51320 Hs.12830AA040790 0.401781 - - Hs.356395AA001250 0.401781 - - Hs.118913R60239 0.401781 Similar to S. cerevisiae SSM4 TEB4 Hs.380875N51711 0.401781 Hypothetical protein DKFZp761D0614 DKFZp761D0614 Hs.25320R47837 0.401781 Zinc finger protein 265 ZNF265 Hs.194718AA040152 0.401781 Cleavage and polyadenylation specific factor 3, 73kDa CPSF3 Hs.16251AA147572 0.401781 RYK receptor-like tyrosine kinase RYK Hs.79350H11054 0.401781 Protein kinase C, delta PRKCD Hs.155342H62940 0.401781 - - -R07975 0.401781 Hypothetical protein MGC955 MGC955 Hs.55608N91376 0.401781 KIAA0247 gene product KIAA0247 Hs.82426AA044734 0.401781 ADP-ribosylation factor 3 ARF3 Hs.119177R31924 0.401781 Hepatoma-derived growth factor (high-mobility group protein 1-like) HDGF Hs.89525R00798 0.401781 Solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, SLC25A17 Hs.62245N90939 0.401781 Major histocompatibility complex, class II, DR alpha HLA-DRA Hs.76807AA137059 0.401781 Alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. ATRX Hs.96264W52111 0.401781 - - -T87161 0.401781 ESTs ESTs Hs.16335N73980 0.401781 Keratin 8 KRT8 Hs.242463R72179 0.401781 Hypothetical protein DKFZp761H0421 DKFZp761H0421 Hs.218182T52348 0.413504 Hypothetical protein FLJ40629 FLJ40629 Hs.99807AA203162 0.413504 - - -AA001326 0.413504 Ariadne homolog 2 (Drosophila) ARIH2 Hs.241558AA040805 0.413504 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 5 PSMD5 Hs.193725R67243 0.413504 Chromosome 20 open reading frame 99 C20orf99 Hs.28608W90379 0.413504 - - -T87787 0.413504 Crumbs homolog 1 (Drosophila) CRB1 Hs.169745H44188 0.413504 - - -W92625 0.413504 Interleukin enhancer binding factor 3, 90kDa ILF3 Hs.256583N32327 0.413504 Cleavage and polyadenylation specific factor 5, 25 kDa CPSF5 Hs.9605N42979 0.413504 Sialyltransferase STHM Hs.288215N51083 0.413504 Hypothetical protein FLJ11159 FLJ11159 Hs.27021N39446 0.413504 E1A binding protein p300 EP300 Hs.25272N80289 0.413504 ORM1-like 2 (S. cerevisiae) ORMDL2 Hs.13144AA045736 0.413504 KIAA1966 protein KIAA1966 Hs.158184T39368 0.413504 Solute carrier family 7 (cationic amino acid transporter, y+ system), member 4 SLC7A4 Hs.197116AA011604 0.413504 - - Hs.278312N24593 0.413504 - - Hs.170538AA026250 0.413504 - - -H81036 0.413504 Hypothetical protein FLJ22059 FLJ22059 Hs.13323AA034006 0.413504 ESTs ESTs Hs.133537AA116105 0.413504 - - Hs.351649N94623 0.413504 Peptidylprolyl isomerase (cyclophilin)-like 1 PPIL1 Hs.27693N31469 0.413504 NCK-associated protein 1 NCKAP1 Hs.278411AA203636 0.413504 - - Hs.132355AA040028 0.413504 Hypothetical protein BC014641 LOC129138 Hs.135259N91920 0.413504 - - -AA150500 0.413504 Interferon stimulated gene 20kDa ISG20 Hs.183487AA204664 0.413504 SMC1 structural maintenance of chromosomes 1-like 2 (yeast) SMC1L2 Hs.182437W68810 0.413504 - - Hs.381134N33237 0.413504 Processing of precursors 1 POP1 Hs.170114N51128 0.413504 Inositol hexaphosphate kinase 2 IHPK2 Hs.323432N68522 0.413504 Transforming growth factor, beta 3 TGFB3 Hs.2025AA136883 0.413504 Poly(rC) binding protein 1 PCBP1 Hs.2853H59677 0.413504 Hypothetical protein FLJ13909 FLJ13909 Hs.288672H21785 0.413504 Zinc finger protein 91 homolog (mouse) ZFP91 Hs.46366H61388 0.413504 Fragile X mental retardation, autosomal homolog 1 FXR1 Hs.82712AA203677 0.413504 - - -AA047414 0.413504 Lactate dehydrogenase A LDHA Hs.2795T84135 0.413504 Cytochrome b5 outer mitochondrial membrane precursor CYB5-M Hs.381218H85363 0.413504 - - -R82447 0.413504 E3 ubiquitin ligase SMURF1 SMURF1 Hs.119120N47737 0.413504 ESTs ESTs Hs.41272R88840 0.413504 - - Hs.268832AA029861 0.413504 Beclin 1 (coiled-coil, myosin-like BCL2 interacting protein) BECN1 Hs.12272N36299 0.413504 COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltra COX10 Hs.77513R87929 0.413504 H326 H326 Hs.110707H58340 0.413504 RNA binding motif protein 10 RBM10 Hs.154583R19138 0.413504 Activated p21cdc42Hs kinase ACK1 Hs.153937H21748 0.413504 Caveolin 2 CAV2 Hs.139851R88297 0.413504 - - Hs.144531R61634 0.413504 Hypothetical protein PRO1855 PRO1855 Hs.283558H03130 0.413504 ESTs ESTs Hs.24370AA136889 0.413504 ESTs ESTs Hs.62578H16789 0.413504 CGI-152 protein CGI-152 Hs.9275H87386 0.413504 Hypothetical protein FLJ11362 FLJ11362 Hs.8929R86854 0.413504 Chromosome 11 open reading frame 14 C11orf14 Hs.32017H51380 0.413504 P450 (cytochrome) oxidoreductase POR Hs.167246H39034 0.413504 Hypothetical protein PRO1489 PRO1489 Hs.197922W47134 0.425428 CGI-58 protein CGI-58 Hs.19385T72589 0.425428 Skeletal muscle and kidney enriched inositol phosphatase SKIP Hs.178347AA210782 0.425428 Signal transducer and activator of transcription 6, interleukin-4 induced STAT6 Hs.181015R97034 0.425428 Serine hydroxymethyltransferase 1 (soluble) SHMT1 Hs.8889W60704 0.425428 Hypothetical protein FLJ20312 FLJ20312 Hs.7862

AA213820 0.425428 - - Hs.256533H53623 0.425428 - - -R59532 0.425428 Phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synt GART Hs.82285AA127934 0.425428 Protein kinase, X-linked PRKX Hs.147996H80498 0.425428 KIAA0286 protein KIAA0286 Hs.14912T84103 0.425428 - - Hs.377850AA045266 0.425428 Thymopoietin TMPO Hs.11355H53969 0.425428 Clone FLB5214 LOC51219 Hs.5486N21505 0.425428 - - Hs.27048N58341 0.425428 Mitochondrial ribosomal protein L22 MRPL22 Hs.41007N72901 0.425428 U5 snRNP-specific 40 kDa protein (hPrp8-binding) HPRP8BP Hs.10290AA047412 0.425428 Zinc finger protein 23 (KOX 16) ZNF23 Hs.55606AA203422 0.425428 Splicing factor, arginine/serine-rich, 46kD SRP46 Hs.155160AA043805 0.425428 Integrin beta 3 binding protein (beta3-endonexin) ITGB3BP Hs.82084AA150275 0.425428 - - Hs.355877R81742 0.425428 Solute carrier family 23 (nucleobase transporters), member 1 SLC23A1 Hs.82042W47031 0.425428 Hypothetical protein LOC51241 LOC51241 Hs.171566R26854 0.425428 - - Hs.261734R85333 0.425428 - - Hs.373513H42146 0.425428 Inositol polyphosphate-5-phosphatase, 40kDa INPP5A Hs.124029N57339 0.425428 Hypothetical protein FLJ11240 FLJ11240 Hs.339833N20508 0.425428 Fidgetin FIGN Hs.274281AA126700 0.425428 Nucleolar and coiled-body phosphoprotein 1 NOLC1 Hs.75337H10439 0.425428 Hypothetical protein MGC5560 MGC5560 Hs.233150H90406 0.425428 Deoxythymidylate kinase (thymidylate kinase) DTYMK Hs.79006R46183 0.425428 Hypothetical protein DKFZp313A2432 DKFZp313A2432 Hs.349096W85777 0.425428 Kaptin (actin binding protein) KPTN Hs.25441AA121547 0.425428 IMP (inosine monophosphate) dehydrogenase 2 IMPDH2 Hs.75432W33123 0.425428 ADP-ribosylation factor-like 3 ARL3 Hs.182215W33065 0.425428 - - Hs.381204H18581 0.425428 CD164 antigen, sialomucin CD164 Hs.43910R72787 0.425428 Immunoglobulin heavy constant mu IGHM Hs.153261AA099373 0.425428 Glycogen synthase 1 (muscle) GYS1 Hs.772R95735 0.425428 Hypothetical protein FLJ25804 FLJ25804 Hs.373547N46182 0.425428 ATP-binding cassette, sub-family A (ABC1), member 1 ABCA1 Hs.211562H38879 0.425428 Phosphoserine phosphatase PSPH Hs.56407AA039428 0.425428 - - -AA045730 0.425428 TGFB inducible early growth response TIEG Hs.82173R05881 0.425428 KIAA0971 protein KIAA0971 Hs.84429H83405 0.425428 Faciogenital dysplasia (Aarskog-Scott syndrome) FGD1 Hs.1572T95796 0.425428 Eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa EIF2B1 Hs.78592R61384 0.425428 ATPase, Cu++ transporting, alpha polypeptide (Menkes syndrome) ATP7A Hs.606R36140 0.425428 - - -W03758 0.425428 - - Hs.141278W47349 0.425428 KIAA0592 protein KIAA0592 Hs.13273N32560 0.425428 Forkhead box M1 FOXM1 Hs.239AA036798 0.43755 - - Hs.339024R00710 0.43755 - - Hs.379472AA028961 0.43755 Hypothetical protein FLJ12150 FLJ12150 Hs.118983R65826 0.43755 Amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3 ALS2CR3 Hs.154248R32753 0.43755 Hypothetical protein FLJ12541 similar to Stra6 FLJ12541 Hs.24553N28966 0.43755 Lysosomal-associated membrane protein 2 LAMP2 Hs.8262H05616 0.43755 Nuclear receptor co-repressor 1 NCOR1 Hs.144904AA069527 0.43755 Tuftelin interacting protein 11 TFIP11 Hs.20225W39596 0.43755 Aldehyde dehydrogenase 1 family, member A1 ALDH1A1 Hs.76392N79524 0.43755 Zinc finger protein, subfamily 2A (FYVE domain containing), 1 ZNFN2A1 Hs.20047W67797 0.43755 Laminin, alpha 5 LAMA5 Hs.11669W45086 0.43755 Multidrug resistance-associated protein 7 SIMRP7 Hs.55879AA134876 0.43755 - - Hs.71523R77424 0.43755 - - -R22967 0.43755 Hypothetical protein FLJ12442 FLJ12442 Hs.84753W39328 0.43755 Hypothetical transmembrane protein SBBI54 SBBI54 Hs.116708W33069 0.43755 SFRS protein kinase 2 SRPK2 Hs.78353AA034480 0.43755 Mannose-6-phosphate receptor (cation dependent) M6PR Hs.75709N93302 0.43755 Hypothetical protein MGC4549 MGC4549 Hs.326422H56534 0.43755 - - -N48166 0.43755 Histone deacetylase 11 HDAC11 Hs.74280AA210890 0.43755 - - -R00802 0.43755 ESTs ESTs Hs.191359R12987 0.43755 - - -H69334 0.43755 Pirin PIR Hs.279663AA037360 0.43755 - - Hs.90960H97372 0.43755 Integrin, beta 5 ITGB5 Hs.149846N66053 0.43755 Butyrophilin, subfamily 3, member A1 BTN3A1 Hs.284283R84964 0.43755 Hypothetical protein FLJ22127 FLJ22127 Hs.59457H22827 0.43755 Serine hydroxymethyltransferase 2 (mitochondrial) SHMT2 Hs.75069T83773 0.43755 Hypothetical protein HSPC216 HSPC216 Hs.13525H79853 0.43755 - - Hs.14355R60986 0.43755 - - Hs.348282R45475 0.43755 Phosphodiesterase 8B PDE8B Hs.78106AA037777 0.43755 Phosphatidylinositol 4-kinase type II PI4KII Hs.25300N45678 0.43755 CDC26 subunit of anaphase promoting complex CDC26 Hs.3991N32304 0.43755 Proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) PSME1 Hs.75348R50785 0.43755 Tubulin, gamma complex associated protein 6 TUBGCP6 Hs.336431T97531 0.43755 - - -AA069570 0.43755 Heat shock 27kDa protein 1 HSPB1 Hs.76067N44874 0.43755 Ubiquitin-protein isopeptide ligase (E3) KIAA0010 Hs.155287R77965 0.43755 Lipin 1 LPIN1 Hs.81412AA052907 0.43755 Hypothetical protein DKFZP434G0310 DKFZP434G0310 Hs.334836AA194092 0.43755 Leukocyte-associated Ig-like receptor 1 LAIR1 Hs.115808H88485 0.43755 - - Hs.108806H04220 0.43755 - - -H21648 0.43755 - - Hs.31834H40074 0.43755 ESTs ESTs Hs.21475N24725 0.43755 Small nuclear ribonucleoprotein polypeptide B'' SNRPB2 Hs.82575N54088 0.43755 - - Hs.96566R66182 0.43755 Reticulocalbin 2, EF-hand calcium binding domain RCN2 Hs.79088AA039374 0.43755 - - -W70217 0.43755 Catechol-O-methyltransferase COMT Hs.240013N27488 0.43755 Sarcolemma associated protein SLMAP Hs.4007

R54933 0.43755 Peptidase D PEPD Hs.73947H89087 0.449868 - - -R80700 0.449868 - - Hs.25218H65168 0.449868 Solute carrier family 12 (sodium/potassium/chloride transporters), member 2 SLC12A2 Hs.110736R20026 0.449868 ESTs ESTs Hs.326475R90829 0.449868 Vascular endothelial growth factor B VEGFB Hs.78781AA120872 0.449868 - - Hs.27552N32967 0.449868 KIAA0678 protein KIAA0678 Hs.12707R12118 0.449868 Heparan sulfate 6-O-sulfotransferase 1 HS6ST1 Hs.6363H06279 0.449868 Hypothetical protein DKFZp762M136 DKFZp762M136 Hs.351747R71647 0.449868 Pleckstrin homology, Sec7 and coiled/coil domains 3 PSCD3 Hs.7984W90523 0.449868 Hypothetical protein FLJ20211 FLJ20211 Hs.311100R17664 0.449868 Methyltransferase-like 1 METTL1 Hs.42957R66879 0.449868 KIAA1911 protein KIAA1911 Hs.290931H50391 0.449868 Acid phosphatase 1, soluble ACP1 Hs.75393R55688 0.449868 KIAA0349 protein KIAA0349 Hs.15303AA039984 0.449868 CCR4-NOT transcription complex, subunit 8 CNOT8 Hs.26703R19011 0.449868 - - -W89149 0.449868 - - -N/A1 0.449868 - - -AA046481 0.449868 Chloride channel 6 CLCN6 Hs.211614H86793 0.449868 - - Hs.81376AA121513 0.449868 KIAA0084 protein KIAA0084 Hs.79123R20590 0.449868 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 ABCC4 Hs.139336N92284 0.449868 Phospholipid transfer protein PLTP Hs.283007H20853 0.449868 - - Hs.288862T95014 0.449868 Serine/threonine kinase 4 STK4 Hs.35140H67893 0.449868 Sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 SULT1A1 Hs.142AA029575 0.449868 KIAA0697 protein KIAA0697 Hs.12329N92723 0.449868 ARF GTPase-activating protein MRIP2 Hs.356559W46217 0.449868 Tigger transposable element derived 6 TIGD6 Hs.169333H82729 0.449868 Homeo box C9 HOXC9 Hs.40408R60660 0.449868 ESTs ESTs Hs.116828H18810 0.449868 - - Hs.9961H19718 0.449868 Glutamate receptor, ionotrophic, AMPA 4 GRIA4 Hs.163697N26046 0.449868 Solute carrier family 25 (mitochondrial deoxynucleotide carrier), member 19 SLC25A19 Hs.16786R28325 0.449868 Hypothetical protein MGC10500 MGC10500 Hs.271599R88426 0.449868 Ran GTPase activating protein 1 RANGAP1 Hs.183800N33831 0.449868 Glutathione peroxidase 4 (phospholipid hydroperoxidase) GPX4 Hs.2706H25157 0.449868 - - -R12692 0.449868 Sterol-C4-methyl oxidase-like SC4MOL Hs.239926H58957 0.449868 Myeloid cell leukemia sequence 1 (BCL2-related) MCL1 Hs.86386AA147492 0.449868 - - Hs.343211W90777 0.449868 Interferon regulatory factor 2 IRF2 Hs.83795N64693 0.449868 ESTs ESTs Hs.132918W56249 0.449868 - - Hs.80285R96346 0.449868 - - Hs.374127W16753 0.449868 - - Hs.198552R25789 0.449868 RAB2, member RAS oncogene family-like RAB2L Hs.170160H43746 0.449868 Hypothetical protein DKFZp761F0118 DKFZp761F0118 Hs.6685N73731 0.449868 ESTs ESTs Hs.269183AA148577 0.449868 Zinc finger protein 20 (KOX 13) ZNF20 Hs.110956N77922 0.449868 - - Hs.343271AA150683 0.449868 Hypothetical protein FLJ10849 FLJ10849 Hs.8768H46579 0.449868 - - Hs.141269H21122 0.449868 Scaffold attachment factor B SAFB Hs.23978AA056740 0.449868 Heterogeneous nuclear ribonucleoprotein K HNRPK Hs.129548W24831 0.46238 Dermatopontin DPT Hs.80552R38502 0.46238 Hypothetical protein FLJ13154 FLJ13154 Hs.25303H90408 0.46238 Hypothetical protein FLJ13910 FLJ13910 Hs.75277AA069568 0.46238 CSRP2 binding protein CSRP2BP Hs.301532R24574 0.46238 Chromosome 7 open reading frame 14 C7orf14 Hs.84790N89894 0.46238 - - -AA033875 0.46238 Similar to yeast Upf3, variant A UPF3A Hs.274412N50403 0.46238 Nucleosome assembly protein 1-like 1 NAP1L1 Hs.302649R25219 0.46238 - - Hs.175652AA099606 0.46238 - - Hs.24143N91931 0.46238 NME7 NME7 Hs.274479H04530 0.46238 Enoyl Coenzyme A hydratase, short chain, 1, mitochondrial ECHS1 Hs.76394W42426 0.46238 Iron-responsive element binding protein 2 IREB2 Hs.370324R98672 0.46238 - - Hs.27004H06281 0.46238 Hypothetical protein FLJ10737 FLJ10737 Hs.261134AA058318 0.46238 Plastin 3 (T isoform) PLS3 Hs.4114N33087 0.46238 Myosin regulatory light chain interacting protein MIR Hs.20072AA046820 0.46238 - - Hs.345588H25618 0.46238 Hypothetical protein HSPC177 HSPC177 Hs.36237W31516 0.46238 - - Hs.7000W70336 0.46238 Hypothetical protein BC007540 LOC144097 Hs.63405T93721 0.46238 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16 DDX16 Hs.12797AA045760 0.46238 Thyroid hormone receptor interactor 10 TRIP10 Hs.73999H86173 0.46238 - - -N52339 0.46238 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) ELAVL1 Hs.12379T87593 0.46238 ESTs ESTs Hs.111805AA063044 0.46238 Hypothetical protein MGC4840 MGC4840 Hs.301872W40179 0.46238 APEX nuclease (multifunctional DNA repair enzyme) APEX Hs.73722AA029959 0.46238 Regulator of G-protein signalling 16 RGS16 Hs.183601W90593 0.46238 Ubiquitin-like 4 UBL4 Hs.76480R17132 0.46238 HSPC055 protein HSPC055 Hs.179898W56037 0.46238 Ras homolog gene family, member H ARHH Hs.109918W90343 0.46238 - - Hs.231637T86708 0.46238 Solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane proSLC4A1 Hs.185923H18558 0.46238 Transcription factor A, mitochondrial TFAM Hs.75133N73088 0.46238 Ataxin 2 related protein A2LP Hs.43509N36659 0.46238 Neuron navigator 1 NAV1 Hs.6298H64559 0.46238 - - -N23296 0.46238 Dynein, cytoplasmic, intermediate polypeptide 2 DNCI2 Hs.66881W80603 0.46238 - - Hs.380051N28259 0.46238 - - Hs.12030H57134 0.46238 - - -W69443 0.46238 High-mobility group nucleosome binding domain 1 HMGN1 Hs.251064

R20019 0.46238 - - -AA031495 0.46238 Peptidylprolyl isomerase E (cyclophilin E) PPIE Hs.33251N20259 0.46238 Hypothetical protein MGC2840 similar to a putative glucosyltransferase MGC2840 Hs.155356W33060 0.46238 Sialyltransferase 4B (beta-galactosidase alpha-2,3-sialytransferase) SIAT4B Hs.343628N73101 0.475085 Solute carrier family 26 (sulfate transporter), member 2 SLC26A2 Hs.29981R80525 0.475085 Nucleoporin Nup37 Nup37 Hs.5152AA131615 0.475085 HRAS-like suppressor 3 HRASLS3 Hs.37189R50487 0.475085 - - Hs.25717T84447 0.475085 - - -R25517 0.475085 - - -AA053306 0.475085 Polyglutamine binding protein 1 PQBP1 Hs.30570R41888 0.475085 - - -W47153 0.475085 Polymerase I and transcript release factor PTRF Hs.29759R21579 0.475085 GTP binding protein 1 GTPBP1 Hs.283677H52694 0.475085 WAP four-disulfide core domain 1 WFDC1 Hs.36688N66072 0.475085 ESTs ESTs Hs.13680R91933 0.475085 C-Mpl binding protein LOC113251 Hs.26613R80770 0.475085 Hypothetical protein C40 C40 Hs.30819AA043836 0.475085 Hypothetical protein BC009518 LOC90799 Hs.135265R60231 0.475085 KIAA1255 protein KIAA1255 Hs.351633R88082 0.475085 ESTs ESTs Hs.31755N29574 0.475085 Rag D protein RAGD Hs.238679T90545 0.475085 KIAA1536 protein KIAA1536 Hs.156667H98783 0.475085 Hypothetical protein FLJ31413 FLJ31413 Hs.24643AA194219 0.475085 - - -R73175 0.475085 Leucine-zipper-like transcriptional regulator, 1 LZTR1 Hs.78788T85305 0.475085 - - -AA136755 0.475085 ESTs ESTs Hs.29475T94105 0.475085 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 ABCC1 Hs.89433N79456 0.475085 Ferritin, heavy polypeptide 1 FTH1 Hs.62954N51117 0.475085 ESTs ESTs Hs.110028N47294 0.475085 - - Hs.350001AA134878 0.475085 KIAA0117 protein KIAA0117 Hs.322478R50511 0.475085 Hydroxysteroid (17-beta) dehydrogenase 1 HSD17B1 Hs.85279R20231 0.475085 Raptor raptor Hs.20677H62770 0.475085 ESTs ESTs Hs.176721R53645 0.475085 - - Hs.378080T86360 0.475085 ESTs ESTs Hs.15266H23225 0.475085 Protein kinase C, epsilon PRKCE Hs.211592N48314 0.475085 Hermansky-Pudlak syndrome 4 HPS4 Hs.6657R48933 0.475085 Polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa POLR2J Hs.80475AA001139 0.475085 Zinc finger protein 274 ZNF274 Hs.83761H52698 0.475085 Diptheria toxin resistance protein required for diphthamide biosynthesis-like 2 ( DPH2L2 Hs.324830N69433 0.475085 KIAA0212 gene product KIAA0212 Hs.154332W37846 0.475085 Hypothetical protein MGC955 MGC955 Hs.55608H85625 0.475085 Checkpoint suppressor 1 CHES1 Hs.211773T96983 0.475085 Cerebroside (3'-phosphoadenylylsulfate:galactosylceramide 3') sulfotransferaseCST Hs.17958R18779 0.475085 - - -N48309 0.475085 Hypothetical protein MGC8721 MGC8721 Hs.279921AA151305 0.475085 DNA directed RNA polymerase II polypeptide J-related gene POLR2J2 Hs.375569W31103 0.475085 Bromodomain containing 2 BRD2 Hs.75243AA210725 0.475085 ESTs ESTs Hs.365595R38638 0.475085 - - Hs.5064T89662 0.475085 - - Hs.268617R69935 0.475085 - - -H19514 0.475085 Frizzled homolog 10 (Drosophila) FZD10 Hs.31664H15553 0.475085 COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltra COX10 Hs.77513R50205 0.475085 - - -N30288 0.475085 Prefoldin 2 PFDN2 Hs.298229AA032211 0.475085 ESTs ESTs Hs.118493AA045253 0.475085 ESTs ESTs Hs.161566AA043249 0.475085 ESTs ESTs Hs.275224H23019 0.475085 - - Hs.28005N25562 0.475085 Protein tyrosine kinase 9 PTK9 Hs.82643W81465 0.475085 Mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase MGAT1 Hs.151513AA150729 0.475085 Nuclear receptor co-repressor 2 NCOR2 Hs.287994R62727 0.475085 Ankyrin repeat, family A (RFXANK-like), 2 ANKRA2 Hs.239154H14473 0.475085 Tetracycline transporter-like protein TETRAN Hs.157145N25253 0.475085 Chromosome 5 open reading frame 8 C5orf8 Hs.75864AA010007 0.487978 - - Hs.222505R01677 0.487978 Ring finger protein 4 RNF4 Hs.66394AA047406 0.487978 Translocase of outer mitochondrial membrane 70 homolog A (yeast) TOMM70A Hs.21198N73885 0.487978 CDA02 protein CDA02 Hs.332404R02110 0.487978 XPMC2 protein LOC57109 Hs.235376W17370 0.487978 Mitochondrial elongation factor G EFG1 Hs.274543AA069400 0.487978 Hypothetical protein MGC10974 MGC10974 Hs.111099R46209 0.487978 Phosphatidylglycerophosphate synthase PGS1 Hs.162604AA213820 0.487978 - - Hs.256533AA054468 0.487978 - - Hs.356385W46270 0.487978 Hypothetical protein FLJ22625 FLJ22625 Hs.106534H01133 0.487978 - - Hs.30120R60480 0.487978 Beclin 1 (coiled-coil, myosin-like BCL2 interacting protein) BECN1 Hs.12272N24115 0.487978 - - Hs.323780AA028907 0.487978 - - Hs.34447H73128 0.487978 Integrin, beta 5 ITGB5 Hs.149846W00877 0.487978 - - -T86470 0.487978 - - -R11719 0.487978 Nucleolar protein 1, 120kDa NOL1 Hs.15243AA056752 0.487978 Hypothetical protein FLJ20568 FLJ20568 Hs.279581R39405 0.487978 Dishevelled, dsh homolog 2 (Drosophila) DVL2 Hs.118640H14810 0.487978 - - Hs.303154W69323 0.487978 - - -H89832 0.487978 Centromere protein F, 350/400ka (mitosin) CENPF Hs.77204H51316 0.487978 Sestrin 2 SES2 Hs.8026N92789 0.487978 Hypothetical protein HSPC148 HSPC148 Hs.42743H95787 0.487978 - - Hs.108745R40457 0.487978 - - -H21758 0.487978 - - Hs.375003N75316 0.487978 DKFZP727C091 protein DKFZP727C091 Hs.43141N71104 0.487978 - - Hs.46506

R62983 0.487978 - - Hs.82276H11588 0.487978 Bromodomain containing 2 BRD2 Hs.75243R98467 0.487978 Hypothetical protein FLJ14668 FLJ14668 Hs.334644H75270 0.487978 Hypothetical protein FLJ14743 FLJ14743 Hs.169577H19829 0.487978 Rab acceptor 1 (prenylated) RABAC1 Hs.11417H17141 0.487978 KIAA0376 protein KIAA0376 Hs.4791N48155 0.487978 - - Hs.46826H05539 0.487978 Uncharacterized bone marrow protein BM046 BM046 Hs.177812H52616 0.487978 Beta-amyloid binding protein precursor BBP Hs.333541N25620 0.487978 Midline 1 (Opitz/BBB syndrome) MID1 Hs.27695R27190 0.487978 Placental growth factor, vascular endothelial growth factor-related protein PGF Hs.2894R02573 0.487978 Similar to yeast Upf3, variant A UPF3A Hs.274412N67638 0.487978 Disrupted in renal carcinoma 2 DIRC2 Hs.11360H26760 0.487978 KIAA0375 gene product KIAA0375 Hs.26951AA131280 0.487978 B-cell CLL/lymphoma 6 (zinc finger protein 51) BCL6 Hs.155024H23029 0.487978 Protein inhibitor of activated STAT X PIASX-BETA Hs.111323H47146 0.487978 Excision repair cross-complementing rodent repair deficiency, complementationERCC1 Hs.59544AA044382 0.487978 YY1 transcription factor YY1 Hs.97496N71546 0.487978 Hypothetical protein FLJ20920 FLJ20920 Hs.288959AA045366 0.487978 Plastin 3 (T isoform) PLS3 Hs.4114N93402 0.487978 Guanine nucleotide binding protein-like 1 GNL1 Hs.83147H46276 0.487978 RNA, U17D small nucleolar RNU17D Hs.196769H88535 0.487978 - - Hs.153527R71614 0.487978 - - Hs.233354N79532 0.487978 - - Hs.378235N70859 0.487978 Exportin 1 (CRM1 homolog, yeast) XPO1 Hs.79090AA055333 0.487978 CCAAT/enhancer binding protein (C/EBP), gamma CEBPG Hs.2227H52742 0.487978 HMT1 hnRNP methyltransferase-like 2 (S. cerevisiae) HRMT1L2 Hs.20521N99057 0.487978 Likely ortholog of mouse synembryn RIC-8 Hs.7393W78857 0.487978 - - Hs.339722R09933 0.487978 - - Hs.355762R96766 0.487978 Sema domain, transmembrane domain (TM), and cytoplasmic domain, (semapSEMA6A Hs.263395H20778 0.487978 Pregnancy-induced growth inhibitor OKL38 Hs.31773H20004 0.487978 WD repeat domain 8 WDR8 Hs.31714N62934 0.487978 ESTs ESTs Hs.348421W93284 0.487978 Transcription elongation factor A (SII), 3 TCEA3 Hs.94952T83961 0.487978 - - -H52728 0.487978 Tripartite motif-containing 35 TRIM35 Hs.137732AA034330 0.487978 - - -N95162 0.487978 Cytochrome c oxidase subunit Va COX5A Hs.323834AA035227 0.487978 Unknown LOC51693 Hs.27445R13347 0.487978 Kelch motif containing protein AB026190 Hs.106290R56381 0.487978 Hypothetical protein FLJ14775 FLJ14775 Hs.334878AA045847 0.487978 - - Hs.188361R17728 0.501058 Molybdenum cofactor synthesis 3 MOCS3 Hs.159410R63060 0.501058 - - -W42742 0.501058 CGI-29 protein LOC51074 Hs.104058W93292 0.501058 Mitochondrial carrier homolog 2 MTCH2 Hs.279609R35255 0.501058 - - Hs.283839H17405 0.501058 KIAA0435 gene product KIAA0435 Hs.31438AA040920 0.501058 Chromosome 3p21.1 gene sequence HUMAGCGB Hs.84162AA043178 0.501058 Mitogen-activated protein kinase 3 MAPK3 Hs.861R39441 0.501058 - - -W86753 0.501058 Chemokine (C-X-C motif) ligand 16 CXCL16 Hs.82407W60673 0.501058 Hypothetical protein FLJ21868 FLJ21868 Hs.46829N73898 0.501058 - - Hs.220656AA045615 0.501058 Membrane-bound transcription factor protease, site 1 MBTPS1 Hs.75890H77659 0.501058 Tubulin, gamma 1 TUBG1 Hs.21635AA039246 0.501058 Transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila) TLE2 Hs.332173R86741 0.501058 HRD1 protein HRD1 Hs.334819T66845 0.501058 Tax interaction protein 1 TIP-1 Hs.12956W58176 0.501058 ATPase, H+ transporting, lysosomal 21kDa, V0 subunit c'' ATP6V0B Hs.7476H83830 0.501058 KIAA1096 protein KIAA1096 Hs.69559H63542 0.501058 Upstream binding protein 1 (LBP-1a) UBP1 Hs.28423W37381 0.501058 Splicing factor, arginine/serine-rich 2 SFRS2 Hs.73965N27178 0.501058 T-box 3 (ulnar mammary syndrome) TBX3 Hs.267182H80175 0.501058 Radixin RDX Hs.263671T85113 0.501058 Tumor protein, translationally-controlled 1 TPT1 Hs.279860AA130095 0.501058 Hypothetical protein FLJ21749 FLJ21749 Hs.288761R97690 0.501058 Limkain beta 2 FLJ22471 Hs.288909H01172 0.501058 Golgi reassembly stacking protein 2, 55kDa GORASP2 Hs.6880W58007 0.501058 KIAA0222 gene product KIAA0222 Hs.48450W90706 0.501058 Chromosome 20 open reading frame 119 C20orf119 Hs.372714AA043638 0.501058 Crystallin, zeta (quinone reductase) CRYZ Hs.83114H55916 0.501058 Peptidylprolyl isomerase F (cyclophilin F) PPIF Hs.173125N32669 0.501058 RPA-binding trans-activator RBT1 Hs.169138R55696 0.501058 KIAA1107 protein KIAA1107 Hs.21554AA128278 0.501058 KIAA0326 protein KIAA0326 Hs.301094R70894 0.501058 TGFB-induced factor (TALE family homeobox) TGIF Hs.90077W56466 0.501058 ESTs ESTs Hs.130214AA099036 0.501058 Astrotactin 2 ASTN2 Hs.30898AA121308 0.501058 TRNA isopentenylpyrophosphate transferase IPT Hs.356554AA213541 0.501058 Ninein (GSK3B interacting protein) NIN Hs.44054N42817 0.501058 Cytochrome c oxidase subunit VIc COX6C Hs.351875H18275 0.501058 - - -R22236 0.501058 KIAA0336 gene product KIAA0336 Hs.278671N74699 0.501058 Malonyl-CoA decarboxylase MLYCD Hs.150748N29422 0.501058 Matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV coll MMP2 Hs.111301R60482 0.501058 DNA methyltransferase 1-associated protein 1 DMAP1 Hs.8008AA101835 0.501058 - - Hs.374524R87681 0.501058 MUF1 protein MUF1 Hs.172210T91710 0.501058 Intersectin 2 ITSN2 Hs.166184R88993 0.501058 Vesicle trafficking protein SEC22C Hs.12942AA137220 0.501058 - - Hs.83286T99307 0.501058 Zinc finger protein 384 ZNF384 Hs.103315R14556 0.501058 - - -R70121 0.501058 Inositol 1,3,4-triphosphate 5/6 kinase ITPK1 Hs.6453AA039869 0.501058 Charot-Leyden crystal protein CLC Hs.889N57645 0.501058 ESTs ESTs Hs.380509AA001104 0.501058 Regulator of G-protein signalling 3 RGS3 Hs.82294

H66279 0.501058 - - Hs.216226W45534 0.501058 Laminin, alpha 4 LAMA4 Hs.78672T88719 0.501058 Baculoviral IAP repeat-containing 5 (survivin) BIRC5 Hs.1578W74466 0.501058 Keratin 10 (epidermolytic hyperkeratosis; keratosis palmaris et plantaris) KRT10 Hs.99936N23950 0.501058 High-mobility group box 2 HMGB2 Hs.80684AA190714 0.501058 Cytoskeleton associated protein 2 CKAP2 Hs.24641H28105 0.501058 Small nuclear ribonucleoprotein polypeptide N SNRPN Hs.48375N90076 0.501058 Exostoses (multiple)-like 2 EXTL2 Hs.61152T79588 0.501058 CCR4-NOT transcription complex, subunit 3 CNOT3 Hs.343571W40227 0.501058 Nucleobindin 2 NUCB2 Hs.3164R12960 0.514321 KIAA1110 protein KIAA1110 Hs.22479W55924 0.514321 - - Hs.35962H82142 0.514321 PC326 protein PC326 Hs.279882N32330 0.514321 DAZ associated protein 2 DAZAP2 Hs.75416R93684 0.514321 Hypothetical protein My014 MY014 Hs.67619H12862 0.514321 Protein inhibitor of activated STAT protein PIASy PIASY Hs.105779H03709 0.514321 Hypothetical protein RP4-622L5 RP4-622L5 Hs.272299AA069620 0.514321 - - Hs.198552N49728 0.514321 KIAA0916 protein KIAA0916 Hs.151411H50875 0.514321 Hepatocyte nuclear factor 3, gamma HNF3G Hs.36137W23711 0.514321 Core-binding factor, runt domain, alpha subunit 2; translocated to, 2 CBFA2T2 Hs.153934AA047581 0.514321 Peroxiredoxin 5 PRDX5 Hs.31731R31356 0.514321 RE1-silencing transcription factor REST Hs.227630H28165 0.514321 Chaperone, ABC1 activity of bc1 complex like (S. pombe) CABC1 Hs.273186R50526 0.514321 - - -W61377 0.514321 Aminolevulinate, delta-, dehydratase ALAD Hs.1227H23260 0.514321 NDRG family member 3 NDRG3 Hs.355855AA044244 0.514321 - - Hs.275038R33946 0.514321 Quinolinate phosphoribosyltransferase (nicotinate-nucleotide pyrophosphorylasQPRT Hs.8935H00517 0.514321 Chromosome 21 open reading frame 63 C21orf63 Hs.30156H27907 0.514321 CDK5 regulatory subunit associated protein 2 CDK5RAP2 Hs.32360N90287 0.514321 - - -H85860 0.514321 - - -N63833 0.514321 Glucosamine (N-acetyl)-6-sulfatase (Sanfilippo disease IIID) GNS Hs.334534N91368 0.514321 ALL1-fused gene from chromosome 1q AF1Q Hs.75823AA045634 0.514321 ESTs ESTs Hs.364644H13832 0.514321 Hypothetical protein FLJ10404 FLJ10404 Hs.111279N59563 0.514321 Cyclin D-type binding-protein 1 CCNDBP1 Hs.36794R69611 0.514321 Karyopherin alpha 6 (importin alpha 7) KPNA6 Hs.301553H18495 0.514321 ESTs ESTs Hs.8053R25019 0.514321 ESTs ESTs Hs.21364T93907 0.514321 - - -T66784 0.514321 Zinc-fingers and homeoboxes 1 ZHX1 Hs.12940R59315 0.514321 Polymerase (DNA directed), delta 3 POLD3 Hs.82502AA055329 0.514321 - - Hs.351561H38592 0.514321 ESTs ESTs Hs.32840AA114891 0.514321 Syndecan 2 (heparan sulfate proteoglycan 1, cell surface-associated, fibroglycaSDC2 Hs.1501N48160 0.514321 - - Hs.43619W31480 0.514321 Coiled-coil protein BICD2 BICD2 Hs.330988H88566 0.514321 - - -H06742 0.514321 Oxysterol binding protein-like 9 OSBPL9 Hs.21938W93404 0.514321 Mitotic spindle coiled-coil related protein DEEPEST Hs.16244R72114 0.514321 Melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor) MC1R Hs.380388N27137 0.514321 Catechol-O-methyltransferase COMT Hs.240013R40400 0.514321 Cell adhesion molecule with homology to L1CAM (close homolog of L1) CHL1 Hs.210863AA054757 0.514321 Zinc finger protein 226 ZNF226 Hs.145956H57284 0.514321 Neural precursor cell expressed, developmentally down-regulated 5 NEDD5 Hs.155595N91448 0.514321 Protease, serine, 23 SPUVE Hs.25338R23136 0.514321 Solute carrier family 11 (proton-coupled divalent metal ion transporters), membSLC11A2 Hs.57435R51845 0.514321 Cyclin-dependent kinase 8 CDK8 Hs.25283W31584 0.514321 Hypothetical protein MGC3251 MGC3251 Hs.13467R31364 0.514321 - - Hs.128676T86146 0.514321 ESTs ESTs Hs.16094AA055968 0.514321 Synuclein, gamma (breast cancer-specific protein 1) SNCG Hs.349470H65280 0.514321 ESTs ESTs Hs.38348W47043 0.514321 Cyclin-dependent kinase 5 CDK5 Hs.166071N40301 0.514321 Cytoskeleton associated protein 2 CKAP2 Hs.24641R65748 0.514321 - - -W85883 0.514321 Hypothetical protein FLJ10847 FLJ10847 Hs.48403N24593 0.514321 - - Hs.170538N63997 0.514321 - - Hs.373497R65823 0.514321 Two-pore channel 1, homolog KIAA1169 Hs.26440AA011350 0.514321 Similar to phosphoserine/threonine/tyrosine interaction protein; STNS (alternatiLOC122792 Hs.224818AA005152 0.514321 - - Hs.356494R32787 0.514321 - - -R12233 0.527765 NY-REN-24 antigen LOC58509 Hs.128425H06635 0.527765 Integrin, alpha 6 ITGA6 Hs.227730W87502 0.527765 - - Hs.356201R45115 0.527765 Thyroid hormone receptor interactor 12 TRIP12 Hs.138617R13172 0.527765 Nuclear receptor co-repressor 1 NCOR1 Hs.144904H16602 0.527765 - - Hs.356087W89013 0.527765 Tripartite motif-containing 26 TRIM26 Hs.1287AA036758 0.527765 S100 calcium binding protein A4 (calcium protein, calvasculin, metastasin, mur S100A4 Hs.81256T87251 0.527765 ESTs ESTs Hs.114604H08164 0.527765 KIAA1265 protein KIAA1265 Hs.355925T77424 0.527765 FOXJ2 forkhead factor FHX Hs.120844N34859 0.527765 Histone deacetylase 10 HDAC10 Hs.26593T72401 0.527765 Chromosome 8 open reading frame 4 C8orf4 Hs.283683W92120 0.527765 Splicing factor, arginine/serine-rich, 46kD SRP46 Hs.155160H68599 0.527765 Hypothetical protein MGC15737 MGC15737 Hs.39122AA142881 0.527765 - - Hs.154304H77668 0.527765 Aryl hydrocarbon receptor AHR Hs.170087AA069271 0.527765 IK cytokine, down-regulator of HLA II IK Hs.8024AA032250 0.527765 - - Hs.15806T97307 0.527765 - - -N91767 0.527765 Twisted gastrulation TSG Hs.247302R18625 0.527765 Proteasome (prosome, macropain) 26S subunit, ATPase, 3 PSMC3 Hs.250758H42140 0.527765 - - Hs.12311T85637 0.527765 Hypothetical protein MGC10993 MGC10993 Hs.12199N44886 0.527765 MGC4170 protein MGC4170 Hs.7041

AA130176 0.527765 SNF-1 related kinase SNRK Hs.79025N31725 0.527765 TRAF family member-associated NFKB activator TANK Hs.146847N35485 0.527765 MAD1 mitotic arrest deficient-like 1 (yeast) MAD1L1 Hs.7345R53519 0.527765 Golgi associated, gamma adaptin ear containing, ARF binding protein 2 GGA2 Hs.155546AA150924 0.527765 Immunoglobulin (CD79A) binding protein 1 IGBP1 Hs.3631N46949 0.527765 - - -R71067 0.527765 Low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor) LRP1 Hs.89137R72275 0.527765 Dolichyl-p-mannose:Man7GlcNAc2-PP-dolichyl mannosyltransferase ALG12 Hs.77575N48159 0.527765 CGI-148 protein LOC51030 Hs.6776N63996 0.527765 ESTs ESTs Hs.289083W52943 0.527765 Dudulin 2 FLJ10829 Hs.57655H78668 0.527765 - - Hs.189869AA056513 0.527765 Glutaredoxin 2 GLRX2 Hs.5054R74157 0.527765 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 ATP6V0D1 Hs.106876N62942 0.527765 Putative membrane protein LOC54499 Hs.93832R64172 0.527765 ESTs ESTs Hs.260100T84454 0.527765 COP9 subunit 6 (MOV34 homolog, 34 kD) MOV34-34KD Hs.15591R22308 0.527765 Nuclear phosphoprotein similar to S. cerevisiae PWP1 PWP1 Hs.172589H45128 0.527765 - - Hs.293441N30715 0.527765 ATP binding protein associated with cell differentiation APACD Hs.153884T87532 0.527765 ESTs ESTs Hs.10739H26561 0.527765 Serine/threonine kinase 11 interacting protein STK11IP Hs.22410R26919 0.527765 Down syndrome critical region gene 1-like 2 DSCR1L2 Hs.129319W58270 0.527765 Karyopherin beta 2b, transportin TRN2 Hs.278378N46377 0.527765 Beta-galactose-3-O-sulfotransferase, 4 GAL3ST-4 Hs.44856R77731 0.527765 DKFZP566C0424 protein DKFZP566C0424 Hs.226770W88941 0.527765 Microspherule protein 1 MCRS1 Hs.25313T95296 0.527765 - - -N34169 0.527765 Neurofibromin 2 (bilateral acoustic neuroma) NF2 Hs.902AA213820 0.527765 - - Hs.256533R34225 0.527765 KIAA0998 protein KIAA0998 Hs.131525AA040629 0.527765 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); trMLLT6 Hs.349196R65766 0.527765 SEC22 vesicle trafficking protein-like 1 (S. cerevisiae) SEC22L1 Hs.50785T75200 0.527765 Hypothetical protein FLJ14566 FLJ14566 Hs.12313N24302 0.527765 Zinc finger protein 146 ZNF146 Hs.301819R48321 0.527765 KIAA0450 gene product KIAA0450 Hs.170156H53410 0.527765 Polymerase (DNA-directed), delta 4 POLD4 Hs.82520H11615 0.527765 Zinc finger, DHHC domain containing 4 ZDHHC4 Hs.5268N95220 0.527765 Hypothetical protein MBC3205 MBC3205 Hs.43621H93832 0.527765 Chromosome 20 open reading frame 16 C20orf16 Hs.92374R20810 0.527765 Topoisomerase (DNA) I TOP1 Hs.317R59901 0.527765 Mevalonate kinase (mevalonic aciduria) MVK Hs.130607R54865 0.527765 Hypothetical protein from EUROIMAGE 2021883 LOC56926 Hs.24983H22064 0.527765 PHD zinc finger transcription factor PF1 Hs.135890AA152292 0.541386 Ovarian carcinoma immunoreactive antigen OCIA Hs.132071AA059128 0.541386 H2A histone family, member Y H2AFY Hs.75258H38322 0.541386 SET binding factor 1 SBF1 Hs.112049R27192 0.541386 Putative intramembrane cleaving protease SPPL2A Hs.28980N45646 0.541386 - - -R53443 0.541386 ESTs ESTs Hs.23691R96472 0.541386 Hypothetical protein FLJ10276 FLJ10276 Hs.333149T87888 0.541386 KIAA1046 protein KIAA1046 Hs.89519N27569 0.541386 - - Hs.218707H88020 0.541386 ESTs ESTs Hs.114271AA152026 0.541386 - - Hs.323527H04597 0.541386 Inner membrane protein, mitochondrial (mitofilin) IMMT Hs.78504H72617 0.541386 Hypothetical protein FLJ13150 FLJ13150 Hs.169728N74558 0.541386 Suppression of tumorigenicity 7 ST7 Hs.5814R79550 0.541386 Lysosomal-associated protein transmembrane 4 alpha LAPTM4A Hs.111894AA213887 0.541386 Hypothetical protein FLJ21908 FLJ21908 Hs.26750R94867 0.541386 Ring finger protein 1 RING1 Hs.35384T75396 0.541386 GMPR2 for guanosine monophosphate reductase isolog LOC51292 Hs.234546N30177 0.541386 - - Hs.25892N27188 0.541386 Hypothetical protein from BCRA2 region CG005 Hs.23518W05091 0.541386 Wilms' tumour 1-associating protein WTAP Hs.119AA115345 0.541386 Hypothetical protein DKFZp586F2423 DKFZP586F2423 Hs.13659H92226 0.541386 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, TAF12 Hs.82037AA028141 0.541386 Pogo transposable element with ZNF domain POGZ Hs.107088AA033652 0.541386 ATP-dependent RNA helicase MGC2835 Hs.70582W68734 0.541386 Uncharacterized hematopoietic stem/progenitor cells protein MDS028 MDS028 Hs.29647H39075 0.541386 Calcium/calmodulin-dependent protein kinase kinase 2, beta CAMKK2 Hs.108708H53712 0.541386 Protein kinase C, delta PRKCD Hs.155342H50941 0.541386 Interleukin enhancer binding factor 3, 90kDa ILF3 Hs.256583H69082 0.541386 KIAA0241 protein KIAA0241 Hs.150275N23806 0.541386 Similar to envelope protein LOC113386 Hs.132055N63501 0.541386 YY1 transcription factor YY1 Hs.97496H19822 0.541386 Leucyl-tRNA synthetase, mitochondrial LARS2 Hs.2450AA036972 0.541386 Pre-mRNA splicing factor 17 PRP17 Hs.116674H19984 0.541386 Stromal membrane-associated protein SMAP1 Hs.373517W46278 0.541386 T-cell activation protein phosphatase 2C TA-PP2C Hs.13854H50940 0.541386 Nef-associated factor 1 NAF1 Hs.109281AA037517 0.541386 Chromosome 20 open reading frame 13 C20orf13 Hs.88367R92026 0.541386 Fracture callus 1 homolog (rat) FXC1 Hs.54943N90407 0.541386 Ems1 sequence (mammary tumor and squamous cell carcinoma-associated (pEMS1 Hs.119257AA114905 0.541386 Sperm associated antigen 7 SPAG7 Hs.90436AA039452 0.541386 YY1 transcription factor YY1 Hs.97496AA035309 0.541386 Hypothetical protein 20D7-FC4 20D7-FC4 Hs.128702AA053901 0.541386 - - Hs.60740H82747 0.541386 ESTs ESTs Hs.295855AA115581 0.541386 Phosphoglycerate kinase 1 PGK1 Hs.78771T83724 0.541386 Growth arrest-specific 2 like 1 GAS2L1 Hs.322852H49479 0.541386 CCR4-NOT transcription complex, subunit 8 CNOT8 Hs.26703R47931 0.541386 Hypothetical protein DKFZp434M0519 MGC26684 Hs.7001H17403 0.541386 Hypothetical protein FLJ22318 FLJ22318 Hs.22753W31293 0.541386 Hypothetical protein FLJ10631 FLJ10631 Hs.238944H67332 0.541386 GTP binding protein 1 GTPBP1 Hs.283677AA001116 0.541386 Peroxisomal farnesylated protein PXF Hs.168670W87701 0.541386 KIAA0981 protein KIAA0981 Hs.158135T47536 0.541386 Hypothetical protein MGC16924 MGC16924 Hs.85752AA054522 0.541386 Similar to triple functional domain (PTPRF interacting) LOC115557 Hs.61581

T80727 0.541386 Protease, serine, 25 PRSS25 Hs.115721AA047678 0.541386 Death associated protein 3 DAP3 Hs.159627AA134825 0.541386 Solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 SLC7A6 Hs.10315W69683 0.541386 Nuclear factor (erythroid-derived 2)-like 1 NFE2L1 Hs.83469T77588 0.541386 ESTs ESTs Hs.187466H67809 0.541386 U3 snoRNP-associated 55-kDa protein U3-55K Hs.153768R72173 0.541386 - - -R19153 0.541386 - - Hs.356751AA057856 0.541386 ESTs ESTs Hs.63344N33563 0.541386 Transgelin TAGLN Hs.75777AA045318 0.541386 Holocytochrome c synthase (cytochrome c heme-lyase) HCCS Hs.211571AA099608 0.541386 - - Hs.7037W72903 0.541386 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNDDX9 Hs.74578AA136882 0.541386 Activin A receptor, type I ACVR1 Hs.150402R60261 0.541386 Slingshot 2 SSH2 Hs.25127H26021 0.541386 - - Hs.136235R55690 0.541386 Ninein (GSK3B interacting protein) NIN Hs.44054H64513 0.55518 - - -H81680 0.55518 Nucleolar protein ANKT ANKT Hs.279905N38958 0.55518 CCCTC-binding factor (zinc finger protein) CTCF Hs.57419R80979 0.55518 Mitogen-activated protein kinase kinase kinase 11 MAP3K11 Hs.89449H73928 0.55518 Protein translocation complex beta SEC61B Hs.77028AA099226 0.55518 - - Hs.356377N46725 0.55518 Hypothetical protein FLJ22679 FLJ22679 Hs.5472N44176 0.55518 Hypothetical protein MGC2865 MGC2865 Hs.94814AA039275 0.55518 - - Hs.125073H80258 0.55518 - - Hs.41352R18357 0.55518 KIAA1045 protein KIAA1045 Hs.7989H25699 0.55518 Opa-interacting protein 2 OIP2 Hs.274170N27829 0.55518 Hypothetical protein BC013035 LOC114926 Hs.10018R72606 0.55518 Hypothetical protein FLJ20457 FLJ20457 Hs.29276N93442 0.55518 - - -R52847 0.55518 - - -W72937 0.55518 Caldesmon 1 CALD1 Hs.325474W67471 0.55518 Ras homolog gene family, member B ARHB Hs.204354N25190 0.55518 Glutathione peroxidase 1 GPX1 Hs.76686W88447 0.55518 Cell growth regulatory with ring finger domain CGR19 Hs.59106N93559 0.55518 Tyrosine kinase 2 TYK2 Hs.75516H26570 0.55518 V-akt murine thymoma viral oncogene homolog 2 AKT2 Hs.326445N49737 0.55518 DKFZp434K114 protein DKFZp434K114 Hs.6107AA101787 0.55518 Hypothetical protein FLJ20442 FLJ20442 Hs.55505N47087 0.55518 Polymerase (RNA) II (DNA directed) polypeptide C, 33kDa POLR2C Hs.79402H23264 0.55518 - - Hs.13781T58690 0.55518 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 39 DDX39 Hs.311609T53682 0.55518 Gene predicted from cDNA with a complete coding sequence KIAA0110 Hs.124N29018 0.55518 - - -W15595 0.55518 Coactivator for steroid receptors COASTER Hs.172329W47073 0.55518 Solute carrier family 20 (phosphate transporter), member 1 SLC20A1 Hs.78452N25636 0.55518 Esterase D/formylglutathione hydrolase ESD Hs.82193R50785 0.55518 Tubulin, gamma complex associated protein 6 TUBGCP6 Hs.336431H23269 0.55518 Vacuolar protein sorting 41 (yeast) VPS41 Hs.180941H27559 0.55518 Conserved gene telomeric to alpha globin cluster CGTHBA Hs.19699H16467 0.55518 Sorting nexin 11 SNX11 Hs.15827R67239 0.55518 Bromodomain adjacent to zinc finger domain, 2A BAZ2A Hs.277401AA029050 0.55518 - - -R14063 0.55518 Hypothetical protein DKFZp586M1819 DKFZp586M1819 Hs.355753T83747 0.55518 - - -AA147535 0.55518 Retinoic acid induced 1 RAI1 Hs.110953R55787 0.55518 KIAA1069 protein KIAA1069 Hs.193143N66086 0.55518 - - Hs.350534N35908 0.55518 - - Hs.171553R53559 0.55518 Non-metastatic cells 1, protein (NM23A) expressed in NME1 Hs.118638N58514 0.55518 Mitochondrial Acyl-CoA Thioesterase MT-ACT48 Hs.18625T80020 0.55518 Microtubule-associated protein 4 MAP4 Hs.239298N74655 0.55518 ESTs ESTs Hs.35064R60915 0.55518 Growth suppressor 1 GROS1 Hs.10114N70291 0.55518 Apolipoprotein A-II APOA2 Hs.237658T92561 0.55518 Suppression of tumorigenicity 7 ST7 Hs.5814R82668 0.55518 Hypothetical protein MGC2577 MGC2577 Hs.30114R53743 0.55518 Ankyrin 3, node of Ranvier (ankyrin G) ANK3 Hs.75893AA130374 0.55518 - - -AA043491 0.55518 Chromosome 6 open reading frame 1 C6orf1 Hs.62620T92153 0.55518 - - -AA039602 0.55518 Hypothetical protein HSPC216 HSPC216 Hs.13525W24560 0.55518 Pleiomorphic adenoma gene-like 2 PLAGL2 Hs.154104N94610 0.55518 Hypothetical protein BC010734 LOC147632 Hs.48821AA009672 0.55518 Tyrosine kinase 2 TYK2 Hs.75516H61280 0.55518 - - -H16254 0.55518 Pannexin 1 PANX1 Hs.30985R96178 0.55518 - - -AA043764 0.55518 Putative nucleic acid binding protein RY-1 RY1 Hs.54649R67214 0.55518 MAD, mothers against decapentaplegic homolog 4 (Drosophila) MADH4 Hs.75862N39072 0.55518 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypepGNAI1 Hs.203862N36953 0.55518 Deoxycytidine kinase DCK Hs.709H88208 0.55518 Suppressor of var1, 3-like 1 (S. cerevisiae) SUPV3L1 Hs.106469AA122364 0.55518 Receptor tyrosine kinase-like orphan receptor 2 ROR2 Hs.155585H18310 0.55518 Ecotropic viral integration site 5 EVI5 Hs.179747H10327 0.55518 - - Hs.374418H57835 0.55518 Hypothetical protein LOC51240 LOC51240 Hs.7870AA007617 0.55518 Hypothetical protein AD034 AD034 Hs.281397W46869 0.55518 - - Hs.356699N62617 0.55518 Hypothetical protein CL640 CL640 Hs.44563R83613 0.55518 Cyclin G associated kinase GAK Hs.153227R02581 0.55518 F-box only protein 9 FBXO9 Hs.11050N48827 0.55518 FLJ23277 protein FLJ23277 Hs.334477R88526 0.55518 Scotin SCOTIN Hs.24220R63806 0.55518 Likely ortholog of mouse heat shock protein, 70 kDa 4 LOC51182 Hs.44581AA142986 0.55518 Hypothetical protein FLJ11294 FLJ11294 Hs.107000R39875 0.55518 - - -AA044730 0.55518 FLJ23277 protein FLJ23277 Hs.334477

T69714 0.569143 Polymerase (DNA directed), beta POLB Hs.180107H50923 0.569143 KIAA0747 protein KIAA0747 Hs.8309N77380 0.569143 ESTs ESTs Hs.19918T74462 0.569143 Transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) TAP1 Hs.352018N68959 0.569143 Adenylate cyclase 6 ADCY6 Hs.12373W58034 0.569143 Small nuclear ribonucleoprotein polypeptide A' SNRPA1 Hs.80506R59976 0.569143 KIAA1831 protein KIAA1831 Hs.26714R88085 0.569143 Quiescin Q6 QSCN6 Hs.77266R31243 0.569143 Multiple endocrine neoplasia I MEN1 Hs.240443N29431 0.569143 NEDD8 ultimate buster-1 LOC51667 Hs.279780H05532 0.569143 Hypothetical protein BC004501 LOC90231 Hs.110906AA213442 0.569143 ESTs ESTs Hs.148000W37533 0.569143 Hexokinase 1 HK1 Hs.118625H75548 0.569143 Tumor protein p53 binding protein, 1 TP53BP1 Hs.170263H24891 0.569143 - - Hs.293663W72933 0.569143 Splicing factor, arginine/serine-rich 1 (splicing factor 2, alternate splicing factor)SFRS1 Hs.73737H62445 0.569143 - - -H52696 0.569143 Hypothetical protein FLJ10101 FLJ10101 Hs.334802R20374 0.569143 Chromatin assembly factor 1, subunit B (p60) CHAF1B Hs.75238T94898 0.569143 Hypothetical protein SP192 SP192 Hs.169854H10452 0.569143 Insulin-like growth factor 1 receptor IGF1R Hs.239176H16773 0.569143 - - Hs.12245H43546 0.569143 ESTs ESTs Hs.30258R59970 0.569143 GABA(A) receptor-associated protein like 1 GABARAPL1 Hs.336429AA039528 0.569143 - - Hs.37858H14054 0.569143 Beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) B3GAT3 Hs.26492R62751 0.569143 Sjogren syndrome antigen A1 (52kDa, ribonucleoprotein autoantigen SS-A/Ro)SSA1 Hs.1042H12710 0.569143 KIAA0802 protein KIAA0802 Hs.27657R59471 0.569143 Protein phosphatase 2A, regulatory subunit B' (PR 53) PPP2R4 Hs.236963H45196 0.569143 Rho/rac guanine nucleotide exchange factor (GEF) 2 ARHGEF2 Hs.337774H87111 0.569143 Hypothetical protein FLJ11011 FLJ11011 Hs.21275R27994 0.569143 - - Hs.83086N91541 0.569143 Non-metastatic cells 1, protein (NM23A) expressed in NME1 Hs.118638R22945 0.569143 Hypothetical protein FLJ14511 FLJ14511 Hs.40919T79365 0.569143 - - -W07427 0.569143 - - Hs.380100AA156746 0.569143 FLJ00005 protein FLJ00005 Hs.367690H16830 0.569143 Hypothetical protein FLJ10374 FLJ10374 Hs.21811AA148608 0.569143 - - -H89555 0.569143 Hypothetical protein FLJ34588 FLJ34588 Hs.375580H25547 0.569143 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34 DDX34 Hs.151706R25217 0.569143 Surfeit 6 SURF6 Hs.274430T75250 0.569143 COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis) COPS7B Hs.114432H85464 0.569143 Deleted in split-hand/split-foot 1 region DSS1 Hs.333495AA069444 0.569143 Dicer1, Dcr-1 homolog (Drosophila) DICER1 Hs.87889N35505 0.569143 Ras homolog gene family, member E ARHE Hs.6838AA043926 0.569143 Tumor necrosis factor receptor superfamily, member 1A TNFRSF1A Hs.159AA010246 0.569143 Hypothetical protein FLJ10890 FLJ10890 Hs.17283R77028 0.569143 Lymphotoxin beta receptor (TNFR superfamily, member 3) LTBR Hs.1116AA142965 0.569143 Protein kinase C binding protein 1 PRKCBP1 Hs.75871AA193482 0.569143 Hypothetical protein FLJ12287 similar to semaphorins FLJ12287 Hs.7634AA150246 0.569143 Protein kinase Njmu-R1 NJMU-R1 Hs.9800H88088 0.569143 Serine/threonine kinase 3 (STE20 homolog, yeast) STK3 Hs.166684AA115529 0.569143 - - Hs.134202H58750 0.569143 Similar to RIKEN cDNA 2610030J16 gene MGC2541 Hs.173103N48895 0.569143 F-box DNA helicase 1 FBH1 Hs.6193R34387 0.569143 Fatty acid amide hydrolase FAAH Hs.288828R66676 0.569143 Ets variant gene 5 (ets-related molecule) ETV5 Hs.43697R20594 0.569143 Glutathione S-transferase M4 GSTM4 Hs.348387AA156866 0.569143 Uncharacterized bone marrow protein BM045 BM045 Hs.8750W40330 0.569143 G1 to S phase transition 1 GSPT1 Hs.2707H79184 0.569143 Hypothetical protein FLJ14981 FLJ14981 Hs.76925H50029 0.569143 Ubiquitin-conjugating enzyme E2 variant 1 UBE2V1 Hs.75875T83106 0.569143 Chemokine-like factor 1 CKLF1 Hs.15159AA044810 0.569143 KIAA0547 gene product KIAA0547 Hs.200596H81063 0.569143 Citrate synthase CS Hs.239760W73506 0.583272 Activated RNA polymerase II transcription cofactor 4 PC4 Hs.349506H08969 0.583272 Hypothetical protein FLJ12529 FLJ12529 Hs.169100R34257 0.583272 Hepatocyte growth factor-regulated tyrosine kinase substrate HGS Hs.24756R85099 0.583272 ADP-ribosylation factor 3 ARF3 Hs.119177T65437 0.583272 R3H domain (binds single-stranded nucleic acids) containing R3HDM Hs.268053W40409 0.583272 Lysyl-tRNA synthetase KARS Hs.3100N32572 0.583272 Hypothetical protein FLJ20291 FLJ20291 Hs.8928N26563 0.583272 Second mitochondria-derived activator of caspase SMAC Hs.169611AA039596 0.583272 Hypothetical protein FLJ21308 FLJ21308 Hs.29977R24850 0.583272 - - -AA151625 0.583272 IQ motif containing GTPase activating protein 1 IQGAP1 Hs.1742R72865 0.583272 KIAA1285 protein KIAA1285 Hs.119175R13813 0.583272 Growth factor receptor-bound protein 2 GRB2 Hs.381152H49289 0.583272 Actin, alpha 2, smooth muscle, aorta ACTA2 Hs.195851R25125 0.583272 NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa NDUFC2 Hs.193313H71737 0.583272 - - -R91908 0.583272 Transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) TLE1 Hs.28935N31486 0.583272 Hypothetical protein FLJ37562 FLJ37562 Hs.356734AA058398 0.583272 - - Hs.6670N69097 0.583272 - - -AA101984 0.583272 G-protein coupled receptor RE2 Hs.301642W81709 0.583272 Ornithine aminotransferase (gyrate atrophy) OAT Hs.75485AA004506 0.583272 LanC lantibiotic synthetase component C-like 2 (bacterial) LANCL2 Hs.134342H13694 0.583272 Sec15B protein SEC15B Hs.44175R91278 0.583272 - - -AA039927 0.583272 - - Hs.356843R43198 0.583272 Nuclear factor (erythroid-derived 2)-like 3 NFE2L3 Hs.22900N26050 0.583272 Polymyositis/scleroderma autoantigen 1, 75kDa PMSCL1 Hs.91728R42552 0.583272 ESTs ESTs Hs.351142H57367 0.583272 - - Hs.335274H81987 0.583272 - - Hs.117907AA039224 0.583272 Hypothetical protein MGC14817 MGC14817 Hs.124813AA059131 0.583272 BTB (POZ) domain containing 1 BTBD1 Hs.21332AA147010 0.583272 Hypothetical protein BC015148 LOC93081 Hs.13413

AA026354 0.583272 - - -W58007 0.583272 KIAA0222 gene product KIAA0222 Hs.48450H71112 0.583272 MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae) MCM2 Hs.57101W94575 0.583272 Cathepsin H CTSH Hs.288181R72851 0.583272 Phosphatidylinositol glycan, class S PIGS Hs.347950R72425 0.583272 HLA-B associated transcript 1 BAT1 Hs.55296AA129848 0.583272 Exosome component Rrp41 FLJ20591 Hs.343589T86121 0.583272 ESTs ESTs Hs.191445W01524 0.583272 Splicing factor, arginine/serine-rich 11 SFRS11 Hs.11482AA005130 0.583272 Chromosome 7 open reading frame 2 C7orf2 Hs.107537R61777 0.583272 Hypothetical protein MGC14421 MGC14421 Hs.334713T53417 0.583272 Purinergic receptor P2X, ligand-gated ion channel, 4 P2RX4 Hs.321709W25075 0.583272 Hypothetical protein MGC23908 MGC23908 Hs.93748AA029275 0.583272 HTPAP protein HTPAP Hs.169341R12917 0.583272 - - Hs.21195R14543 0.583272 KIAA1500 protein KIAA1500 Hs.15420N22229 0.583272 Protein phosphatase 1, catalytic subunit, gamma isoform PPP1CC Hs.79081N93294 0.583272 KIAA0076 gene product KIAA0076 Hs.51039N36628 0.583272 - - Hs.233382N50068 0.583272 - - Hs.356733H25911 0.583272 - - -R19166 0.583272 ESTs ESTs Hs.91401AA156864 0.583272 Hypothetical protein IMAGE3455200 IMAGE3455200 Hs.324844H43564 0.583272 COX15 homolog, cytochrome c oxidase assembly protein (yeast) COX15 Hs.226581R15335 0.583272 Importin 4 FLJ23338 Hs.61790N94435 0.583272 LYST-interacting protein LIP8 LIP8 Hs.348012H16689 0.583272 RNA binding motif protein 8A RBM8A Hs.10283R79684 0.583272 KIAA1805 protein KIAA1805 Hs.294122AA148720 0.583272 PTPL1-associated RhoGAP 1 PARG1 Hs.70983AA057398 0.583272 - - -R80193 0.583272 Zinc finger protein 261 ZNF261 Hs.9568AA010162 0.583272 Frizzled homolog 1 (Drosophila) FZD1 Hs.94234W37098 0.583272 Fukuyama type congenital muscular dystrophy (fukutin) FCMD Hs.55777N33193 0.583272 Glioma-amplified sequence-41 GAS41 Hs.4029N93225 0.583272 Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein ID2 Hs.180919H46019 0.583272 Hypothetical protein FLJ10201 FLJ10201 Hs.318127AA011675 0.583272 Adaptor-related protein complex 1, sigma 1 subunit AP1S1 Hs.57600N51794 0.583272 Transforming growth factor, beta-induced, 68kDa TGFBI Hs.118787N25631 0.583272 Regulatory factor X-associated ankyrin-containing protein RFXANK Hs.296776R00553 0.583272 - - Hs.270347H15020 0.583272 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) GCN1L1 Hs.75354H68441 0.597562 Hypothetical protein FLJ14054 FLJ14054 Hs.13528AA057261 0.597562 KIAA0240 protein KIAA0240 Hs.196275R48937 0.597562 - - Hs.334606R20820 0.597562 ESTs ESTs Hs.171487N94606 0.597562 HSCARG protein HSCARG Hs.288969N47851 0.597562 - - -H90090 0.597562 DKFZP564G0222 protein DKFZP564G0222 Hs.13370R35160 0.597562 Insulin-like growth factor 2 receptor IGF2R Hs.76473R42777 0.597562 - - Hs.22216AA035226 0.597562 KIAA1542 protein KIAA1542 Hs.130541N67477 0.597562 - - Hs.281561R74114 0.597562 - - Hs.285833N71548 0.597562 CDC42 binding protein kinase beta (DMPK-like) CDC42BPB Hs.12908H75346 0.597562 ESTs ESTs Hs.294014N90249 0.597562 Protein phosphatase 1, regulatory subunit 10 PPP1R10 Hs.106019T78869 0.597562 ESTs ESTs Hs.182898R71048 0.597562 Glycolipid transfer protein GLTP Hs.381256N72505 0.597562 Hypothetical protein MGC5508 MGC5508 Hs.13662AA011654 0.597562 KIAA1458 protein KIAA1458 Hs.27263H00222 0.597562 XPA binding protein 1; putative ATP(GTP)-binding protein NTPBP Hs.18259H59174 0.597562 Hypothetical protein MGC19556 MGC19556 Hs.334787N98261 0.597562 Guanine nucleotide binding protein (G protein), beta polypeptide 2 GNB2 Hs.91299R93504 0.597562 Rag C protein GTR2 Hs.110950W47099 0.597562 CGI-63 protein LOC51102 Hs.19513R35372 0.597562 Tetracycline transporter-like protein TETRAN Hs.157145W04244 0.597562 ESTs ESTs Hs.49829R25121 0.597562 Uncharacterized hypothalamus protein HCDASE LOC55862 Hs.239218AA156753 0.597562 Chromosome 14 open reading frame 3 C14orf3 Hs.204041AA192730 0.597562 - - -N73289 0.597562 - - -N21661 0.597562 BMP-2 inducible kinase BIKE Hs.20137N94625 0.597562 Protein x 013 AD-020 Hs.82933R56495 0.597562 Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma IKBKG Hs.43505H11639 0.597562 SH2-B homolog SH2B Hs.15744W86364 0.597562 ESTs ESTs Hs.58819N69470 0.597562 Hypothetical protein FLJ10569 FLJ10569 Hs.5105AA036631 0.597562 Esophageal cancer related gene 4 protein ECRG4 Hs.43125H11243 0.597562 Bromodomain containing 1 BRD1 Hs.127950H64625 0.597562 Coproporphyrinogen oxidase (coproporphyria, harderoporphyria) CPO Hs.89866N36068 0.597562 Nit protein 2 NIT2 Hs.15627R21449 0.597562 Heterogeneous nuclear ribonucleoprotein K HNRPK Hs.129548H70778 0.597562 Cell division cycle associated 4 CDCA4 Hs.34045AA043293 0.597562 Hypothetical protein DT1P1A10 DT1P1A10 Hs.178207H06932 0.597562 Mitochondrial ribosomal protein L20 MRPL20 Hs.182698H81760 0.597562 - - Hs.40289AA055185 0.597562 Splicing factor, arginine/serine-rich 4 SFRS4 Hs.76122R48060 0.597562 DKFZP564O243 protein DKFZP564O243 Hs.92700N75518 0.597562 Translocated promoter region (to activated MET oncogene) TPR Hs.169750W47533 0.597562 A disintegrin and metalloproteinase domain 9 (meltrin gamma) ADAM9 Hs.2442R61688 0.597562 ATP-binding cassette, sub-family A (ABC1), member 2 ABCA2 Hs.94806N50370 0.597562 - - Hs.178485AA029012 0.597562 SMA3 SMA3 Hs.289061N43796 0.597562 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 ATP6V0D1 Hs.106876R01336 0.597562 - - Hs.19150H59203 0.597562 CDC6 cell division cycle 6 homolog (S. cerevisiae) CDC6 Hs.69563AA037624 0.597562 Hypothetical protein MGC5242 MGC5242 Hs.77365H28453 0.597562 Hypothetical protein MGC4840 MGC4840 Hs.301872AA146850 0.597562 - - -N55327 0.597562 Geminin, DNA replication inhibitor GMNN Hs.234896

H26802 0.597562 - - Hs.352614R34842 0.597562 ESTs ESTs Hs.24185AA042813 0.597562 Olfactory receptor, family 7, subfamily E, member 38 pseudogene OR7E38P Hs.120017AA045295 0.597562 - - Hs.376116H66409 0.597562 ESTs ESTs Hs.108275R20578 0.597562 ESTs ESTs Hs.90431W40184 0.597562 Solute carrier family 25 (mitochondrial carrier, Aralar), member 12 SLC25A12 Hs.179866H63353 0.597562 Hypothetical protein HSPC242 HSPC242 Hs.25199AA039905 0.597562 Myosin, heavy polypeptide 9, non-muscle MYH9 Hs.146550H59207 0.597562 SudD suppressor of bimD6 homolog (A. nidulans) SUDD Hs.209061AA150898 0.597562 FK506 binding protein 9, 63 kDa FKBP9 Hs.302749N90291 0.597562 DKFZP564J0863 protein DKFZP564J0863 Hs.333403H16663 0.597562 HSPC049 protein HSPC049 Hs.172622AA005195 0.597562 Serine/threonine kinase 36 (fused homolog, Drosophila) STK36 Hs.26996H96934 0.597562 ESTs ESTs Hs.136246R31387 0.597562 - - -H99570 0.597562 ESTs ESTs Hs.337736AA099075 0.597562 Single stranded DNA binding protein 3 SSBP3 Hs.266914T80433 0.597562 HSKM-B protein HSKM-B Hs.66170AA147503 0.597562 Homolog of yeast ribosome biogenesis regulatory protein RRS1 RRS1 Hs.71827W51783 0.597562 Argininosuccinate lyase ASL Hs.61258W60489 0.597562 ESTs ESTs Hs.12253R38964 0.597562 - - -H09314 0.597562 Protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform PPP2CA Hs.91773H79411 0.597562 CDC10 cell division cycle 10 homolog (S. cerevisiae) CDC10 Hs.184326AA004891 0.597562 Ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) UBE2H Hs.372758N39255 0.597562 Butyrophilin, subfamily 3, member A2 BTN3A2 Hs.87497AA029014 0.597562 ESTs ESTs Hs.58373N62518 0.597562 CD22 antigen CD22 Hs.171763R79279 0.597562 Zinc finger protein 226 ZNF226 Hs.145956R34513 0.597562 KIAA1468 protein KIAA1468 Hs.23542N20900 0.612009 ESTs ESTs Hs.32163AA213820 0.612009 - - Hs.256533N99927 0.612009 Beta-1,4 mannosyltransferase HMT-1 Hs.44592AA033871 0.612009 Methionine adenosyltransferase II, alpha MAT2A Hs.77502T89566 0.612009 ESTs ESTs Hs.16586AA053850 0.612009 Nucleosome assembly protein 1-like 1 NAP1L1 Hs.302649W23595 0.612009 HDCMA18P protein HDCMA18P Hs.278635AA010467 0.612009 Lysyl oxidase-like 1 LOXL1 Hs.65436AA045081 0.612009 Hypothetical protein FLJ21742 FLJ21742 Hs.306809H93344 0.612009 - - Hs.41877R23251 0.612009 Not56 (D. melanogaster)-like protein NOT56L Hs.153591AA035066 0.612009 Hypothetical protein MGC4268 MGC4268 Hs.22708W56434 0.612009 ESTs ESTs Hs.201608AA056762 0.612009 - - -N24066 0.612009 Cold shock domain protein A CSDA Hs.198726W24852 0.612009 COX11 homolog, cytochrome c oxidase assembly protein (yeast) COX11 Hs.241515H90078 0.612009 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 ABCC5 Hs.108660H09452 0.612009 Hypothetical protein MGC13007 MGC13007 Hs.332382T92003 0.612009 - - -R00749 0.612009 - - Hs.17240W47189 0.612009 HSPC041 protein LOC51125 Hs.7953H56572 0.612009 Proteasome activator 200 kDa PA200 Hs.112396AA044645 0.612009 Hypothetical protein FLJ21127 FLJ21127 Hs.351440H51376 0.612009 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 PSMD11 Hs.90744H70392 0.612009 ATP-dependent RNA helicase ROK1 Hs.380430H21078 0.612009 Makorin, ring finger protein, 2 MKRN2 Hs.279474R28340 0.612009 MYC-associated zinc finger protein (purine-binding transcription factor) MAZ Hs.7647H51648 0.612009 Similar to RIKEN cDNA 4933424N09 gene MGC16943 Hs.248437T84043 0.612009 Chromosome 1 open reading frame 6 C1orf6 Hs.283739T97149 0.612009 KIAA1533 protein KIAA1533 Hs.83575N90248 0.612009 Suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) ST13 Hs.119222N68307 0.612009 - - Hs.381077W52940 0.612009 MIL1 protein MIL1 Hs.10267H54691 0.612009 Rho guanine nucleotide exchange factor (GEF) 12 ARHGEF12 Hs.6582R49307 0.612009 Formin 2 FMN2 Hs.24889R89118 0.612009 Alpha-fetoprotein AFP Hs.155421W32377 0.612009 Methylmalonyl Coenzyme A mutase MUT Hs.155212R88122 0.612009 Pericentriolar material 1 PCM1 Hs.75737R16206 0.612009 - - -R05624 0.612009 - - Hs.293993W69156 0.612009 KIAA0095 gene product KIAA0095 Hs.155314R06572 0.612009 Hypothetical protein MGC2550 MGC2550 Hs.169575T79631 0.612009 ESTs ESTs Hs.374458T80488 0.612009 Suppressor of Ty 6 homolog (S. cerevisiae) SUPT6H Hs.12303H16544 0.612009 Autocrine motility factor receptor AMFR Hs.80731H45110 0.612009 Immediate early response 5 IER5 Hs.15725H69440 0.612009 NY-REN-25 antigen NY-REN-25 Hs.15301AA046951 0.612009 Insulinoma-associated protein IA-6 INSM2 Hs.62813N30625 0.612009 - - Hs.44205W02039 0.612009 Agouti signaling protein, nonagouti homolog (mouse) ASIP Hs.361642H52714 0.612009 Ubinuclein 1 UBN1 Hs.21479R17859 0.612009 DKFZP434C131 protein DKFZP434C131 Hs.7978H69321 0.612009 Interleukin 14 IL14 Hs.83004T81538 0.612009 MADS box transcription enhancer factor 2, polypeptide B (myocyte enhancer faMEF2B Hs.78881R20435 0.612009 ESTs ESTs Hs.167361N71529 0.612009 - - Hs.183779R60081 0.612009 - - -R83815 0.612009 Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein ID2 Hs.180919AA136692 0.612009 Transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) TLE3 Hs.287362H12586 0.612009 Nuclear cap binding protein subunit 1, 80kDa NCBP1 Hs.89563H15988 0.612009 - - Hs.27048AA010929 0.612009 N-methylpurine-DNA glycosylase MPG Hs.79396H85608 0.612009 Protein phosphatase 1, regulatory (inhibitor) subunit 2 PPP1R2 Hs.267819N93517 0.612009 - - Hs.67317N53292 0.612009 - - Hs.374344N20343 0.612009 - - -N36898 0.612009 Similar to rat nuclear ubiquitous casein kinase 2 NUCKS Hs.118064H41889 0.612009 - - Hs.315270R66080 0.612009 KIAA1530 protein KIAA1530 Hs.191268

T79185 0.612009 - - -R13700 0.612009 Hypothetical protein MGC5442 MGC5442 Hs.238513R16987 0.626609 Secretory protein SEC8 SEC8 Hs.107394R69570 0.626609 Oxysterol binding protein-like 3 OSBPL3 Hs.197955W00952 0.626609 ESTs ESTs Hs.118163H77388 0.626609 - - Hs.356560H99625 0.626609 Histone acetyltransferase HBOA Hs.21907W31460 0.626609 Aldehyde dehydrogenase 9 family, member A1 ALDH9A1 Hs.2533R46208 0.626609 PL6 protein PL6 Hs.91566N99008 0.626609 DnaJ (Hsp40) homolog, subfamily A, member 1 DNAJA1 Hs.94N50326 0.626609 Hypothetical protein MGC16063 MGC16063 Hs.288544H06950 0.626609 SMC4 structural maintenance of chromosomes 4-like 1 (yeast) SMC4L1 Hs.50758R18171 0.626609 Shroom-related protein ShrmL Hs.278628AA120840 0.626609 ESTs ESTs Hs.323473N79725 0.626609 Mitochondrial translational initiation factor 2 MTIF2 Hs.149894T83158 0.626609 Hypothetical protein DJ328E19.C1.1 DJ328E19.C1.1 Hs.218329AA041283 0.626609 Unc-51-like kinase 1 (C. elegans) ULK1 Hs.47061N62554 0.626609 Hypothetical protein FLJ39514 FLJ39514 Hs.48565N27544 0.626609 Cell division cycle 27 CDC27 Hs.172405H13889 0.626609 - - Hs.259347R06046 0.626609 KIAA1143 protein KIAA1143 Hs.173042T81338 0.626609 Trans-golgi network protein 2 TGOLN2 Hs.14894H58438 0.626609 High-mobility group 20B HMG20B Hs.32317H95396 0.626609 Elongation factor-2 kinase EEF2K Hs.259855H20790 0.626609 - - Hs.352590H00660 0.626609 - - Hs.313342R64299 0.626609 ESTs ESTs Hs.28507R22673 0.626609 Chromosome 16 open reading frame 5 C16orf5 Hs.7765W92898 0.626609 RAE1 RNA export 1 homolog (S. pombe) RAE1 Hs.196209R43900 0.626609 Calcineurin binding protein 1 CABIN1 Hs.7840AA045241 0.626609 Hypothetical protein FLJ12118 FLJ12118 Hs.381043N32803 0.626609 KIAA0494 gene product KIAA0494 Hs.62515R11714 0.626609 ESTs ESTs Hs.295334T96942 0.626609 Enoyl Coenzyme A hydratase, short chain, 1, mitochondrial ECHS1 Hs.76394W93073 0.626609 - - Hs.269180R08892 0.626609 Hypothetical protein MGC4692 MGC4692 Hs.13561AA037760 0.626609 Hypothetical protein MGC1203 MGC1203 Hs.17987T79789 0.626609 ESTs ESTs Hs.154701H84980 0.626609 Tripartite motif-containing 11 TRIM11 Hs.13543R67199 0.626609 Ubinuclein 1 UBN1 Hs.21479T83953 0.626609 Similar to arginyl-tRNA synthetase LOC57038 Hs.15395H13517 0.626609 ADP-ribosylation factor-like 5 ARL5 Hs.342849R47912 0.626609 - - Hs.17567R12657 0.626609 Platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa PAFAH1B3 Hs.6793R70783 0.626609 BCL2-like 2 BCL2L2 Hs.75244R64681 0.626609 SPPL3 SPPL3 Hs.21143AA203338 0.626609 Hypothetical SBBI03 protein SBB103 Hs.153639H92049 0.626609 LPS-responsive vesicle trafficking, beach and anchor containing LRBA Hs.62354AA040028 0.626609 Hypothetical protein BC014641 LOC129138 Hs.135259W58334 0.626609 Hydroxyacyl glutathione hydrolase HAGH Hs.155482T89676 0.626609 Plasminogen activator, urokinase PLAU Hs.77274N89606 0.626609 Mitochondrial ribosomal protein S36 MRPS36 Hs.41182N31931 0.626609 - - -T65539 0.626609 Kinesin heavy chain member 2 KIF2 Hs.113319N39391 0.626609 Hypothetical protein MGC14799 MGC14799 Hs.333166R31945 0.626609 Chondroitin sulfate proteoglycan 6 (bamacan) CSPG6 Hs.24485R88887 0.626609 FLJ00005 protein FLJ00005 Hs.367690W31553 0.626609 Choline kinase-like CHKL Hs.154886R60393 0.626609 Makorin, ring finger protein, 2 MKRN2 Hs.279474N45518 0.626609 NCK-associated protein 1 NCKAP1 Hs.278411R28329 0.626609 Hypothetical protein MGC16063 MGC16063 Hs.288544N42424 0.626609 RAB3 GTPase-ACTIVATING PROTEIN RAB3GAP Hs.227881R06175 0.626609 BCL2/adenovirus E1B 19kDa interacting protein 3 BNIP3 Hs.79428T89503 0.626609 Hypothetical protein FLJ14166 FLJ14166 Hs.14070N78568 0.626609 - - Hs.288671AA142976 0.626609 - - Hs.177781R52852 0.626609 - - Hs.355780N66243 0.626609 ESTs ESTs Hs.26575AA028907 0.626609 - - Hs.34447H50978 0.626609 ATP-binding cassette, sub-family D (ALD), member 4 ABCD4 Hs.94395AA037128 0.626609 Cisplatin resistance related protein CRR9p CRR9 Hs.323769N75375 0.626609 - - -H15341 0.626609 Phosphoribosyl pyrophosphate synthetase 2 PRPS2 Hs.2910H88042 0.626609 - - -H69511 0.626609 Hypothetical protein FLJ38975 FLJ38975 Hs.27769R64079 0.626609 KIAA0592 protein KIAA0592 Hs.13273AA069532 0.626609 - - Hs.287955H96724 0.626609 Disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) DAB2 Hs.81988AA036978 0.626609 Chromosome 20 open reading frame 27 C20orf27 Hs.274422R97175 0.641357 - - Hs.110783R34645 0.641357 Kinesin family member 13A KIF13A Hs.146286W40235 0.641357 Heat shock 105kD HSP105B Hs.36927H78479 0.641357 Thioredoxin-like 2 TXNL2 Hs.42644N93335 0.641357 DKFZP566C243 protein DKFZP566C243 Hs.107747N26672 0.641357 CD83 antigen (activated B lymphocytes, immunoglobulin superfamily) CD83 Hs.79197N41921 0.641357 - - Hs.33264R22218 0.641357 Hypothetical protein FLJ10983 FLJ10983 Hs.23363AA127218 0.641357 ESTs ESTs Hs.71058N45602 0.641357 - - Hs.250824N52336 0.641357 Aryl-hydrocarbon receptor nuclear translocator 2 ARNT2 Hs.6111N92357 0.641357 - - Hs.311977T65557 0.641357 Dual specificity phosphatase 6 DUSP6 Hs.180383H05378 0.641357 Down syndrome critical region gene 3 DSCR3 Hs.26146AA037661 0.641357 - - -N28734 0.641357 Ring finger protein (C3H2C3 type) 6 RNF6 Hs.32597T93597 0.641357 ESTs ESTs Hs.187429T50061 0.641357 - - -T97966 0.641357 - - -R42555 0.641357 KIAA0494 gene product KIAA0494 Hs.62515W92124 0.641357 Hypothetical protein MGC12981 MGC12981 Hs.104203

AA039437 0.641357 Solute carrier family 39 (zinc transporter), member 1 SLC39A1 Hs.7854N75519 0.641357 - - Hs.367854T81551 0.641357 - - Hs.380093H15158 0.641357 HSPC166 protein HSPC166 Hs.279836W39327 0.641357 LIM domain binding 1 LDB1 Hs.26002AA054041 0.641357 Protein kinase C substrate 80K-H PRKCSH Hs.1432N92858 0.641357 U6 snRNA-associated Sm-like protein LSM4 Hs.76719AA149634 0.641357 - - Hs.182545AA036844 0.641357 - - Hs.20000R37898 0.641357 Interleukin 1 receptor accessory protein IL1RAP Hs.173880W46682 0.641357 ESTs ESTs Hs.21475W55903 0.641357 Adipose differentiation-related protein ADFP Hs.3416N69648 0.641357 - - Hs.269135H79311 0.641357 - - -R17860 0.641357 - - Hs.288361AA131322 0.641357 Tryptase beta 1 TPSB1 Hs.347933N31931 0.641357 - - -R45593 0.641357 FLN29 gene product FLN29 Hs.5148W24575 0.641357 WW domain binding protein 1 WBP1 Hs.375564AA040295 0.641357 Formin homology 2 domain containing 1 FHOD1 Hs.95231AA026302 0.641357 Myeloid leukemia factor 1 MLF1 Hs.85195AA135332 0.641357 ESTs ESTs Hs.71608H11653 0.641357 - - -AA044588 0.641357 Hypothetical protein FLJ11171 FLJ11171 Hs.72782T87589 0.641357 Coagulation factor VIII-associated (intronic transcript) F8A Hs.83363R83637 0.641357 KIAA1204 protein KIAA1204 Hs.300670AA152194 0.641357 Hypothetical protein FLJ37312 FLJ37312 Hs.181480AA203467 0.641357 - - -R10991 0.641357 MAD2 mitotic arrest deficient-like 1 (yeast) MAD2L1 Hs.79078AA127641 0.641357 ESTs ESTs Hs.193657H61387 0.641357 Reticulon 4 receptor RTN4R Hs.30868AA203723 0.641357 ESTs ESTs Hs.188016R14112 0.641357 Cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 1 CYP1A1 Hs.72912T83745 0.641357 Polymerase (RNA) II (DNA directed) polypeptide D POLR2D Hs.194638H82521 0.641357 ATPase, H+ transporting, lysosomal 21kDa, V0 subunit c'' ATP6V0B Hs.7476AA043201 0.641357 - - Hs.179891R69813 0.641357 Hypothetical protein MGC4707 MGC4707 Hs.291003W31714 0.641357 - - Hs.122656R01692 0.641357 Junctional adhesion molecule 1 JAM1 Hs.12284R66021 0.641357 - - Hs.378493R00834 0.641357 SLIT-ROBO Rho GTPase-activating protein 1 SRGAP1 Hs.18995W72686 0.641357 Diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A bindinDBI Hs.78888N90754 0.641357 HP43.8KD protein HP43.8KD Hs.332841H84316 0.641357 Neuroligin 3 NLGN3 Hs.47320N36913 0.641357 Hypothetical protein DKFZp762N1910 DKFZp762N1910 Hs.321717R88135 0.641357 Ribonuclease P (30kD) RPP30 Hs.139120N24920 0.641357 Angiogenin, ribonuclease, RNase A family, 5 ANG Hs.332764N21349 0.641357 Protein kinase, cAMP-dependent, catalytic, alpha PRKACA Hs.77271W21233 0.641357 Hypothetical protein FLJ10496 FLJ10496 Hs.379807R72685 0.641357 Similar to vaccinia virus HindIII K4L ORF HU-K4 Hs.74573AA045404 0.641357 Squamous cell carcinoma antigen recognized by T cell SART2 Hs.58636N54731 0.641357 Protein kinase C and casein kinase substrate in neurons 2 PACSIN2 Hs.18842H45117 0.656247 KIAA0140 gene product KIAA0140 Hs.156016R55896 0.656247 - - -R24969 0.656247 Gamma-aminobutyric acid (GABA) A receptor, beta 1 GABRB1 Hs.89768AA034296 0.656247 - - Hs.288613R35308 0.656247 HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae) HRMT1L1 Hs.235887R68364 0.656247 - - -H14800 0.656247 - - -H18988 0.656247 Hypothetical protein FLJ12242 FLJ12242 Hs.94810H25530 0.656247 - - -H15640 0.656247 - - Hs.279607N63640 0.656247 - - Hs.39911T86632 0.656247 - - -H69656 0.656247 Nuclear prelamin A recognition factor NARF Hs.256526H39095 0.656247 Cell cycle progression 2 protein CPR2 Hs.347349T75267 0.656247 FK506 binding protein 12-rapamycin associated protein 1 FRAP1 Hs.338207R17445 0.656247 Hypothetical protein MGC10854 MGC10854 Hs.22222W95000 0.656247 Cell division cycle 25C CDC25C Hs.656H04784 0.656247 RE1-silencing transcription factor REST Hs.227630H12149 0.656247 MAX dimerization protein 4 MAD4 Hs.102402H25007 0.656247 - - Hs.188757R91821 0.656247 ESTs ESTs Hs.245997N50342 0.656247 KIAA0725 protein KIAA0725 Hs.26450H20849 0.656247 Deformed epidermal autoregulatory factor 1 (Drosophila) DEAF1 Hs.6574R02725 0.656247 Similar to TLH29 protein precursor LOC122509 Hs.19414AA053984 0.656247 H2B histone family, member Q H2BFQ Hs.2178N28653 0.656247 Cornichon-like CNIL Hs.201673R50087 0.656247 GREB1 protein GREB1 Hs.193914N29558 0.656247 - - Hs.293865R69858 0.656247 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, e YWHAH Hs.349530H62319 0.656247 - - Hs.133526R54762 0.656247 - - Hs.58582R74573 0.656247 Male-specific lethal 3-like 1 (Drosophila) MSL3L1 Hs.88764N52015 0.656247 ADP-ribosylation factor 4 ARF4 Hs.75290R53567 0.656247 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble) HMGCS1 Hs.77910T93605 0.656247 ESTs ESTs Hs.188627AA134572 0.656247 - - -N21515 0.656247 Choline/ethanolaminephosphotransferase CEPT1 Hs.363572N23528 0.656247 Arginyl aminopeptidase (aminopeptidase B) RNPEP Hs.283667W42442 0.656247 Transcription factor binding to IGHM enhancer 3 TFE3 Hs.274184W15457 0.656247 HSPC067 protein HSPC067 Hs.279938R28059 0.656247 Breast carcinoma amplified sequence 2 BCAS2 Hs.22960R88246 0.656247 Adrenergic, beta, receptor kinase 1 ADRBK1 Hs.83636N36697 0.656247 ESTs ESTs Hs.41322H73724 0.656247 Cyclin-dependent kinase 6 CDK6 Hs.38481W74528 0.656247 Calcium channel, voltage-dependent, beta 1 subunit CACNB1 Hs.635W68344 0.656247 Chromosome 7 open reading frame 3 C7orf3 Hs.334540AA026852 0.656247 Chromosome 20 open reading frame 67 C20orf67 Hs.272814R78346 0.656247 - - -

R61014 0.656247 Leucine-zipper-like transcriptional regulator, 1 LZTR1 Hs.78788N29775 0.656247 Small fragment nuclease DKFZP566E144 Hs.7527R74405 0.656247 - - Hs.185018AA069421 0.656247 - - -AA005131 0.656247 - - Hs.37372H15400 0.656247 Hypothetical protein FLJ12661 FLJ12661 Hs.318526W58039 0.656247 Regulator of G-protein signalling 10 RGS10 Hs.82280AA057293 0.656247 Peptidylprolyl isomerase C (cyclophilin C) PPIC Hs.110364R09962 0.656247 Hypothetical protein MGC2463 MGC2463 Hs.323634W86640 0.656247 Receptor (TNFRSF)-interacting serine-threonine kinase 1 RIPK1 Hs.296327W04635 0.656247 Sorbin and SH3 domain containing 1 SORBS1 Hs.108924W68077 0.656247 Single-stranded DNA binding protein SSBP1 Hs.923AA120759 0.656247 DnaJ (Hsp40) homolog, subfamily B, member 5 DNAJB5 Hs.237506R80244 0.656247 BTB and CNC homology 1, basic leucine zipper transcription factor 1 BACH1 Hs.154276W86915 0.656247 PHD protein Jade-1 Jade-1 Hs.238246H09552 0.656247 Hypothetical protein FLJ20272 FLJ20272 Hs.26090AA055269 0.656247 - - Hs.41269R18944 0.656247 Transcriptional co-repressor Sin3A SIN3A Hs.22583AA029857 0.656247 RAD1 homolog (S. pombe) RAD1 Hs.7179T88813 0.656247 Hypothetical protein PRO1855 PRO1855 Hs.283558T81304 0.656247 Similar to cyclin-E binding protein 1 (H. sapiens) MGC14386 Hs.14870H15055 0.656247 DNA segment, single copy probe LNS-CAI/LNS-CAII (deleted in polyposis D5S346 Hs.178112H15642 0.656247 - - -H67165 0.656247 Nitric oxide synthase 2A (inducible, hepatocytes) NOS2A Hs.193788T85827 0.656247 - - -N69389 0.671276 Nerve injury gene 283 NIN283 Hs.320834AA053325 0.671276 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 1 ATP6V1G1 Hs.90336AA147542 0.671276 Serine/arginine repetitive matrix 1 SRRM1 Hs.18192N91060 0.671276 Vascular endothelial growth factor VEGF Hs.73793W24882 0.671276 Hypothetical protein FLJ35779 FLJ35779 Hs.374991R21804 0.671276 - - -N71958 0.671276 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa NDUFA9 Hs.75227AA115563 0.671276 Histidyl-tRNA synthetase-like HARSL Hs.278507N52383 0.671276 Hypothetical protein FLJ20079 FLJ20079 Hs.165948H18934 0.671276 Ribosomal large subunit pseudouridine synthase C like RLUCL Hs.101742N70267 0.671276 Integral membrane protein 2B ITM2B Hs.239625H72121 0.671276 Mitochondrial ribosomal protein S12 MRPS12 Hs.9964AA059148 0.671276 KIAA1199 protein KIAA1199 Hs.50081H93850 0.671276 Extracellular link domain containing 1 XLKD1 Hs.17917N31564 0.671276 - - Hs.111364W88760 0.671276 Calcium/calmodulin-dependent protein kinase (CaM kinase) II delta CAMK2D Hs.111460W79682 0.671276 ORF LOC51035 Hs.351296R74454 0.671276 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1 B3GNT1 Hs.173203AA009512 0.671276 - - -R32813 0.671276 Hypothetical protein MGC2668 MGC2668 Hs.56851H51004 0.671276 - - -W92517 0.671276 Actin binding LIM protein 1 ABLIM1 Hs.158203W07077 0.671276 Hematopoietic PBX-interacting protein HPIP Hs.8068AA054498 0.671276 Hypothetical protein DKFZp566J2046 DKFZP566J2046 Hs.322482T84193 0.671276 - - Hs.290241H47578 0.671276 Ring finger protein 34 RNF34 Hs.316809AA037862 0.671276 Nucleotide-sugar transporter similar to C. elegans sqv-7 SQV7L Hs.90078R73213 0.671276 RAB40B, member RAS oncogene family RAB40B Hs.302498W46239 0.671276 Sprouty homolog 4 (Drosophila) SPRY4 Hs.381153W90242 0.671276 Chromosome 14 open reading frame 1 C14orf1 Hs.15106N29183 0.671276 - - Hs.289018H77996 0.671276 KIAA1463 protein KIAA1463 Hs.21104W15155 0.671276 - - -N45225 0.671276 Vesicle transport-related protein RA410 Hs.27023H26657 0.671276 Smcx homolog, X chromosome (mouse) SMCX Hs.283429W37491 0.671276 Biliverdin reductase B (flavin reductase (NADPH)) BLVRB Hs.76289H38961 0.671276 ADP-ribosylation factor 3 ARF3 Hs.119177W90758 0.671276 Hypothetical protein FLJ10514 FLJ10514 Hs.59346N50375 0.671276 Activated RNA polymerase II transcription cofactor 4 PC4 Hs.349506T75252 0.671276 Hypothetical protein DKFZp434B195 DKFZP434B195 Hs.10748AA036894 0.671276 Hypothetical protein FLJ20303 FLJ20303 Hs.17138T66839 0.671276 Hypothetical protein FLJ11806 FLJ11806 Hs.323443T84763 0.671276 - - Hs.284344R22203 0.671276 Hypothetical protein FLJ10330 FLJ10330 Hs.342307R67624 0.671276 Erythrocyte membrane protein band 4.1-like 1 EPB41L1 Hs.26395H53304 0.671276 - - Hs.117530AA044383 0.671276 Interferon regulatory factor 2 IRF2 Hs.83795W78808 0.671276 AFG3 ATPase family gene 3-like 1 (yeast) AFG3L1 Hs.337620R46554 0.671276 KIAA0930 protein KIAA0930 Hs.13255W87936 0.671276 ESTs ESTs Hs.14372H51348 0.671276 F-box only protein 25 FBXO25 Hs.81001H79770 0.671276 Ret finger protein RFP Hs.142653N29672 0.671276 V-fos FBJ murine osteosarcoma viral oncogene homolog FOS Hs.25647H99483 0.671276 - - -T81049 0.671276 Ubinuclein 1 UBN1 Hs.21479AA054690 0.671276 Epithelial protein lost in neoplasm beta EPLIN Hs.10706N24811 0.671276 Rho GTPase activating protein 5 ARHGAP5 Hs.267831N50617 0.671276 Small nuclear ribonucleoprotein polypeptide A' SNRPA1 Hs.80506R02669 0.671276 Adaptor-related protein complex 3, beta 1 subunit AP3B1 Hs.155172R92111 0.671276 - - -R17451 0.671276 Male-enhanced antigen MEA Hs.278362R02682 0.671276 Double-stranded RNA-binding zinc finger protein JAZ JAZ Hs.181012N30186 0.671276 Hypothetical protein FLJ21615 FLJ21615 Hs.44159H67335 0.671276 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa NDUFA10 Hs.198271R72184 0.671276 Hypothetical protein FLJ10948 FLJ10948 Hs.9670H52618 0.671276 - - -AA004838 0.671276 SOCS box-containing WD protein SWiP-1 WSB1 Hs.187991W61132 0.671276 - - Hs.301226N20517 0.671276 Hypothetical protein DKFZp434A1319 DKFZP434A1319 Hs.307084T94585 0.671276 - - Hs.116691N92594 0.671276 S-adenosylmethionine decarboxylase 1 AMD1 Hs.262476R40588 0.671276 - - Hs.21256W31152 0.671276 Hypothetical protein MGC33177 DMR Hs.55209AA029328 0.671276 KIAA0073 protein KIAA0073 Hs.1191H88030 0.671276 Splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila) SFRS10 Hs.30035

H21835 0.686437 - - -AA134770 0.686437 Zinc finger protein 24 (KOX 17) ZNF24 Hs.183593H82166 0.686437 Sorting nexin 17 SNX17 Hs.278569AA101919 0.686437 Phosphofructokinase, muscle PFKM Hs.75160H19826 0.686437 Hippocalcin-like 1 HPCAL1 Hs.3618AA009926 0.686437 - - -R81939 0.686437 - - Hs.13396AA047517 0.686437 VRK3 for vaccinia related kinase 3 LOC51231 Hs.98289R35199 0.686437 Hypothetical protein FLJ21080 FLJ21080 Hs.8109H65158 0.686437 Tumor susceptibility gene 101 TSG101 Hs.118910W90607 0.686437 Homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like HERPUD1 Hs.146393R46527 0.686437 DKFZP434H132 protein DKFZP434H132 Hs.17936W07300 0.686437 Adaptor-related protein complex 1, gamma 1 subunit AP1G1 Hs.5344N47660 0.686437 Cyclin-dependent kinase inhibitor 1B (p27, Kip1) CDKN1B Hs.238990AA156458 0.686437 Spastic paraplegia 7, paraplegin (pure and complicated autosomal recessive) SPG7 Hs.296847W23579 0.686437 ATP-dependent RNA helicase MGC2835 Hs.70582AA046800 0.686437 Tuftelin interacting protein 11 TFIP11 Hs.20225R72133 0.686437 - - Hs.5957T79317 0.686437 ESTs ESTs Hs.302245N46251 0.686437 Phafin 2 FLJ13187 Hs.29724R17999 0.686437 Hypothetical protein FLJ20371 FLJ20371 Hs.267566AA099404 0.686437 Hypothetical protein MGC22793 MGC22793 Hs.293937W90375 0.686437 ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H ATP6V1H Hs.19575AA005020 0.686437 Protein tyrosine phosphatase, non-receptor type 1 PTPN1 Hs.155894N69412 0.686437 - - -H09667 0.686437 - - -R20746 0.686437 Chloride channel 7 CLCN7 Hs.80768R12705 0.686437 Thyroid hormone receptor interactor 13 TRIP13 Hs.6566R50443 0.686437 - - -N78868 0.686437 KIAA1049 protein KIAA1049 Hs.227835N30286 0.686437 DKFZP564A043 protein DKFZP564A043 Hs.271623AA099135 0.686437 Hypothetical protein FLJ20186 FLJ20186 Hs.62771R50698 0.686437 KIAA1938 protein KIAA1938 Hs.25734N89889 0.686437 - - -H20847 0.686437 KIAA0923 protein KIAA0923 Hs.22587AA149479 0.686437 CD2 antigen (cytoplasmic tail) binding protein 2 CD2BP2 Hs.202677AA043760 0.686437 General transcription factor IIB GTF2B Hs.258561R61551 0.686437 - - Hs.131798AA045139 0.686437 Hypothetical protein FLJ12592 FLJ12592 Hs.23100N21144 0.686437 Transcription factor binding to IGHM enhancer 3 TFE3 Hs.274184AA121546 0.686437 Hypothetical protein PRO0971 PRO0971 Hs.152316T56959 0.686437 Hypothetical protein FLJ12525 FLJ12525 Hs.321618W02088 0.686437 - - -AA150894 0.686437 Guanine nucleotide binding protein 11 GNG11 Hs.83381N92358 0.686437 Hypothetical protein FLJ22029 FLJ22029 Hs.285243R73484 0.686437 Similar to CG9886 gene product LOC132158 Hs.109414AA151027 0.686437 Chromosome 21 open reading frame 108 C21orf108 Hs.18759H77998 0.686437 KIAA0310 gene product KIAA0310 Hs.5716H24894 0.686437 - - -R87739 0.686437 Transmembrane protein 1 TMEM1 Hs.94479W88557 0.686437 TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, TAF10 Hs.89657R80191 0.686437 Microtubule-associated protein, RP/EB family, member 3 MAPRE3 Hs.172740W92014 0.686437 Alcohol dehydrogenase 6 (class V) ADH6 Hs.76800T79936 0.686437 ESTs ESTs Hs.119583R33249 0.686437 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3 B4GALT3 Hs.321231N51791 0.686437 Hypothetical protein FLJ20296 FLJ20296 Hs.6603N91458 0.686437 T-cell activation WD repeat protein TA-WDRP Hs.175596H52789 0.686437 DKFZP434P106 protein DKFZP434P106 Hs.236522W01923 0.686437 A kinase (PRKA) anchor protein 2 AKAP2 Hs.42322N66260 0.686437 MUS81 endonuclease MUS81 Hs.288798W60308 0.686437 - - Hs.350200AA134109 0.686437 Hypothetical protein MGC14327 MGC14327 Hs.231029R63808 0.686437 TSPY-like TSPYL Hs.278479N30559 0.686437 - - -R10564 0.686437 Sentrin/SUMO-specific protease 3 SENP3 Hs.118926N/A1 0.686437 - - -H27593 0.686437 Socius SOC Hs.145061AA057856 0.686437 ESTs ESTs Hs.63344H14485 0.686437 Phosphatidylinositol-4-phosphate 5-kinase, type II, beta PIP5K2B Hs.6335N69552 0.686437 Similar to MOB-LAK LOC148932 Hs.97927AA001216 0.686437 Paxillin PXN Hs.102497T92329 0.686437 - - Hs.193969W33159 0.686437 Phospholipase C, beta 1 (phosphoinositide-specific) PLCB1 Hs.41143N30606 0.701725 Cyclin H CCNH Hs.514N62067 0.701725 IQ motif containing GTPase activating protein 1 IQGAP1 Hs.1742W86803 0.701725 Exostoses (multiple) 2 EXT2 Hs.75334W87404 0.701725 Hypothetical protein FLJ10715 FLJ10715 Hs.58974AA047447 0.701725 - - Hs.201060H50945 0.701725 Proteasome (prosome, macropain) subunit, beta type, 5 PSMB5 Hs.78596N27830 0.701725 - - Hs.43047H58427 0.701725 ESTs ESTs Hs.307940W78711 0.701725 - - Hs.110069W90600 0.701725 CGI-92 protein COQ4 Hs.20159AA152287 0.701725 Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsNFKBIE Hs.182885AA007449 0.701725 Spastic ataxia of Charlevoix-Saguenay (sacsin) SACS Hs.159492AA039863 0.701725 Prolylcarboxypeptidase (angiotensinase C) PRCP Hs.75693T96595 0.701725 ESTs ESTs Hs.302270H95498 0.701725 ESTs ESTs Hs.42041AA047410 0.701725 Tafazzin (cardiomyopathy, dilated 3A (X-linked); endocardial fibroelastosis 2; BTAZ Hs.79021AA136159 0.701725 Microsomal glutathione S-transferase 1 MGST1 Hs.355733N50349 0.701725 Rho guanine nucleotide exchange factor (GEF) 10 ARHGEF10 Hs.20695N57249 0.701725 Proteasome (prosome, macropain) subunit, beta type, 5 PSMB5 Hs.78596R47930 0.701725 Hypothetical protein 669 LOC56267 Hs.180378H27414 0.701725 Ring finger protein 20 RNF20 Hs.168095R33011 0.701725 Suppressor of cytokine signaling 5 SOCS5 Hs.169836R41426 0.701725 ESTs ESTs Hs.175370N75497 0.701725 RAB1A, member RAS oncogene family RAB1A Hs.3642H99751 0.701725 Lipidosin BG1 Hs.277543W44398 0.701725 Function unknown protein 1 FLJ10648 Hs.379758H98830 0.701725 Glucosamine-6-phosphate isomerase GNPI Hs.278500

R75983 0.701725 Serologically defined colon cancer antigen 28 SDCCAG28 Hs.84700R95136 0.701725 - - -H69318 0.701725 A disintegrin and metalloproteinase domain 10 ADAM10 Hs.172028AA031356 0.701725 Hypothetical protein MGC14288 MGC14288 Hs.181073H91044 0.701725 Mitogen-activated protein kinase phosphatase x MKPX Hs.29106R24513 0.701725 Low density lipoprotein receptor-related protein 6 LRP6 Hs.23672H30899 0.701725 - - -R87343 0.701725 Ubiquitin-conjugating enzyme UBC3B UBC3B Hs.11184AA099685 0.701725 Progesterone-induced blocking factor 1 PIBF1 Hs.43913W78946 0.701725 Electron-transfer-flavoprotein, alpha polypeptide (glutaric aciduria II) ETFA Hs.169919R18833 0.701725 - - Hs.268709N45664 0.701725 Putative Rab5 GDP/GTP exchange factor homologue RABEX5 Hs.187660R71436 0.701725 - - Hs.6236N69431 0.701725 Hypothetical protein FLJ20699 FLJ20699 Hs.15125R34571 0.701725 Hypothetical protein FLJ20136 FLJ20136 Hs.24817N75031 0.701725 GDP dissociation inhibitor 2 GDI2 Hs.56845W05406 0.701725 Phosphatidylinositol glycan, class K PIGK Hs.62187AA047466 0.701725 RUN and FYVE domain-containing 1 RUFY1 Hs.289064R76890 0.701725 KIAA1340 protein KIAA1340 Hs.51743W39690 0.701725 Dickkopf homolog 1 (Xenopus laevis) DKK1 Hs.40499R48773 0.701725 Nucleosome assembly protein 1-like 4 NAP1L4 Hs.78103N94831 0.701725 KIAA0013 gene product ARHGAP11A Hs.172652AA001329 0.701725 Cyclin A2 CCNA2 Hs.85137T77130 0.701725 ESTs ESTs Hs.268606H16558 0.701725 Myosin VA (heavy polypeptide 12, myoxin) MYO5A Hs.170157W87414 0.701725 HLA-B associated transcript 1 BAT1 Hs.55296W20491 0.701725 TAR (HIV) RNA binding protein 2 TARBP2 Hs.326N26710 0.701725 Hypothetical protein BC011593 LOC112495 Hs.344097AA053311 0.701725 KIAA0233 gene product KIAA0233 Hs.79077R96393 0.701725 ESTs ESTs Hs.184721N38762 0.701725 Lymphoid enhancer-binding factor 1 LEF1 Hs.44865R18698 0.701725 Hypothetical protein DKFZp761B1514 DKFZp761B1514 Hs.177537AA028142 0.701725 SLC2A4 regulator SLC2A4RG Hs.170088H69659 0.701725 - - -H43854 0.701725 A disintegrin and metalloproteinase domain 11 ADAM11 Hs.6088R54961 0.701725 PHD zinc finger protein XAP135 XAP135 Hs.7759H47418 0.701725 - - -T74240 0.717135 Heat shock 70kDa protein 1B HSPA1B Hs.274402H20126 0.717135 Hypothetical protein PRO2325 PRO2325 Hs.31535N44136 0.717135 Kinesin family member 1B KIF1B Hs.375193AA042936 0.717135 My015 My015 Hs.325531AA045281 0.717135 Phosphoprotein associated with glycosphingolipid-enriched microdomains PAG Hs.266175H89361 0.717135 Mesoderm development candidate 1 MESDC1 Hs.290356W45719 0.717135 PAP-1 binding protein PAPA-1 Hs.7709H85873 0.717135 SUMO-1 activating enzyme subunit 2 UBA2 Hs.4311N54859 0.717135 Hypothetical protein FLJ11151 FLJ11151 Hs.14992W45538 0.717135 KIAA0062 protein KIAA0062 Hs.89868N32385 0.717135 Hypothetical protein FLJ14249 similar to HS1 binding protein 3 FLJ14249 Hs.125520AA045732 0.717135 LOC147184 LOC147184 Hs.13740R19920 0.717135 KIAA1464 protein KIAA1464 Hs.6343T83266 0.717135 Tetraspan 3 TSPAN-3 Hs.100090T81752 0.717135 Gemin 5 GEMIN5 Hs.25882N56810 0.717135 CAMP responsive element modulator CREM Hs.155924W32666 0.717135 TNFRSF1A-associated via death domain TRADD Hs.89862AA195455 0.717135 Stanniocalcin 2 STC2 Hs.155223AA156795 0.717135 ESTs ESTs Hs.62772N34764 0.717135 - - Hs.245537N77915 0.717135 - - -R18841 0.717135 Neurotrimin HNT Hs.288433R55296 0.717135 Promyelocytic leukemia PML Hs.89633R45197 0.717135 Hypothetical protein MGC11349 MGC11349 Hs.288697R48603 0.717135 - - -R47773 0.717135 Gene with multiple splice variants near HD locus on 4p16.3 RES4-22 Hs.325987H17690 0.717135 APG12 autophagy 12-like (S. cerevisiae) APG12L Hs.264482AA029852 0.717135 Hypothetical protein FLJ20259 FLJ20259 Hs.9956N39216 0.717135 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 CDS2 Hs.24812AA147539 0.717135 D-dopachrome tautomerase DDT Hs.180015R28554 0.717135 Hypothetical protein DKFZp313A2432 DKFZp313A2432 Hs.349096H25201 0.717135 - - -N46331 0.717135 KIAA0675 gene product KIAA0675 Hs.165662N64002 0.717135 Rap guanine nucleotide exchange factor RA-GEF-2 Hs.174795R14788 0.717135 - - Hs.293815W37617 0.717135 Transmembrane 7 superfamily member 1 (upregulated in kidney) TM7SF1 Hs.15791R98214 0.717135 Chromosome 1 open reading frame 22 C1orf22 Hs.279951AA127045 0.717135 Hypothetical protein BC009331 LOC92305 Hs.337772N72553 0.717135 Calmodulin 3 (phosphorylase kinase, delta) CALM3 Hs.334330W52903 0.717135 Hypothetical protein HSPC177 HSPC177 Hs.36237H02590 0.717135 - - -R37680 0.717135 ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1 ADPRTL1 Hs.77225T75262 0.717135 - - -N25619 0.717135 ESTs ESTs Hs.269036AA213820 0.717135 - - Hs.256533N43860 0.717135 Polymyositis/scleroderma autoantigen 1, 75kDa PMSCL1 Hs.91728T84624 0.717135 Ets variant gene 6 (TEL oncogene) ETV6 Hs.169081R66209 0.717135 Synaptosomal-associated protein, 29kDa SNAP29 Hs.194714R12961 0.717135 Hypothetical protein DKFZp434B044 DKFZP434B044 Hs.262958T80464 0.717135 Gemin 7 GEMIN7 Hs.102991N91912 0.717135 Phospholipase A2, group XII PLA2G12 Hs.25206AA062961 0.717135 Gamma-glutamyltransferase 1 GGT1 Hs.284380N35507 0.717135 Oxysterol binding protein OSBP Hs.24734AA131823 0.717135 - - Hs.272198N79754 0.717135 ElaC homolog 1 (E. coli) ELAC1 Hs.47572H99886 0.717135 Nuclear receptor subfamily 4, group A, member 3 NR4A3 Hs.80561H75344 0.717135 ESTs ESTs Hs.167614AA133284 0.717135 Hypothetical protein FLJ40452 FLJ40452 Hs.339834AA053319 0.717135 - - Hs.167700R36586 0.717135 Phosphatidylinositol (4,5) bisphosphate 5-phosphatase homolog; phosphatidyli PPI5PIV Hs.25156W37775 0.717135 - - -T87547 0.717135 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 PSMD1 Hs.3887W92121 0.717135 KIAA0618 gene product KIAA0618 Hs.295112

R25090 0.717135 - - -N99946 0.717135 Mesoderm development candidate 2 MESDC2 Hs.78871AA151305 0.717135 DNA directed RNA polymerase II polypeptide J-related gene POLR2J2 Hs.375569H82880 0.732661 Peptidylprolyl isomerase A (cyclophilin A) PPIA Hs.342389N48315 0.732661 Hypothetical protein MGC2452 MGC2452 Hs.275711N92996 0.732661 Retinoblastoma binding protein 7 RBBP7 Hs.31314N93576 0.732661 Hypothetical protein MGC2477 MGC2477 Hs.9061T70324 0.732661 - - Hs.13179N31738 0.732661 Hypothetical protein MGC20262 MGC20262 Hs.351871N92710 0.732661 Cold inducible RNA binding protein CIRBP Hs.119475N58497 0.732661 Translocated promoter region (to activated MET oncogene) TPR Hs.169750N46726 0.732661 KIAA0185 protein KIAA0185 Hs.239499T86841 0.732661 - - -N71996 0.732661 Macrophage myristoylated alanine-rich C kinase substrate MACMARCKS Hs.75061N35749 0.732661 - - -H14191 0.732661 MMS19-like (MET18 homolog, S. cerevisiae) MMS19L Hs.288891H47450 0.732661 - - -AA099555 0.732661 Hypothetical protein FLJ12666 FLJ12666 Hs.23767W74506 0.732661 Casein kinase 1, alpha 1 CSNK1A1 Hs.283738R18812 0.732661 Reticulon 1 RTN1 Hs.99947W90594 0.732661 Hypothetical protein FLJ21174 FLJ21174 Hs.194329H10223 0.732661 - - Hs.63368H96032 0.732661 Hypothetical protein MGC11102 MGC11102 Hs.42129N32733 0.732661 - - -H03349 0.732661 DNA (cytosine-5-)-methyltransferase 3 alpha DNMT3A Hs.241565N48062 0.732661 - - Hs.13809R01903 0.732661 Dystonia 1, torsion (autosomal dominant; torsin A) DYT1 Hs.19261W92260 0.732661 RAB11A, member RAS oncogene family RAB11A Hs.75618N73861 0.732661 - - -H51386 0.732661 KIAA0202 protein KIAA0202 Hs.80712W45562 0.732661 - - -AA150112 0.732661 Intermediate filament protein syncoilin SYNCOILIN Hs.348415N62372 0.732661 Polynucleotide phosphorylase-like PNPASE Hs.356503AA040149 0.732661 - - Hs.348989AA056998 0.732661 - - -N46198 0.732661 - - Hs.43744H03342 0.732661 Hypothetical protein FLJ21939 similar to 5-azacytidine induced gene 2 FLJ21939 Hs.164478R20452 0.732661 Calpain 10 CAPN10 Hs.112218AA053903 0.732661 KIAA0826 protein KIAA0826 Hs.169600AA010668 0.732661 Protein tyrosine phosphatase, receptor type, C-associated protein PTPRCAP Hs.155975R52315 0.732661 Oculocutaneous albinism II (pink-eye dilution homolog, mouse) OCA2 Hs.82027AA046822 0.732661 ESTs ESTs Hs.61272H42051 0.732661 Early growth response 1 EGR1 Hs.326035N58733 0.732661 - - -N92376 0.732661 Hypothetical protein MGC23918 MGC23918 Hs.43773R96651 0.732661 ATX1 antioxidant protein 1 homolog (yeast) ATOX1 Hs.279910W07491 0.732661 - - Hs.58633AA029802 0.732661 High density lipoprotein binding protein (vigilin) HDLBP Hs.177516N70264 0.732661 Phosphatidylcholine transfer protein PCTP Hs.285218H03286 0.732661 3 beta-hydroxy-delta 5-C27-steroid oxidoreductase C(27)-3BETA-HSD Hs.23628N34766 0.732661 Mannosidase, alpha, class 2A, member 2 MAN2A2 Hs.295605H80533 0.732661 Interleukin 1 receptor accessory protein IL1RAP Hs.173880AA029564 0.732661 Component of oligomeric golgi complex 2 COG2 Hs.82399AA134944 0.732661 - - -H01569 0.732661 ESTs ESTs Hs.30237H43653 0.732661 Cytochrome c oxidase subunit VIII COX8 Hs.374980R34762 0.732661 - - Hs.380911H26621 0.732661 Membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigMCP Hs.83532W19134 0.732661 DKFZP564F0522 protein DKFZP564F0522 Hs.23060N51733 0.732661 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatasCTDP1 Hs.4076AA031407 0.732661 ESTs ESTs Hs.303016W85892 0.732661 BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (MBTAF1 Hs.180930R54944 0.732661 Interleukin 18 binding protein IL18BP Hs.325978N76256 0.732661 Tubulin, gamma complex associated protein 3 TUBGCP3 Hs.9884N39092 0.732661 ESTs ESTs Hs.44940N74271 0.732661 Membrane-bound transcription factor protease, site 1 MBTPS1 Hs.75890H47565 0.732661 NS1-binding protein NS1-BP Hs.197298AA010546 0.732661 Synuclein, alpha (non A4 component of amyloid precursor) SNCA Hs.76930R80974 0.732661 WEE1+ homolog (S. pombe) WEE1 Hs.75188AA040506 0.732661 - - Hs.251865T78899 0.732661 NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme QNDUFS8 Hs.90443N70097 0.732661 - - -H92944 0.732661 - - -N59347 0.732661 Hypothetical protein MGC9344 MGC9344 Hs.84131W56823 0.732661 Paired basic amino acid cleaving enzyme (furin, membrane associated receptoPACE Hs.59242H83357 0.732661 Hypothetical protein BC012008 LOC144467 Hs.348374W90295 0.732661 Erbb2 interacting protein ERBB2IP Hs.8117W63774 0.732661 H2A histone family, member X H2AFX Hs.147097T71625 0.732661 - - -W49783 0.748297 - - Hs.13328N95253 0.748297 ESTs ESTs Hs.5669AA136976 0.748297 KIAA1023 protein KIAA1023 Hs.21361R82340 0.748297 Pyruvate dehydrogenase complex, lipoyl-containing component X; E3-binding pPDX1 Hs.351622AA045469 0.748297 Hypothetical protein FLJ20186 FLJ20186 Hs.62771AA115948 0.748297 Collagen, type V, alpha 2 COL5A2 Hs.82985AA136669 0.748297 - - Hs.374535R48434 0.748297 ESTs ESTs Hs.25560AA039862 0.748297 MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated proMCM3AP Hs.168481W68755 0.748297 Nucleotide binding protein 1 (MinD homolog, E. coli) NUBP1 Hs.81469R22413 0.748297 Protein phosphatase 1, regulatory (inhibitor) subunit 14B PPP1R14B Hs.100623H42375 0.748297 Hypothetical protein FLJ10211 FLJ10211 Hs.380134AA022903 0.748297 Laminin, gamma 1 (formerly LAMB2) LAMC1 Hs.214982AA193555 0.748297 - - Hs.365589H96198 0.748297 Heterogeneous nuclear ribonucleoprotein H1 (H) HNRPH1 Hs.245710N20098 0.748297 CD151 antigen CD151 Hs.75564T71616 0.748297 Eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa EIF2S1 Hs.151777R34114 0.748297 - - Hs.352487N69956 0.748297 - - Hs.148676R39287 0.748297 Melanin-concentrating hormone receptor 1 interacting zinc-finger protein MIZIP Hs.128096H95137 0.748297 Map kinase phosphatase-like protein MK-STYX LOC51657 Hs.11615

N/A1 0.748297 - - -AA063580 0.748297 TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 5TAF7 Hs.155188R38155 0.748297 - - Hs.351029AA132067 0.748297 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, suSMARCC2 Hs.236030AA126385 0.748297 Hypothetical protein BC010736 LOC92609 Hs.355819N89707 0.748297 Dynein light chain 2A DNLC2A Hs.100002W86341 0.748297 Hypothetical protein BC006130 LOC93622 Hs.6815AA043507 0.748297 Kinesin-like 5 (mitotic kinesin-like protein 1) KNSL5 Hs.270845H29086 0.748297 Myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila) MLL5 Hs.333300N42285 0.748297 Lysosomal-associated membrane protein 1 LAMP1 Hs.150101H90219 0.748297 Inositol(myo)-1(or 4)-monophosphatase 1 IMPA1 Hs.171776N59525 0.748297 CDC16 cell division cycle 16 homolog (S. cerevisiae) CDC16 Hs.1592W94597 0.748297 ATPase, Ca++ transporting, plasma membrane 1 ATP2B1 Hs.78546R34172 0.748297 - - Hs.22968H16242 0.748297 Serologically defined colon cancer antigen 16 SDCCAG16 Hs.271926N20844 0.748297 Heat shock 70kDa protein 1A HSPA1A Hs.8997R46284 0.748297 Lipase, hormone-sensitive LIPE Hs.95351AA130235 0.748297 Optic atrophy 1 (autosomal dominant) OPA1 Hs.147946R54646 0.748297 F-box and leucine-rich repeat protein 6 FBXL6 Hs.12271AA029530 0.748297 Hypothetical protein FLJ20005 FLJ20005 Hs.184634W03009 0.748297 KIAA0472 protein KIAA0472 Hs.6874AA134750 0.748297 Hypothetical protein MGC10848 MGC10848 Hs.207443R79034 0.748297 - - Hs.79204N49742 0.748297 Nuclear receptor subfamily 1, group D, member 2 NR1D2 Hs.37288R54308 0.748297 SLIT-ROBO Rho GTPase-activating protein 2 SRGAP2 Hs.5003R75874 0.748297 KIAA1932 protein KIAA1932 Hs.306121R13117 0.748297 - - Hs.348516T97327 0.748297 ESTs ESTs Hs.18041AA056534 0.748297 ESTs ESTs Hs.110294R89246 0.748297 KIAA0711 gene product KIAA0711 Hs.5333AA035448 0.748297 - - -N90171 0.748297 C-myc binding protein MYCBP Hs.78221R70391 0.748297 Ribonuclease/angiogenin inhibitor RNH Hs.75108N22357 0.748297 - - -W51986 0.748297 - - -H06274 0.748297 Hypothetical protein MGC2508 MGC2508 Hs.11110H78466 0.748297 Chromosome 4 open reading frame 1 C4orf1 Hs.270956AA203681 0.748297 ESTs ESTs Hs.293589H99520 0.748297 Sialyltransferase 4C (beta-galactosidase alpha-2,3-sialytransferase) SIAT4C Hs.75268H98718 0.748297 - - Hs.12460H57851 0.748297 Homo sapiens, clone MGC:29471 IMAGE:4329216, mRNA, complete cds RAB24 Hs.16258R70183 0.748297 Nuclear receptor coactivator 6 interacting protein NCOA6IP Hs.179909N30253 0.748297 - - -H75387 0.748297 - - -H15905 0.748297 KIAA0191 protein KIAA0191 Hs.12413N21334 0.748297 Abl-interactor 2 ABI-2 Hs.343575R38335 0.748297 Ribonuclease H2, large subunit RNASEH2A Hs.25292W57806 0.748297 Unknown LOC51693 Hs.27445AA132068 0.748297 - - Hs.352381T95687 0.748297 RAP1, GTP-GDP dissociation stimulator 1 RAP1GDS1 Hs.7940N34202 0.748297 - - Hs.275732H72703 0.748297 Chromosome 11 open reading frame 10 C11orf10 Hs.90918N24096 0.748297 - - -R87373 0.748297 - - -H91631 0.748297 Hypothetical protein MGC15416 MGC15416 Hs.41514H45410 0.748297 Uveal autoantigen with coiled-coil domains and ankyrin repeats UACA Hs.49753W67797 0.748297 Laminin, alpha 5 LAMA5 Hs.11669AA058474 0.748297 Hypothetical protein DKFZp586C1924 DKFZp586C1924 Hs.108338R88064 0.748297 Transcription factor-like 1 TCFL1 Hs.2430N28292 0.764037 Sec23-interacting protein p125 P125 Hs.300208AA150909 0.764037 - - -R18865 0.764037 - - -T98226 0.764037 Tropomyosin 4 TPM4 Hs.250641H86785 0.764037 KIAA0874 protein KIAA0874 Hs.27973AA098909 0.764037 KIAA0564 protein KIAA0564 Hs.151385W72939 0.764037 KIAA0097 gene product KIAA0097 Hs.76989H88039 0.764037 - - Hs.55098N59677 0.764037 Proteasome (prosome, macropain) subunit, alpha type, 7 PSMA7 Hs.233952AA005109 0.764037 Oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) OGDH Hs.168669N80021 0.764037 Origin recognition complex, subunit 4-like (yeast) ORC4L Hs.55055H07882 0.764037 KIAA0586 gene product KIAA0586 Hs.77724R35559 0.764037 T-cell activation protein PGR1 Hs.285902AA044634 0.764037 Sirtuin silent mating type information regulation 2 homolog 1 (S. cerevisiae) SIRT1 Hs.31176N45309 0.764037 Prenylcysteine lyase PCL1 Hs.278627R14363 0.764037 Histone deacetylase 5 HDAC5 Hs.9028AA128275 0.764037 - - -H49493 0.764037 - - -T47567 0.764037 - - -R34443 0.764037 - - Hs.4194N64388 0.764037 Nuclear receptor subfamily 4, group A, member 1 NR4A1 Hs.1119R07284 0.764037 Hypothetical protein SP329 SP329 Hs.19928AA129848 0.764037 Exosome component Rrp41 FLJ20591 Hs.343589T79597 0.764037 - - -AA044631 0.764037 - - -T47502 0.764037 PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated proPCQAP Hs.8657N64706 0.764037 KIAA1951 protein KIAA1951 Hs.137282AA034114 0.764037 Transmembrane protein 5 TMEM5 Hs.112986W91912 0.764037 G protein-coupled receptor kinase-interactor 2 GIT2 Hs.57734T86647 0.764037 ESTs ESTs Hs.332087AA054570 0.764037 Apolipoprotein E APOE Hs.169401N25927 0.764037 - - Hs.374362N89687 0.764037 - - Hs.351597N39086 0.764037 Zinc finger protein AF020591 Hs.142634N53706 0.764037 Zinc finger protein ZNF-U69274 Hs.301956H16647 0.764037 Solute carrier family 27 (fatty acid transporter), member 4 SLC27A4 Hs.248953W16435 0.764037 PXR2b protein PXR2b Hs.46780H30857 0.764037 MutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) MLH1 Hs.57301AA047100 0.764037 Hypothetical protein FLJ22584 FLJ22584 Hs.343551AA044139 0.764037 Hypothetical protein MGC4645 MGC4645 Hs.332381W70006 0.764037 Cell division cycle 25B CDC25B Hs.153752

N75222 0.764037 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 28 DDX28 Hs.155049H99883 0.764037 KIAA0828 protein KIAA0828 Hs.4984H93919 0.764037 Glutamate-cysteine ligase, catalytic subunit GCLC Hs.151393N71478 0.764037 Glutamate dehydrogenase 1 GLUD1 Hs.77508R11184 0.764037 - - Hs.14337W42414 0.764037 MAD, mothers against decapentaplegic homolog 3 (Drosophila) MADH3 Hs.288261AA152215 0.764037 Tubulin-specific chaperone d TBCD Hs.12570T79802 0.764037 - - Hs.14535N31735 0.764037 Hypothetical protein FLJ20671 FLJ20671 Hs.180201W31052 0.764037 Hypothetical protein FLJ12592 FLJ12592 Hs.23100R23917 0.764037 Three prime repair exonuclease 1 TREX1 Hs.278408N22158 0.764037 - - Hs.283072H01923 0.764037 HSPC019 protein HSPC019 Hs.163724N25873 0.764037 Chromosome 20 open reading frame 36 C20orf36 Hs.184628W47662 0.764037 Modulator recognition factor I MRF-1 Hs.920AA039454 0.764037 Split hand/foot malformation (ectrodactyly) type 3 SHFM3 Hs.24307H29623 0.764037 Bullous pemphigoid antigen 1, 230/240kDa BPAG1 Hs.198689W07319 0.764037 Zinc finger protein 41 ZNF41 Hs.143700H10877 0.764037 Ankyrin repeat and SOCS box-containing 1 ASB1 Hs.153489AA033813 0.764037 Chromatin assembly factor 1, subunit A (p150) CHAF1A Hs.79018H15247 0.764037 Lipase A, lysosomal acid, cholesterol esterase (Wolman disease) LIPA Hs.85226W92307 0.764037 Interleukin enhancer binding factor 2, 45kDa ILF2 Hs.75117H49584 0.764037 KIAA0962 protein KIAA0962 Hs.9059R82847 0.764037 PHD finger protein 7 PHF7 Hs.30127R43107 0.764037 Hypothetical protein FLJ10450 FLJ10450 Hs.267604N80932 0.764037 - - -AA010640 0.764037 N-myristoyltransferase 1 NMT1 Hs.111039W19744 0.764037 - - Hs.180059H75843 0.764037 Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed FAU Hs.177415N51785 0.764037 - - Hs.380911R22985 0.764037 RCD1 required for cell differentiation1 homolog (S. pombe) RQCD1 Hs.293687H38496 0.764037 REV3-like, catalytic subunit of DNA polymerase zeta (yeast) REV3L Hs.115521H49954 0.764037 Hypothetical protein FLJ23469 FLJ23469 Hs.103833H12628 0.764037 KIAA1237 protein KIAA1237 Hs.10491H40716 0.764037 ESTs ESTs Hs.121518H90520 0.764037 Hypothetical protein MGC4643 MGC4643 Hs.226434H23930 0.764037 Lipin 1 LPIN1 Hs.81412N35107 0.764037 HSPC019 protein HSPC019 Hs.163724AA040162 0.764037 Calnexin CANX Hs.155560W23819 0.764037 Hypothetical protein FLJ11305 FLJ11305 Hs.7049W86176 0.764037 HT002 protein; hypertension-related calcium-regulated gene HT002 Hs.238928W94862 0.764037 Adenosine deaminase, RNA-specific ADAR Hs.7957H00294 0.764037 Hypothetical protein 628 LOC56270 Hs.181349W90099 0.779875 Neuroepithelial cell transforming gene 1 NET1 Hs.25155H91088 0.779875 - - -N33169 0.779875 GPAA1P anchor attachment protein 1 homolog (yeast) GPAA1 Hs.4742R98049 0.779875 Testis intracellular mediator protein PEAS Hs.281706H50895 0.779875 Microtubule-associated protein 4 MAP4 Hs.239298AA136072 0.779875 - - Hs.330310N73706 0.779875 ESTs ESTs Hs.177366AA150965 0.779875 KIAA1921 protein KIAA1921 Hs.348392W51779 0.779875 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, suSMARCE1 Hs.332848R69584 0.779875 - - Hs.269392R80664 0.779875 Phosphoinositide-binding protein SR1 FENS-1 Hs.44743H05011 0.779875 - - -AA101861 0.779875 Heat shock transcription factor 4 HSF4 Hs.75486H52236 0.779875 Adducin 1 (alpha) ADD1 Hs.183706W31151 0.779875 DNA segment on chromosome X and Y (unique) 155 expressed sequence DXYS155E Hs.21595H24136 0.779875 - - -T53316 0.779875 Proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) PSME3 Hs.152978R51286 0.779875 Integrin cytoplasmic domain-associated protein 1 ICAP-1A Hs.173274R54439 0.779875 ESTs ESTs Hs.26119AA043297 0.779875 Vacuolar protein sorting 45A (yeast) VPS45A Hs.6650N34875 0.779875 Hypothetical protein FLJ20373 FLJ20373 Hs.6631N49891 0.779875 Hypothetical protein FLJ20748 FLJ20748 Hs.91973H27730 0.779875 Protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoformPPP2R1B Hs.108705AA203304 0.779875 CGI-130 protein LOC51020 Hs.32826N66544 0.779875 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 PSMD4 Hs.148495N36401 0.779875 Rad50-interacting protein 1 FLJ11785 Hs.44625H27352 0.779875 V-Ha-ras Harvey rat sarcoma viral oncogene homolog HRAS Hs.37003H58225 0.779875 LIM and senescent cell antigen-like domains 1 LIMS1 Hs.112378AA010958 0.779875 Myogenic factor 6 (herculin) MYF6 Hs.35937N67741 0.779875 DKFZP586D0919 protein DKFZP586D0919 Hs.49378AA203622 0.779875 - - -R10734 0.779875 - - -W04197 0.779875 ESTs ESTs Hs.380239W88660 0.779875 DKFZP586F1524 protein DKFZP586F1524 Hs.241543H47562 0.779875 Mitochondrial ribosomal protein L11 MRPL11 Hs.152738AA035296 0.779875 Vasodilator-stimulated phosphoprotein VASP Hs.93183R17409 0.779875 - - -N51684 0.779875 - - Hs.47315H77460 0.779875 Lymphocyte adaptor protein LNK Hs.13131R44307 0.779875 Neurabin II LOC84687 Hs.110095H71745 0.779875 Proteasome (prosome, macropain) 26S subunit, ATPase, 4 PSMC4 Hs.211594N79517 0.779875 Fibrinogen, gamma polypeptide FGG Hs.75431AA056650 0.779875 - - Hs.380129N47636 0.779875 Hypothetical protein DC42 DC42 Hs.72805AA156696 0.779875 B-cell translocation gene 1, anti-proliferative BTG1 Hs.77054R54435 0.779875 - - Hs.352614R43033 0.779875 - - Hs.374352R52448 0.779875 Synovial sarcoma translocation, chromosome 18 SS18 Hs.153221T80857 0.779875 - - -AA011565 0.779875 Squamous cell carcinoma antigen recognised by T cells 3 SART3 Hs.116875R43282 0.779875 Leucine zipper, putative tumor suppressor 1 LZTS1 Hs.93605R74076 0.779875 Hypothetical protein FLJ30656 FLJ30656 Hs.349887H94706 0.779875 - - Hs.349150N36402 0.779875 Hypothetical protein PRO2032 PRO2032 Hs.372571T77709 0.779875 Nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (p105) NFKB1 Hs.83428H39829 0.779875 Protein kinase C-like 1 PRKCL1 Hs.2499R70930 0.779875 Sialyltransferase 4C (beta-galactosidase alpha-2,3-sialytransferase) SIAT4C Hs.75268

R00701 0.779875 Abhydrolase domain containing 1 ABHD2 Hs.99364N59843 0.779875 Hypothetical protein MGC2217 MGC2217 Hs.323164W15594 0.779875 Hypothetical protein FLJ20811 FLJ20811 Hs.83530R31892 0.779875 - - -H63988 0.779875 ESTs ESTs Hs.38264T71262 0.779875 Neuron navigator 2 NAV2 Hs.23467N31849 0.779875 - - Hs.282895W03020 0.779875 Calpain 3, (p94) CAPN3 Hs.40300R19913 0.779875 ESTs ESTs Hs.22860R01140 0.779875 Heat shock 90kDa protein 1, alpha HSPCA Hs.289088H84204 0.779875 Protein phosphatase 1, catalytic subunit, beta isoform PPP1CB Hs.21537R20723 0.779875 ESTs ESTs Hs.374490AA040087 0.779875 Collagen, type IV, alpha 3 (Goodpasture antigen) binding protein COL4A3BP Hs.21276R91950 0.779875 Cytochrome b-5 CYB5 Hs.83834T86363 0.779875 - - -T92962 0.779875 CD81 antigen (target of antiproliferative antibody 1) CD81 Hs.54457T79503 0.779875 - - -AA042830 0.779875 Lymphocyte-specific protein 1 LSP1 Hs.56729H28623 0.779875 Cellular repressor of E1A-stimulated genes CREG Hs.5710N69904 0.779875 Nuclear receptor coactivator 5 NCOA5 Hs.288140H49329 0.795806 Breakpoint cluster region protein, uterine leiomyoma, 1; barrier to autointegratioBCRP1 Hs.268763H53071 0.795806 Phosphatidylserine decarboxylase PISD Hs.8128H10350 0.795806 Replication factor C (activator 1) 5, 36.5kDa RFC5 Hs.171075R05480 0.795806 Solute carrier family 26, member 6 SLC26A6 Hs.298476W85878 0.795806 Transcription factor 19 (SC1) TCF19 Hs.249184AA156866 0.795806 Uncharacterized bone marrow protein BM045 BM045 Hs.8750R26193 0.795806 Hypothetical protein FLJ10432 FLJ10432 Hs.143187W38731 0.795806 - - -W78920 0.795806 DNA directed RNA polymerase II polypeptide J-related gene POLR2J2 Hs.375569AA046623 0.795806 Hypothetical protein FLJ10377 FLJ10377 Hs.274263R77727 0.795806 Nucleolar protein family A, member 2 (H/ACA small nucleolar RNPs) NOLA2 Hs.23990H27211 0.795806 Splicing factor 3a, subunit 2, 66kDa SF3A2 Hs.115232H00903 0.795806 SWAP-70 protein SWAP70 Hs.153026N68107 0.795806 3-hydroxy-3-methylglutaryl-Coenzyme A reductase HMGCR Hs.11899R83178 0.795806 Hydroxysteroid (17-beta) dehydrogenase 7 HSD17B7 Hs.187579N90061 0.795806 Sulfotransferase, estrogen-preferring STE Hs.54576H78385 0.795806 Huntingtin interacting protein 2 HIP2 Hs.155485N24877 0.795806 Ubiquitin specific protease 8 USP8 Hs.152818R71120 0.795806 KIAA0831 protein KIAA0831 Hs.103000W35335 0.795806 - - -AA040160 0.795806 Hypothetical protein BC017335 LOC92715 Hs.292570R46282 0.795806 - - -W25045 0.795806 General transcription factor IIIA GTF3A Hs.75113W68588 0.795806 Collagen, type VII, alpha 1 (epidermolysis bullosa, dystrophic, dominant and re COL7A1 Hs.1640R22188 0.795806 - - Hs.356392H17513 0.795806 Heat shock 70kDa protein 1-like HSPA1L Hs.80288AA115291 0.795806 Epidermal growth factor receptor pathway substrate 15 EPS15 Hs.79095AA135498 0.795806 CCAAT/enhancer binding protein (C/EBP), beta CEBPB Hs.99029AA001813 0.795806 KIAA0052 protein KIAA0052 Hs.278608N80318 0.795806 - - Hs.42834AA210734 0.795806 ESTs ESTs Hs.291386R11717 0.795806 Dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) DUSP11 Hs.14611W37843 0.795806 Vacuolar protein sorting 11 (yeast) VPS11 Hs.234282H20945 0.795806 - - Hs.379958N54249 0.795806 - - -R26953 0.795806 Solute carrier family 31 (copper transporters), member 1 SLC31A1 Hs.380728H15461 0.795806 - - Hs.323409H14840 0.795806 Hypothetical protein MGC2668 MGC2668 Hs.56851H49219 0.795806 Muscleblind-like (Drosophila) MBNL Hs.28578R15788 0.795806 - - -R37394 0.795806 Hypothetical protein MGC3123 MGC3123 Hs.288600N36412 0.795806 Dynein, cytoplasmic, light intermediate polypeptide 2 DNCLI2 Hs.194625AA037843 0.795806 Transmembrane 4 superfamily member tetraspan NET-7 NET-7 Hs.95583H51489 0.795806 Plexin B3 PLXNB3 Hs.380742R65812 0.795806 Enabled homolog (Drosophila) ENAH Hs.14838AA004801 0.795806 - - -T78345 0.795806 - - Hs.269116T79902 0.795806 - - Hs.376652AA035325 0.795806 Insulin receptor substrate 2 IRS2 Hs.143648H49312 0.795806 Cytoplasmic linker 2 CYLN2 Hs.104717H58462 0.795806 Nucleolar protein family A, member 3 (H/ACA small nucleolar RNPs) NOLA3 Hs.14317W15224 0.795806 KIAA0819 protein KIAA0819 Hs.301866R00277 0.795806 GS15 LOC51272 Hs.300631R14297 0.795806 RAS-like, estrogen-regulated, growth-inhibitor RERG Hs.21594R37954 0.795806 Ras association (RalGDS/AF-6) domain family 2 RASSF2 Hs.80905H82069 0.795806 Nuclear cap binding protein subunit 2, 20kDa NCBP2 Hs.240770H44192 0.795806 Nischarin NISCH Hs.26285H44693 0.795806 Hypothetical protein FLJ25604 FLJ25604 Hs.220745AA045130 0.795806 Hypothetical protein FLJ10761 FLJ10761 Hs.343154R21171 0.795806 Electron-transfer-flavoprotein, alpha polypeptide (glutaric aciduria II) ETFA Hs.169919N98883 0.795806 General transcription factor IIA, 1, 19/37kDa GTF2A1 Hs.299542H43455 0.795806 Hypothetical protein PP2447 PP2447 Hs.33026H77938 0.795806 Eukaryotic translation termination factor 1 ETF1 Hs.77324W38743 0.795806 Olfactomedin 2 OLFM2 Hs.169743N50674 0.795806 - - Hs.311051AA033662 0.795806 Jun dimerization protein 2 JDP2 Hs.154095R11257 0.795806 DNA directed RNA polymerase II polypeptide J-related gene POLR2J2 Hs.375569N63947 0.795806 Hypothetical protein FLJ21940 FLJ21940 Hs.104916R67381 0.795806 - - Hs.330716H49993 0.795806 Neuron navigator 2 NAV2 Hs.23467N30036 0.795806 Chorionic gonadotropin, beta polypeptide CGB Hs.348407R39419 0.795806 - - Hs.351152T95126 0.795806 - - -AA150238 0.811821 - - -T75241 0.811821 Plasminogen activator, urokinase receptor PLAUR Hs.179657N36861 0.811821 ESTs ESTs Hs.42344AA031564 0.811821 - - Hs.221255R98556 0.811821 Cytochrome b-5 CYB5 Hs.83834H62252 0.811821 Amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2 ALS2CR2 Hs.5771N81095 0.811821 High-mobility group box 3 HMGB3 Hs.19114

N54932 0.811821 Hypothetical protein FLJ22875 FLJ22875 Hs.111222R60357 0.811821 Alanyl-tRNA synthetase AARS Hs.75102AA044807 0.811821 - - -AA045796 0.811821 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, suSMARCB1 Hs.159971AA101823 0.811821 Elastin microfibril interface located protein EMILIN Hs.63348W46363 0.811821 Host cell factor homolog LCP Hs.20597R71155 0.811821 RalA binding protein 1 RALBP1 Hs.75447R61624 0.811821 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 35 DDX35 Hs.7174AA203496 0.811821 - - Hs.20818N40633 0.811821 AD031 protein AD031 Hs.44004N59346 0.811821 Protein tyrosine phosphatase, non-receptor type 12 PTPN12 Hs.62N67658 0.811821 - - Hs.10949T92286 0.811821 Ral guanine nucleotide exchange factor RalGPS1A RALGPS1A Hs.374518N64545 0.811821 Flightless I homolog (Drosophila) FLII Hs.83849AA043545 0.811821 Procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2 PLOD2 Hs.41270T99195 0.811821 - - Hs.18593N41670 0.811821 KIAA1673 KIAA1673 Hs.301444R98077 0.811821 Anti-oxidant protein 2 (non-selenium glutathione peroxidase, acidic calcium-indAOP2 Hs.120AA210772 0.811821 Hypothetical protein FLJ22611 FLJ22611 Hs.27774N/A2 0.811821 - - -H50385 0.811821 Calsenilin, presenilin binding protein, EF hand transcription factor CSEN Hs.13228N93284 0.811821 Hypothetical protein MGC5627 MGC5627 Hs.237971H75745 0.811821 Calcium homeostasis endoplasmic reticulum protein CHERP Hs.6430N50057 0.811821 Cytokine induced protein 29 kDa CIP29 Hs.63908R12426 0.811821 - - -R81337 0.811821 Colon carcinoma related protein LOC51159 Hs.30343N99930 0.811821 BDG-29 proten BDG-29 Hs.81505T77389 0.811821 Leiomodin 1 (smooth muscle) LMOD1 Hs.79386T97968 0.811821 ESTs ESTs Hs.325159R06577 0.811821 Deltex homolog 2 (Drosophila) DTX2 Hs.89135R73991 0.811821 KIAA1160 protein KIAA1160 Hs.33122W68697 0.811821 Hypothetical protein FLJ10998 FLJ10998 Hs.78110H43499 0.811821 Immunoglobulin lambda locus IGL@ Hs.181125W03485 0.811821 MAD, mothers against decapentaplegic homolog 5 (Drosophila) MADH5 Hs.37501H45746 0.811821 - - -H11384 0.811821 - - Hs.352554T97916 0.811821 ESTs ESTs Hs.191184AA099688 0.811821 Melanoma differentiation associated protein-5 MDA5 Hs.293591T93849 0.811821 Zinc finger protein 185 (LIM domain) ZNF185 Hs.16622R83176 0.811821 Hypothetical protein FLJ11753 FLJ11753 Hs.62348AA150973 0.811821 Hypothetical protein MGC10812 MGC10812 Hs.4188N92448 0.811821 Transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)TCF3 Hs.101047N59622 0.811821 Integral membrane protein 2A ITM2A Hs.17109R22272 0.811821 ESTs ESTs Hs.355658AA010675 0.811821 Glycogen synthase 1 (muscle) GYS1 Hs.772T87912 0.811821 - - Hs.16478W56002 0.811821 Acetyl-Coenzyme A acyltransferase 1 (peroxisomal 3-oxoacyl-Coenzyme A thioACAA1 Hs.166160T86617 0.811821 V-myb myeloblastosis viral oncogene homolog (avian)-like 2 MYBL2 Hs.179718AA043987 0.811821 Parvin, alpha PARVA Hs.44077T88001 0.811821 ESTs ESTs Hs.294105H81249 0.811821 - - -W23818 0.811821 Nm23-phosphorylated unknown substrate MGC15437 Hs.55067T95778 0.811821 SH3-domain binding protein 4 SH3BP4 Hs.17667W52113 0.811821 - - Hs.106510R71914 0.811821 - - Hs.17567R79393 0.827916 Hypothetical protein FLJ25785 FLJ25785 Hs.9070W03928 0.827916 Ribosomal protein S8 RPS8 Hs.151604R35019 0.827916 - - Hs.24906H38703 0.827916 Hypothetical protein FLJ10512 FLJ10512 Hs.93581AA137064 0.827916 Cerebral cell adhesion molecule LOC51148 Hs.23954N52496 0.827916 BTG family, member 3 BTG3 Hs.77311R37843 0.827916 Mannosidase, alpha, class 1A, member 1 MAN1A1 Hs.25253R13073 0.827916 Dual specificity phosphatase 7 DUSP7 Hs.296938R72799 0.827916 HpaII tiny fragments locus 9C HTF9C Hs.63609H01212 0.827916 Dynein, cytoplasmic, light intermediate polypeptide 1 DNCLI1 Hs.266483N39088 0.827916 - - Hs.356387AA099734 0.827916 Ribosomal protein L36a-like RPL36AL Hs.336628N92463 0.827916 - - -N24561 0.827916 - - Hs.290880AA134766 0.827916 Chromosome 7 open reading frame 11 C7orf11 Hs.66666R21970 0.827916 General transcription factor IIH, polypeptide 2, 44kDa GTF2H2 Hs.191356T97814 0.827916 Arrestin, beta 2 ARRB2 Hs.18142R47758 0.827916 Hypothetical protein MGC2721 MGC2721 Hs.76084W23577 0.827916 Polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa POLR2J Hs.80475H05018 0.827916 Hypothetical protein FLJ10379 FLJ10379 Hs.14229T96932 0.827916 Chromosome 6 open reading frame 11 C6orf11 Hs.17930AA037862 0.827916 Nucleotide-sugar transporter similar to C. elegans sqv-7 SQV7L Hs.90078N99001 0.827916 BCL2-associated athanogene 2 BAG2 Hs.55220N48661 0.827916 KIAA1604 protein KIAA1604 Hs.209464W05039 0.827916 HLA class II region expressed gene KE2 HKE2 Hs.356468AA001937 0.827916 ESTs ESTs Hs.59974AA033787 0.827916 G protein-coupled receptor 108 GPR108 Hs.167641N30548 0.827916 Solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator) SLC25A4 Hs.2043W46155 0.827916 - - Hs.355892R72609 0.827916 - - Hs.5724N40607 0.827916 Alpha2,3-sialyltransferase ST3GALVI Hs.34578AA210722 0.827916 - - Hs.117920N63007 0.827916 Dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit DPM1 Hs.5085R48450 0.827916 KIAA1055 protein KIAA1055 Hs.126084AA007414 0.827916 Copper metabolism gene MURR1 MURR1 Hs.339669H12016 0.827916 Hypothetical protein FLJ21839 FLJ21839 Hs.348708H78385 0.827916 Huntingtin interacting protein 2 HIP2 Hs.155485AA058393 0.827916 - - Hs.40369AA150315 0.827916 Chromosome 5 open reading frame 3 C5orf3 Hs.166551H52254 0.827916 - - Hs.356708W02900 0.827916 Cytochrome P450, subfamily I (dioxin-inducible), polypeptide 1 (glaucoma 3, prCYP1B1 Hs.154654N30559 0.827916 - - -AA046451 0.827916 - - Hs.165200R28061 0.827916 - - Hs.14846AA057300 0.827916 Quinoid dihydropteridine reductase QDPR Hs.75438

N22715 0.827916 Glutathione peroxidase 4 (phospholipid hydroperoxidase) GPX4 Hs.2706R08828 0.827916 Pyruvate kinase, liver and RBC PKLR Hs.95990R24964 0.827916 ESTs ESTs Hs.23766H06560 0.827916 F-box and leucine-rich repeat protein 11 FBXL11 Hs.219614N46615 0.827916 Similar to envelope protein LOC113386 Hs.132055W73595 0.827916 Spondin 2, extracellular matrix protein SPON2 Hs.288126T86626 0.827916 Connector enhancer of KSR-like (Drosophila kinase suppressor of ras) CNK1 Hs.16232R28033 0.827916 Protein tyrosine phosphatase, non-receptor type 18 (brain-derived) PTPN18 Hs.278597T52361 0.827916 DKFZP434P1750 protein DKFZP434P1750 Hs.7274T97692 0.827916 Nicotinamide nucleotide transhydrogenase NNT Hs.18136R23664 0.827916 Colon carcinoma related protein LOC51159 Hs.30343W49616 0.827916 Villin 2 (ezrin) VIL2 Hs.155191AA130080 0.827916 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 PSMD12 Hs.4295AA011676 0.827916 G protein-coupled receptor 44 GPR44 Hs.299567AA136788 0.827916 - - -H29572 0.827916 Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa PAFAH1B1 Hs.77318AA101710 0.827916 - - Hs.12396W72029 0.827916 E2F transcription factor 1 E2F1 Hs.96055W85779 0.827916 Zinc finger protein 133 (clone pHZ-13) ZNF133 Hs.78434AA046034 0.827916 Retinoblastoma binding protein 1 RBBP1 Hs.380994AA039915 0.827916 Serum response factor (c-fos serum response element-binding transcription facSRF Hs.155321AA028143 0.827916 Hypothetical protein FLJ22329 FLJ22329 Hs.367653W42620 0.827916 RAB5B, member RAS oncogene family RAB5B Hs.77690H05163 0.827916 FGF receptor activating protein 1 FRAG1 Hs.133968W31684 0.827916 Hypothetical protein FLJ34969 FLJ34969 Hs.373580W60866 0.827916 - - Hs.57806N69403 0.827916 - - Hs.48480N28915 0.827916 Ceramide kinase CERK Hs.34516R17350 0.827916 KIAA1387 protein KIAA1387 Hs.301434R67235 0.827916 HLA-B associated transcript 1 BAT1 Hs.55296N91882 0.827916 Alpha2,3-sialyltransferase ST3GALVI Hs.34578H15287 0.827916 P21(CDKN1A)-activated kinase 6 PAK6 Hs.21420AA029349 0.827916 - - -AA045286 0.827916 Hypothetical protein FLJ10206 FLJ10206 Hs.55014W57807 0.827916 Xylosylprotein beta1,4-galactosyltransferase, polypeptide 7 (galactosyltransferaB4GALT7 Hs.54702W60893 0.827916 Polymerase (DNA-directed), delta 4 POLD4 Hs.82520H14058 0.827916 Similar to HYPOTHETICAL 43.1 KD TRP-ASP REPEATS CONTAINING PROTLOC197336 Hs.12705AA047792 0.827916 Regulator of G-protein signalling 1 RGS1 Hs.75256H73169 0.827916 Hypothetical protein MGC2454 MGC2454 Hs.38399AA029543 0.844084 - - Hs.112619R21462 0.844084 Rho-GTPase activating protein 10 ARHGAP10 Hs.11611W90601 0.844084 Hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/en HADHA Hs.75860N20054 0.844084 - - Hs.20325R13023 0.844084 - - -H21214 0.844084 NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme QNDUFS7 Hs.211914T79037 0.844084 - - -AA035135 0.844084 - - -H88063 0.844084 Chromosome 1 open reading frame 9 C1orf9 Hs.108636N59378 0.844084 ESTs ESTs Hs.48372T93661 0.844084 Endogenous retroviral family W, env(C7), member 1 (syncytin) ERVWE1 Hs.373811R20853 0.844084 KIAA1320 protein KIAA1320 Hs.117414W46374 0.844084 - - Hs.24435N20225 0.844084 Polymerase (RNA) II (DNA directed) polypeptide A, 220kDa POLR2A Hs.171880R08338 0.844084 - - Hs.309257N33054 0.844084 - - Hs.339654T96059 0.844084 Uterine-derived 14 kDa protein LOC64150 Hs.173780N44634 0.844084 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptideATP5C1 Hs.155433AA054497 0.844084 AND-1 protein AND-1 Hs.72160H08387 0.844084 Ubiquitin specific protease 3 USP3 Hs.251636R63034 0.844084 Zinc finger protein 185 (LIM domain) ZNF185 Hs.16622N92308 0.844084 Protein phosphatase 1, regulatory (inhibitor) subunit 16A PPP1R16A Hs.12185N92995 0.844084 Monocytic leukemia zinc finger protein-related factor MORF Hs.27590H06915 0.844084 Hypothetical protein FLJ21919 FLJ21919 Hs.105894AA135644 0.844084 - - Hs.323511AA054503 0.844084 - - -AA054080 0.844084 Zinc finger protein 36, C3H type, homolog (mouse) ZFP36 Hs.343586N77703 0.844084 Unknown MGC21654 product MGC21654 Hs.95631T97275 0.844084 Histone H2A.F/Z variant H2AV Hs.301005AA037249 0.844084 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptideATP5C1 Hs.155433W84774 0.844084 - - Hs.17643W17368 0.844084 - - Hs.261734H99877 0.844084 - - Hs.380785AA099397 0.844084 DEAD-box protein abstrakt ABS Hs.274317AA010349 0.844084 Slingshot 1 SSH1 Hs.60377R60545 0.844084 Similar to RIKEN cDNA 2610036L13 MGC16386 Hs.23044W68273 0.844084 CGI-18 protein LOC51008 Hs.121599AA054454 0.844084 Proteasome (prosome, macropain) subunit, alpha type, 1 PSMA1 Hs.82159AA039738 0.844084 KIAA0697 protein KIAA0697 Hs.12329T80134 0.844084 Tubulin-specific chaperone d TBCD Hs.12570R76719 0.844084 Microtubule-associated protein 1 light chain 3 alpha MAP1LC3A Hs.134707N56656 0.844084 Highly charged protein D13S106E Hs.151236W90103 0.844084 Heterogeneous nuclear ribonucleoprotein A1 HNRPA1 Hs.249495AA028065 0.844084 Zinc finger protein 36, C3H type-like 2 ZFP36L2 Hs.78909W15599 0.844084 BCL2/adenovirus E1B 19kDa interacting protein 3 BNIP3 Hs.79428AA035343 0.844084 - - -H80179 0.844084 DKFZP586N0721 protein DKFZP586N0721 Hs.99843H42133 0.844084 Retinal short-chain dehydrogenase/reductase retSDR2 LOC51170 Hs.12150AA033680 0.844084 Hypothetical protein FLJ31657 FLJ31657 Hs.5518H01162 0.844084 Hypothetical protein FLJ23251 FLJ23251 Hs.170737W47132 0.844084 Amyotrophic lateral sclerosis 2 (juvenile) ALS2 Hs.27669R02816 0.844084 KIAA0790 protein KIAA0790 Hs.12002H70975 0.844084 - - -R97935 0.844084 Cell division cycle 34 CDC34 Hs.76932AA214455 0.844084 - - -R99052 0.844084 Biliverdin reductase B (flavin reductase (NADPH)) BLVRB Hs.76289N27136 0.844084 Karyopherin alpha 3 (importin alpha 4) KPNA3 Hs.3886R74281 0.844084 Protein phosphatase 4 (formerly X), catalytic subunit PPP4C Hs.2903N32770 0.844084 Likely ortholog of mouse metal response element binding transcription factor 2 M96 Hs.31016R72784 0.844084 Cysteinyl-tRNA synthetase CARS Hs.159604AA046082 0.844084 - - -

N25294 0.844084 Collagen, type XVI, alpha 1 COL16A1 Hs.26208W86390 0.844084 Hermansky-Pudlak syndrome 4 HPS4 Hs.6657H75353 0.844084 - - -N59805 0.844084 Cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa CSTF1 Hs.172865R20063 0.860318 Translocated promoter region (to activated MET oncogene) TPR Hs.169750H84657 0.860318 Glutamate rich WD repeat protein GRWD GRWD Hs.218842H43658 0.860318 Gene overexpressed in astrocytoma GOA Hs.293660H77475 0.860318 - - Hs.13766T96870 0.860318 ESTs ESTs Hs.17910T79657 0.860318 ESTs ESTs Hs.14598W92051 0.860318 ESTs ESTs Hs.58694AA195213 0.860318 RAB2, member RAS oncogene family RAB2 Hs.78305R49415 0.860318 Hypothetical protein BC013576 LOC114928 Hs.348493H11043 0.860318 Kinesin family member 3B KIF3B Hs.301206H92449 0.860318 TRIAD3 protein TRIAD3 Hs.86228R53477 0.860318 - - Hs.4283R93692 0.860318 Vaccinia related kinase 2 VRK2 Hs.82771R14285 0.860318 - - Hs.100261H00227 0.860318 YY1 associated protein YAP Hs.18851R12731 0.860318 Zinc finger protein 335 ZNF335 Hs.165983N56703 0.860318 CGI-145 protein LOC51028 Hs.146324AA029359 0.860318 Laminin, beta 2 (laminin S) LAMB2 Hs.90291H13238 0.860318 B-cell CLL/lymphoma 3 BCL3 Hs.31210H09054 0.860318 DNA (cytosine-5-)-methyltransferase 1 DNMT1 Hs.77462W86913 0.860318 - - -N75222 0.860318 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 28 DDX28 Hs.155049R72977 0.860318 RNA binding motif protein 8A RBM8A Hs.10283AA004951 0.860318 DKFZP434C212 protein DKFZP434C212 Hs.172069AA045470 0.860318 Keratin 10 (epidermolytic hyperkeratosis; keratosis palmaris et plantaris) KRT10 Hs.99936W93811 0.860318 Killer cell lectin-like receptor subfamily B, member 1 KLRB1 Hs.169824R05455 0.860318 Myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila) MLL5 Hs.333300H10406 0.860318 Profilin 2 PFN2 Hs.91747AA035378 0.860318 - - Hs.11700N74404 0.860318 - - Hs.38516N81046 0.860318 - - -T74007 0.860318 Nicastrin NCSTN Hs.4788H69509 0.860318 ATP-binding cassette, sub-family B (MDR/TAP), member 10 ABCB10 Hs.1710AA131782 0.860318 - - Hs.182314AA151485 0.860318 Insulin-like growth factor binding protein 7 IGFBP7 Hs.119206N24445 0.860318 Synovial sarcoma, X breakpoint 4 SSX4 Hs.278632AA047136 0.860318 - - Hs.355559AA054552 0.860318 Chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alphaCXCL1 Hs.789R45428 0.860318 DnaJ (Hsp40) homolog, subfamily A, member 1 DNAJA1 Hs.94R36571 0.860318 Neuroglobin NGB Hs.274363AA053856 0.860318 - - -N72694 0.860318 - - -W84339 0.860318 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6 ATP5J Hs.73851T94859 0.860318 Ring finger protein 10 RNF10 Hs.5094H28583 0.860318 - - Hs.31396R38456 0.860318 - - -AA041350 0.860318 - - Hs.57847W52466 0.860318 Carboxypeptidase A1 (pancreatic) CPA1 Hs.2879R75740 0.860318 Hypothetical protein BC011880 LOC113444 Hs.27160H39778 0.860318 Hypothetical protein MGC11134 MGC11134 Hs.326586H58724 0.860318 - - Hs.374462H85459 0.860318 Sortilin 1 SORT1 Hs.351872H19104 0.860318 - - Hs.23406N21274 0.860318 Nucleoporin 153kDa NUP153 Hs.211608R87806 0.860318 ESTs ESTs Hs.356099R25303 0.860318 Hypothetical protein MGC10940 MGC10940 Hs.47986R08418 0.860318 KIAA0674 protein KIAA0674 Hs.14799H84617 0.860318 P300/CBP-associated factor PCAF Hs.199061R50259 0.860318 Protein kinase C-like 1 PRKCL1 Hs.2499R07644 0.860318 RuvB-like 1 (E. coli) RUVBL1 Hs.272822R20737 0.860318 CDC23 (cell division cycle 23, yeast, homolog) CDC23 Hs.153546T86593 0.860318 ESTs ESTs Hs.16222R31300 0.860318 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1 CDS1 Hs.152981AA054551 0.860318 - - -N76293 0.860318 Diaphanous homolog 1 (Drosophila) DIAPH1 Hs.26584N92372 0.860318 Peroxiredoxin 4 PRDX4 Hs.83383AA029467 0.860318 - - -N52670 0.860318 Likely ortholog of mouse exportin 4 XPO4 Hs.117102AA047085 0.860318 Synaptotagmin-like 2 SYTL2 Hs.92254W58500 0.860318 DNA segment on chromosome X (unique) 9928 expressed sequence DXS9928E Hs.54277AA053136 0.860318 KIAA1982 protein KIAA1982 Hs.22969H38928 0.860318 DKFZP566B183 protein DKFZP566B183 Hs.12305N95764 0.860318 Chromosome 20 open reading frame 77 C20orf77 Hs.27192R53547 0.860318 Elongation factor for selenoprotein translation SELB Hs.6522AA059125 0.860318 Filamin B, beta (actin binding protein 278) FLNB Hs.81008N21520 0.860318 Hypothetical protein BC008632 LOC90632 Hs.31917AA027065 0.860318 LIS1-interacting protein NUDE1, rat homolog NUDE1 Hs.263925W24394 0.860318 Alpha-2-macroglobulin A2M Hs.74561T96045 0.860318 - - -N93147 0.860318 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); trMLLT2 Hs.114765N71955 0.860318 Chromosome 20 open reading frame 111 C20orf111 Hs.75798H44601 0.860318 ESTs ESTs Hs.134542N72982 0.87661 Calpastatin CAST Hs.359682H83499 0.87661 Endothelin converting enzyme 1 ECE1 Hs.288203R88505 0.87661 Serine arginine-rich pre-mRNA splicing factor SR-A1 SR-A1 Hs.103521N52622 0.87661 General transcription factor IIH, polypeptide 1, 62kDa GTF2H1 Hs.89578N21286 0.87661 - - -W31173 0.87661 Hypothetical protein FLJ10326 FLJ10326 Hs.262823R48041 0.87661 Glucosidase, alpha; acid (Pompe disease, glycogen storage disease type II) GAA Hs.1437AA046918 0.87661 Splicing factor 3b, subunit 2, 145kDa SF3B2 Hs.75916N33230 0.87661 High-mobility group 20A HMG20A Hs.69594T81175 0.87661 - - Hs.355957W58243 0.87661 - - Hs.134158H46055 0.87661 KIAA0725 protein KIAA0725 Hs.26450T51718 0.87661 Hypothetical protein FLJ13263 FLJ13263 Hs.288768N59459 0.87661 Muscleblind-like protein MBLL39 MBLL39 Hs.283609

W40108 0.87661 - - Hs.346735H09049 0.87661 Enolase 2, (gamma, neuronal) ENO2 Hs.146580R68288 0.87661 - - -AA149233 0.87661 Prostaglandin E synthase PTGES Hs.146688W21172 0.87661 Growth arrest-specific 11 GAS11 Hs.54877R74460 0.87661 CGI-45 protein LOC51094 Hs.5298W88742 0.87661 Bridging integrator 3 BIN3 Hs.68090N36861 0.87661 ESTs ESTs Hs.42344AA203403 0.87661 Hypothetical protein MGC13064 MGC13064 Hs.333524N75841 0.87661 H1 histone family, member 2 H1F2 Hs.7644H49724 0.87661 KIAA1373 protein KIAA1373 Hs.16229T81697 0.87661 DKFZP434M154 protein DKFZP434M154 Hs.154680N92218 0.87661 KIAA1598 protein KIAA1598 Hs.23740H65659 0.87661 Acyl-Coenzyme A oxidase 1, palmitoyl ACOX1 Hs.379991AA131505 0.87661 HSPCO34 protein LOC51668 Hs.46967N69121 0.87661 HSPC159 protein HSPC159 Hs.372208AA115115 0.87661 Pyruvate dehydrogenase (lipoamide) beta PDHB Hs.979R71970 0.87661 Retinoic acid receptor, alpha RARA Hs.250505R77960 0.87661 Ubiquitin specific protease 4 (proto-oncogene) USP4 Hs.77500W24393 0.87661 Syntaxin 10 STX10 Hs.43812R02729 0.87661 Wolf-Hirschhorn syndrome candidate 1 WHSC1 Hs.110457T84053 0.87661 WAS protein family, member 2 WASF2 Hs.288908R52388 0.87661 KIAA1363 protein KIAA1363 Hs.22941N62356 0.87661 Eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa EIF2S1 Hs.151777AA054102 0.87661 Suppressor of cytokine signaling 5 SOCS5 Hs.169836R62399 0.87661 Tetraspanin similar to TM4SF9 DC-TM4F2 Hs.101395H10407 0.87661 KIAA0515 protein KIAA0515 Hs.108945R61879 0.87661 - - -N21080 0.87661 PAX transcription activation domain interacting protein 1 like PAXIP1L Hs.173854H85447 0.87661 - - -H27729 0.87661 AD038 LOC85026 Hs.22164AA036873 0.87661 Chromosome 20 open reading frame 108 C20orf108 Hs.352413R26320 0.87661 Filamin B, beta (actin binding protein 278) FLNB Hs.81008W93338 0.87661 Hypothetical protein FLJ12592 FLJ12592 Hs.23100AA047471 0.87661 Nucleolar protein GU2 GU2 Hs.7392AA101862 0.87661 Source of immunodominant MHC-associated peptides SIMP Hs.183454H79855 0.87661 Translational inhibitor protein p14.5 UK114 Hs.18426AA099910 0.87661 Glutamyl aminopeptidase (aminopeptidase A) ENPEP Hs.291T95735 0.87661 Phosphatidylinositol-4-phosphate 5-kinase, type I, alpha PIP5K1A Hs.149255AA005268 0.87661 Chromosome 21 open reading frame 91 C21orf91 Hs.49391H75644 0.87661 Hypothetical protein BC016005 LOC129642 Hs.356547AA053141 0.87661 CGI-31 protein LOC51075 Hs.279861H66591 0.87661 - - Hs.376349W38337 0.87661 - - -AA029484 0.87661 DKFZP727M111 protein DKFZP727M111 Hs.4849N70628 0.87661 Polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa POLR2K Hs.351475N78859 0.87661 Myosin, light polypeptide 4, alkali; atrial, embryonic MYL4 Hs.356717AA128311 0.87661 Peripheral myelin protein 22 PMP22 Hs.103724W89153 0.87661 GABA(A) receptor-associated protein-like 2 GABARAPL2 Hs.6518W20441 0.87661 KIAA0116 protein KIAA0116 Hs.182877AA035519 0.87661 Chromosome 2 open reading frame 3 C2orf3 Hs.184175H77990 0.87661 - - Hs.28113N58742 0.87661 - - -H93203 0.87661 Nesca protein NESCA Hs.226499T66828 0.87661 Hypothetical protein FLJ36748 FLJ36748 Hs.64313N29439 0.87661 Sarcoglycan, delta (35kDa dystrophin-associated glycoprotein) SGCD Hs.151899H78279 0.87661 - - Hs.295789R55733 0.87661 - - Hs.26454R18594 0.87661 Hypothetical protein MGC2817 MGC2817 Hs.159406W39414 0.87661 ESTs ESTs Hs.55327AA115202 0.87661 - - Hs.136061N52232 0.87661 NEDD8 ultimate buster-1 LOC51667 Hs.279780W56565 0.87661 - - Hs.56185N26031 0.87661 ESTs ESTs Hs.43725AA040123 0.87661 Solute carrier family 27 (fatty acid transporter), member 4 SLC27A4 Hs.248953N75008 0.87661 DKFZP564K247 protein DKFZP564K247 Hs.7917N36780 0.87661 Carbonyl reductase 1 CBR1 Hs.88778N75516 0.87661 KIAA1096 protein KIAA1096 Hs.69559H10448 0.87661 Cytochrome b5 reductase 1 (B5R.1) LOC51706 Hs.289113H70040 0.87661 TIGA1 TIGA1 Hs.12082R83572 0.87661 Hypothetical protein FLJ10154 FLJ10154 Hs.179972N35773 0.87661 Laminin, beta 1 LAMB1 Hs.82124R25275 0.87661 ESTs ESTs Hs.356211W93973 0.87661 BCL2/adenovirus E1B 19kDa interacting protein 1 BNIP1 Hs.77572AA203110 0.87661 Androgen-induced basic leucine zipper AIBZIP Hs.372924H14891 0.87661 Kinesin family member 3B KIF3B Hs.301206T90647 0.87661 - - Hs.193649AA009587 0.87661 Hypothetical protein MGC13183 MGC13183 Hs.59791N54967 0.87661 Hypothetical protein BM-002 BM-002 Hs.367646R01798 0.87661 LATS, large tumor suppressor, homolog 2 (Drosophila) LATS2 Hs.19074N34234 0.87661 Esterase D/formylglutathione hydrolase ESD Hs.82193R55009 0.892956 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypepGNAI2 Hs.77269W21604 0.892956 Novel putative protein similar to YIL091C yeast hypothetical 84 kD protein fromDJ434O14.5 Hs.194754R24277 0.892956 RAB40C, member RAS oncogene family RAB40C Hs.31408AA114977 0.892956 Glutaminyl-tRNA synthetase QARS Hs.79322N26477 0.892956 Iduronate 2-sulfatase (Hunter syndrome) IDS Hs.172458H63547 0.892956 N-ethylmaleimide-sensitive factor attachment protein, alpha NAPA Hs.75932R61769 0.892956 Crm, cramped-like (Drosophila) CRAMP1L Hs.15441N36071 0.892956 - - Hs.28890AA203115 0.892956 Organic cation transporter OKB1 OKB1 Hs.191996H06474 0.892956 Fatty acid desaturase 3 FADS3 Hs.21765AA041346 0.892956 M-phase phosphoprotein 6 MPHOSPH6 Hs.152720N34626 0.892956 Cadherin 19, type 2 CDH19 Hs.129887AA039228 0.892956 Farnesyltransferase, CAAX box, beta FNTB Hs.276N29880 0.892956 Hypothetical protein DKFZp762O076 DKFZp762O076 Hs.21621R88822 0.892956 - - Hs.26249H69632 0.892956 Slingshot 1 SSH1 Hs.60377R70132 0.892956 - - Hs.378751T66873 0.892956 26S proteasome-associated pad1 homolog POH1 Hs.178761R36127 0.892956 Filamin B, beta (actin binding protein 278) FLNB Hs.81008

H24175 0.892956 Adaptor-related protein complex 1, mu 1 subunit AP1M1 Hs.3832N74005 0.892956 Bromodomain and PHD finger containing, 3 BRPF3 Hs.246795R79187 0.892956 KIAA0101 gene product KIAA0101 Hs.81892H65687 0.892956 Hypothetical protein FLJ23263 FLJ23263 Hs.288716R53544 0.892956 - - Hs.4285N42273 0.892956 Signal-induced proliferation-associated gene 1 SIPA1 Hs.7019AA156433 0.892956 ESTs ESTs Hs.103864R76103 0.892956 - - Hs.367898W15364 0.892956 B-cell CLL/lymphoma 7A BCL7A Hs.211563R48311 0.892956 - - -H60501 0.892956 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); trMLLT4 Hs.100469N40830 0.892956 Hypothetical protein FLJ25436 FLJ25436 Hs.29706H48733 0.892956 Interleukin enhancer binding factor 3, 90kDa ILF3 Hs.256583R08800 0.892956 Tubulin, gamma 2 TUBG2 Hs.279669T78404 0.892956 ESTs ESTs Hs.14280R97943 0.892956 Zinc finger protein 26 (KOX 20) ZNF26 Hs.26432W57795 0.892956 TSC-22-like THG-1 Hs.102447H98919 0.892956 - - -AA047454 0.892956 Zinc finger protein 76 (expressed in testis) ZNF76 Hs.29222AA064765 0.892956 Chromosome 11 hypothetical protein ORF3 LOC56851 Hs.4245R24727 0.892956 Phosphatidylserine receptor PSR Hs.72660H18946 0.892956 Leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domai LILRB2 Hs.22405AA127846 0.892956 ESTs ESTs Hs.348901H25541 0.892956 STRIN protein STRIN Hs.180403W51953 0.892956 Tenascin XB TNXB Hs.169886W60709 0.892956 C-terminal modulator protein CTMP Hs.293691R17562 0.892956 - - Hs.239666R28095 0.892956 Solute carrier family 12 (potassium/chloride transporters), member 4 SLC12A4 Hs.10094N63284 0.892956 Putative protein O-mannosyltransferase POMT2 Hs.132989W38465 0.892956 Developmentally regulated GTP binding protein 2 DRG2 Hs.78582AA045672 0.892956 LIM domain protein RIL Hs.79691AA136473 0.892956 - - Hs.46609T84334 0.892956 Thymidine kinase 2, mitochondrial TK2 Hs.274701N99051 0.892956 RNA binding motif, single stranded interacting protein 1 RBMS1 Hs.241567N72176 0.892956 KIAA1046 protein KIAA1046 Hs.89519R50031 0.892956 KIAA0602 protein KIAA0602 Hs.37656AA031859 0.892956 Translocase of inner mitochondrial membrane 13 homolog (yeast) TIMM13 Hs.23410AA029842 0.892956 Mature T-cell proliferation 1 MTCP1 Hs.3548AA148637 0.892956 Neurofascin NFASC Hs.13349N95812 0.892956 Insulin-like growth factor binding protein 6 IGFBP6 Hs.274313AA036778 0.892956 - - -H81916 0.892956 Transcription termination factor, RNA polymerase II TTF2 Hs.142157N69957 0.892956 - - Hs.164230AA004492 0.892956 Cytochrome P450 monooxygenase CYP-M Hs.352566T81296 0.892956 Glucocorticoid receptor DNA binding factor 1 GRLF1 Hs.102548AA001748 0.892956 Hypothetical protein FLJ11286 FLJ11286 Hs.12151AA043886 0.892956 Dystrobrevin binding protein 1 DTNBP1 Hs.43481AA194139 0.892956 C-Mpl binding protein LOC113251 Hs.26613R62341 0.892956 Hypothetical protein FLJ35564 FLJ35564 Hs.374836H95259 0.892956 Membrane protein, palmitoylated 1, 55kDa MPP1 Hs.1861W47372 0.892956 Zinc finger protein 36, C3H type-like 2 ZFP36L2 Hs.78909H14586 0.892956 - - -W74233 0.892956 Related RAS viral (r-ras) oncogene homolog RRAS Hs.9651N68511 0.892956 Hypothetical protein FLJ12085 FLJ12085 Hs.48827H83414 0.892956 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa NDUFB6 Hs.109646W40304 0.909347 Apoptosis inhibitor 5 API5 Hs.227913N27628 0.909347 - - -H87107 0.909347 Ring finger protein 5 RNF5 Hs.216354AA151307 0.909347 Guanine nucleotide binding protein (G protein), beta polypeptide 2 GNB2 Hs.91299T39578 0.909347 Mitochondrial ribosomal protein S18C MRPS18C Hs.3385H37900 0.909347 Rhodopsin (opsin 2, rod pigment) (retinitis pigmentosa 4, autosomal dominant) RHO Hs.247565AA151412 0.909347 - - -H89628 0.909347 Solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+SLC9A1 Hs.170222R90757 0.909347 Likely ortholog of mouse rabphilin 3A RPH3A Hs.21239AA054731 0.909347 Hypothetical protein BC014942 LOC89941 Hs.21497R93735 0.909347 ESTs ESTs Hs.35193H16934 0.909347 Zinc finger protein 278 ZNF278 Hs.27801N42162 0.909347 DC2 protein DC2 Hs.103180H50914 0.909347 Endothelin converting enzyme 1 ECE1 Hs.288203AA042817 0.909347 Calmodulin 2 (phosphorylase kinase, delta) CALM2 Hs.182278AA126411 0.909347 - - Hs.15806R18757 0.909347 - - Hs.13702AA031411 0.909347 Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa PAFAH1B1 Hs.77318R54992 0.909347 - - -R08498 0.909347 - - -W85972 0.909347 Reserved SYAP1 Hs.47334W16814 0.909347 Hypothetical protein MGC18257 MGC18257 Hs.350860W39250 0.909347 Hairy homolog (Drosophila) HRY Hs.250666AA045331 0.909347 ADP-ribosylation factor 4-like ARF4L Hs.183153R48247 0.909347 Hypothetical protein MGC15429 MGC15429 Hs.79N63014 0.909347 Poly (ADP-ribose) glycohydrolase PARG Hs.91390N36109 0.909347 Macrophage myristoylated alanine-rich C kinase substrate MACMARCKS Hs.75061H49229 0.909347 Hypothetical protein FLJ20040 FLJ20040 Hs.61960N77925 0.909347 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa NDUFA1 Hs.74823N80287 0.909347 KIAA1357 protein KIAA1357 Hs.170162AA047408 0.909347 Family with sequence similarity 3, member A FAM3A Hs.289108N25598 0.909347 - - Hs.187908H49485 0.909347 Cytochrome c oxidase subunit VIIb COX7B Hs.75752AA130140 0.909347 SnRNP assembly defective 1 homolog SAD1 Hs.12820N46199 0.909347 Hypothetical protein DKFZp761N0624 DKFZp761N0624 Hs.21893N76910 0.909347 Ribosomal protein L23a pseudogene 7 RPL23AP7 Hs.247828R24294 0.909347 Citron (rho-interacting, serine/threonine kinase 21) CIT Hs.15767AA041282 0.909347 - - -R14521 0.909347 Spectrin SH3 domain binding protein 1 SSH3BP1 Hs.24752AA115560 0.909347 - - Hs.63368W90588 0.909347 Synaptogyrin 1 SYNGR1 Hs.6139N52493 0.909347 Hypothetical protein FLJ21432 FLJ21432 Hs.334854R90939 0.909347 ESTs ESTs Hs.34180N40437 0.909347 S-adenosylhomocysteine hydrolase-like 1 AHCYL1 Hs.4113R22511 0.909347 LAG1 longevity assurance homolog 2 (S. cerevisiae) LASS2 Hs.285976

W04539 0.909347 KIAA0295 protein KIAA0295 Hs.155979R61363 0.909347 - - Hs.117530W87783 0.909347 REV1-like (yeast) REV1L Hs.110347H08342 0.909347 - - -AA034388 0.909347 Sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and SEMA4B Hs.9598R13348 0.909347 Plexin A1 PLXNA1 Hs.334666W43007 0.909347 Pregnancy specific beta-1-glycoprotein 5 PSG5 Hs.251850R55573 0.909347 - - Hs.249365R89801 0.909347 Hypothetical protein BC001584 LOC124245 Hs.93670R16440 0.909347 AD024 protein AD024 Hs.21137W23776 0.909347 ENOS interacting protein NOSIP Hs.7236N22081 0.909347 PC4 and SFRS1 interacting protein 2 PSIP2 Hs.82110H69584 0.909347 - - -AA031836 0.909347 ESTs ESTs Hs.131714H81266 0.909347 Retinol dehydrogenase 5 (11-cis and 9-cis) RDH5 Hs.172914W87527 0.909347 Hypothetical protein PNAS-131 PNAS-131 Hs.37883R47922 0.909347 Hypothetical protein FLJ22341 FLJ22341 Hs.25485H49910 0.909347 Insulin-like growth factor binding protein 7 IGFBP7 Hs.119206T86612 0.909347 ESTs ESTs Hs.16228H29171 0.909347 DKFZP564A2416 protein DKFZP564A2416 Hs.5297R39303 0.909347 Rab geranylgeranyltransferase, alpha subunit RABGGTA Hs.78920R17223 0.909347 - - -R51929 0.909347 KIAA0864 protein KIAA0864 Hs.84883AA063161 0.909347 - - Hs.181767AA027125 0.909347 Hypothetical protein FLJ10385 FLJ10385 Hs.30922T72638 0.909347 - - Hs.380756N59818 0.909347 Endocrine regulator HRIHFB2436 Hs.48433R93572 0.909347 - - -AA136799 0.909347 Growth arrest and DNA-damage-inducible, alpha GADD45A Hs.80409N29438 0.909347 Mitochondrial ribosomal protein L46 MRPL46 Hs.278328H93830 0.909347 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9ATP5G1 Hs.80986AA053299 0.909347 CD59 antigen p18-20 (antigen identified by monoclonal antibodies 16.3A5, EJ1CD59 Hs.278573N25352 0.909347 Coxsackie virus and adenovirus receptor CXADR Hs.79187R18959 0.909347 Hypothetical protein FLJ13111 FLJ13111 Hs.288382H08236 0.909347 KIAA1096 protein KIAA1096 Hs.69559R51985 0.909347 Uncharacterized hypothalamus protein HT008 HT008 Hs.16206W06830 0.925776 MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cereMCM5 Hs.77171R93490 0.925776 Cleavage and polyadenylation specific factor 4, 30kDa CPSF4 Hs.6351R66367 0.925776 ESTs ESTs Hs.118769W03106 0.925776 Mitogen-activated protein kinase kinase kinase kinase 5 MAP4K5 Hs.246970AA033687 0.925776 STAT induced STAT inhibitor-2 STATI2 Hs.110776H43647 0.925776 Uncharacterized hematopoietic stem/progenitor cells protein MDS033 MDS033 Hs.54960H23263 0.925776 Spir-1 protein Spir-1 Hs.16758H10026 0.925776 Zinc finger protein 193 ZNF193 Hs.96448R36886 0.925776 Chromosome 20 open reading frame 104 C20orf104 Hs.301055N24229 0.925776 Polypyrimidine tract binding protein 1 PTBP1 Hs.172550H82739 0.925776 - - Hs.40411H03425 0.925776 Alpha-1-microglobulin/bikunin precursor AMBP Hs.76177AA043196 0.925776 Hypothetical protein FLJ10450 FLJ10450 Hs.267604AA203234 0.925776 KIAA1728 protein KIAA1728 Hs.252748H50248 0.925776 Prostate derived STE20-like kinase PSK PSK Hs.66141T87298 0.925776 - - -AA126383 0.925776 Neuropilin 2 NRP2 Hs.17778H26525 0.925776 LATS, large tumor suppressor, homolog 2 (Drosophila) LATS2 Hs.19074W60890 0.925776 RAB2, member RAS oncogene family RAB2 Hs.78305AA115748 0.925776 Interferon-related developmental regulator 1 IFRD1 Hs.7879N47247 0.925776 - - -R17784 0.925776 ESTs ESTs Hs.21757T81285 0.925776 Phosphofructokinase, liver PFKL Hs.155455N80988 0.925776 GTP binding protein 2 GTPBP2 Hs.13011W24178 0.925776 IlvB (bacterial acetolactate synthase)-like ILVBL Hs.78880W44390 0.925776 GM2 ganglioside activator protein GM2A Hs.289082R72158 0.925776 - - -N46186 0.925776 Clone FLB4739 LOC51218 Hs.294083T83261 0.925776 - - Hs.14456H84221 0.925776 High-glucose-regulated protein 8 HGRG8 Hs.20993H10406 0.925776 Profilin 2 PFN2 Hs.91747AA099731 0.925776 Follicular lymphoma variant translocation 1 FVT1 Hs.74050AA037207 0.925776 KIAA1668 protein KIAA1668 Hs.8535AA149643 0.925776 Egl nine homolog 1 (C. elegans) EGLN1 Hs.6523AA150728 0.925776 ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 3 ADPRTL3 Hs.271742AA044084 0.925776 Chromosome 12 open reading frame 5 C12orf5 Hs.24792H37804 0.925776 Glucose-6-phosphatase, transport (glucose-6-phosphate) protein 1 G6PT1 Hs.132760R52028 0.925776 Protein tyrosine phosphatase, non-receptor type 23 PTPN23 Hs.25524N73287 0.925776 Death-associated protein 6 DAXX Hs.336916N71959 0.925776 Hypothetical protein MGC13204 MGC13204 Hs.157148W80994 0.925776 Nerve growth factor receptor (TNFRSF16) associated protein 1 NGFRAP1 Hs.381039N69014 0.925776 SRY (sex determining region Y)-box 12 SOX12 Hs.43627AA010048 0.925776 Hypothetical protein FLJ11301 FLJ11301 Hs.301724AA010018 0.925776 Hypothetical protein FLJ22353 FLJ22353 Hs.22157N79530 0.925776 Clathrin, heavy polypeptide (Hc) CLTC Hs.178710AA037618 0.925776 - - Hs.109731R76996 0.925776 Lamin B receptor LBR Hs.152931H53989 0.925776 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, suSMARCD2 Hs.250581N77879 0.925776 WD-repeat protein HAN11 Hs.288283AA131634 0.925776 - - Hs.8172W02089 0.925776 Hypothetical protein PRO1843 PRO1843 Hs.283330AA028185 0.925776 Sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase) SPR Hs.301540AA047076 0.925776 Cytochrome b5 reductase b5R.2 LOC51700 Hs.22142T93888 0.925776 - - -AA194047 0.925776 Mitogen-activated protein kinase kinase 7 MAP2K7 Hs.110299AA033710 0.925776 - - Hs.351928T83736 0.925776 Hypothetical protein FLJ31121 FLJ31121 Hs.350194AA136694 0.925776 KIAA0229 protein KIAA0229 Hs.20060N72077 0.925776 - - Hs.196716N36351 0.925776 Connective tissue growth factor CTGF Hs.75511AA125942 0.925776 ESTs ESTs Hs.61881AA043535 0.925776 Lysophosphatidic acid acyltransferase-delta LPAAT-delta Hs.353175W42881 0.925776 DKFZp434J1813 protein DKFZP434J1813 Hs.1098AA024415 0.925776 Keratin 1 (epidermolytic hyperkeratosis) KRT1 Hs.80828

H43482 0.925776 Valyl-tRNA synthetase 2 VARS2 Hs.159637N95455 0.925776 N-acetylgalactosaminidase, alpha- NAGA Hs.75372N79578 0.925776 ClpP caseinolytic protease, ATP-dependent, proteolytic subunit homolog (E. coCLPP Hs.74362R78873 0.925776 ESTs ESTs Hs.29822N67708 0.925776 Hypothetical protein FLJ20644 FLJ20644 Hs.49376H43498 0.925776 MAP/microtubule affinity-regulating kinase 1 MARK1 Hs.12808AA046075 0.925776 - - Hs.88845N93577 0.925776 Hypothetical protein HSPC251 HSPC251 Hs.54971H45175 0.925776 Zinc finger protein 36, C3H type-like 1 ZFP36L1 Hs.85155AA040886 0.925776 ESTs ESTs Hs.11325R17452 0.925776 ATPase, Class II, type 9B ATP9B Hs.91471AA044141 0.925776 Chromosome 20 open reading frame 98 C20orf98 Hs.286128R35530 0.942237 RAD23 homolog B (S. cerevisiae) RAD23B Hs.178658R93500 0.942237 - - Hs.34490R20380 0.942237 ESTs ESTs Hs.12758AA213820 0.942237 - - Hs.256533T71576 0.942237 Hypothetical protein MGC5309 MGC5309 Hs.13885W07170 0.942237 Hepatitis B virus x interacting protein HBXIP Hs.80464AA031852 0.942237 Synaptophysin-like protein SYPL Hs.80919H05457 0.942237 - - -AA102111 0.942237 Collagen, type XV, alpha 1 COL15A1 Hs.83164H61134 0.942237 Solute carrier family 6 (neurotransmitter transporter, creatine), member 8 SLC6A8 Hs.187958N63482 0.942237 Lysosomal-associated membrane protein 2 LAMP2 Hs.8262AA057870 0.942237 Solute carrier family 26, member 10 SLC26A10 Hs.353207R25755 0.942237 ESTs ESTs Hs.106131W69209 0.942237 Phosphatidylinositol glycan, class H PIGH Hs.177T78208 0.942237 IQ motif containing GTPase activating protein 1 IQGAP1 Hs.1742AA046245 0.942237 Osteoblast specific factor 2 (fasciclin I-like) OSF-2 Hs.136348AA129971 0.942237 - - -R45007 0.942237 Adaptor-related protein complex 3, delta 1 subunit AP3D1 Hs.75056AA044181 0.942237 Enabled homolog (Drosophila) ENAH Hs.14838N26062 0.942237 WD40 protein Ciao1 CIAO1 Hs.12109AA039643 0.942237 Endothelial-derived gene 1 EG1 Hs.380864T84583 0.942237 KIAA0195 gene product KIAA0195 Hs.301132N42535 0.942237 Hypothetical protein BC008647 LOC91875 Hs.102480N77814 0.942237 C-src tyrosine kinase CSK Hs.77793AA203544 0.942237 Ubiquitin-activating enzyme E1-like UBE1L Hs.16695R35343 0.942237 Hypothetical protein BC016683 LOC139231 Hs.24968W87377 0.942237 DNA segment, numerous copies, expressed probes (GS1 gene) DXF68S1E Hs.78991AA147618 0.942237 - - Hs.71848AA053736 0.942237 Hypothetical protein FLJ23375 FLJ23375 Hs.285996R20016 0.942237 - - Hs.22689R55789 0.942237 Amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like) APBA2 Hs.26468R72445 0.942237 Sarcospan (Kras oncogene-associated gene) SSPN Hs.183428H98809 0.942237 Poly(A) binding protein, cytoplasmic 1 PABPC1 Hs.172182R11669 0.942237 Hypothetical protein LOC56912 LOC56912 Hs.334360R86233 0.942237 Serum/glucocorticoid regulated kinase SGK Hs.296323R34021 0.942237 High-mobility group nucleosome binding domain 1 HMGN1 Hs.251064H64822 0.942237 RNA binding motif protein 8A RBM8A Hs.10283H21780 0.942237 Craniofacial development protein 1 CFDP1 Hs.296460H89751 0.942237 KIAA1870 protein KIAA1870 Hs.334604H53718 0.942237 - - -AA115289 0.942237 Huntingtin-associated protein interacting protein (duo) HAPIP Hs.8004R99156 0.942237 P53-regulated DDA3 DDA3 Hs.77550W78790 0.942237 TNF receptor-associated factor 4 TRAF4 Hs.8375H23344 0.942237 - - Hs.356140N67802 0.942237 KIAA0871 protein KIAA0871 Hs.7972H99843 0.942237 Quinolinate phosphoribosyltransferase (nicotinate-nucleotide pyrophosphorylasQPRT Hs.8935H20174 0.942237 Adenosine monophosphate deaminase 2 (isoform L) AMPD2 Hs.82927AA011707 0.942237 Ras homolog gene family, member U ARHU Hs.20252R55337 0.942237 - - Hs.310092W52798 0.942237 Emerin (Emery-Dreifuss muscular dystrophy) EMD Hs.2985T67153 0.942237 Inner mitochondrial membrane peptidase 2 like IMMP2L Hs.89576N95177 0.942237 Replication factor C (activator 1) 1, 145kDa RFC1 Hs.166563R39195 0.942237 Junctional adhesion molecule 1 JAM1 Hs.12284N41517 0.942237 Aminoacylase 1 ACY1 Hs.334707T83291 0.942237 ESTs ESTs Hs.220624H37821 0.942237 - - -T83125 0.942237 - - -N57339 0.942237 Hypothetical protein FLJ11240 FLJ11240 Hs.339833AA040084 0.942237 - - Hs.25144R36505 0.942237 ESTs ESTs Hs.271945N24957 0.942237 Chromosome 21 open reading frame 6 C21orf6 Hs.34136AA126874 0.942237 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, e YWHAH Hs.349530H69302 0.942237 Cyclin-dependent kinase (CDC2-like) 10 CDK10 Hs.77313R11847 0.942237 - - -AA126734 0.942237 Downstream neighbor of SON DONSON Hs.17834N71255 0.942237 SAC2 suppressor of actin mutations 2-like (yeast) SACM2L Hs.169407R80601 0.942237 Zinc finger protein 294 ZNF294 Hs.288773N90836 0.942237 Fragile X mental retardation 1 FMR1 Hs.89764AA101783 0.942237 ESTs ESTs Hs.22380AA099589 0.942237 GDP dissociation inhibitor 2 GDI2 Hs.56845W35370 0.942237 Nuclear domain 10 protein NDP52 Hs.154230R10692 0.942237 Hypothetical protein DKFZp762E1312 DKFZp762E1312 Hs.104859N68460 0.942237 - - Hs.27038R70771 0.942237 Ubiquitin specific protease 11 USP11 Hs.171501N68372 0.942237 - - -AA059245 0.942237 ESTs ESTs Hs.32713R14784 0.942237 ESTs ESTs Hs.268773N59242 0.942237 Hypothetical protein HH114 HH114 Hs.48348N25228 0.942237 Heparan sulfate 2-O-sulfotransferase 1 HS2ST1 Hs.169939W68491 0.942237 KIAA0892 protein KIAA0892 Hs.112751R66076 0.942237 Hypothetical protein FLJ20038 FLJ20038 Hs.72071N51466 0.942237 - - -R80226 0.942237 ESTs ESTs Hs.105636N20843 0.942237 - - -H61334 0.942237 RNA binding protein S1, serine-rich domain RNPS1 Hs.75104H15851 0.942237 Hypothetical protein FLJ31821 FLJ31821 Hs.351575AA043766 0.942237 - - -R56380 0.942237 - - Hs.356416

AA150792 0.942237 - - -T75394 0.958723 Eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa EIF2B3 Hs.283627W39234 0.958723 Mitochondrial ribosomal protein L16 MRPL16 Hs.5080AA029895 0.958723 Fibrillarin FBL Hs.99853H04790 0.958723 KIAA1855 protein KIAA1855 Hs.343820N77027 0.958723 - - Hs.279607R84556 0.958723 WD repeat domain 10 WDR10 Hs.70202H10070 0.958723 KIAA0169 protein KIAA0169 Hs.374382AA045734 0.958723 GS15 LOC51272 Hs.300631R38371 0.958723 - - Hs.9691N72504 0.958723 Ferrochelatase (protoporphyria) FECH Hs.26H82876 0.958723 ESTs ESTs Hs.374415T79456 0.958723 - - -W16434 0.958723 Testis expressed sequence 27 TEX27 Hs.6120N80703 0.958723 Chromosome 20 open reading frame 20 C20orf20 Hs.143954AA115737 0.958723 Solute carrier family 2 (facilitated glucose transporter), member 10 SLC2A10 Hs.305971W45316 0.958723 XPMC2 protein LOC57109 Hs.235376R44372 0.958723 KIAA1322 protein KIAA1322 Hs.72242AA213820 0.958723 - - Hs.256533N93367 0.958723 Phosphorylase kinase, alpha 2 (liver) PHKA2 Hs.54941AA151400 0.958723 - - Hs.379188N33136 0.958723 Translin TSN Hs.75066N30278 0.958723 KIAA0872 protein KIAA0872 Hs.40109H75861 0.958723 Apoptotic chromatin condensation inducer in the nucleus ACN Hs.227133R52052 0.958723 Hypothetical protein BC012357 LOC89953 Hs.53447H17047 0.958723 Zinc finger protein 133 (clone pHZ-13) ZNF133 Hs.78434H02626 0.958723 Annexin A6 ANXA6 Hs.118796H84157 0.958723 Bobby sox homolog (Drosophila) BBX Hs.35380W58638 0.958723 - - -H82175 0.958723 Sialidase 1 (lysosomal sialidase) NEU1 Hs.118721R10029 0.958723 ESTs ESTs Hs.20516T54683 0.958723 DNA helicase homolog PIF1 PIF1 Hs.112160AA054459 0.958723 DKFZP564O1863 protein DKFZP564O1863 Hs.173074W58007 0.958723 KIAA0222 gene product KIAA0222 Hs.48450AA026748 0.958723 Phosphoinositide-3-kinase, class 2, alpha polypeptide PIK3C2A Hs.249235N20261 0.958723 - - Hs.26418R07631 0.958723 ESTs ESTs Hs.268640N27190 0.958723 Ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) UCHL3 Hs.77917R94555 0.958723 Collagen, type IV, alpha 2 COL4A2 Hs.75617N50540 0.958723 - - Hs.346742AA029709 0.958723 Syntaxin 18 STX18 Hs.13406AA041273 0.958723 BRG1-binding protein ELD/OSA1 ELD/OSA1 Hs.73287R71264 0.958723 - - Hs.16798R66378 0.958723 RAB9A, member RAS oncogene family RAB9A Hs.330994AA137081 0.958723 Adaptor-related protein complex 1, mu 1 subunit AP1M1 Hs.3832H27818 0.958723 Hypothetical protein FLJ30656 FLJ30656 Hs.349887W23753 0.958723 Phosphoprotein enriched in astrocytes 15 PEA15 Hs.194673H85791 0.958723 - - Hs.380059N73756 0.958723 KIAA0628 gene product KIAA0628 Hs.43133W40265 0.958723 NEFA-interacting nuclear protein NIP30 NIP30 Hs.285017AA002088 0.958723 Pregnancy specific beta-1-glycoprotein 6 PSG6 Hs.252097AA037306 0.958723 - - Hs.169872R39304 0.958723 Ephrin-B2 EFNB2 Hs.30942AA037091 0.958723 Transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) TCEB1 Hs.184693H44228 0.958723 Calcium/calmodulin-dependent protein kinase kinase 2, beta CAMKK2 Hs.108708AA149279 0.958723 DNAJ domain-containing MCJ Hs.279884N89673 0.958723 Peroxisome proliferative activated receptor, gamma, coactivator 1 PPARGC1 Hs.198468AA047157 0.958723 Kangai 1 (suppression of tumorigenicity 6, prostate; CD82 antigen (R2 leukocy KAI1 Hs.323949H00619 0.958723 - - Hs.349261R21825 0.958723 - - Hs.23272N29648 0.958723 CD164 antigen, sialomucin CD164 Hs.43910N68917 0.958723 P53 regulated PA26 nuclear protein PA26 Hs.14125N74870 0.958723 Ring-box 1 RBX1 Hs.279919AA059073 0.958723 - - -H00267 0.958723 Hypothetical protein FLJ22955 FLJ22955 Hs.83097H80740 0.958723 Phosphofructokinase, muscle PFKM Hs.75160AA057871 0.958723 DNA-damage-inducible transcript 3 DDIT3 Hs.337761H87188 0.958723 Hypothetical protein FLJ14511 FLJ14511 Hs.40919N69477 0.958723 Cytochrome c oxidase subunit Vb COX5B Hs.1342N27866 0.958723 Pp21 homolog LOC51186 Hs.15984T51710 0.958723 Endoglin (Osler-Rendu-Weber syndrome 1) ENG Hs.76753N50632 0.958723 Leucine-rich and death domain containing LRDD Hs.123136R83875 0.958723 ATP-binding cassette, sub-family B (MDR/TAP), member 10 ABCB10 Hs.1710AA044143 0.958723 Molybdenum cofactor synthesis 1 MOCS1 Hs.349416T85994 0.958723 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa NDUFB4 Hs.227750AA010417 0.958723 Leukotriene A4 hydrolase LTA4H Hs.81118W78793 0.958723 Epidermal growth factor receptor pathway substrate 8 EPS8 Hs.2132R68652 0.958723 Adducin 1 (alpha) ADD1 Hs.183706H66836 0.958723 - - Hs.224967N23988 0.958723 RAB13, member RAS oncogene family RAB13 Hs.151536R49920 0.958723 Pilin-like transcription factor PILB Hs.279754R77522 0.958723 - - Hs.29643R41603 0.958723 Secretogranin II (chromogranin C) SCG2 Hs.75426H28503 0.958723 - - -H09731 0.958723 - - Hs.7133R82950 0.958723 DKFZP434N093 protein DKFZP434N093 Hs.33363H22657 0.975227 Carboxylesterase 2 (intestine, liver) CES2 Hs.282975R31509 0.975227 Arfaptin 1 HSU52521 Hs.301064R50656 0.975227 Protein phosphatase 1, regulatory (inhibitor) subunit 12C PPP1R12C Hs.235975H61827 0.975227 KIAA1882 protein MGC4737 Hs.157240AA056593 0.975227 KIAA0063 gene product KIAA0063 Hs.3094H00874 0.975227 - - Hs.295789R86973 0.975227 Hypothetical protein DKFZp434P0531 DKFZp434P0531 Hs.284181N93056 0.975227 Mitochondrial ribosomal protein L14 MRPL14 Hs.343579N23302 0.975227 Lysyl oxidase LOX Hs.102267N25073 0.975227 - EST Hs.322020R00205 0.975227 KIAA0595 protein KIAA0595 Hs.146957R92012 0.975227 Death-associated protein DAP Hs.75189N89829 0.975227 - - Hs.293653R36748 0.975227 - - Hs.22545

AA147566 0.975227 - - -H03154 0.975227 CAC-1 CAC-1 Hs.343912AA020869 0.975227 Heterogeneous nuclear ribonucleoprotein C (C1/C2) HNRPC Hs.182447H26401 0.975227 Serine/arginine repetitive matrix 2 SRRM2 Hs.197114AA045171 0.975227 - - Hs.25930R40486 0.975227 Mitogen-activated protein kinase kinase kinase 7 interacting protein 1 MAP3K7IP1 Hs.31472H12368 0.975227 Mucolipin 1 MCOLN1 Hs.12909R36697 0.975227 START domain containing 3 STARD3 Hs.77628N78582 0.975227 Protein kinase, AMP-activated, beta 2 non-catalytic subunit PRKAB2 Hs.50732H84616 0.975227 Hypothetical protein MGC18216 MGC18216 Hs.104679AA053859 0.975227 U2 small nuclear ribonucleoprotein auxiliary factor (65kD) U2AF65 Hs.7655N70558 0.975227 Potassium inwardly-rectifying channel, subfamily J, member 8 KCNJ8 Hs.102308N29418 0.975227 - - Hs.44024H79768 0.975227 Activity-dependent neuroprotector ADNP Hs.3657N36881 0.975227 Hypothetical protein FLJ38968 FLJ38968 Hs.356496H49229 0.975227 Hypothetical protein FLJ20040 FLJ20040 Hs.61960W92049 0.975227 - - -N92276 0.975227 Chromosome 4 open reading frame 1 C4orf1 Hs.270956AA057495 0.975227 EGF-containing fibulin-like extracellular matrix protein 1 EFEMP1 Hs.76224R23871 0.975227 Poly(rC) binding protein 1 PCBP1 Hs.2853R62318 0.975227 - - Hs.283402AA099489 0.975227 KIAA0111 gene product KIAA0111 Hs.79768R55942 0.975227 - - Hs.4267T91049 0.975227 - - -AA057033 0.975227 - - Hs.103388N90234 0.975227 Glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase) GCAT Hs.54609AA046006 0.975227 - - Hs.271541T85305 0.975227 - - -H63543 0.975227 FK506 binding protein 12-rapamycin associated protein 1 FRAP1 Hs.338207N30436 0.975227 - - Hs.11556H00173 0.975227 SH3-domain GRB2-like endophilin B2 SH3GLB2 Hs.30002AA148906 0.975227 Tumor rejection antigen (gp96) 1 TRA1 Hs.82689N71041 0.975227 RNA polymerase I 16 kDa subunit LOC51082 Hs.106127AA135745 0.975227 Calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma CAMK2G Hs.12436H52753 0.975227 - - Hs.21213AA055170 0.975227 - - Hs.265891W03011 0.975227 MSTP043 protein MSTP043 Hs.306881H15178 0.975227 - - Hs.352358H81783 0.975227 ESTs ESTs Hs.40290H58066 0.975227 HSPC037 protein LOC51659 Hs.108196AA054758 0.975227 - - -R71531 0.975227 Hypothetical protein FLJ32731 FLJ32731 Hs.380474AA036809 0.975227 - - Hs.188826AA032252 0.975227 - - -N59616 0.975227 Hypothetical protein FLJ11274 FLJ11274 Hs.18104R60395 0.975227 - - Hs.378718H79385 0.975227 Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B APOBEC3B Hs.226307H87262 0.975227 - - -W90073 0.975227 Sel-1 suppressor of lin-12-like (C. elegans) SEL1L Hs.181300T83097 0.975227 Hypothetical protein 384D8_6 384D8-2 Hs.180903N41539 0.975227 Sp1 transcription factor SP1 Hs.2021N20321 0.975227 Translocase of outer mitochondrial membrane 40 homolog (yeast) TOMM40 Hs.30928R88266 0.975227 Glutamate receptor, ionotropic, N-methyl D-aspartate 1 GRIN1 Hs.105T95573 0.975227 Nuclear antigen Sp100 SP100 Hs.77617H88577 0.975227 Heterogeneous nuclear ribonucleoprotein H1 (H) HNRPH1 Hs.245710AA099490 0.975227 Squamous cell carcinoma antigen recognised by T cells 3 SART3 Hs.116875AA036635 0.975227 - - Hs.168450N62464 0.975227 - - Hs.355530R05747 0.975227 Ust3 ust3 Hs.19102AA045083 0.975227 - - Hs.289047R06564 0.975227 Galactose-4-epimerase, UDP- GALE Hs.76057R52005 0.975227 Retinoblastoma-associated factor 600 RBAF600 Hs.297641T83467 0.975227 Inositol 1,4,5-trisphosphate 3-kinase B ITPKB Hs.78877H24050 0.975227 ESTs ESTs Hs.28039R50558 0.975227 Transposon-derived Buster1 transposase-like protein LOC58486 Hs.25726N95400 0.975227 DKFZP564G2022 protein DKFZP564G2022 Hs.16492T81946 0.975227 - - -H98717 0.975227 Small nuclear ribonucleoprotein polypeptide C SNRPC Hs.1063R92361 0.975227 ESTs ESTs Hs.34576R39774 0.975227 KIAA1698 protein KIAA1698 Hs.6259N48174 0.975227 KIAA0332 protein KIAA0332 Hs.7976N42484 0.991741 - - -H09083 0.991741 TNF receptor-associated factor 2 TRAF2 Hs.373508R77735 0.991741 Ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease) CLN2 Hs.20478N68686 0.991741 Hypothetical protein FLJ10486 FLJ10486 Hs.173946N95807 0.991741 Insulin-like growth factor binding protein 4 IGFBP4 Hs.1516H68528 0.991741 Hypothetical protein FLJ32499 FLJ32499 Hs.27475R64518 0.991741 - - Hs.16979H09104 0.991741 Syntrophin, alpha 1 (dystrophin-associated protein A1, 59kDa, acidic compone SNTA1 Hs.31121H67177 0.991741 - - -H12745 0.991741 Zinc finger protein 148 (pHZ-52) ZNF148 Hs.355866N28519 0.991741 Papillomavirus regulatory factor PRF-1 LOC55893 Hs.27410AA036953 0.991741 Growth arrest and DNA-damage-inducible, alpha GADD45A Hs.80409W33160 0.991741 Gene predicted from cDNA with a complete coding sequence KIAA0110 Hs.124AA034995 0.991741 ESTs ESTs Hs.293819H08451 0.991741 CDC-like kinase 1 CLK1 Hs.2083N68960 0.991741 Mitochondrial ribosomal protein L45 MRPL45 Hs.19347R18905 0.991741 Centaurin, delta 1 CENTD1 Hs.22572H05011 0.991741 - - -AA152298 0.991741 KIAA0800 gene product KIAA0800 Hs.118738W24084 0.991741 Major histocompatibility complex, class I, B HLA-B Hs.77961AA133959 0.991741 Brain-specific protein p25 alpha p25 Hs.29353W04797 0.991741 Dystrobrevin binding protein 1 DTNBP1 Hs.43481AA043736 0.991741 Actinin, alpha 1 ACTN1 Hs.119000N70615 0.991741 RAB40A, member RAS oncogene family RAB40A Hs.27453N36089 0.991741 Yes-associated protein 1, 65kDa YAP1 Hs.84520R38029 0.991741 Acidic (leucine-rich) nuclear phosphoprotein 32 family, member A ANP32A Hs.285013N35883 0.991741 Profilin 2 PFN2 Hs.91747AA025089 0.991741 Voltage-dependent anion channel 1 VDAC1 Hs.149155N75330 0.991741 Ac-like transposable element ALTE Hs.9933

W32182 0.991741 Hypothetical protein MGC2574 MGC2574 Hs.4253H38361 0.991741 Vacuolar protein sorting 16 (yeast) VPS16 Hs.302441H10461 0.991741 Tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2 TNKS2 Hs.280776T96990 0.991741 Ubiquitination factor E4B (UFD2 homolog, yeast) UBE4B Hs.24594H10415 0.991741 Likely ortholog of mouse Rw1 RW1 Hs.75912AA099896 0.991741 Hypothetical protein FLJ20604 FLJ20604 Hs.55781R25268 0.991741 Uracil-DNA glycosylase UNG Hs.78853N35011 0.991741 - - Hs.20797AA135928 0.991741 Frequenin homolog (Drosophila) FREQ Hs.301760W89053 0.991741 Hypothetical protein FLJ20343 FLJ20343 Hs.252692T84134 0.991741 Hydroxymethylbilane synthase HMBS Hs.82609N57515 0.991741 - - Hs.46627H66467 0.991741 F-box only protein 8 FBXO8 Hs.76917AA131590 0.991741 DiGeorge syndrome critical region gene 6-like DGCR6L Hs.347285R47739 0.991741 KIAA1332 protein KIAA1332 Hs.62767N58356 0.991741 HSPC009 protein HSPC009 Hs.16059R26339 0.991741 Adaptor-related protein complex 2, alpha 2 subunit AP2A2 Hs.19121AA047259 0.991741 Endometrial bleeding associated factor (left-right determination, factor A; transfEBAF Hs.25195H16888 0.991741 Protein-L-isoaspartate (D-aspartate) O-methyltransferase PCMT1 Hs.79137H90564 0.991741 - - Hs.41423AA047424 0.991741 - - -N20641 0.991741 Chromosome 5 open reading frame 5 C5orf5 Hs.82035N44758 0.991741 KIAA1036 protein KIAA1036 Hs.155182H97361 0.991741 - - Hs.36258H73053 0.991741 Von Hippel-Lindau syndrome VHL Hs.174007T90893 0.991741 Rab geranylgeranyltransferase, beta subunit RABGGTB Hs.78948H22702 0.991741 Hypothetical protein MGC10540 MGC10540 Hs.108824R44852 0.991741 ESTs ESTs Hs.3737AA010875 0.991741 Proteasome (prosome, macropain) subunit, alpha type, 1 PSMA1 Hs.82159AA069424 0.991741 ESTs ESTs Hs.20573R52816 0.991741 Reticulon 3 RTN3 Hs.252831H22871 0.991741 Peptidase D PEPD Hs.73947R00402 0.991741 - - Hs.380859N51951 0.991741 - - -R62469 0.991741 Cylindromatosis (turban tumor syndrome) CYLD Hs.18827H67560 0.991741 Chaperonin containing TCP1, subunit 8 (theta) CCT8 Hs.15071T48696 0.991741 Putative nuclear protein ORF1-FL49 ORF1-FL49 Hs.323512R19007 0.991741 Lysosomal apyrase-like protein 1 LALP1 Hs.22604N48306 0.991741 PC4 and SFRS1 interacting protein 2 PSIP2 Hs.82110H26130 0.991741 Hypothetical protein PRO1580 PRO1580 Hs.270863AA101713 0.991741 - - Hs.19215N74411 0.991741 Trophinin associated protein (tastin) TROAP Hs.171955R23635 0.991741 - - -AA142943 0.991741 Docking protein 1, 62kDa (downstream of tyrosine kinase 1) DOK1 Hs.103854N66548 0.991741 Stearoyl-CoA desaturase (delta-9-desaturase) SCD Hs.119597AA043774 0.991741 Programmed cell death 5 PDCD5 Hs.166468H22698 0.991741 General transcription factor IIB GTF2B Hs.258561AA054119 0.991741 - - Hs.31835AA069569 0.991741 Lecuine-rich acidic protein-like protein LANP-L Hs.71331

Supporting Table 5 - Genes Ranked within top 80 of SVMs in association with a BRAF mutation

*ID's of clones on chip were sequence verified by the manufacter and have been updated below.ID on Chip

Verified ID Assigned*

Verified GenBank Accession ID* Description Gene Symbol UniGene Cytoband Chromo- some

W88806 W88806 W88806 uroporphyrinogen III synthase (congenital erythropoietic porphyria) UROS Hs.75593 10q25.2-q26.3 10W46396 W46504 W46504 dihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex) DLAT Hs.157101 11q23.1 11R60317 R60374 R60374 dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate compleDLD Hs.74635 7q31-q32 7H78941 AL520209 AL520209 hypothetical protein MGC43399 MGC43399 Hs.7299 1p36.23 1N63044 AW968122 AW968122 poly (ADP-ribose) glycohydrolase PARG Hs.91390 10q11.23 10R52086 R52179 R52179 hypothetical protein FLJ31657 FLJ31657 Hs.409076 8q12.1 8H12076 H12076 H12076 dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate compleDLD Hs.74635 7q31-q32 7AA133960 AA134026 AA134026 ubiquitin-conjugating enzyme E2A (RAD6 homolog) UBE2A Hs.80612 Xq24-q25 23W42423 BG770889 BG770889 Rab11-family interacting protein 2 Rab11-FIP2 Hs.173656 10q26.12 10H08441 H08441 H08441 protein tyrosine phosphatase, receptor type, A PTPRA Hs.26045 20p13 20T83153 T83153 T83153 dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate compleDLD Hs.74635 7q31-q32 7N29673 N56629 N56629 hypoxia up-regulated 1 HYOU1 Hs.277704 11q23.1-q23.3 11W58034 W58034 unknown UnknownW42634 W42634 unknown UnknownT91050 T85912 T85912 KIAA1586 protein KIAA1586 Hs.391492 6p11.1 6N27557 N40375 N40375 proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 PSMD9 Hs.5648 12q24.31-q24.32 12N72115 W00390 W00390/N72115 cyclin-dependent kinase inhibitor 2C /Unknown CDKN2C/unkown Hs.4854/unkown 1p32/unknown 1/unknownR59224 BM707054-01 BM707054 fatty acid desaturase 1 FADS1 Hs.132898 11q12.2-q13.1 11R36627 AL553069 AL553069 putative protein similar to nessy (Drosophila) C3F Hs.300423 12p13 12T79604 BI670486 BI670486 fatty acid desaturase 1 FADS1 Hs.132898 11q12.2-q13.1 11AA001144 AA001144 AA001144 similar to RIKEN cDNA 5730528L13 gene MGC17337 Hs.78531 9q22.33 9AA033605 BM564823 BM564823 thioredoxin related protein MGC3178 Hs.409203 6p24.3 6AA102088 AA099340 AA099340 tripartite motif-containing 37 TRIM37 Hs.8164 17q22-q23 17R13127 R13127 R13127 suppressor of potassium transport defect 3 SKD3 Hs.21263 11q13.2 11N/A2 (N/A2)/T85663/AU123(N/A2)/T85663/AU123 Unknown/EST/dihydrolipoamide dehydrogenase (E3 component)/EST/EST/EST/integrin, alpha L /elongation factor-2 kinaseN53295 N53295 N53295 ribosomal protein L39-like RPL39L Hs.132748 3q27 3H90879 H90225 H90225 hypothetical protein MGC8974 MGC8974 Hs.40094 1p33-p32.1 1AA001333 AA001333 AA001333 FUS...CHOP [human, myxoid liposarcoma specimens, mRNA Partial Mutant, 3 genes, 652 nt] TRAP1 Hs.182366 16p12.3 16N73284 BG484990 BG484990 SEC22 vesicle trafficking protein-like 3 (S. cerevisiae) SEC22L3 Hs.12942 3p21.32 3R33452 R33553 R33553 protein O-fucosyltransferase 1 POFUT1 Hs.178292 20q11 20AA034917 AA034982 AA034982 Hermansky-Pudlak syndrome 1 HPS1 Hs.83951 10q23.1-q23.3 10N51855 BI256660/N51855 BI256660/N51855 ribosomal protein L32/ADP-ribosyltransferase (NAD+; poly(ADP-ribose) polymerase)-like 2 RPL32/ADPRTL2 Hs.169793/Hs.24284 3p25-p24/14q11.2-q1 3/14AA041401 AA041500 AA041500 ESTs, Moderately similar to hypothetical protein FLJ20378 [Homo sapiens] [H.sapiens] Hs.57967 1 1AA099636 AA099636 AA099636 KIAA1039 protein KIAA1039 Hs.394589 17p13.3 17H09315 H09374 H09374 proprotein convertase subtilisin/kexin type 7 PCSK7 Hs.32978 11q23-q24 11W87530 W87530 unknown Unknown 0R32855 R31353 R31353 glucosamine (N-acetyl)-6-sulfatase (Sanfilippo disease IIID) GNS Hs.393206 12q14 12N21289 N31224 N31224 melanoma cell adhesion molecule MCAM Hs.211579 11q23.3 11R80243 R80353 R80353 X-box binding protein 1 XBP1 Hs.149923 22q12.1 22N52744 N52744 N52744 HSPC043 protein HSPC043 Hs.356633 9q32 9AA101823 BM464072 BM464072/AA101823 claudin 12/Unknown CLDN12/unknown Hs.258576/unknown 7q21/unknown 7/unknownN63458 N63458 N63458 sialyltransferase 6 (N-acetyllacosaminide alpha 2,3-sialyltransferase) SIAT6 Hs.48793 1p34.1 1N64618 N79947 N79947 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast) BUB3 Hs.40323 10q26 10N66208 N99208 N99208 protein phosphatase 1, regulatory (inhibitor) subunit 8 PPP1R8 Hs.356590 1p35 1T96118 AL579290 AL579290 protein phosphatase 2, regulatory subunit B (B56), delta isoform PPP2R5D Hs.118244 6p21.1 6R54062 R54062 R54062 Crn, crooked neck-like 1 (Drosophila) CRNKL1 Hs.268281 20p11.2 20R35157 R35157 R35157 diacylglycerol kinase, delta 130kDa DGKD Hs.115907 2q37.1 2N20259 N20259/BM692643 N20259/BM692643 Unknown/ESTs, Weakly similar to pancreas-enriched phospholipase C [Homo sapiens] [H.sapiens]AA215407 AA215407 unknown UnknownAA029361 BM695433/AA029361 BM695433/AA029361 DNA methyltransferase 1-associated protein 1/Homo sapiens cDNA FLJ33489 fis, clone BRAMY2003585. DMAP1/EST Hs.8008/Hs.31841 1p34/unknown 1/unknownT80625 BM449526 BM449526 chromodomain protein, Y chromosome-like CDYL Hs.16081 6p25.1 6R55182 R55182 R55182 hypothetical protein DKFZp547C195 DKFZp547C195 Hs.374526 11 11H10318 H10318 H10318 HLA-B associated transcript 4 BAT4 Hs.247478 6p21.3 6R54777 R54777 R54777 Homo sapiens, Similar to transmembrane protein induced by tumor necrosis factor alpha, clone MGC:32944 IMAGE:5277668, mR Hs.374908 7 7H15871 H15871 H15871 nicotinamide nucleotide transhydrogenase NNT Hs.18136 5p13.1-5cen 5H20850 H20901 H20901 thioredoxin 2 TXN2 Hs.211929 22q13.1 22W31471 W31471 unknown UnknownR80802 R81004 R81004 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 KDELR1 Hs.78040 19q13.3 19W33047 W33047 W33047 Homo sapiens cDNA FLJ40810 fis, clone TRACH2009743. Hs.389265 1 1AA059311 BM969053 BM969053 protein tyrosine phosphatase type IVA, member 2 PTP4A2 Hs.82911 1p35 1T96379 T96463 T96463 protein phosphatase 2, regulatory subunit B (B56), delta isoform PPP2R5D Hs.118244 6p21.1 6W90083 BM541374 BM541374 peptidyl prolyl isomerase H (cyclophilin H) PPIH Hs.9880 1p34.1 1N36349 N36349 unknownN62816 BM750142 BM750142 Homo sapiens cDNA: FLJ22141 fis, clone HEP21327. Hs.391485T39460 T39460 T39460 protein phosphatase 1, catalytic subunit, alpha isoform PPP1CA Hs.183994 11q13 11AA135740 BQ009475 BQ009475 annexin A7 ANXA7 Hs.78637 10q21.1-q21.2 10R34632 AL708726 AL708726 sorting nexin 2 SNX2 Hs.11183 5q23 5W37210 W37210 W37210 3-hydroxyisobutyrate dehydrogenase HIBADH Hs.284170 7p15.1 7AA031913 AA032024 AA032024 hypothetical protein LOC123803 LOC123803 Hs.351573 16p13.11 16R06281 R06339 R06339 ubiquitin ligase E3 alpha-II KIAA0349 Hs.15303 6p21.1 6N79912 N79912 unknownR25789 R25789 R25789 RAB2, member RAS oncogene family-like RAB2L Hs.170160 6p21.3 6W15337 W63762 W63762 COX15 homolog, cytochrome c oxidase assembly protein (yeast) COX15 Hs.226581 10q24 10AA033545 AA033545 AA033545/BG548895/ Unkkown/tumor necrosis factor receptor superfamily, member 6/Homo sapiens cDNA FLJ32248 fis, clone PROST1000123. unknown/Hs.82359/Hunknown/10q24.1/18 unknown/10/18W03395 W03395 W03395 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 ELOVL1 Hs.25597 1p34.1 1AA099341 AA099341 AA099341 golgi-specific brefeldin A resistance factor 1 GBF1 Hs.155499 10q24 10R49336 R35700 R35700 SKI-interacting protein SNW1 Hs.79008 14q24.3 14H49981 H50023 H50023 hypothetical protein LOC90624 LOC90624 Hs.391468 5q31.1 5R61759 R61759 R61759 Homo sapiens clone FBD3 Cri-du-chat critical region mRNA Hs.409167 5 5N59182 N59182/N75919 N59182/N75919 Unknown/Homo sapiens cDNA FLJ10705 fis, clone NT2RP3000850. unknown/PCYT1A unknown/Hs.273558 unknown/3q29 unknown/3R07295 R07295 unknown UnkownAA121306 AA121306 AA121306/BQ072893 unknown/KDEL endoplasmic reticulum protein retention receptor 1 unknown/KDELR1 unknown/Hs.78040 unknown/19q13.3 unknown/19R80585 R80585 R80585 CD2-associated protein CD2AP Hs.374340 6p12 6

Supporting Table 6a - PTPRA -Quantitative RT-PCR dataPTPRA: Protein tyrosine phosphatase, receptor type, A

PTPRA qRT-PCR vs. microarray expression data

NameqRT-PCR PTPRA / GAPDH

Array PTPRA / GAPDH

Ratio qRT-PCR /

arrayA07 0.24 0.67 0.35A11 1.06 0.61 1.74CJM 0.75 0.57 1.32D04 0.84 0.76 1.10D08 0.79 0.65 1.21D10 0.36 0.16 2.20D11 1.17 1.26 0.93D24 1.57 1.33 1.18Me1007 1.49 1.23 1.21Me4405 1.81 1.22 1.49Mel-FH 0.82 1.32 0.62Mel-RM 0.83 1.08 0.77MM127 1.20 0.94 1.28MM329 1.00 0.89 1.13MM415 0.77 0.63 1.23MM485 0.43 0.74 0.59RPMI7932 2.13 0.80 2.67A02 0.21 2.34 0.09A05 0.35 1.21 0.29A15 0.99 0.50 1.98A2058 0.42 1.41 0.30BL 0.37 1.12 0.33C32 0.58 0.96 0.60COLOF 2.03 0.95 2.15D05 3.91 1.46 2.67D14 1.82 0.83 2.18D17 1.51 1.29 1.18D20 2.02 1.28 1.58D23 1.32 1.06 1.25D25 1.96 1.17 1.67HT144 0.82 0.44 1.84JA 0.67 0.94 0.71Me10538 1.10 0.81 1.35Me1402 0.91 0.81 1.13Mel-RMU 0.77 1.45 0.53MM170 2.08 1.75 1.19MM200 2.15 0.98 2.18MM229 2.72 2.30 1.18MM253 1.49 1.14 1.31MM370 0.84 0.82 1.03MM383 1.43 0.66 2.18MM386 0.70 0.71 0.98MM426 0.38 0.42 0.90MM455 1.58 1.10 1.43MM466 0.83 1.31 0.64MM470 1.67 1.43 1.17MM472 0.84 0.83 1.02MM473 2.38 1.50 1.59MM537 1.24 0.63 1.96MM540 0.55 0.82 0.68MM595 0.67 0.93 0.73MM603 1.30 0.96 1.36MM608 0.74 0.64 1.15MM622 2.92 2.19 1.33MM629 1.12 1.18 0.95MM648 1.29 1.75 0.74MM649 0.80 1.92 0.42MM96L 0.87 1.27 0.68SkMel13 1.33 1.57 0.85WSB 1.52 1.44 1.06WW 0.55 1.05 0.52

WT BRAFMutant BRAF

Supporting Table 6b - RAB2L -Quantitative RT-PCR dataRAB2L: RAB2, member RAS oncogene family-like

RAB2L qRT-PCR vs. microarray expression data

NameqRT-PCR RAB2L / GAPDH

Array RAB2L / GAPDH

Ratio qRT-PCR / array

A07 0.22 2.20 0.10A11 1.46 1.10 1.33CJM 0.93 1.00 0.94D04 1.52 2.20 0.69D08 3.02 1.35 2.23D10 0.88 1.06 0.82D11 2.02 1.62 1.25D24 1.66 1.67 0.99Me1007 1.72 2.00 0.86Me4405 3.62 1.48 2.45Mel-FH 1.21 1.68 0.72Mel-RM 0.99 1.00 0.99MM127 1.37 1.27 1.07MM329 1.00 0.94 1.07MM415 0.72 0.99 0.72MM485 0.58 1.59 0.37RPMI7932 2.44 1.32 1.85A02 0.20 2.62 0.08A05 0.25 2.00 0.13A15 1.70 1.24 1.38A2058 0.16 2.10 0.07BL 0.15 1.65 0.09C32 0.66 1.44 0.46COLOF 3.32 1.43 2.32D05 6.92 1.86 3.72D14 3.64 1.39 2.62D17 2.75 1.61 1.71D20 2.84 1.77 1.60D23 3.35 2.58 1.30D25 2.76 1.77 1.56HT144 1.31 1.17 1.12JA 0.78 1.11 0.70Me10538 1.04 0.92 1.14Me1402 1.43 1.44 1.00Mel-RMU 0.72 0.97 0.75MM170 1.71 1.66 1.03MM200 1.54 0.62 2.50MM229 3.44 2.59 1.33MM253 3.51 2.27 1.54MM370 0.87 1.24 0.70MM383 1.23 0.71 1.73MM386 1.97 1.85 1.07MM426 1.57 2.06 0.77MM455 1.93 2.21 0.87MM466 1.13 3.50 0.32MM470 2.24 1.57 1.43MM472 1.30 1.44 0.91MM473 2.70 2.01 1.35MM537 1.38 1.29 1.07MM540 0.85 1.96 0.43MM595 1.72 3.14 0.55MM603 1.08 1.04 1.04MM608 0.99 1.11 0.89MM622 3.16 2.33 1.36MM629 1.09 1.59 0.69MM648 1.39 2.12 0.66MM649 1.17 2.15 0.54MM96L 1.28 1.37 0.94SkMel13 0.86 0.60 1.43WSB 1.12 1.93 0.58WW 0.43 1.06 0.40

WT BRAFMutant BRAF

Supporting Table 6c - ANXA7 -Quantitative qRT-PCR dataANXA7: Annexin A7

ANXA7 qRT-PCR vs. array expression data

NameqRT-PCR ANXA7 / GAPDH

Array ANXA7 / GAPDH

Ratio qRT-PCR /

arrayA07 0.32 0.79 0.40A11 1.22 0.83 1.47CJM 1.65 1.85 0.89D04 0.83 0.82 1.00D08 1.25 1.27 0.99D10 0.95 1.55 0.61D11 1.51 0.98 1.54D24 3.47 2.36 1.47Me1007 2.05 2.09 0.98Me4405 2.15 1.99 1.08Mel-FH 1.36 1.80 0.76Mel-RM 1.13 1.35 0.84MM127 1.87 1.67 1.12MM329 1.00 0.88 1.14MM415 1.81 0.93 1.94MM485 0.58 0.87 0.67RPMI7932 3.28 1.05 3.13A02 0.52 1.50 0.34A05 0.91 1.23 0.74A15 1.87 1.41 1.33A2058 0.55 1.46 0.38BL 0.38 1.04 0.37C32 0.74 1.02 0.72COLOF 4.06 0.96 4.24D05 1.24 0.51 2.44D14 2.08 0.81 2.56D17 1.32 0.75 1.76D20 1.80 1.00 1.81D23 2.55 1.82 1.40D25 1.12 0.61 1.84HT144 1.06 0.65 1.63JA 1.48 1.64 0.90Me10538 1.07 0.67 1.58Me1402 0.94 0.84 1.12Mel-RMU 0.91 1.21 0.75MM170 0.96 1.02 0.94MM200 0.96 0.33 2.88MM229 1.98 1.12 1.76MM253 0.50 0.85 0.59MM370 0.60 0.66 0.91MM383 0.90 0.68 1.33MM386 1.00 1.09 0.92MM426 1.51 1.45 1.04MM455 1.22 0.68 1.78MM466 0.78 1.39 0.56MM470 1.39 0.71 1.95MM472 1.34 1.48 0.91MM473 1.55 1.25 1.25MM537 1.39 0.61 2.28MM540 0.59 0.73 0.82MM595 0.92 1.21 0.76MM603 0.71 0.59 1.20MM608 1.04 0.79 1.31MM622 1.74 0.97 1.80MM629 0.69 0.83 0.84MM648 0.44 0.45 0.99MM649 0.72 0.92 0.78MM96L 1.71 1.16 1.47SkMel13 1.18 1.19 0.99WSB 0.71 0.70 1.02WW 0.39 0.77 0.51

WT BRAFMutant BRAF

Supporting Table 6d - CD2AP -Quantitative RT-PCR dataCD2AP: CD2-associated protein

CD2AP qRT-PCR vs. microarray expression data

NameqRT-PCR CD2AP / GAPDH

Array CD2AP / GAPDH

Ratio qRT-PCR /

arrayA07 1.70 0.73 2.33A11 2.03 0.92 2.20CJM 1.01 0.84 1.21D04 1.44 0.93 1.55D08 1.14 0.67 1.70D10 1.06 1.91 0.55D11 1.67 0.76 2.20D24 1.83 0.71 2.58Me1007 1.23 0.83 1.47Me4405 7.28 0.47 15.34Mel-FH 1.51 1.04 1.44Mel-RM 0.88 0.89 0.99MM127 1.94 1.33 1.47MM415 1.38 0.92 1.50MM485 0.43 0.99 0.44RPMI7932 2.11 0.81 2.62MM329 1.00 0.86 1.17A15 1.92 0.91 2.10A05 0.83 0.78 1.06A2058 1.10 0.98 1.12C-32 0.70 1.00 0.70D05 5.43 1.51 3.60Me10538 2.41 0.89 2.70MM200 3.09 0.56 5.53MM455 1.99 1.16 1.71MM472 1.22 1.21 1.01MM473 1.74 1.26 1.39MM595 3.64 2.41 1.51MM603 2.20 1.47 1.50MM608 1.20 0.47 2.58MM629 0.69 0.73 0.95MM648 1.87 1.02 1.83MM649 1.02 1.00 1.02MM96L 1.78 1.08 1.64

WT BRAFMutant BRAF

Supporting Table 6e - DLAT -Quantitative RT-PCR dataDLAT: Dihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex)

DLAT array vs qRT-PCR expression data

NameqRT-PCR

DLAT / GAPDH

Array DLAT / GAPDH

Ratio qRT-PCR /

arrayA07 0.43 1.81 0.24A11 1.03 1.21 0.85CJM 0.85 1.25 0.68D04 0.65 2.10 0.31D08 0.26 0.55 0.46D10 0.35 0.65 0.53D11 0.82 1.58 0.52D24 1.43 1.16 1.24Me1007 0.74 1.51 0.49Me4405 2.44 1.27 1.92Mel-FH 1.64 1.53 1.07Mel-RM 1.21 1.53 0.79MM127 1.90 1.08 1.76MM415 0.65 1.36 0.48MM485 0.51 1.42 0.36RPMI7932 1.66 1.38 1.20MM329 1.00 1.01 0.99A15 0.78 1.65 0.47A05 1.29 1.76 0.73BL 0.51 1.09 0.47D05 2.68 2.46 1.09D17 1.36 2.32 0.59HT144 0.83 1.15 0.73JA 2.29 1.57 1.46MM170 1.57 1.96 0.80MM253 0.70 1.69 0.42MM370 1.70 1.48 1.15MM455 1.70 1.10 1.55MM470 7.18 1.08 6.62MM473 3.54 2.35 1.51MM603 2.67 1.25 2.14MM622 0.88 1.67 0.53MM629 1.73 2.61 0.66

WT BRAFMutant BRAF

Supporting Table 6f - DLD -Quantitative RT-PCR dataDLD: Dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex,

2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex)DLD array vs. qRT-PCR expression data

NameqRT-PCR

DLD / GAPDH

Array DLD /

GAPDH

Ratio qRT-PCR /

GAPDHA07 0.20 0.80 0.25A11 2.21 1.45 1.53CJM 1.05 1.07 0.98D04 1.00 0.82 1.21D08 1.31 0.50 2.62D10 0.26 0.33 0.81D11 1.77 1.28 1.38D24 2.88 1.51 1.90Me1007 1.61 1.17 1.37Me4405 1.44 0.83 1.74Mel-FH 0.99 1.49 0.66Mel-RM 1.15 1.36 0.85MM127 0.76 0.79 0.96MM415 0.94 0.80 1.17MM485 0.38 0.68 0.56RPMI7932 2.69 1.21 2.22MM329 1.00 0.89 1.13A2058 0.27 1.39 0.20BL 0.24 1.34 0.18C32 1.12 2.04 0.55D05 3.33 1.24 2.68D20 2.21 1.09 2.03HT144 1.00 0.64 1.56JA 1.86 1.75 1.06Mel-RMU 0.47 0.59 0.81MM386 1.53 1.40 1.10MM426 1.51 1.21 1.25MM466 2.27 2.07 1.10MM472 1.64 1.58 1.03MM622 1.66 1.10 1.50MM649 3.04 3.35 0.91MM96L 1.98 1.76 1.13WSB 1.71 1.39 1.23WW 1.20 1.91 0.63

WT BRAFMutant BRAF

Supporting Table 6g - MCAM -Quantitative RT-PCR dataMCAM: Melanoma cell adhesion molecule

MCAM array vs. real time expression data

NameqRT-PCR MCAM / GAPDH

Array MCAM / GAPDH

Ratio qRT-PCR /

arrayA07 0.11 0.44 0.25A11 0.04 0.05 0.78CJM 0.04 0.10 0.39D04 0.49 0.66 0.74D08 0.30 0.09 3.31D10 0.08 0.02 3.90D11 0.42 1.13 0.38D24 0.17 0.23 0.73Me1007 0.03 0.05 0.61Me4405 0.37 0.02 18.18Mel-FH 0.86 1.69 0.51Mel-RM 0.42 0.12 3.36MM127 0.26 0.40 0.65MM415 0.42 0.50 0.83MM485 0.52 0.29 1.76MM329 1.00 0.74 1.35RPMI7932 1.52 0.32 4.73A02 0.21 1.22 0.17C-32 0.28 0.29 0.97D14 1.52 0.60 2.54D25 0.85 0.60 1.41HT144 0.36 0.12 3.00Me10538 2.83 1.65 1.72Me1402 2.69 1.67 1.61MM200 0.25 0.26 0.95MM253 0.10 0.41 0.25MM370 0.20 0.76 0.26MM470 2.34 1.62 1.44MM473 0.83 1.33 0.62MM537 0.22 0.26 0.82MM608 0.97 0.67 1.45MM629 0.52 1.42 0.37WSB 0.69 0.78 0.89MM229 1.98 0.96 2.06

WT BRAFMutant BRAF

Supporting Table 6h - BUB3 -Quantitative RT-PCR dataBUB3: BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast)

BUB3 qRT-PCR vs. array expression data

NameqRT-PCR

BUB3 / GAPDH

Array BUB3 / GAPDH

Ratio qRT-PCR /

arrayMel-RM 1.02 1.12 0.91Me1007 1.12 1.54 0.73D11 1.28 1.11 1.15Me4405 2.42 1.41 1.72MM485 0.61 1.38 0.44A11 1.21 0.93 1.31D24 2.18 1.19 1.83RPMI7932 2.66 1.34 1.98A07 0.61 0.88 0.69D10 0.56 1.30 0.43MM540 0.43 0.97 0.44Me10538 0.96 0.90 1.06A05 0.88 0.85 1.04A02 0.43 0.95 0.46SkMel13 1.05 1.05 1.00MM96L 1.03 1.07 0.96D20 1.17 0.95 1.24MM648 0.20 0.25 0.78MM229 0.94 0.82 1.15D23 1.46 1.04 1.41

WT BRAFMutant BRAF

Supporting Table 6i - Rab11-FIP2 -Quantitative RT-PCR dataRab11-FIP2 : Rab11-family interacting protein 2

Rab11 array vs real time expression data

NameqRT-PCR RAB11 / GAPDH

Array RAB11 / GAPDH

Ratio qRT-PCR /

arrayA11 1.76 0.69 2.55D04 2.07 1.19 1.75D11 1.36 0.78 1.74D24 1.89 1.28 1.48Me1007 1.40 0.72 1.96Mel-RM 0.73 0.68 1.07MM329 1.00 1.36 0.74MM415 0.96 0.77 1.24MM485 2.58 0.93 2.78RPMI7932 1.72 0.74 2.34A15 0.93 0.88 1.05C32 1.60 1.14 1.40COLOF 1.02 0.62 1.64D20 0.61 0.26 2.35ME1402 1.28 0.42 3.07MM426 1.13 1.00 1.13MM470 0.99 0.45 2.21MM537 0.34 0.24 1.41SkMel13 0.85 1.00 0.85WW 0.17 0.39 0.43

WT BRAFMutant BRAF

Figure 1 – ROC Curve for BRAF Prediciton

The ROC curve area was used as a measure of the prediction performance on samples not used to train the SVMs, obtaining an area of 82%.