Supporting InformationDutt et al. 10.1073/pnas.0803379105

Fig. S1. Heat map of endometrial carcinoma samples with mutations from discovery sequencing experiment. The number of mutations in sample 288T (25mutations in 18 genes) established this sample as a hypermutated outlyer, so it was removed from subsequent analyses. Incidence of genes known to be mutatedin endometrial carcinoma was obtained from the COSMIC database (www.sanger.ac.uk/genetics/CGP/cosmic). No statistically significant co-occurrences betweenFGFR2 mutations and mutations in known cancer genes were observed.

Dutt et al. www.pnas.org/cgi/content/short/0803379105 1 of 8

Fig. S2. Sequencing chromatograms and genotyping spectra for the two heterozygous somatic FGFR2 S252W mutations found in the discovery experiment.The reverse complement of reverse sequencing reads is displayed by Mutation Surveyor. (A) Chromatogram for tumor sample 63T; heterozygous mutation isindicated with an arrow for forward and reverse sequence reactions. (B and C) Sequenom genotyping spectra for tumor sample 63T and its matched normalsample. Two different alleles, identified by yellow lines and marked by arrows, are present in the tumor sample, but the normal sample is homozygous WT asshown by the single peak marked with an arrow. (D) Chromatogram for tumor sample 201T; heterozygous mutation is indicated with an arrow for forward andreverse sequence reactions. (E and F) Sequenom genotyping spectra for tumor sample 201T and its matched normal sample. Two different alleles, identified byyellow lines and marked by arrows, are present in the tumor sample, but the normal sample is homozygous WT as shown by the single peak marked with anarrow.

Dutt et al. www.pnas.org/cgi/content/short/0803379105 2 of 8

Fig. S3. Anti-phospho-FRS2 immunoblot of lysate from NIH 3T3 cells expression wild-type (wt) FGFR2, empty vector (pBp), or S252W FGFR2. (Upper) Cells weretreated with 2 �M PD173074 for 40 min and/or 30 ng/ml FGF7 for 20 min as indicated. Lanes 1 and 7 demonstrate elevated basal phosphorylation of FRS2 in NIH3T3 cells expressing FGFR2 S252W compared with NIH 3T3 cells expressing WT FGFR2. Treatment with PD173074 dramatically reduces FRS2 phosphorylationinduced by expression of FGFR2 S252W. (Lower) Anti-FRS2 immunoblot used as a loading control.

Dutt et al. www.pnas.org/cgi/content/short/0803379105 3 of 8

Fig. S4. Knockdown of FGFR2 inhibits proliferation of endometrial carcinoma cell lines. (A) shRNA constructs used to knock down FGFR2 expression werepackaged into lentivirus and used to infect MFE-280, MFE296, and AN3CA. Anti-FGFR2 immunoblot shows that hairpins 1 and 4 efficiently knock downendogenous FGFR2 expression. Actin is included as a loading control. NI, no infection. shGFP, control hairpin specific for green fluorescent protein used as anegative control. (B and C) WST survival assay for AN3CA and MFE-296 infected with the hairpin specific for GFP or FGFR2 shRNA 1 or 4. Results are normalizedto those from uninfected cells.

Dutt et al. www.pnas.org/cgi/content/short/0803379105 4 of 8

Table S1. Validated somatic mutations identified in a putative hypermutated endometrialcarcinoma sample

Sample ID Sample Gene Nucleotide change Somatic mutation

S005159 288T1 AKT2 G3GA D399NS005159 288T1 BMX A3AC E56DS005159 288T1 BMX C3CT R670WS005159 288T1 BMX T3GT V550GS005159 288T1 BTK G3TG K296NS005159 288T1 CSF1R G3TG G161VS005159 288T1 CTNNB1 C3AC F293LS005159 288T1 EPHA4 C3TC R230*S005159 288T1 ERBB4 G3TG E100DS005159 288T1 ESR2 T3TC Y226HS005159 288T1 FRK A3CA E392AS005159 288T1 FRK G3GA R179QS005159 288T1 ITK A3AC K138TS005159 288T1 JAK2 G3GT E386*S005159 288T1 JAK2 G3GT Q262HS005159 288T1 MET C3AC F261LS005159 288T1 MUSK G3GT E601*S005159 288T1 NF1 C3AC A2099DS005159 288T1 NTRK3 G3GA A664TS005159 288T1 NTRK3 G3TG E357DS005159 288T1 PTEN G3GT D24YS005159 288T1 PTEN T3GT F341VS005159 288T1 PTEN G3AG R130QS005159 288T1 SRC G3GT G291VS005159 288T1 TYK2 C3TC R265W

All mutations were confirmed by genotyping. This sample was removed from the analyses reported herebecause of its putative hypermutated status.

Dutt et al. www.pnas.org/cgi/content/short/0803379105 5 of 8

Table S2. Validated somatic mutations identified in 39 nonhypermutated endometrialcarcinoma samples

Sample ID Sample Gene Nucleotide change Somatic mutation

S005130 192T AKT3 A3CA E438DS005130 192T APC C3CT R1450*S005162 63T APC C3CT S1842LS005169 113T BMX C3CT R670WS005122 185T CSF1R T3TG V32GS005158 159T CTNNB1 G3GT D32YS005097 441T CTNNB1 G3AG G34ES005130 192T CTNNB1 C3CT R486CS005141 4T CTNNB1 C3CG S37CS005103 172T CTNNB1 C3CT S37FS005096 426T1 CTNNB1 C3AC S37YS005162 63T CTNNB1 C3CT T41IS005118 293T EPHA4 G3GA D867NS005130 192T ESR2 G3GA E211KS005130 192T FBXW7 A3TA K164*S005138 256T FES G3CG L525FS005162 63T FGFR2 C3GC S252WS005116 201T FGFR2 C3GC S252WS005097 441T IGF1R C3CT R895WS005130 192T JAK2 A3AC Q764HS005105 111T KRAS C3CA A59ES005128 48T KRAS G3TG G12CS005169 113T KRAS G3TG G12CS005158 159T KRAS G3GA G12DS005174 436T KRAS G3GA G13DS005097 441T MET C3CT T1293IS005166 456T MST1R A3TA K621MS005128 48T MUSK G3A G107ES005163 67T MUSK A3AG S159GS005097 441T NTRK2 G3GT K566NS005138 256T PIK3CA A3AG E545GS005102 206T PIK3CA G3AG E545KS005116 201T PIK3CA C3AC Q546KS005108 75T PIK3CA C3AC Q546KS005130 192T PIK3CA G3AG R88QS005101 334T PIK3CA G3AG R88QS005103 172T PIK3CA A3AG T1025AS005167 78T PIK3CA G3AG R88QS005150 430T PIK3CA G3AG R88QS005166 456T PTEN G3AG A126TS005105 111T PTEN G3GT E73*S005166 456T PTEN G3AG G36ES005167 78T PTEN T3GT L139*S005126 202T PTEN T3G M134RS005138 256T PTEN C3CT R130*S005156 141T PTEN C3CT R130*S005141 4T PTEN C3CT R130*S005150 430T PTEN C3CG R130GS005128 48T PTEN C3CG R130GS005116 201T PTEN C3CG R130GS005169 113T PTEN C3CG R130GS005158 159T PTEN C3CG R130GS005105 111T PTEN C3CG R130GS005130 192T PTEN G3AG R130QS005163 67T PTEN G3AG R130QS005163 67T PTEN C3CT R173CS005103 172T PTEN G3AG R55RS005101 334T PTK2B G3GT R128MS005169 113T ROR1 G3AG V132MS005102 206T ROS1 T3TC S551PS005155 138T TP53 A3GA H179RS005133 51T TP53 T3TC L330PS005101 334T VHL G � A nt 463 � 1 P154fsS005167 78T VHL del A Q73fsS005118 293T VHL del GCGG R58fsS005133 51T VHL del G W88sp

All mutations found in the endometrial carcinoma discovery experiment were confirmed by mass spectrometricgenotyping. Inferred amino acid changes are listed in the last column. * indicates nonsense mutation. fs,frameshift introduced at indicated amino acid. sp, splice site mutation.

Dutt et al. www.pnas.org/cgi/content/short/0803379105 6 of 8

Table S3. FGFR2 mutations found in endometrial carcinoma, cervical carcinoma, and lung squamous cell carcinoma

MutationNucleotide

change SampleCancertype

Tissuesource

Histologicsubtype Grade Stage Status

Transforms3T3 cellsin vitro? Description

D101Y 301G3GT 31T END POP Endometrial Primary Endometrioid 2 IC Somatic Yes Novel mutationS252W 755C3CG SK7 Endometrial Primary Endometrioid 2 IB Somatic Yes Associated with Apert

syndromeS252W 755C3G MFE-280 Endometrial Cell line Yes Associated with Apert

syndromeS252W 755C3CG 306T NEEDLE Endometrial Primary Endometrioid 1 2A Somatic Yes Associated with Apert

syndromeS252W 755C3CG MFE-319 Endometrial Cell line Yes Associated with Apert

syndromeS252W 755C3CG 63T Endometrial Primary Endometrioid 1 IB Somatic Yes Associated with Apert

syndromeS252W 755C3CG 201T Endometrial Primary Endometrioid 1 IA Somatic Yes Associated with Apert

syndromeP253R 758C3CG 75T Endometrial Primary Endometrioid 2 4A Somatic Yes Associated with Apert

syndromeP253R 758C3CG 141T Endometrial Primary Endometrioid 1 IB Somatic Yes Associated with Apert

syndromeK310R 929A3AG AN3 CA Endometrial Cell line No Novel mutation in the

linker regionbeteween IgII andIgIII

A314D 941C3A 446T END POP Endometrial Primary Serous papillary 3 4B ND Novel allele of amutation associatedwith Pfeiffersyndrome (1)

A389T 1169G3AG SK11 Endometrial Primary Endometrioid 3 IB No Novel mutation in thepredictedtransmembranedomain

N549K 1647T3G AN3 CA Endometrial Cell line Yes Novel allele of amutation associatedwith Crouzonsyndrome (2)

N549K 1647T3G MFE-296 Endometrial Cell line Yes Novel allele of amutation associatedwith Crouzonsyndrome

C382R 1144T3C 130T END POP Endometrial Primary Clear cell 3 1C Yes Novel mutationK659N 1977G3T 43T END POP Endometrial Primary Endometrioid 2 IC ND Novel mutationA97T 289G3GA HSCX1007T Cervical Primary Squamous cell 1B N� Somatic ND Novel mutationK659M 1976A3AT 252T Cervical Primary Squamous cell 3 2A N0 ND Novel mutationN211I 632A3T 20723 Lung Primary Squamous cell 4 Somatic ND Novel mutationW290C 870G3C 24453 Lung Primary Squamous cell 4 Somatic ND Novel allele of a

mutation associatedwith Crouzonsyndrome (3)

Grade and stage information is listed where known (FIGO stage is used for endometrial carcinoma samples). Somatic status is listed if a normal sample wasavailable and successfully sequenced and/or genotyped. NIH-3T3 transformation was assessed by soft agar colony formation assays as in Fig. 2. ND, not tested.1. Schell U, et al. (1995) Mutations in FGFR1 and FGFR2 cause familial and sporadic Pfeiffer syndrome. Hum Mol Genet 4:323–328.2. Fano V, et al. (2005) High specificity of head circumference to recognize N540K mutation in hypochondroplasia. Ann Hum Biol 32:782–788.3. Oldridge M, et al. (1995) Mutations in the third immunoglobulin domain of the fibroblast growth factor receptor-2 gene in Crouzon syndrome. Hum Mol Genet6:1077–1082.

Dutt et al. www.pnas.org/cgi/content/short/0803379105 7 of 8

Table S4. List of FGFR2 sequencing primers

Amplicon name Exon no. Forward primer Reverse primer

NM�000141.2FGFR2�e02�a001�0–85 2 ctctcgggcactggataaag acttgggctggagtgatttgFGFR2�e03�a002�0–100 3 ttaatgatcggcctttctgg tccagatacttcctgacttcctgFGFR2�e04�a001�0�100 4 acgaatgaccagtgacacga ccccgcatactgaaaggttaFGFR2�e05�a003�0–100 5 gagatggaggttgcagtgaa gccagctggattagacttctgFGFR2�e06�a001�0–100 6 ttggggaaatgatgcttctc acactgccgaatactcctgcFGFR2�e08�a001�0�100 7 gcgatctcagggctgataaa acagccaataacctgggatgFGFR2�e12�a001�0�100 8 ttaagagaaagggggatggg tcagtgttgctccgtgtctcFGFR2�e14�a001�0–100 9 ctttcttgcccttggaactg aaatgtggcctcatagcctgFGFR2�e15�a001�0�100 10 ggagtctgaattgcccagac ggactgtctgcatgtcctcaFGFR2�e16�a001�0�100 11 ttcgttccctccaaaaacac agccgttccaccagtaattgFGFR2�e17�a001�0�100 12 aatccaaagtcacctgcacc gcaccatgaagtttggtgtgFGFR2�e18�a002�0–100 13 agcaaatgagcatgtccaaa gcatgggttgtaataactaaaaatgtFGFR2�e19�a001�0�100 14 aaaatcctagcggttgctga ggactacaggtgcacaccacFGFR2�e20�a001�0�100 15 tggcgaattagataaccgct tcagcaaccgctaggattttFGFR2�e21�a001�0�100 16 ctagcttgtttcctgacccg atccccgtgtcatcatcattFGFR2�e22�a001�0�100 17 ccaccagcagctacactgaa ctttagggtgtgacgccattFGFR2�e24�cds�a001�0–100 18 tccactgctccagaaacctt gcccagcacctatagctcaa

NM�022969.1FGFR2�e09�a001�0–100 9 agctgcatcaccgaagaaag caggtctttccgttgtccac

Exons are numbered relative to NM�000141.2 (FGFR2 IIIc) except FGFR2�e09�a001�0–100 is numbered relative to NM�022969.1 (FGFR2 IIIb). NM�022969.1 hasbeen recently replaced by NM�022970 in the National Center for Biotechnology Information database.

Dutt et al. www.pnas.org/cgi/content/short/0803379105 8 of 8