Supporting Information - PNAS · Vapor diffusion experiments in MRC crystallization plates with 200...
8
Supporting Information Aylett et al. 10.1073/pnas.1010176107 SI Materials and Methods. General Sources. All chemicals were provided by Sigma Aldrich, restriction enzymes by New England Biolabs, and chromato- graphy equipment by GE Healthcare except where otherwise stipulated. All PCR was carried out using DNA polymerase from Thermococcus kodakaraensis (Novagen), site directed muta- genesis using the QuikChange system (Stratagene), and restric- tion-free cloning using InFusion enzyme (Clontech). Molecular graphics were generated using PyMol (Schrödinger). Expression Vectors. The Bacillus thuringiensis serovar israelensis TubZ gene [American Type Culture Collection (ATCC) 35646, UniProt Q8KNP3] was a kind gift of R. A. Larsen and J. Pogliano (University of California San Diego). It was provided cloned between the NcoI and HindIII sites of pET28a (Novagen). This construct (TubZL2VH 6 ) included the mutation L2V, providing the NcoI restriction site, and a C-terminal hexahistidine tag. In- itial crystal trials with full-length protein and limited proteolysis were carried out using this construct. TubZ1-421 was generated using site directed mutagenesis to truncate TubZL2VH 6 . The primer GGACGAAGAAAAAGTA- GATATTTCTTTTGCAACATAATAAAATCGTGTTCAAAAA- AACACATTCAATCCTTATAATAAAAACC and its comple- ment insert two stop codons after residue 421. Most crystallogra- phy was carried out using this construct, and both structures have this sequence. A C-terminally hexahistidine tagged construct of TubZ1-421 was generated in the same manner, with the primer GGACGAAGAAAAAGTAGATATTTCTTTTGCAACAGGT- CATCATCATCATCATCATTAATAAAATCGTGTTCAAAAA- AACACATTCAATCCTTATAATAAAAACC and its comple- ment. This construct was used for expression of selenomethio- nine-substituted protein to solve the crystal structure due to low yields of derivatized TubZ1-421. The wild-type TubZ sequence without L2V but with a hexahis- tidine tag was generated by site directed mutagenesis using the primer GAATAATTTTGTTTAACTTTAAGAAGGAGATATA- CCATGTTATTAAACAGTAATGAACTAGAACATATCCATTC and its complement to mutate valine 2 to leucine from TubZL2 VH 6 . The hexahistidine tag was retained to select for the full length of the labile C terminus. This construct was used for in vitro electron microscopy. The thioredoxin N-terminal fusion was produced by using PCR cloning to insert a PCR product of thioredoxin at the N terminus of TubZ. The thioredoxin insert was generated using primers CCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAG- ATATACCATGAGCGATAAAATTATTCACCTGACTGACG and GTTGAATGGATATGTTCTAGTTCATTACTGTTTAA- TAACATGGCCAGGTTAGCGTCGAGGAACTCTTTC and pET32a (Novagen) as the template. This was inserted at the NcoI site of TubZL2VH 6 . This construct was used for in vitro electron microscopy. The C-terminal GFP fusion was generated by producing a full-length TubZ insert with primers GGGCTAGCAGGAG- GAATTCACCATGTTATTAAACAGTAATGAACT and CCC- TCGAGACGTTTTTTAAATGGATTTGAAGTTand then PCR cloning into vector pBAD24 between NheI and XhoI sites. GFPmut2 (1) was inserted C-terminal to TubZ, also using PCR cloning. The construct incorporates GFPmut2 directly after the restriction site and ends with a hexahistidine tag and stop codon immediately after GFPmut2. This construct was used for in vitro electron microscopy. The full-length gene alone, without mutations or tags, was generated using primers CTTTAAGAAGGAGATATACATAT- GTTATTAAACAGTAATGAACTAGA and ATGATGATGA- TGATGATGGGATCCTTAACGTTTTTTAAATGGATTTGA from TubZL2VH 6 and cloned between the NdeI and BamHI sites of pHis17 (2) using PCR cloning. This construct was used for electron microscopy in cells. Protein Expression and Purification. C41 (Invitrogen) Escherichia coli carrying an expression vector were grown in 12 L of 2xYT broth or M9 media for selenomethionine (Acros Organics) sub- stituted protein (according to ref. 3). Cultures were supplemen- ted with 25 mg∕L kanamycin and grown at 37 °C. Expression was induced by addition of isopropyl β-D-1-thiogalactopyranoside or L(+)-arabinose (Carbosynth) to a final concentration of 1 mM or 0.25% wt∕vol, respectively, at an optical density at 600 nm of 1, and harvested by centrifugation at 4;000 × g after 12 h at 20 °C. The pellet from each liter of cells was resuspended in 20 mL 100 mM Tris-Cl pH 8.5, 300 mM NaCl and broken at 25 kPSI, 4 ° C with a cell disruption system (Constant Systems). Lysate was clarified by centrifugation at 20;000 × g, and protein was then purified by chromatography. Hexahistidine tagged protein was retrieved by nickel affinity chromatography (HisTrap HP, Tris- Cl pH 8.5, 0–1 M imidazole gradient), and crystallographic purity achieved by ion exchange (HiTrap Q HP, Tris-Cl pH 8.5, 100– 500 mM NaCl gradient) followed by size exclusion chromatogra- phy (HiLoad Sephacryl S200 16/60, Tris-Cl pH 8.5, 150 mM NaCl, 1 mM EDTA, 1 mM NaN 3 ). Protein without a hexahistidine tag was retrieved by ion exchange chromatography (HiTrap Q HP, Tris-Cl pH 8.5, 100– 500 mM NaCl gradient), followed by further purification by ion exchange (HiTrap DEAE HP, Tris-Cl pH 8.5, 100–500 mM NaCl gradient—HiTrap Q, Tris-Cl pH 9-7 gradient, 200 mM NaCl) and finally size exclusion chromatography (HiLoad Sephacryl S200 16/60, Tris-Cl pH 8.5, 150 mM NaCl, 1mM EDTA, 1 mM NaN 3 ). Protein was concentrated to the final concentration in a 30 kDa cutoff concentrator (Vivaspin). Buffers for seleno- methionine-substituted protein were supplemented with 5 mM β-mercaptoethanol throughout the purification and during crys- tallogenesis. Limited Proteolysis. A 100 μL digestion solution containing 100 mM Tris-Cl pH 8.5, 150 mM NaCl, 2 mg∕mL TubZL2VH 6 , and 0.1 μg∕mL sequencing grade porcine trypsin (Promega) was pre- pared. The trypsin was added last, at time point “0 min.” Aliquots were removed and quenched by heating to 95 °C in lithium-dode- cylsulphate PAGE loading buffer (NuPAGE) for 5 min before being snap frozen in liquid nitrogen until the experiment was com- pleted (Fig. S1). Crystallization. Initial crystallization conditions were found using the high-throughput crystallization facility at the Medical Re- search Council (MRC) Laboratory of Molecular Biology (4). Vapor diffusion experiments in MRC crystallization plates with 200 nL of protein solution to 200 nL of precipitant solution gave crystals at 50 mg∕mL TubZ1-421 in 100 mM Tris-Cl pH 8.5, 200 mM MgCl 2 , 30% PEG 4000 without added nucleotide or in the presence of GDP or 8-I-GppNp, and at 20 mg∕mL using the same condition in the presence of 1 mM GTPγS. We produced diffraction quality crystals in 2 μL to 2 μL protein to precipitant sitting drops in 24 well Cryschem plates (Hampton Research), varying the precipitant between 25% and 35% (wt∕vol). Crystals Aylett et al. www.pnas.org/cgi/doi/10.1073/pnas.1010176107 1 of 8
Transcript of Supporting Information - PNAS · Vapor diffusion experiments in MRC crystallization plates with 200...
Supporting InformationAylett et al. 10.1073/pnas.1010176107SI Materials and Methods.General Sources. All chemicals were provided by Sigma Aldrich,restriction enzymes by New England Biolabs, and chromato-graphy equipment by GE Healthcare except where otherwisestipulated. All PCR was carried out using DNA polymerasefrom Thermococcus kodakaraensis (Novagen), site directed muta-genesis using the QuikChange system (Stratagene), and restric-tion-free cloning using InFusion enzyme (Clontech). Moleculargraphics were generated using PyMol (Schrödinger).
Expression Vectors. The Bacillus thuringiensis serovar israelensisTubZ gene [American Type Culture Collection (ATCC) 35646,UniProt Q8KNP3] was a kind gift of R. A. Larsen and J. Pogliano(University of California San Diego). It was provided clonedbetween the NcoI and HindIII sites of pET28a (Novagen). Thisconstruct (TubZL2VH6) included the mutation L2V, providingthe NcoI restriction site, and a C-terminal hexahistidine tag. In-itial crystal trials with full-length protein and limited proteolysiswere carried out using this construct.
TubZ1-421 was generated using site directed mutagenesis totruncate TubZL2VH6. The primer GGACGAAGAAAAAGTA-GATATTTCTTTTGCAACATAATAAAATCGTGTTCAAAAA-AACACATTCAATCCTTATAATAAAAACC and its comple-ment insert two stop codons after residue 421. Most crystallogra-phy was carried out using this construct, and both structures havethis sequence. A C-terminally hexahistidine tagged construct ofTubZ1-421 was generated in the same manner, with the primerGGACGAAGAAAAAGTAGATATTTCTTTTGCAACAGGT-CATCATCATCATCATCATTAATAAAATCGTGTTCAAAAA-AACACATTCAATCCTTATAATAAAAACC and its comple-ment. This construct was used for expression of selenomethio-nine-substituted protein to solve the crystal structure dueto low yields of derivatized TubZ1-421.
The wild-type TubZ sequence without L2V but with a hexahis-tidine tag was generated by site directed mutagenesis using theprimer GAATAATTTTGTTTAACTTTAAGAAGGAGATATA-CCATGTTATTAAACAGTAATGAACTAGAACATATCCATTCand its complement to mutate valine 2 to leucine from TubZL2VH6. The hexahistidine tag was retained to select for the fulllength of the labile C terminus. This construct was used for in vitroelectron microscopy.
The thioredoxin N-terminal fusion was produced by using PCRcloning to insert a PCR product of thioredoxin at the N terminusof TubZ. The thioredoxin insert was generated using primersCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAG-ATATACCATGAGCGATAAAATTATTCACCTGACTGACGand GTTGAATGGATATGTTCTAGTTCATTACTGTTTAA-TAACATGGCCAGGTTAGCGTCGAGGAACTCTTTC andpET32a (Novagen) as the template. This was inserted at theNcoI site of TubZL2VH6. This construct was used for in vitroelectron microscopy.
The C-terminal GFP fusion was generated by producing afull-length TubZ insert with primers GGGCTAGCAGGAG-GAATTCACCATGTTATTAAACAGTAATGAACT and CCC-TCGAGACGTTTTTTAAATGGATTTGAAGTTand then PCRcloning into vector pBAD24 between NheI and XhoI sites.GFPmut2 (1) was inserted C-terminal to TubZ, also using PCRcloning. The construct incorporates GFPmut2 directly after therestriction site and ends with a hexahistidine tag and stop codonimmediately after GFPmut2. This construct was used for in vitroelectron microscopy.
The full-length gene alone, without mutations or tags, wasgenerated using primers CTTTAAGAAGGAGATATACATAT-GTTATTAAACAGTAATGAACTAGA and ATGATGATGA-TGATGATGGGATCCTTAACGTTTTTTAAATGGATTTGAfrom TubZL2VH6 and cloned between the NdeI and BamHIsites of pHis17 (2) using PCR cloning. This construct was usedfor electron microscopy in cells.
Protein Expression and Purification. C41 (Invitrogen) Escherichiacoli carrying an expression vector were grown in 12 L of 2xYTbroth or M9 media for selenomethionine (Acros Organics) sub-stituted protein (according to ref. 3). Cultures were supplemen-ted with 25 mg∕L kanamycin and grown at 37 °C. Expression wasinduced by addition of isopropyl β-D-1-thiogalactopyranoside orL(+)-arabinose (Carbosynth) to a final concentration of 1 mM or0.25% wt∕vol, respectively, at an optical density at 600 nm of 1,and harvested by centrifugation at 4;000 × g after 12 h at 20 °C.
The pellet from each liter of cells was resuspended in 20 mL100 mM Tris-Cl pH 8.5, 300 mM NaCl and broken at 25 kPSI, 4 °C with a cell disruption system (Constant Systems). Lysate wasclarified by centrifugation at 20;000 × g, and protein was thenpurified by chromatography. Hexahistidine tagged protein wasretrieved by nickel affinity chromatography (HisTrap HP, Tris-Cl pH 8.5, 0–1 M imidazole gradient), and crystallographic purityachieved by ion exchange (HiTrap Q HP, Tris-Cl pH 8.5, 100–500 mM NaCl gradient) followed by size exclusion chromatogra-phy (HiLoad Sephacryl S200 16/60, Tris-Cl pH 8.5, 150 mMNaCl,1 mM EDTA, 1 mM NaN3).
Protein without a hexahistidine tag was retrieved by ionexchange chromatography (HiTrap Q HP, Tris-Cl pH 8.5, 100–500 mM NaCl gradient), followed by further purification by ionexchange (HiTrap DEAE HP, Tris-Cl pH 8.5, 100–500 mM NaClgradient—HiTrap Q, Tris-Cl pH 9-7 gradient, 200 mM NaCl)and finally size exclusion chromatography (HiLoad SephacrylS200 16/60, Tris-Cl pH 8.5, 150 mM NaCl, 1mM EDTA, 1 mMNaN3). Protein was concentrated to the final concentration ina 30 kDa cutoff concentrator (Vivaspin). Buffers for seleno-methionine-substituted protein were supplemented with 5 mMβ-mercaptoethanol throughout the purification and during crys-tallogenesis.
Limited Proteolysis.A100 μLdigestion solution containing 100mMTris-Cl pH 8.5, 150 mM NaCl, 2 mg∕mL TubZL2VH6, and0.1 μg∕mL sequencing grade porcine trypsin (Promega) was pre-pared. The trypsin was added last, at time point “0 min.”Aliquotswere removed and quenched by heating to 95 °C in lithium-dode-cylsulphate PAGE loading buffer (NuPAGE) for 5 min beforebeing snap frozen in liquid nitrogen until the experiment was com-pleted (Fig. S1).
Crystallization. Initial crystallization conditions were found usingthe high-throughput crystallization facility at the Medical Re-search Council (MRC) Laboratory of Molecular Biology (4).Vapor diffusion experiments in MRC crystallization plates with200 nL of protein solution to 200 nL of precipitant solution gavecrystals at 50 mg∕mL TubZ1-421 in 100 mM Tris-Cl pH 8.5,200 mM MgCl2, 30% PEG 4000 without added nucleotide orin the presence of GDP or 8-I-GppNp, and at 20 mg∕mL usingthe same condition in the presence of 1mMGTPγS.We produceddiffraction quality crystals in 2 μL to 2 μL protein to precipitantsitting drops in 24 well Cryschem plates (Hampton Research),varying the precipitant between 25% and 35% (wt∕vol). Crystals
Aylett et al. www.pnas.org/cgi/doi/10.1073/pnas.1010176107 1 of 8
were cryoprotected using artificial mother liquor supplementedwith 20% (vol∕vol) glycerol.
Data Collection.Diffraction images of TubZ crystals were collectedat the European Synchrotron Research Facility beamlinesID23eh1, ID 23eh2, ID29, and ID14eh4 (ESRF) and at DiamondLight Source beamline IO2 (Diamond Light Source). Because ofthe long axes of the unit cells (630 and 540 Å), usable diffractioncould only be recorded from preoriented crystals to avoid over-lapping reflections, and the resolution was limited to 3.0 Å forthe same reason (Fig. S2). Diffraction quality was outstanding,however, and reflections were visible to ∼2.0 Å resolution.
Structure Determination. Images were processed with MOSFLMand SCALA from the CCP4 suite (5). Initial phases were deter-mined for the GTPγS crystal form by single wavelength anoma-lous dispersion, and the selenium substructure was solved firstwith SHELXCD (6) with subsequent phasing and NCS averagingbased on the position of the selenium sites within SOLVE/RESOLVE (7). The model was built manually with MAIN (8)and refined with REFMAC5 (9) and PHENIX.refine (10). TheGDP/apo crystal form was solved by molecular replacementfrom the GTPγS structure using PHASER (11) before refinementas above.
Negative Stain Electron Microscopy. Protein at a concentration of10 mg∕mL was diluted 100-fold into Na-Hepes pH 7.5, 150 mMKCl, 5 mM MgCl2 (supplemented with 0.2% (wt∕vol) DEAEdextran 500,000 for Trx-TubZ), and polymerization initiated byaddition of 1 mM GTPγS. After 10 min the resulting polymerwas applied to carbon coated Cu/Rh 300 mesh grids (Agar Scien-tific) and stained with 1% (wt∕vol) uranyl acetate. Images offilaments were recorded to film (KODAKElectron, 1 s exposure)using a Tecnai 12 electron microscope (FEI Company) at 120 kVand −1 to −2 μm defocus.
Rotary Shadowing. Prior to shadowing, protein was diluted into5 mM ammonium hydrogencarbonate, 50% vol∕vol glycerol, giv-ing a final concentration of 0.1 mg∕mL. The sample was thenspread between two pieces of freshly split mica, dried under high
vacuum for 2 h, and shadowed. Rotary shadowing was performedusing an Edwards E306A coating system with a platinum sourceat an oblique angle of 5° and with a sample-to-source distanceof 10 cm.
Helical Reconstruction. Images were processed and the filamentsstraightened using ImageJ with the straightening plug-in (12, 13).Fourier filtering and 3D helical reconstruction were carried outusing the MRC suite for electron microscopy (14). Regions ofpositive density on the outer boundary of the negative stainand unconnected to the main helix were excluded by segmenta-tion for clarity in Fig. 4 (Fig. 4 and Fig. S7).
Electron Cryomicroscopy Sample Preparation. BL21(AI) (Invitro-gen) cells expressing untagged full-length TubZ were grown inM9 minimal medium supplemented with glycerol at 30 °C. Thecells were induced with 0.1% arabinose (Carbosynth) for 4 hand immediately plunge frozen on a holey carbon grid (Quanti-foil, Cu/Rh 300mesh R3.5/1) into liquid ethane using a Vitrobot(FEI Company). For high pressure freezing, BL21(AI) (Invitro-gen) cells expressing TubZ were grown in LB medium to anoptical density at 600 nm of 0.5 and induced with 0.1% arabinose(Carbosynth) for 4 h. Cells were washed and resuspended inphosphate buffered saline with 30% dextran 35,000–45,000and frozen in copper tubes at 2,000 bar using an EMPACT2high-pressure freezer (Leica Microsystems). Vitreous cryosec-tions were prepared using a Leica EM FC6 cryoultramicrotomeat −140 °C with a nominal feed of 50 nm. The cryosections wereplaced on carbon-coated 400 mesh nickel grids (Agar Scientific).
Electron Cryomicroscopy and Tomography. Samples were imagedwith a Tecnai G2 Polara electron microscope (FEI) equipped witha Gatan energy filter (filter band-pass 20 eV) at 300 kV and100 K. Images were collected on an Ultrascan 4 k CCD camera(Gatan, binned to 2 k). Tilt series were collected around a singleaxis at 1° increments between �50° using SerialEM acquisitionsoftware (15). The defocus was −12 μm for whole cells and−4 μm for cryosections, and the cumulative dose for tilt serieswas ∼175 e∕Å2. Tomographic reconstructions were calculatedwith IMOD (16).
1. Cormack BP, Valdivia RH, Falkow S (1996) FACS-optimized mutants of the greenfluorescent protein. Gene 173:33–38.
2. Miroux B, Walker JE (1996) Overproduction of proteins in Escherichia coli: Mutanthosts that allow synthesis of some membrane proteins and globular proteins at highlevels. J Mol Biol 260:289–298.
3. van den Ent F, Lockhart A, Kendrick-Jones J, Löwe J (1999) Crystal structure of theN-terminal domain of MukB: A protein involved in chromosome partitioning. Struc-ture 7:1181–1187.
4. Stock D, Perisic O, Löwe J (2004) Robotic nanolitre protein crystallisation at the MRCLaboratory of Molecular Biology. Prog Biophys Mol Bio 88:311–327.
5. Collaborative Computational Project, Number 4 (1994) The CCP4 Suite: Programs forProtein Crystallography. Acta Crystallogr, Sect D: Biol Crystallogr 50:760–763.
6. Sheldrick GM (2008) A short history of SHELX. Acta Crystallogr, Sect A: Found Crystal-logr 64:112–122.
7. Terwilliger TC, Berendzen J (1999) Automated MAD and MIR structure solution. ActaCrystallogr, Sect D: Biol Crystallogr 55:849–861.
8. Turk D (1992) Weiterentwicklung eines Programms für Molekülgraphik und Elektro-nendichte-Manipulation und seine Anwendung auf verschiedene Protein Struktur-aufklärungen. PhD thesis, Technical University of Munich, Germany.
9. Murshudov GN, Vagin AA, Dodson EJ (1997) Refinement of macromolecular structures
by the maximum-likelihood method. Acta Crystallogr, Sect D: Biol Crystallogr
53:240–255.
10. Adams PD, et al. (2010) PHENIX: A comprehensive Python-based system for macromo-
lecular structure solution. Acta Crystallogr, Sect D: Biol Crystallogr 66:213–221.
11. McCoy AJ, et al. (2007) Phaser crystallographic software. J Appl Crystallogr 40:658–674.
12. Collins TJ (2007) ImageJ for microscopy. Biotechniques 43:25–30.
13. Kocsis E, Trus BL, Steer CJ, Bisher ME, Steven AC (1991) Image averaging of flexible
fibrous macromolecules: The clathrin triskelion has an elastic proximal segment.
J Struct Biol 107:6–14.
14. Crowther RA, Henderson R, Smith JM (1996) MRC Image Processing Programs. J Struct
Biol 116:9–16.
15. Mastronarde DN (2005) Automated electron microscope tomography using robust
prediction of specimen movements. J Struct Biol 152:36–51.
16. Kremer JR, Mastronarde DN, McIntosh JR (1996) Computer visualization of three-
dimensional image data using IMOD. J Struct Biol 116:71–76.
Aylett et al. www.pnas.org/cgi/doi/10.1073/pnas.1010176107 2 of 8
Fig. S1. The C-terminal region of TubZ is cleaved off by trypsin. SDS-PAGE showing limited proteolysis of full-length TubZ protein. A second stable band can beseen appearing at ∼50 kDa over time. Lanes of TubZ (2 mg∕mL) and trypsin (0.1 μg∕mL) at 0, 15, 30, 60, 90, and 120 min after mixing are shown from left toright. The molecular weights of digestion products were determined and correlated with basic residues providing trypsin cleavage sites to estimate the lengthof the folded region. There are no potential trypsin cleavage sites in the N-terminal extension of TubZ.
Aylett et al. www.pnas.org/cgi/doi/10.1073/pnas.1010176107 3 of 8
Fig. S2. Schematic overview and structural alignment of TubZ and the constructs used. (A) Secondary structure of TubZ superimposed upon a structuralalignment of α-tubulin, TubZ, and FtsZ [Protein Data Bank (PDB) ID codes 1JFF, 2XKA, and 1W5A]. Active site residues are boxed in red, protofilament contactsin tubulin and TubZ in blue, and numbered residues are from TubZ, not the other homologues. (B) One-dimensional schematic representation of the four TubZconstructs used in this study. All color schemes and secondary structural elements labeled as in Fig. 1B.
Aylett et al. www.pnas.org/cgi/doi/10.1073/pnas.1010176107 4 of 8
Fig. S3. Diffraction images of crystals show an extremely large unit cell axis. (A) TubZ•GTPγS crystal form diffraction image collected at ESRF ID14eh4. The632.2 Å c axis is well resolved and the crystal is rotated approximately around this axis to avoid overlaps. (B) Inset of same image as A showing a close-up ofreflections.
Fig. S4. The subunit–subunit interface of TubZ is similar to that of tubulin. (A) A slice through the Cα trace and mesh surface of the TubZ filament showing thecavity leading to the active site. (B) A slice through the Cα trace and mesh surface of the tubulin dimer (PDB ID code 1JFF) showing the same cavity. Colors inboth slices are identical to those used in Fig. 1B. (C) Stereographic drawing of the Cα traces of the TubZ and tubulin (PDB ID code 1JFF) active sites superimposedupon one another. TubZ is colored purple-pink and tubulin yellow-orange. Regions making subunit–subunit contacts are highlighted in brighter colors.
Aylett et al. www.pnas.org/cgi/doi/10.1073/pnas.1010176107 5 of 8
Fig. S5. Relaxation of H2 destabilizes loop T7 and the subunit–subunit interface. Stereographic representation of the Cα traces of all TubZ subunit–subunitinterfaces overlaid upon one another based on the molecule bearing the nucleotide. Subunits where H2 coordinates the Mg2þ ion are colored blue when fromthe GTPγS crystal form or cyan when from the GDP crystal form. Subunits where H2 does not coordinate the Mg2þ ion are colored red if from the GTPγS crystalform or pink if from the GDP crystal form. The apoform subunit is colored yellow.
Fig. S6. Differences between the structures of tubulin and TubZ confer twist and writhe. (A and B) Stereographic Cα traces of tubulin (PDB ID code 1JFF) andTubZ superimposed using only the GTPase domain. B has been rotated by 90° relative to A. (C and D) Stereographic Cα traces of tubulin (PDB ID code 1JFF) andTubZ superimposed solely using the C-terminal domain. D has been rotated by 90° relative to C. The differences between the structures are annotated. TubZ iscolored purple-pink and tubulin yellow-orange. In both figures the β-sheets are highlighted in brighter colors and as cartoons.
Aylett et al. www.pnas.org/cgi/doi/10.1073/pnas.1010176107 6 of 8
Fig. S7. Helical reconstructions of TubZ filaments. (A) TubZ double filaments, (B) TubZ quadruple filaments, (C) TubZ-GFP double filaments, and (D) Trx-TubZdouble filaments. Surfaces have been contoured at the level that allows the density to be fitted by the crystal structure and nothing removed from the outerradii. (E and F) Fourier transforms of TubZ double and quadruple filaments; lattices and spacings are annotated alongside.
Aylett et al. www.pnas.org/cgi/doi/10.1073/pnas.1010176107 7 of 8
Table S1. Data collection, structure solution, and refinement statistics
Bacillus thuringiensis serovar israelensis TubZ Same Same
1-421•GTPγS 1-421•GDP 1-421H6 • GTPγS(SeMet)
CollectionBeamline ESRF-ID14eh4 ESRF-ID23eh1 ESRF-ID29Wavelength, Å 0.9395 1.5 0.9790Distance, mm 540.7 329.7 532.5Oscillation, ° 1 0.5 1Images 90 360 720CrystalSpace group P212121 P21 P212121Cell, Å, ° 51.1, 85.2, 632.2 52.9, 541.1, 86.1, β ¼ 92.5 52.7, 85.4, 631.8ScalingResolution, Å 3.0 3.0 3.5Mean mosaicity, ° 0.46 0.32 0.36Completeness,* % 93.2 (71) 92.9 (65.4) 99.7 (99.6)Multiplicity* 3.0 (2.4) 7.0 (5.0) 28.3 (29.3)Anomalous completeness,* % - - 100 (99.8)Anomalous multiplicity* - - 15.2 (15.4)Anomalous correlation†,* - - 0.488 (0.039)ðIÞ∕σðIÞ* 7.4 (3.6) 10.2 (2.5) 15.1 (6.4)Rmerge* 0.12 (0.34) 0.13 (0.51) 0.223 (0.728)Wilson B factor 47.9 71.9 45.6PhasingScattering element/mode - - Selenium/SADNumber of sites - - 52Figure of merit - - 0.67ModelResidues A (2-82, 85-223, 233-411), Mg2þ, GTPγS A (1-80, 87-223, 233-406), Mg2þ, GDP
B (2-223, 233-410), Mg2þ, GTPγS B (1-80, 88-223, 233-421), Mg2þ, GDPC (2-223, 232-419), Mg2þ, GTPγS C (1-80, 106-223, 226-414), GDPD (2-223, 228-407), Mg2þ, GTPγS D (1-80, 88-233, 235-409), GDPE (2-223, 232-404), Mg2þ, GTPγS E (1-80, 91-223, 233-414), GDPF (1-223, 231-421), Mg2þ, GTPγS F (3-79, 88-223, 234-411), GDPG (2-223, 226-417), Mg2þ, GTPγS G (1-80, 88-407, 416-421), Mg2þ, GDP
H (1-82, 91-135, 144-223, 234-420)I (1-80, 88-223, 233-420), Mg2þ, GDP
J (2-79, 88-223, 233-411), GDPK (2-80, 91-223, 226-414), GDPL (2-79, 91-223, 233-400), GDP
RefinementR∕Rfree
‡ 0.2320∕0.2844 0.2343∕0.2943Bond distance rmsd, Å 0.012 0.010Bond angle rmsd, ° 1.333 1.229Most favored area, %§ 87.9 87.1Disallowed area, %§ 0.0 0.0Mean B factor 24.013 56.301PDB ID code 2XKA 2XKB
*Values in parentheses are from the highest resolution shell.†Anomalous correlation coefficient between half sets. Calculated from intensities.‡Five percent of reflections were randomly selected before refinement in order to calculate Rfree.§Percentage of residues lying in these areas of the Ramachandran plot (calculated by ProCheck).
Aylett et al. www.pnas.org/cgi/doi/10.1073/pnas.1010176107 8 of 8
