Slide 1

Supplementary Tables Name Sequence (Forward 5'-3') or pre-designed siRNA ID# from Ambion Target gene #1 Ctrl siRNAAM4611None siGFPCAAGCUGACCCUGAAGUUCGFP siLucCGUACGCGGAAUACUUCGALuciferase Non-human Ctrl siRNAGUCCGGGCAGGUCUACUUUMouse TNF-a siIFIT5-1s24410Human IFIT5 siIFIT5-2s24411Human IFIT5 siDENND2D-1s36728Human DENND2D siDENND2D-2s36729Human DENND2D siPARP14 -1s29270Human PARP14 siPARP14-2s29271Human PARP14 siTRIM 21-1s13463Human Trim21 siTRIM21-2s13464Human Trim21 siPCGF1-1s39408Human PCGF1 siPCGF1-2s39410Human PCGF1 siIRF3-1s7508Human IRF3 siIRF3-2s7509Human IRF3 siRIG-I-1s223614Human RIG-I siRIG-I-2s22144Human RIG-I siIFI16-1s7136Human IFI16 siIFI16-2s7138Human IFI16 siSTING-1s50644Human STING siSTING-2s50646Human STING siTBK1-1s761Human TBK1 siTBK1-2s763Human TBK1 siMAVS-1s33178Human MAVS siMAVS-2s33180Human MAVS Supplementary Table S1. Pre-designed siRNA ID# (Ambion) or sequences of siRNAs used in this study

Slide 2

Supplementary Figure S1. (A) Stabilities of siRNAs. HeLa cells were transfected with 10 nM siRNA and then cultured for 24 h or 48 h. siRNA quantitation was performed using the custom TaqMan Small RNA assay. (B) Correlation of siRNA stability and their IFN-1 induction activity. The data in the X axis and Y axis indicate copies of intact siRNA from Supplementary Figure S1A and IFN-1 expression level from the Figure 1B, respectively. A B

Slide 3

Supplementary Figure S2. IFN-1 inhibited HIV-1 replication in Macrophages and iDCs. Macrophages (left) or iDCs (right) from a normal healthy donor were infected with HIV BAL strain for 2 h and then cultured for 10-14 days in the presence of different concentration of IFN- 1. HIV replication in culture was monitored using HIV p24 antigen kit. All experiments were performed in quadruplicate assay and data indicates mean + SD. iDC Macrophage Supplementary Figures

Slide 4

Supplementary Figure S3. IFN- enhanced the siRNA and DNA-mediated IFN- 1 induction in a dose dependent manner. HeLa cells were transfected by 10 nM Non- human Ctrl siRNA on day 1, and then treated with IFN- at different concentration on day 2, The cells were further transfected by DNA at day 3. A total RNA was isolated 6 h after DNA transfection. The relative IFN-1 production were detected by real time RT-PCR and compared with untreated cells.

Slide 5

Supplementary Figure S4. The stabilities of siRNAs with different end overhang structure. HeLa cells were transfected with 10 nM siRNA and the small RNA was isolated using TaqMan MicroRNA Cell-to-Ct kit 24 h or 48 h after transfection. siRNA quantitation was performed using the custom TaqMan Small RNA assay. the Ct value of RNU44 was used as a internal control to detect the cell numbers for each sample as described in Supplementary materials and methods.

Slide 6

Supplementary Figure S5. Oligermerization of RIG-I upon siRNA stimulation. 293T cells were transfected with RIG-I expression vector on day 1, and further transfected with or without 10 nM Non-human Ctrl siRNA on day 2. Cytosolic fraction from the cells (1 mg) were loaded on a S-200 column. Fractions were collected and RIG-I protein was detected by Western blot (Upper panel). Distribution of RIG-I was analyzed by NIH Image J based on the result of Western blot analysis (lower panel). FPLC fraction number - siRNA + siRNA 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 349 219158 KDa IB: RIG-I

Slide 7

Supplementary Figure S6. The binding affinity of different siRNA molecules with RIG-I. AlphaScreen assay was performed to estimate the binding affinity between RIG-I and siRNA molecules. Purified FLAG-RIG-I was incubated with different concentrations of siRNA molecules bearing a biotin at 5 end of the antisense strand. The resulting fluorescence signal correlates with the number and proximity of interacting donor (Biotin-siRNA)acceptor (FLAG- RIG-I) pairs. Concentration of indicated siRNAs is plotted against the AlphaScreen signal. The LogEC50 correlated with the dissociation constant Kd. There is an inverse relationship between LogEC50 and affinity (46). The LogEC50 is calculated by statistical analysis (non- linear regression).

Slide 8

Supplementary Figure S7. siRNA highly enhanced DNA-mediated IFN-1 and IFN- gene induction compared with that of 5PPP-RNA. (A) HeLa cells were transfected with 5PPP-RNA (Dashed line) (Invivogen) or Non-human Ctrl siRNA (Solid line) at different concentrations followed by IFN- treatment (1000 U/mL) and plasmid DNA (1 g) transfection on day 2 and day 3, respectively. The IFN-1 (Black line) and IFN- (Blue line) gene expression levels were measured 6 h after DNA transfection by real-time RT-PCR and compared with the cells without RNA transfection. (B) IFN- -treated HeLa cells (1000 U/mL) were transfected with 5PPP-RNA (Dashed line) or Non-human Ctrl siRNA (Solid line) at different concentrations. The cell lysate for RNA extraction were collected at 6 h after RNA transfection. The IFN-1 (Black line) and IFN- (Blue line) gene expression levels were measured by real-time RT-PCR and compared with the cells without RNA transfection. A B IFN-1 IFN-

Slide 9

293T HEK293 A B GFP

Slide 10

IFN- treated HeLa RIG-I IFI16 HEK293 293T -actin IFN- treated HeLa HeLa RIG-I IFI16 -actin C D Supplementary Figure S8. Plasmid DNA encoding GPF transfection in 293T cells induced GFP but doesnt induce IFN-1 production. HEK293 and 293T cells were transfected with plasmid pCMV-GFP, 24 h after transfection, the cells were observed under Fluorescence Microscope. (B) Total RNA was extracted 24 h after DNA transfection and relative IFN-1 expression was measured by real-time RT-PCR and the gene expression level was compared with the untransfected cells. **p < 0.001. (C) & (D) Comparison of endogenous level of RIG-I and IFI16 expression. Western blot was performed with a whole cell lysate of (C) HEK293 and 293T cells or (D) untreated and IFN- -treated HeLa cells. Western blot was probed anti-RIG-I and anti-IFI16. -actin was detected as a loading control. IFN- -treated HeLa cells was loaded as a positive control for protein detection.

Slide 11

Supplementary Figure S9. Comparison of the IFN-1 promoter activity in 293T cells transfected by siRNA alone or DNA alone. 293T cells in a six-well plate were co- transfected with IFN-1 reporter plasmid (pGL4-IFN-1, 100 ng), Renilla luciferase plasmid (pRL-TK, 10 ng), IFI16 (200 ng) and RIG-I (100 ng) expression vectors. Cells were then transfected with 10 nM siRNA on day 2 or 1 g plasmid DNA on day 3, respectively. Cells were then collected for luciferase assay on day 4.

Slide 12

MAVS -actin Lipid alone siMAVS-1 siMAVS-2 Non-human Ctrl siRNA+ No siRNA + Non-human Ctrl siRNA Supplementary Figure S10. MAVS has less effect on the HSV-1-mediated IFN-1 induction compared with STING. (A) HeLa cells were transfected with 10 nM Non-human Ctrl siRNA along with or without siRNA targeting STING or MAVS. Cells were then treated with IFN- (1000 U/mL) on day 2 followed by an infection with HSV-1 at a MOI of 5 on day 3. RNA was extracted 6 h after virus infection. Relative IFN-1 mRNA expression level was measured by real-time RT-PCR and compared with the cells without siRNA transfection. (B) Whole-cell lysates were collected, and an equal amount of total proteins was loaded on SDS-PAGE and then subjected to Western blot by anti-MAVS (Millipore). A B

Slide 13

Supplementary materials and methods: Quantification of siRNA (siRNA stability assay) HeLa cells were transfected with siRNA at 10 nM and then cultured for 24 h or 48 h. The small RNA was isolated using TaqMan MicroRNA Cells-to-Ct Kit (Applied Biosystems) according to the instruction manual. Reverse transcription for each siRNA was performed using the TaqMan microRNA reverse transcription kit (Applied Biosystems). Amounts of undegraded siRNA was measured using quantitative RT-PCR on a CFX96 real-time system (BioRad). Chemically synthesized siRNA was used to make a standard curve and the TaqMan Ct values of siRNA were converted into the siRNA copy numbers. The Ct values for RNU44 small nucleolar were converted into the cell numbers using a standard curve developed between the Ct values of RNU44 and cell numbers. The intact siRNA copy numbers were normalized by cell numbers. The abundance of intact siRNA were expressed by copies per cell. HIV-1 infection and replication assay Macrophages and Immature dendritic cells (iDC) were produced from monocytes isolated from healthy donors as previously described (47). Macrophages or iDC were infected with HIV-1BaL strain (Advanced Biotechnologies Inc) for 2 h and then cultured for 10-14 days in the presence of different concentration of IFN-1 (R&D system). Macrophages were maintained in DMEM supplemented with 10% Human AB serum and 10 mM HEPES, whereas iDCs were cultured in RPMI-1640 supplemented with 10% FBS, 10 mM HEPES, 50 ng/ml GM-CSF and 50 ng/ml of IL-4. Half culture medium were changed every 3-4 days with a fresh medium with the same concentration of IFN-1. HIV-1 replication was determined by measuring p24 antigen in the culture supernatant using a p24 antigen capture assay (PerkinElmer). All experiments were performed in quadruplicate assay and data indicates mean + SD.

Slide 14

Size-exclusion chromatography Oligomerization of RIG-I upon siRNA transfection was analyzed by a size-exclusion chromatography using an S-200 column connected to an FPLC system (GE Healthcare). The column was equilibrated with 50 mM HEPES (pH 7.5), 125 mM NaCl, 10% glycerol (v/v), 0.1% NP40, 0.05% NaN3 and 1 mM DTT). A total of 1 mg of cytosolic protein was applied to the gel filtration column. Protein elution was monitored by UV absorption at 280 nm. The column was calibrated using a high- molecular-weight calibration kit (GE Healthcare). The molecular masses of each fraction were estimated using the calibration curve. Protein purification and analysis Flag-tagged RIG-I was transiently overexpressed in 293T cells and lysed in Pierce IP lysis buffer (Thermo Scientific) including protease inhibitor cocktail (Roche). The lysate was incubated over night at 4C with anti-FLAG beads (Sigma). Anti-FLAG beads were washed subsequently with the IP lysis buffer. FLAG-RIG-I was eluted by 0.1 M glycine HCL (PH 3.5) and neutralized by 0.5 M Tris HCL, pH 7.4 with 1.5M NaCL. Purity of recombinant RIG-I was determined by SDS-PAGE separation and subsequent Coomassie blue stain. AlphaScreen RIG-I-binding assay The binding affinity of siRNA for FLAG-tagged RIG-I was determined by an amplified luminescent proximity homogenous assay (AlphaScreen; Perkin Elmer) as described (30). Briefly, purified FLAG-RIG-I was incubated with different concentration of biotinylated siRNA for 1 h at 37C in buffer (50 mM Tris/pH7.4, 100 mM NaCl, 0.01% Tween20, 0.1% BSA) and subsequently incubated for 30 min at 25C with anti-FLAG conjugated acceptor beads (Perkin-Elmer) and Streptavidine conjugated donor beads (Perkin Elmer). The resulting chemiluminescence emitting in the range of 520620 nm correlates with the number and proximity of associated beads which is inversely correlated with the dissociation constant of donor (biotin- siRNA) and acceptor (FLAG-RIG-I). The assay was performed in wells of half area 96-well plates (Perkin-Elmer). Plates were analyzed for emitted fluorescence with a multilabel reader (Envision; Perkin Elmer).