SUPPLEMENTARY INFORMATION FOR THE GENOMIC … · 1 SUPPLEMENTARY INFORMATION FOR THE GENOMIC...

1

SUPPLEMENTARY INFORMATION FOR

THE GENOMIC LANDSCAPE OF HYPODIPLOID ACUTE LYMPHOBLASTIC LEUKEMIA

Linda Holmfeldt1,30, Lei Wei1,30, Ernesto Diaz-Flores2, Michael Walsh3, Jinghui Zhang4, Li Ding5,6, Debbie Payne-Turner1, Michelle Churchman1, Anna Andersson1,7, Shann-Ching Chen1, Kelly McCastlain1, Jared Becksfort4, Jing Ma1, Gang Wu4, Samir N. Patel1,29, Susan L. Heatley1,29, Letha A. Phillips1, Guangchun Song1, John Easton8, Matthew Parker4, Xiang Chen4, Michael Rusch4, Kristy Boggs8, Bhavin Vadodaria8, Erin Hedlund4, Christina Drenberg9, Sharyn Baker9,

Deqing Pei10, Cheng Cheng10, Robert Huether4, Charles Lu5, Robert S. Fulton5,6, Lucinda L.

Fulton5,6, Yashodhan Tabib5, David J. Dooling5,6, Kerri Ochoa5, Mark Minden11, Ian D. Lewis12, L. Bik To12, Paula Marlton13, Andrew W. Roberts14, Gordana Raca15, Wendy Stock15, Geoffrey Neale16, Hans G. Drexler17, Ross A. Dickins18, David W. Ellison1, Sheila A. Shurtleff1, Ching-Hon Pui3, Raul C. Ribeiro3, Meenakshi Devidas19, Andrew J. Carroll20, Nyla A. Heerema21, Brent Wood22, Michael J. Borowitz23, Julie M. Gastier-Foster24,25,26, Susana C. Raimondi1, Elaine R. Mardis4,5,27, Richard K. Wilson4,5,27, James R. Downing1, Stephen P. Hunger28, Mignon L. Loh2, and Charles G. Mullighan1

1Pathology, St. Jude Children’s Research Hospital, Memphis, Tennessee, USA 2Department of Pediatrics, University of California School of Medicine, San Francisco, California, USA 3Department of Oncology, St. Jude Children’s Research Hospital, Memphis, Tennessee, USA 4Department of Computational Biology and Bioinformatics, St. Jude Children’s Research Hospital, Memphis, Tennessee, USA

5The Genome Institute at Washington University, St Louis, Missouri, USA

6Department of Genetics, Washington University School of Medicine, St Louis, Missouri, USA

7Department of Clinical Genetics, Lund University Hospital, Lund, Sweden

8Pediatric Cancer Genome Project, St. Jude Children’s Research Hospital, Memphis, Tennessee USA 9Department of Pharmaceutical Sciences, St. Jude Children’s Research Hospital, Memphis, Tennessee, USA

10Department of Biostatistics, St. Jude Children’s Research Hospital, Memphis, Tennessee, USA 11Princess Margaret Hospital/University Health Network, University of Toronto, Ontario, Canada 12Division of Haematology, Institute of Medical and Veterinary Science, Adelaide, South Australia, Australia 13Oncology/Haematology Unit, Princess Alexandra Hospital, Woolloongabba, Queensland, Australia 14Department of Clinical Haematology and Bone Marrow Transplant, Royal Melbourne Hospital, Melbourne, Victoria, Australia

15Hematology/Oncology, University of Chicago Medicine, Chicago, Illinois, USA 16The Hartwell Center for Bioinformatics and Biotechnology, St. Jude Children’s Research Hospital, Memphis, Tennessee, USA

17Department of Human and Animal Cell Cultures, Deutsche Sammlung von Mikroorganismen und Zellkulturen, Braunschweig, Germany 18Molecular Medicine Division, Walter & Eliza Hall Institute of Medical Research, Parkville, Victoria, Australia 19Department of Biostatistics, College of Medicine, University of Florida, Gainesville, Florida, USA 20Department of Genetics, University of Alabama at Birmingham, Birmingham, Alabama, USA

Nature Genetics: doi: 10.1038/ng.2532

2

21Department of Pathology, College of Medicine, Ohio State University Comprehensive Cancer Center, Columbus, Ohio, USA 22Department of Laboratory Medicine, Seattle Children’s Hospital, Seattle, Washington, USA 23Division of Hematologic Pathology, Johns Hopkins Hospital, Baltimore, Maryland, USA 24Department of Pathology and Laboratory Medicine, Nationwide Children’s Hospital, Columbus, Ohio, USA 25Department of Pathology, Ohio State University, Columbus, Ohio, USA 26Department of Pediatrics, Ohio State University, Columbus, Ohio, USA 27Siteman Cancer Center, Washington University, St Louis, Missouri, USA 28Section of Pediatric Hematology/Oncology/Bone Marrow Transplantation and Center for Cancer and Blood Disorders, University of Colorado Denver School of Medicine, Children’s Hospital Colorado, Aurora, Colorado, USA 29Present addresses: Weill Cornell Medical College, Cornell University, New York, New York, USA (S.N.P.) and Human Immunology, Centre for Cancer Biology, SA Pathology, Adelaide, South Australia, Australia (S.L.H.)

30These authors contributed equally to this work


3

TABLE OF CONTENTS

SUPPLEMENTARY NOTE ........................................................................................................ 6

Next generation sequencing of hypodiploid ALL ..................................................................... 6

Kindred harboring inherited TP53 mutation in the light of Li-Fraumeni syndrome ................... 6

Germline variants in hypodiploid ALL ..................................................................................... 7

PAX5 and CDKN2A/B alterations in hypodiploid ALL ............................................................. 7

Low frequency of JAK mutations in hypodiploid ALL............................................................... 8

Additional copy number alterations identified in hypodiploid ALL ............................................ 8

Additional histone modifier genes mutated in next-generation sequenced hypodiploid ALL ...10

Two potential open reading frames in the NALM-16 NF1 transcript .......................................14

Verification of genetic alterations in xenografted primary hypodiploid ALL cells .....................14

Minimal Residual Disease status and PAG1 alterations are associated with poor outcome ...15

SUPPLEMENTARY TABLES ...................................................................................................16

Supplementary Table 1: Pediatric hypodiploid ALL cohort. ....................................................16

Supplementary Table 2: Adult ALL cohort. ............................................................................16

Supplementary Table 3: Whole genome sequencing coverage data. ....................................17

Supplementary Table 4: Whole exome sequencing coverage data. .......................................19

Supplementary Table 5: Validation frequency of next-generation sequencing data. ..............20

Supplementary Table 6: Number of sequence mutations, copy number alterations and

structural variants identified by next-generation sequencing. .................................................21

Supplementary Table 7: Mutations identified by next-generation sequencing. .......................23

Supplementary Table 8: Structural variations identified by whole genome sequencing. .........24

Supplementary Table 9: Genes resequenced. .......................................................................25

Supplementary Table 10: Regions of copy number alterations and copy-neutral loss-of-

heterozygosity in hypodiploid ALL. ........................................................................................26

Supplementary Table 11: Mutations identified by Sanger sequencing in the hypodiploid ALL

cohort. ...................................................................................................................................27

Supplementary Table 12: Copy number alterations and mutations. .......................................28

Supplementary Table 13: Association between aneuploidy and lesions. ...............................29

Supplementary Table 14: Differential expression analysis – NH versus masked NH. ............31

Supplementary Table 15: Differential expression analysis – LH versus masked LH. .............31

Supplementary Table 16: TP53 mutations in adult ALL. ........................................................32


4

Supplementary Table 17: Copy number alterations and mutations in hypodiploid ALL vs non-

hypodiploid ALL. ....................................................................................................................33

Supplementary Table 18: TP53 mutations in pediatric hypodiploid ALL. ................................36

Supplementary Table 19: IKZF1, IKZF2 and RB1 deletions in adult ALL. ..............................38

Supplementary Table 20: Alterations targeting histone modifiers in next-generation

sequenced hypodiploid ALL. ..................................................................................................39

Supplementary Table 21: Differential expression analysis – NH versus LH. ..........................41

Supplementary Table 22: Gene set enrichment analysis (GSEA) – NH versus LH. ...............41

Supplementary Table 23: Ex vivo drug study of PI3K/mTOR and MEK inhibitors on

hypodiploid ALL cells. ............................................................................................................42

Supplementary Table 24: Sequences of shRNAs. .................................................................43

Supplementary Table 25: Single nucleotide variations identified by mRNA seq of NALM-16. 44

Supplementary Table 26: Primer sequences used for targeted gene resequencing and NF1

deletion mapping. ..................................................................................................................45

Supplementary Table 27: Murine lymphoid precursor cells used for gene expression profiling.

..............................................................................................................................................45

Supplementary Table 28: Antibodies used for biochemical studies. .......................................46

Supplementary Table 29: Association between aneuploidy and event free survival (EFS).....47

Supplementary Table 30: Association between aneuploidy and cumulative incidence of any

relapse. .................................................................................................................................48

Supplementary Table 31: Association between aneuploidy and minimal residual disease. ....49

Supplementary Table 32: Association between copy number alterations/mutations and event

free survival (EFS). ................................................................................................................50

Supplementary Table 33: Association between copy number alterations/mutations and

cumulative incidence (CIN) of any relapse. ............................................................................52

Supplementary Table 34: Multivariable analysis of copy number alterations/mutations, clinical

features and association with cumulative incidence of any relapse. .......................................54

SUPPLEMENTARY FIGURES .................................................................................................55

Supplementary Figure 1: Coverage plots for next-generation sequenced hypodiploid ALL

cases. ....................................................................................................................................55

Supplementary Figure 2: Circos plots of whole genome sequenced hypodiploid ALL. ...........57

Supplementary Figure 3: Mutation spectrum of next-generation sequenced hypodiploid ALL.

..............................................................................................................................................62

Supplementary Figure 4: Protein domain and alteration plots for targets of sequence

mutations in hypodiploid ALL. ................................................................................................63


5

Supplementary Figure 5: Mapping of NF1 deletions. .............................................................64

Supplementary Figure 6: Immunoblot analysis of NF1. ..........................................................66

Supplementary Figure 7: Validation of mutations in NRAS and PTPN11 in non-tumor samples

in near haploid ALL. ...............................................................................................................67

Supplementary Figure 8: PAG1 deletions correlate with PAG1 expression levels. ................68

Supplementary Figure 9: Mutant p53 fails to stimulate p21 in hypodiploid ALL. .....................69

Supplementary Figure 10: IKZF1 and IKZF2 deletions in adult ALL. ......................................70

Supplementary Figure 11: Expression of Ikzf1, Ikzf2 and Ikzf3 during murine lymphoid

development. .........................................................................................................................71

Supplementary Figure 12: CD19 levels and degree of antigen receptor rearrangements in

hypodiploid ALL. ....................................................................................................................72

Supplementary Figure 13: RB1 alterations in pediatric hypodiploid ALL and adult ALL. ........74

Supplementary Figure 14: Tumor suppressor gene pathway alterations in hypodiploid ALL. .75

Supplementary Figure 15: Deletions and sequence mutations in genes encoding histones and

histone modifiers. ..................................................................................................................76

Supplementary Figure 16: GEP restricted to probes on chromosomes showing identical

patterns of aneuploidy. ..........................................................................................................77

Supplementary Figure 17: Flow cytometric analysis of signaling pathways in hypodiploid ALL.

..............................................................................................................................................78

Supplementary Figure 18: Ikzf2 and Ikzf3 knockdown efficiency assessed by immunoblot

analysis. ................................................................................................................................79

Supplementary Figure 19: Flow cytometric analysis of signaling pathways in hematopoietic

cell lines. ...............................................................................................................................80

Supplementary Figure 20: The importance of optimal normalization of SNP microarray data.

..............................................................................................................................................81

Supplementary Figure 21: Immunohistochemistry and FACS analyses of tissue from mice

xenografted with human primary hypodiploid ALL cells. ........................................................82

Supplementary Figure 22: Copy number analysis of primary hypodiploid ALL samples versus

xenografted leukemic samples. .............................................................................................83

SUPPLEMENTARY REFERENCES .....................................................................................84


6

SUPPLEMENTARY NOTE

Next generation sequencing of hypodiploid ALL

We identified 988 putative somatic single nucleotide variations (SNVs) and insertion/deletion

mutations (Indels) and 164 structural variations (SVs) in the whole genome- and exome

sequenced cases. We selected 822 SNVs and Indels (excluding some synonymous and UTR

mutations) and 137 SVs (excluding some low quality SVs from exome sequencing) for

experimental validation. We successfully determined statuses for 779 SNVs and Indels and 112

SVs, including 646 somatic SNVs and Indels and 96 somatic SVs, at validation rates of 83%

and 86%, respectively (Supplementary Tables 5-8 and Supplementary Figs. 2-3). In addition,

germline variant analysis was performed and initially identified 289 SNVs and 544 Indels that

after filtering left 58 germline variants predicted to be deleterious (Supplementary Note and

Supplementary Table 7).

Kindred harboring inherited TP53 mutation in the light of Li-Fraumeni syndrome

A 9 year-old diagnosed with relapsed low hypodiploid ALL was treated at St Jude. At remission,

the patient underwent NK cell therapy and conditioning of clofarabine 40 mg/m2, etoposide 100

mg/m2 and cyclophosphamide 400 mg/m2 in view of a match unrelated transplant. However,

prior to transplant the patient developed massive capillary leak, multi-organ failure and died.

The family history was salient for his biological father dying from gliobastoma multiforme

at the age of 31 and the paternal grandfather dying from a malignancy of unknown type. Given

the family history, TP53 testing was performed. The testing for both the patient and his father

was significant for a frame-shift g.13886delG mutation that was heterozygous in a skin biopsy

from the patient and homozygous in the tumor samples from both the boy and his father

(p.Gly302fs; Fig. 4c-e). This mutation has been previously reported (http://www-p53.iarc.fr). The

father’s tumor also harbored a heterozygous deleterious mutation of IDH1. In addition,

immunohistochemistry testing of the patient’s father’s tumor supported findings consistent with

p53 and IDH mutations (Fig. 4e).

Li-Fraumeni syndrome (LFS) carries at least three different definitions. The classic

definition is a proband with a sarcoma before the age of 45 years and a first degree relative with

any cancer before 45 years of age and a first or second-degree relative with any cancer before

age 45 years or a sarcoma at any age.1 In 2009, the Chompret criteria for LFS in the context of

a positive gene test for a TP53 mutation were reported.2-4 Other definitions of LFS were put forth


http://www-p53.iarc.fr/

7

by Birch and Eeles.5,6 Birch included any childhood cancer coupled with other criteria whereas

Eeles’ description made adjustment for age and degrees of relatedness with LFS-related

malignancies. A germline mutation in TP53 confirms the diagnosis of LFS or LFL syndrome.

While patients with leukemia and LFS/LFL syndrome have been reported there is less

agreement that this type of cancer should be included in the definition of LFS/LFL syndrome.7-12

Here we present two generations with a deleterious TP53 mutation leading to a

hematologic malignancy in a child and a solid tumor in his father. This case is notable since it

supports leukemia, in particular low hypodiploid ALL, as a diagnostic cancer for LFS. Further,

this patient responded with significant toxicity to clofarabine, perhaps indicating further study

and caution of this agent in patients with p53 mutations.

Current screening guidelines for individuals with TP53 mutations are controversial given

the cost of screening and whether preventative steps can be taken. However, Villani et. al. have

generated biochemical and imaging guidelines, which have shown some evidence to improve

outcome.13

Germline variants in hypodiploid ALL

In addition to the mutations in TP53, NRAS and PTPN11, 49 deleterious mutations were

identified in matched remission DNA from next generation sequencing, and thus likely inherited

(Supplementary Table 7). Among these, a frame-shift mutation was identified in SH2B3,

encoding LNK, a negative regulator of cytokine signaling14 also mutated in non-hypodiploid

high-risk ALL.15 One case harbored a frame-shift mutation in XRCC1, which encodes a protein

involved in DNA single-strand break repair.16 Another case harbored a nonsense mutation in

TP53INP1, a p53 target gene that is expressed upon high levels of reactive oxygen species and

that encodes a protein with antioxidant functions17. Splice region mutations were identified in the

cancer associated genes FANCA18, MLL319,20 and ROS121. The majority of these mutations

were heterozygous in remission cells and homozygous in the tumors due to aneuploidy of the

respective chromosomes (Supplementary Table 7).

PAX5 and CDKN2A/B alterations in hypodiploid ALL

Some of the recurrent alterations identified in hypodiploid ALL have been reported previously in

ALL/high-risk ALL22,23. One of these was focal deletion of CDKN2A/CDKN2B at 9p21 (encoding

INK4/ARF), which was most common in near diploid ALL (77.3%) compared to 22.1% and

23.5% of near haploid and low hypodiploid ALL cases, respectively (Table 1 and Supplementary


8

Table 12). Deletions of these genes are common in ALL, with deletions in about one third of B-

ALL (Supplementary Table 17) and 72% of T-ALL.22,23 The B-lymphoid transcription factor gene

PAX5 (9p13) was altered in 59.1% of near diploid cases (by focal deletion (18.2%), amplification

(4.5%), broad deletions terminating in the gene (13.6%) or sequence mutation (27.3%)) but less

frequent in near haploid (7.4%) and low hypodiploid (5.9%) ALL (Table 1 and Supplementary

Table 12). PAX5 is frequently altered in non-hypodiploid ALL (more than 30% of B-ALL22,23). In

addition to the focal deletions and sequence mutations, mono-allelic loss of the PAX5 and

CDKN2A/CDKN2B genes due to deletion of 9p was observed in 31.8% and 9.1% of near diploid

cases, respectively, and by whole chromosome 9 loss or copy-neutral LOH of chromosome 9 in

cases with less than 44 chromosomes (PAX5 78.9%, and CDKN2A/CDKN2B 62.5%, of the 104

near haploid and low hypodiploid cases).

Low frequency of JAK mutations in hypodiploid ALL

The Janus kinase genes JAK1 and JAK2 are mutated in ALL23,24, and alterations were identified

in 2 near diploid ALL cases, but not in near haploid or low hypodiploid ALL (JAK1 p.Val658Phe

and p.Lys847Glu in SJHYPO101-D and SJHYPO104-D, respectively; Supplementary Table 12

and Supplementary Fig. 4). SJHYPO101 also harbored a deletion in the pseudoautosomal

region (PAR1) on the sex chromosomes X and Y that results in P2RY8-CRLF2 fusion and over-

expression of CRLF2 (cytokine receptor-like factor 2, or thymic stromal lymphopoietin

receptor).25,26 JAK1 p.Val658Phe is a homologue of the transforming JAK p.Val617Phe

substitution, and normally found together with CRLF2 rearrangements.26 JAK and CRLF2

alterations have been shown to occur together in 7% of B-progenitor ALL cases, and are

associated with Down syndrome ALL.26 Two additional near diploid and two near haploid cases

harbored a deletion in this region. All three near diploid and one of the near haploid cases had

evidence of a P2RY8-CRLF2 fusion based on PCR of cDNA from these cases (Supplementary

Table 12 and data not shown).

Additional copy number alterations identified in hypodiploid ALL

Additional targets of DNA copy number alteration identified in at least 2 cases by SNP 6.0

microarray analysis of the entire pediatric hypodiploid ALL cohort included ANKRD11, ARID1B,

ARPP21, C20orf194, CUL5, DMD, EPHA7, FAM53B, GAB2, PDS5B/APRIN, RASA2 and

SMAD2 (Supplementary Tables 10 and 12).


9

ANKRD11 (ankyrin repeat domain 11) was partially deleted (exon 2 or only a deletion in

intron 2) in 2 low hypodiploid cases and one near haploid case. This gene is a member of an

ankyrin repeat-containing co-factor family that interacts with p160 nuclear receptor co-

activators, and inhibits ligand-dependent transcriptional activation.27 ANKRD11 is also a p53 co-

activator28. No focal copy number alterations involving this gene were identified in a previous

study of childhood ALL.29

A deletion directly upstream (in two near haploid cases) and a deletion of the first 3

exons (in one near diploid case) of ARID1B (AT rich interactive domain 1B) were identified in

the hypodiploid ALL cohort. ARID1B encodes a protein involved in transcriptional activation and

repression of a number of genes by chromatin remodeling. ARID1B and the closely related

protein p270/ARID1A are non-catalytic subunits of the mammalian SWI/SNF complex, in which

p270/ARID1A is required for differentiation-associated cell cycle arrest and is a tumor

suppressor, while ARID1B has been shown to be dispensable for this function.30,31

Intragenic deletions of ARPP-21 (cAMP-regulated phosphoprotein, 21kDa) were

identified in 3 near diploid cases and one near haploid case, and alterations of this gene have

been identified previously (Supplementary Table 17 and Refs. 29,32). ARPP21 is a cAMP-

regulated phosphoprotein also known as Regulator of Calmodulin Signaling (RCS) that has a

central role in integration of signals in medium spiny neurons33.

A deletion of intron 1 of C20orf194 was identified in two near haploid cases. The specific

function of the protein encoded by this gene is unknown.

CUL5, also known as Cullin-5, encodes an E3 ubiquitin ligase that interacts with

members of the Hsp90 chaperone complex, and polyubiquitinates the Hsp90 client ErbB2.34

This gene was focally deleted in two near haploid cases, but was not found targeted in a

previous large scale genome-wide study on childhood ALL29 (Supplementary Table 17).

FAM53B (Family with sequence similarity 53, member B) is the human homologue of the

Medaka and Zebrafish gene simplet (smp). In fish, simplet has been shown to stimulate cell

proliferation and tissue regeneration35,36, while no function has been depicted in mammals.

Focal deletion of FAM53B was identified in two near haploid cases.

DMD (Dystrophin) is one of the largest genes found in the human genome, and

mutations in DMD are responsible for Duchenne (DMD) and Becker (BMD) muscular

dystrophies. This gene was altered in 2 low hypodiploid cases (one intragenic amplification and

one deletion of the first 11 exons) and 2 near diploid cases (deletion of the 5’ end and the 3’

end, and one case with LOH and amplification of the entire gene). It was also deleted in 4.3% of

cases in a study of B-cell progenitor ALL.29 The expression levels of DMD are predictive of


10

overall survival in B-cell chronic lymphoblastic leukemia (e.g. Ref. 37), but the encoded protein

has not been implicated in tumorigenesis. No sequence mutations of DMD were identified in a

large-scale resequencing project of high-risk, non-hypodiploid B-ALL.23

Two near haploid cases harbored focal deletions of the EPHA7 (EPH receptor A7) gene,

belonging to the Ephrin receptor subfamily of the protein-tyrosine kinase family. EPHA7 is a

direct target of different MLL fusion gene products in acute leukemia, like MLL-AF4 and MLL-

AF9. The resulting up-regulated EPHA7 levels are accompanied by an increase in

phosphorylated ERK.38 The deletions of this gene identified in the hypodiploid ALL cohort,

however, are homozygous and lead to a complete loss of a functional gene product.

Deletions targeting intron 1 of GAB2 (GRB2-associated binding protein 2) were found in

two near haploid cases and one low hypodiploid case. GAB2 is a member of the GRB2-

associated binding protein gene family, is an activator of phosphatidylinositol-3 kinase39, and

has been shown to be a mediator for the pathogenic effects of Ptpn11 mutations in mice.40

PDS5B/APRIN (PDS5, regulator of cohesion maintenance, homolog B) was deleted in

two near haploid cases. The protein encoded by PDS5B/APRIN is cohesion-associated and is

involved in accurate chromosome segregation during mitosis. Deletion and down-regulation of

this gene have been reported in a variety of cancers and cancer cell lines.41-46

RASA2 (RAS p21 protein activator 2) also known as GAP1m, a member of the GAP1

family of GTPase-activating proteins.47,48 RASA2 has a perinuclear localization and binds

inositol 1,3,4,5-tetrakisphosphate (IP4), which is a compound suggested to function as a second

messenger.49 Focal deletion of this gene was identified in two near haploid cases, both of which

harbored an alteration in the Ras signaling pathway (NF1 deletion and NRAS mutation,

respectively; Supplementary Table 12).

Two low hypodiploid ALL cases harbored an amplification of the first exon of SMAD2.

The protein encoded by this gene is a mediator of TGF signaling and a transcriptional

modulator, ultimately controlling apoptosis, cell proliferation and differentiation. SMAD2 (MAD

homolog 2) has previously been shown to be inactivated in cancer by missense, nonsense and

frame shift mutations, focal deletions and by loss of the entire chromosomal region.50-52

Additional histone modifier genes mutated in next-generation sequenced hypodiploid

ALL

Details for all the mutations below are presented in Supplementary Tables 7-8 and 20.


11

Histone writers

EHMT2 (euchromatic histone-lysine N-methyltransferase 2) encodes a protein

methyltransferase that mediates silencing of specific genes during endotoxin shock via

dimethylation of H3K9.53,54 One near haploid case harbored a somatic missense alteration

(p.Glu883Gln) that is predicted to be deleterious.

PRDM1 encodes a repressor of IFNB1 (Interferon-β) expression via direct binding to the

IFNB1 promoter55 and by assembling silent chromatin over the IFNB1 promoter when in

complex with EHMT2.56 A somatic 3’-UTR mutation was identified in one near haploid case.

The protein encoded by MLL2 (myeloid/lymphoid or mixed-lineage leukemia 2) is a

histone methyltransferase that methylates H3K4.57,58 One near haploid case harbored a somatic

missense alteration (p.Val4642Ile) in the MLL2 gene.

One near haploid case harbored a WHSC1 p.Glu1099Lys substitution that is predicted

to be deleterious. WHSC1, also known as MMSET, encodes a histone methyltransferase that

methylates H3K36, and alteration of the WHSC1 expression affects cell growth, adhesion and

access to chromatin.59,60

UBR4 (Ubiquitin protein ligase E3 component n-recognin 4) encodes an E3 ubiquitin

ligase, and its family member UBR2 has been shown to be a H2A ubiquitin ligase.61,62 One low

hypodiploid case harbored a somatic mutation in the exon 19 splice region and one low

hypodiploid tumor/normal pair had a p.Arg1349His substitution.

The gene encoding the histone methyltransferase protein Nuclear receptor binding SET

domain protein 1 (NSD1) harbored a 3’UTR mutation in one near haploid case60.

Histone erasers

USP7 (ubiquitin specific peptidase 7) encodes a histone deubiquitylating enzyme, which has a

wide variety of targets that includes Histone H2B.63 Overexpression of USP7 has been linked to

prostate, bladder, colon, liver and lung cancer.64,65 One low hypodiploid case harbored a USP7

missense substitution (p.Ala381Thr) that is predicted to be deleterious.

Lysine (K)-specific demethylase 1A (encoded by KDM1A) is a nuclear protein that is a

component of several histone deacetylase complexes, but usually silences genes by functioning

as a histone demethylase of H3K4.66,67 Inhibition of KDM1A activity has been proposed as a

therapeutic strategy in cancer.68 A somatic nonsense mutation was identified at codon 417 of

this gene in one near haploid case.

USP22 is a gene encoding a member of a TFTC/STAGA histone acetyltransferase

complex that mediates a histone H2A and H2B deubiquitinase activity.69 There is evidence for


12

USP22 being an oncogene, with down-regulation of this gene being associated with a reduction

of cyclin D2 levels, while high expression in colorectal carcinoma was associated with higher

levels of amongst others c-Myc and pAKT in primary tumor tissue.70 A focal deletion in this gene

was identified in one low hypodiploid ALL case.

HDAC2 encodes one of five proteins known to deacetylate H3K56 (the other four are

SIRT1, SIRT2, SIRT3 and HDAC1).71 The use of histone deacetylase inhibitors is in advanced

clinical development as cancer therapeutic agents.72-74 One near haploid case harbored a

somatic HDAC2 missense substitution (p. Ser118Pro) that is predicted to be deleterious.

Histone readers

BRDT (Bromodomain, testis-specific) has the ability to recognize acetylated lysines.60 A BRDT

missense substitution with a predicted deleterious effect (p.Arg532Gln) was identified in one low

hypodipoloid case.

SFMBT2 belongs to the Scm family of Polycomb transcriptional represseor genes. The

encoded protein has four MBT (Malignant Brain Tumor) domains that are known to have tumor

suppressor activity. deletion in near haploid.75,76 A focal deletion of this gene was identified in

one near haploid case.

Histone binders

ASXL3 belongs to the ASXL family that encodes orthologs of the Drosophila Additional sex

combs (Asx) gene that is an enhancer of both the polycomb and trithorax group gene77. A

predicted deleterious p.Thr1243Ala substitution was identified in a low hypodiploid case.

Binders of histone writers

NFYC encodes one subumit of the trimerix complex NF-Y, which is a highly conserved

transcription factor that binds with high specificity and affinity to CCAAT motifs in various

promoter regions. NF-Y recruits ASH2L, a subunit of MLL, which is a complex that methylates

Lysine 4 on histone 3 (H3K4).78 One near haploid case harbored a p.Pro240Lys substitution

with a predicted deleterious effect.

Binders of histone erasers

PHF12 (PHD zinc finger transcription factor) encodes a protein that with HDAC1 forms a protein

complex involved in transcription regulation. The ability of PHF12 to interact with chromatin is

necessary for the complex to bind upstream of the promoter of the regulated genes. Inactivation


13

of this protein complex promotes the progression of RNAP II within transcribed regions and thus

increased transcription.79 One low hypodiploid case harbored a p.Glu986Ala substitution.

The chromodomain helicase DNA binding (CHD) genes CDH3 and CHD4 encode

proteins that are part of the Mi2–nucleosome remodeling and deacetylase (Mi2-NuRD) complex.

The Mi2-NuRD complex couples histone deacetylation and chromatin remodeling, mediating

repressive functions that affect transcriptional regulation, replication, DNA repair and

determination of cell fate.80-82 One CHD3 splice region mutation and one CHD4 missense

alteration (p.Asn1131Ile) that is predicted to be deleterious were identified in near haploid

cases.

Histone DNA modifiers

Cell division control protein 6, encoded by CDC6, is essential for the initiation of DNA replication

by being responsible for the loading of mini-chromosome maintenance (MCM) proteins onto

replication origins.83 A near haploid case harbored a predicted deleterious substitution in CDC6

(p.Glu402Gln).

TET1 and TET3 belong to the Ten-eleven translocation gene family. The encoded

proteins are members of a DNA hydroxylase family that possess enzymatic activity toward 5-

methylcytosine (5mC). They can convert 5mC into 5-hydroxymethylcytosine, which may

influence maintenance of DNA methylation.83,84 A TET1 3’-UTR mutation was identified in one

near haploid case and a TET3 missense substitution (p.Gly795Asp) that is predicted to be

deleterious in a low hypodiploid case.

The protein encoded by MBD5 contains a methyl-binding domain that is required for

localization to chromatin, and may contribute to the formation or function of heterochromatin.85

An MBD5 p.Ser1097Ile substitution with a predicted deleterious effect was identified in a low

hypodiploid case.

Chromatin remodeling

ARID1A belongs to the SWI/SNF family, the members of which have ATPase and helicase

activities. The ARID1A protein is part of the large ATP-dependent chromatin remodeling

complex SNF/SWI that is required for activation of transcription of genes normally repressed by

chromatin.86,87 One near haploid case harbored a p.Pro1384Ser substitution in the ARID1A

gene. This mutation was predicted to be deleterious. As stated above, deletions were identified

directly above the gene family member ARID1B in two near haploid cases and one near diploid

case harbored a deletion in that gene (Supplementary Tables 10 and 12).


14

Histone genes

The HIST1H2BK gene is located in a histone cluster on chromosome 6p21.33, and encodes a

member of the histone H2B family. A Gly14Ser substitution with a predicted deleterious effect

was identified in one near haploid case. In addition, as mentioned in the main text, recurrent

deletions in a histone cluster at 6p22 was identified in 19.1% of near haploid cases (Table 1,

and Supplementary Tables 12 and 20).

Two potential open reading frames in the NALM-16 NF1 transcript

To define the consequences of the exon 15-35 deletion of NF1, we performed transcriptome

sequencing (RNA-seq) of the near haploid NALM-16 ALL cell line88, which harbors the same

intragenic NF1 deletion that results in splicing of exons 14 to 36 (Supplementary Fig. 5). This

identified a 9.18 kb long NF1 transcript with two potential open reading frames (ORFs). Mutant

ORF1 is translated from the canonical translational start site and encodes a truncated protein

with a premature stop in exon 36, downstream of the deletion. Mutant ORF2 encodes a C-

terminal fragment of Neurofibromin (amino acids 1792-2818, NP_000258.1), translated from a

start codon located in exon 37 downstream of the deletion. Immunoblot analysis on NALM-16

and THP-1 extracts using antibodies specific for the NF1 N-terminus (sc-68) and NF1 C-

terminus (sc-67) detected the full length NF1 protein in THP-1 (an acute monocytic leukemia

cell line lacking an NF1 alteration and with high NF1 mRNA levels as assessed by gene

expression profiling; Ref 89 and data not shown) but not in NALM-16. Further, this antibody

failed to detect the putative ORF1 and ORF2 products in the NF1 extract, indicating that no NF1

protein is produced in cells harboring the exon 15-35 deletion (Supplementary Fig. 6).

Verification of genetic alterations in xenografted primary hypodiploid ALL cells

The panel of hypodiploid ALL xenografts established showed a remarkable consistency in the

tempo of engraftment between transplant replicates (2-3 mice transplanted per primary tumor).

To confirm the presence of human leukemia in the xenografted mice, an immunohistochemical

analysis was performed on a subset of xenografted tumors (4 tumors, all from different primary

cases), identifying leukemic cells positive for human CD45 in tissues including spleen,

meninges and sternal marrow (Supplementary Fig. 21). Further, DNA extracted from bone

marrow of xenografted mice was analyzed for copy number alterations by Affymetrix SNP 6.0

microarrays (7 tumors from 3 different primary cases). In six xenografts derived from two


15

primary tumors, the patterns of aneuploidy and focal DNA copy number alterations were

identical to those identified in the primary tumors (Supplementary Fig. 22a-b). A xenograft

derived from a third primary tumor acquired three regions of amplification, two of which were

focal (at chromosomes 2p24.2 and 9p13.3), and one of which was approximately 10Mb in size

(19p13.3-p13.12) (Supplementary Fig. 22c). Each of these three regions was located on

aneuploid chromosomes, and the amplifications resulted in the acquisition of copy-neutral LOH

in the regions of copy number gain (data not shown). This tumor also acquired a focal deletion

of AUTS2 at 7q11.22, leading to complete loss of this gene as the other chromosome was

already lost in the primary tumor. Importantly, the focal deletion of NF1 exons 15-35 present in

the primary tumor was also present in the xenograft (Supplementary Fig. 22c).

Minimal Residual Disease status and PAG1 alterations are associated with poor outcome

Associations between karyotype, genetic lesions, clinical features and outcome were analyzed.

Both near haploid and low hypodiploid ALL are associated with poor outcome, with no

significant difference between these subgroups (Supplementary Table 29). In accordance with

prior studies9, near haploid and low hypodiploid ALL had a higher incidence of relapse

compared to near diploid ALL (Supplementary Table 30). As expected, near haploid and low

hypodiploid ALL exhibited a high frequency of positive minimal residual disease (MRD ≥0.01%;

40% and 42.9%, respectively) at the end of induction (day 29) compared to near diploid ALL

(6.7%; Supplementary Table 31).

In univariate analysis, the degree of aneuploidy, MRD status and IKZF2 and PAG1

alterations were associated with poor outcome, and PAX5 alterations with favorable outcome

(Supplementary Tables 30-33). MRD status and PAG1 alterations were associated with poor

outcome also in multivariable analyses (Supplementary Table 34).


16

SUPPLEMENTARY TABLES

Supplementary Table 1: Pediatric hypodiploid ALL cohort.

See Excel Table: “Table_S1_Pediatric_hypodiploid_ALL_cohort.xlsx”

D, diagnosis; G, germline (remission material); R, relapse; WGS, whole genome sequencing; WES, whole exome sequencing; GEP, gene expression profiling; COG, Children’s Oncology Group.

Supplementary Table 2: Adult ALL cohort.

See Excel Table: “Table_S2_Adult_ALL_cohort.xlsx”

D, diagnosis; R, relapse; PH, BCR-ABL1 positive; H50, >50 chromosomes; H47, >47 chromosomes; IMVS, Institute of Medical and Veterinary Science, Adelaide, Australia; PAH, Princess Alexandra Hospital, Woolloongabba, Australia; RMH, Royal Melbourne Hospital, Parkville, Australia; UHN, University Health Network, Toronto, Canada; CALGB, The Cancer and Leukemia Group B.


17

Supplementary Table 3: Whole genome sequencing coverage data.

Average haploid coverage: 44.9 fold (±1.6) for tumor samples and 34.4 fold (±1.3) for normal samples. D, diagnosis; G, germline (remission material)

Patient G / D Nucleotides Sequenced

% Reads Mapped

Genome Coverage

Haploid Coverage

Exon Coverage

% Genomic

bases covered

% Exonic bases

covered

% Coding bases

covered

% SNP Detection

SJHYPO046 G 93,509,941,800 95.23% 27.3 27.86 24.6 97 89 88 99.15

SJHYPO056 G 98,926,517,800 94.66% 28.3 28.42 27 98 91 91 99.36

SJHYPO021 G 106,058,755,000 92.57% 28.8 29.84 25.6 98 94 94 99.37

SJHYPO013 G 103,903,194,200 91.15% 29 29.37 26.3 98 92 90 99.33

SJHYPO055 G 108,917,276,800 95.36% 29.4 29.94 30 98 97 97 99.54

SJHYPO044 G 107,498,752,200 95.04% 29.7 30.5 28.1 98 92 92 99.06

SJHYPO052 G 110,026,458,600 95.91% 29.9 30.34 28.8 98 93 93 99.43

SJHYPO052 D 150,981,391,000 95.89% 30.6 44.02 28.3 97 89 87 99.38

SJHYPO042 G 114,125,730,000 94.82% 30.9 31.47 30 99 97 97 99.52

SJHYPO022 G 118,293,797,200 92.15% 31.3 32.86 27.4 98 94 94 99.01

SJHYPO026 G 111,262,869,400 94.67% 31.7 31.73 31.3 99 99 99 99.54

SJHYPO051 G 109,674,698,800 95.41% 31.9 32.53 29.2 98 90 88 99.12

SJHYPO029 G 120,422,313,200 93.55% 32.2 32.68 33 99 98 98 99.54

SJHYPO040 G 112,724,007,600 93.28% 32.6 33.07 31.3 99 98 98 99.35

SJHYPO029 D 126,566,434,400 92.46% 33.5 33.75 34.3 99 98 99 99.15

SJHYPO020 G 124,887,001,600 94.70% 34.1 35.45 31.7 99 96 96 99.47

SJHYPO056 D 125,840,368,000 95.03% 34.3 34.59 33.7 98 97 97 99.44

SJHYPO123 G 130,329,067,406 95.24% 35.9 36.61 31.9 98 88 86 98.71

SJHYPO051 D 130,004,435,400 95.54% 36 36.78 32.1 98 89 87 98.54

SJHYPO119 D 129,244,870,800 95.04% 36.3 36.83 32.7 98 90 88 98.66

SJHYPO046 D 132,861,794,200 94.98% 37.2 38.4 33.2 97 90 89 99.31

SJHYPO004 G 129,531,260,200 95.57% 37.8 39.14 34.6 99 96 96 99.55

SJHYPO121 G 135,246,155,200 93.67% 39.3 40.69 36.3 99 97 97 99.56

SJHYPO013 D 150,742,264,200 94.95% 39.8 40.5 37.6 99 97 97 99.56

SJHYPO044 D 144,971,006,200 94.68% 41.3 42.3 40.6 99 98 99 99.09

SJHYPO120 G 160,109,976,800 95.83% 41.3 41.83 37 98 91 89 99.25

SJHYPO123 D 152,626,710,348 93.73% 41.5 42.73 36.7 98 90 88 98.98


18

Patient G / D Nucleotides Sequenced

% Reads Mapped

Genome Coverage

Haploid Coverage

Exon Coverage

% Genomic

bases covered

% Exonic bases

covered

% Coding bases

covered

% SNP Detection

SJHYPO002 D 142,284,502,000 95.58% 41.6 42.93 36.3 99 94 93 99.46

SJHYPO002 G 144,479,906,000 95.39% 42.5 43.9 37.4 99 94 93 99.38

SJHYPO120 D 151,205,890,800 95.77% 42.6 43.14 37 98 88 86 98.69

SJHYPO006 G 148,819,701,800 95.76% 43.7 44.89 39.3 99 95 95 99.48

SJHYPO004 D 170,082,231,800 94.49% 43.9 44.52 43.6 99 98 99 99.57

SJHYPO006 D 149,759,844,600 95.87% 44 45.72 39.4 98 94 94 99.31

SJHYPO119 G 164,845,521,200 96.44% 44.3 45.34 38.5 98 90 89 99.26

SJHYPO055 D 185,146,504,000 95.09% 47.3 48.53 45.2 98 98 98 99.61

SJHYPO021 D 194,894,104,400 91.72% 47.7 50 43.3 99 97 97 97.43

SJHYPO022 D 193,078,257,200 91.66% 47.9 51.31 41.7 98 96 96 98.96

SJHYPO042 D 193,520,383,400 93.47% 49.9 51.85 47.9 99 99 99 99.45

SJHYPO040 D 203,845,340,000 91.56% 51.6 53.62 47.5 98 97 97 99.4

SJHYPO020 D 216,676,659,400 94.41% 52.6 58.32 48.2 99 98 98 99.43

SJHYPO026 D 216,234,398,400 94.70% 56 57.23 56.9 99 99 99 99.01

SJHYPO121 D 215,636,739,800 94.61% 60.7 63.44 55.8 99 98 98 99.49


19

Supplementary Table 4: Whole exome sequencing coverage data. D, diagnosis; G, germline (remission material); R, relapse

Case G / D /

R Nucleotides Sequenced

% Reads Mapped

Duplication Rate

% Covered Coding Bases ≥ 10x



SJHYPO001 D 36,203,643,314 98.2% 0.18 98.0 96.3 94.6

SJHYPO001 G 23,676,803,494 89.8% 0.096 93.4 89.2 85.4

SJHYPO005 D 18,219,143,560 98.6% 0.15 97.0 94.3 91.9

SJHYPO005 G 19,460,765,244 98.4% 0.13 96.9 94.2 91.8

SJHYPO009 D 17,764,641,338 98.5% 0.25 96.7 93.7 90.7

SJHYPO009 G 14,040,901,830 98.0% 0.12 96.4 93.1 90.1

SJHYPO009 R 8,842,150,848 99.1% 0.23 93.3 87.1 78.0

SJHYPO012 D 14,348,121,812 96.9% 0.49 89.9 82.4 74.5

SJHYPO012 G 15,199,382,132 95.2% 0.36 92.1 87.1 81.9

SJHYPO014 D 23,025,245,932 98.2% 0.13 97.6 95.5 93.6

SJHYPO014 G 20,245,193,662 98.7% 0.15 97.6 95.4 93.1

SJHYPO016 D 14,199,789,458 96.5% 0.23 91.9 86.7 81.5

SJHYPO016 G 10,731,147,788 95.1% 0.19 94.6 90.2 85.8

SJHYPO019 D 7,772,516,004 98.6% 0.27 91.7 84.0 73.4

SJHYPO019 G 9,554,828,260 98.8% 0.2 94.2 90.2 84.7

SJHYPO024 D 14,791,275,674 99.1% 0.18 95.3 93.1 90.6

SJHYPO024 G 20,608,688,016 99.2% 0.24 95.7 94.1 92.4

SJHYPO032 D 16,899,506,042 98.0% 0.094 93.7 89.6 86.0

SJHYPO032 G 14,253,139,392 98.4% 0.15 93.7 89.3 85.1

SJHYPO036 D 25,996,903,080 99.1% 0.21 96.2 95.1 94.0

SJHYPO036 G 16,179,316,452 99.2% 0.18 95.7 94.1 92.1

SJHYPO037 D 11,345,339,292 98.1% 0.56 91.5 83.0 71.0

SJHYPO037 R 11,900,972,410 99.0% 0.5 93.2 87.5 79.1

SJHYPO039 D 11,917,553,580 90.1% 0.11 89.1 81.8 74.9

SJHYPO039 G 12,215,196,742 98.2% 0.12 92.8 87.8 82.6

SJHYPO041 D 5,202,479,296 98.7% 0.33 87.0 70.6 50.2

SJHYPO041 G 8,122,168,106 99.1% 0.23 93.9 88.8 81.1

SJHYPO045 D 10,228,524,600 86.0% 0.048 82.8 78.6 74.2

SJHYPO045 G 12,959,649,308 77.4% 0.054 82.7 78.6 74.6

SJHYPO047 D 11,252,109,626 99.0% 0.21 94.8 91.7 87.5

SJHYPO047 G 14,875,868,628 99.2% 0.27 95.2 92.9 89.9

SJHYPO052 R 9,029,261,630 98.7% 0.26 93.2 87.1 78.4

SJHYPO116 D 5,890,611,060 95.7% 0.041 90.9 80.3 65.9

SJHYPO116 G 4,953,854,700 96.9% 0.042 90.7 81.0 67.7

SJHYPO117 D 16,385,912,760 99.2% 0.48 94.6 91.2 86.3

SJHYPO117 R 9,911,419,870 98.5% 0.53 89.6 78.6 64.3

SJHYPO124 D 10,739,280,914 99.2% 0.48 92.8 85.2 73.6

SJHYPO124 G 4,325,139,968 98.9% 0.31 84.3 63.8 40.8

SJHYPO125 D 15,139,696,586 96.4% 0.05 91.9 86.5 81.4

SJHYPO125 G 14,135,196,844 95.9% 0.088 91.5 86.3 81.3

SJHYPO126 D 14,091,114,990 99.2% 0.33 95.1 92.2 87.6

SJHYPO126 G 8,951,109,244 98.4% 0.42 91.4 82.2 69.5


20

Supplementary Table 5: Validation frequency of next-generation sequencing data.

Total number of mutations/alterations per next generation sequencing (NGS) technique is indicated as well as validation percentages. WES, whole exome sequencing; WGS, whole genome sequencing; SNV, single nucleotide variation; Indel, insertion/deletion mutation.

NGS Technique

Mutation type

Somatic Somatic

% Non-

tumor Non-

tumor % Wild-type

Wild-type %

WES SNV/Indel 229 72.9 33 10.5 52 16.6

WES SV 1 50 0 0 1 50

WGS SNV/Indel 417 89.7 33 7.1 15 3.2

WGS SV 95 86.4 10 9.1 5 4.5

WES & WGS All 742 83.3 76 8.5 73 8.2


21

Supplementary Table 6: Number of sequence mutations, copy number alterations and structural variants identified by next-generation sequencing.

Tier1: Coding synonymous, nonsynonymous, splice site, and non-coding RNA variants; Tier2: Conserved variants; Tier3: Variants in non-repeat masked regions; Tier4: Remaining SNVs. SNV, single nucleotide variation; Indel, insertion/deletion mutation; CDS, Coding DNA sequence; HQ, high quality; SV, structural variation; CNA, copy number alteration; N, number; Mb, megabases; AA, amino acid; UTR, untranslated leader region; Amp, amplification; Del, deletion. * Including numbers based on whole chromosome gain and loss.


22

Sample SNVs SNVs SNVs Indels HQ

SNVs HQ

SNVs HQ

SNVs SVs

CNA (N) *

CNA (Mb) *

CNA (N) *

CNA (Mb) *

Tier1 AA Change

Tier1 UTRs

Tier1 Silent

CDS Tier2 Tier3 Tier4

Amp Amp Del Del

SJHYPO002-D 2 1 5 2 32 222 1708 2 0 0 29 2455

SJHYPO006-D 11 6 10 0 50 522 2050 5 0 0 40 2725

SJHYPO020-D 4 3 0 1 7 149 1762 3 0 0 25 2219

SJHYPO021-D 7 4 1 1 33 261 1672 4 0 0 29 2757

SJHYPO029-D 5 6 0 2 25 260 2070 3 17 555 18 0.8

SJHYPO040-D 7 13 2 1 40 336 2100 4 2 0.007 30 2725

SJHYPO042-D 6 2 1 2 29 297 2135 2 13 632 11 0.2

SJHYPO044-D 49 28 11 5 198 2011 3608 12 36 548 15 1

SJHYPO046-D 35 42 12 2 242 2557 4497 2 0 0 20 2600

SJHYPO056-D 5 5 0 4 9 150 1792 2 0 0 34 2726

SJHYPO123-D 15 16 5 1 96 927 2092 14 1 0.002 37 2505

SJHYPO004-D 5 1 1 0 27 243 2308 3 1 0.0001 21 1397

SJHYPO013-D 7 4 0 1 27 323 1675 2 1 0.1 20 1866

SJHYPO022-D 14 6 2 1 38 443 1342 7 0 0 23 1292

SJHYPO026-D 5 6 4 1 19 194 1094 4 0 0 15 1427

SJHYPO051-D 6 6 4 0 41 330 1022 9 3 0.002 30 1565

SJHYPO052-D 8 3 1 0 42 315 1554 3 1 0.01 22 1415

SJHYPO055-D 12 0 1 3 47 405 1680 6 28 1720 9 56

SJHYPO119-D 4 7 0 0 33 274 1117 5 1 0.009 20 1397

SJHYPO120-D 11 0 1 1 37 398 1256 22 15 81 32 980

Median 7 6 1 1 33 315 1708 4 1 22

Mean 10.9 8 3.1 1.4 53.6 530.9 1926.7 5.7 6 24

Range 2-49 0-42 0-12 0-5 7-242 149- 2557 1022-4497 2-22 0-36 9-40


23

Supplementary Table 7: Mutations identified by next-generation sequencing.

See Excel Table: “Table_S7_NGS_SNVs_Indels.xlsx”

Somatic and putative germline deleterious single nucleotide variations (SNVs) and insertion/deletion mutations (Indels) identified by whole genome- and whole exome sequencing of a subset of the hypodiploid ALL cohort. Putative germline variants are highlighted in yellow. D, diagnosis; R, relapse. Column definition is listed below: A. GeneName: HUGO gene symbol B. VarType: SNV, single nucleotide variation; Indel, insertion/deletion mutation C. Sample: Hypodiploid ALL sample ID D. Chr: chromosome E. Position: chromosome position in hg19 coordinates F. Class: classification based on amino acid change pattern. ‘exon’, mutation in non-coding RNA genes; ‘splice_region’ mutation not directly affecting the canonical splice sites but located within 10bp of the canonical splice sites. G. AAChange: predicted amino acid change for the mutation H. ProteinGI: NCBI protein GI number I. mRNA_acc: RefSeq accession number J. Mut Reads Diagnosis: number of NGS reads containing mutant allele (diagnosis) K. Total Reads Diagnosis: number of NGS reads covering the site (diagnosis) L. Mut Reads Relapse: number of NGS reads containing mutant allele (relapse) M. Total Reads Relapse: number of NGS reads covering the site (relapse) N. Mut Reads Normal: number of NGS reads containing mutant allele (normal) O.Total Reads Normal: number of NGS reads covering the site (normal) P. Reference Allele: the allele represented in the reference human genome. Reference allele is marked as ‘–‘ for an insertion. Q. Non-reference Allele: the mutated allele R. Flanking: 20bp [reference allele/mutant allele] 20bp S. Status: somatic or germline mutation (germline referring to non-tumor cells) T. SIFTResult: ‘deleterious status’ assigned by SIFT U. pph2result: ‘deleterious status’ assigned by polyPHEN2


24

Supplementary Table 8: Structural variations identified by whole genome sequencing.

See Excel Table: “Table_S8_WGS_SVs.xlsx”

Somatic structural variations identified by whole genome sequencing of a subset of the hypodiploid ALL cohort. CDS, coding DNA sequence.

Column definition is listed below: A. Sample: Hypodiploid ALL sample ID B. ChrA: Chromosome for breakpoint A C. PosA: Position of breakpoint A D. OrientationA: + Region to the left of PosA is included in mutant genotype - Region to the right of PosA is included in mutant genotype E. ChrB: Chromosome for breakpoint B F. PosB: Position of breakpoint B G. OrientationB: + Region to the right of PosB is included in mutant genotype - Region to the left of PosB is included in mutant genotype H. Type: INS, insertion; DEL, deletion; INV, inversion; ITX, intrachromosomal

translocation; CTX, interchromosomal translocation I. Usage: GENIC: Both endpoints were in genes: checked for fusion

HALF_INTERGENIC: One endpoint was in a gene: checked for truncation INTERGENIC / INTRONIC: Neither endpoint was in a gene or both were in the same intron of a gene; no gene fusion or truncation INVERTED_REPEAT: Both endpoints were in the same gene, but in opposite orientations: checked for truncation

J. Gene: Fusion or truncated gene that would result from structural variation K. Chromosomes: Chromosomes involved in the rearrangement L. Tx: Number of predicted fusion transcripts M. Valid CDS: Number of predicted fusion transcripts with an annotated CDS start and stop N. In-Frame CDS: Number of “Valid CDS” transcripts with a CDS length divisible by three. O. Mod. In-Frame CDS: Number of “In-Frame CDS” transcripts that are not identical to an

existing annotated transcript. P. mutA: Number of reads supporting the structural variation at breakpoint A Q. mutB: Number of reads supporting the structural variation at breakpoint B R. Validation Status:

Valid: The SV has been experimentally validated Putative: The SV has yet to be validated


25

Supplementary Table 9: Genes resequenced.

CDS, coding DNA sequence.

Gene Genbank Accession Number Exons sequenced

CBL NM_005188.2 8-9

CRLF2 NM_022148.2 6

ETV6 NM_001987.4 CDS

FLT3 NM_004119.2 14, 20 and coding region of 24

IKZF1 NM_006060.3 CDS



JAK1 NM_002227.2 13-18

JAK2 NM_004972.3 13-24 and coding region of 25

KIF2B NM_032559.4 CDS

KRAS NM_033360.2 2-3

MAPK1 NM_138957.2 CDS

NF1 NM_000267.2 CDS

NRAS NM_002524.3 2-3

PAG1 NM_018440.3 CDS

PAX5 NM_016734.1 CDS

PTPN11 NM_002834.3 3, 4 and 13

RB1 NM_000321.2 CDS

TP53 NM_000546.4 CDS


26

Supplementary Table 10: Regions of copy number alterations and copy-neutral loss-of-heterozygosity in hypodiploid ALL. See Excel Table: “Table_S10_SNP_data.xlsx” The table lists all regions of copy number alterations (CNAs) identified by manual curation of circular binary segmentation data for the hypodiploid ALL cohort, and copy-neutral loss-of-heterozygosity (CN LOH) identified by dChip using the Hidden Markov Model algorithm. CNAs smaller than 8 SNP and/or copy number probes have been filtered. Final lesion listings exclude DNA gains and losses arising from antigen receptor gene rearrangements at 2p11.2 (IGK@), 7p14.1 (TRG@), 7q34 (TRB@), 14q11.2 (TRA@), 14q32.33 (IGH@) and 22q11.22 (IGL@). The workbook contains 5 sheets, with the near haploid, masked near haploid, low hypodiploid, masked low hypodiploid and near diploid cases in different sheets. Del, deletion; Homo, homozygous; Hemi, hemizygous; Subpop, subpopulation; R, relapse. “Duplicated genome” indicates lesions and whole chromosomal events affected by reduplication of the hypodiploid genomic complement in the masked near haploid and low hypodiploid ALL cases. Masked hypodiploid cases do here refer to cases with either a pure doubled hypodiploid clone or cases harboring a doubled clone constituting at least 30%. The analyses were initially performed in human assembly hg18, on which the Affymetrix SNP 6.0 microarray is based, and then mapped to hg19 using a method described previously90. Both hg18 and hg19 coordinates are included in the table.

A. ID: Sample B. Comment: lesion type C. Chrom: Chromosome D. Cytoband: Sublocation on chromosome E. loc.start_hg18: Chromosomal start position of lesion based on Human genome build 18 F. loc.end_hg18: Chromosomal end position of lesion based on Human genome build 18 G. loc.start_hg19: Chromosomal start position of lesion based on Human genome build 19 H. loc.end_hg19: Chromosomal end position of lesion based on Human genome build 19 I. LiftOverStatus: One of the following: “complete” (all bases in the original hg18 segment are

successfully remapped to hg19); “partial” (not all, but >50% of the bases are remapped, with the ratio of remapping); “suspicious” (>50% of the bases are remapped, but did not pass subsequent QA); “failed” (>50% of the bases cannot be remapped).

J. num.mark: Number of probes included in the segment K. seg.mean: log2 ([normalized tumor signal]/[normalized normal signal]) L. seg.observedCN: Absolute copy number M. seg.size (kb): Size of segment in kilobases N. total # of gene in the segment: Number of genes included in segment O. first 10 genes in segment: Lists the names of the first 10 genes in the segment P. total # of miRNA in the segment: Number of miRNAs included in segment Q. first 10 miRNAs in segment: Lists the names of the first 10 miRNAs in the segment


27

Supplementary Table 11: Mutations identified by Sanger sequencing in the hypodiploid ALL cohort. See Excel Table: “Table_S11_Sanger_mutations.xlsx” Somatic and putative germline deleterious single nucleotide variations (SNVs) and insertion/deletion mutations (Indels) identified by Sanger sequencing of the entire hypodiploid ALL cohort. Column definition is listed below: A. Gene Name: HUGO gene symbol B. VarType: SNV, single nucleotide variation; Indel, insertion/deletion mutation C. Sample: Hypodiploid ALL sample ID D. Chr: chromosome E. Position: chromosome position in hg19 coordinates F. Class: classification based on amino acid change pattern. ‘exon’, mutation in non-coding

RNA genes; ‘splice_region’ mutation not directly affecting the canonical splice sites but located within 10bp of the canonical splice sites.

G. AAChange: predicted amino acid change for the mutation H. ProteinGI: NCBI protein GI number I. mRNA_acc: RefSeq accession number J. Mutant peak intensity (%): Mutant peak size of total peaks K. Reference Allele: the allele represented in the reference human genome. Reference allele

is marked as ‘–‘ for an insertion. L. Non-reference Allele: the mutated allele M. Flanking: 10bp [reference allele/mutant allele] 10bp N. Status: somatic or germline mutation (germline referring to non-tumor cells) O. SIFTResult: ‘deleterious status’ assigned by SIFT P. SIFTScore Q. pph2result: ‘deleterious status’ assigned by polyPHEN2 R. pph2score


28

Supplementary Table 12: Copy number alterations and mutations. See Excel Table: “Table_S12_Specific_lesion_information.xlsx” Unless otherwise stated, genes were not sequenced. Paired or unpaired indicate whether a matched normal DNA sample was available. Masked hypodiploid cases here refer to cases with either a pure doubled hypodiploid clone or cases harboring a doubled clone constituting at least 30%. NH, near haploid (24-31 chromosomes); mNH, masked near haploid (2x24-31 chromosomes); LH, low hypodiploid (32-39 chromosomes); mLH, masked low hypodiploid (2x32-39 chromosomes); ND, near diploid (44-45 chromosomes); CNA, copy number alteration; Seq mut, sequence mutation; Del, deletion; Amp, amplification; Homo, homozygous; Het, heterozygous; e, exon; i, intron; LOH, loss-of-heterozygosity; US, upstream; DS, downstream; † Concomitant deletion of the other corresponding chromosomal copy, giving rise to a bi-allelic mutational event; § Mutation present in matched remission sample; §§ Directly upstream of gene in question; ¥ Deleted as part of rearrangement of the immunoglobulin lambda light chain locus at 22q11.22.


29

Supplementary Table 13: Association between aneuploidy and lesions.

P values were calculated by an Exact Chi-Square test (2x5) and values <0.05 are highlighted, as well as the subgroup(s) that are associated with a high frequency of the lesion in question. Signaling indicates genes involved in RTK- and/or Ras signaling. Masked hypodiploid cases here refer to cases with either a pure doubled hypodiploid clone or cases harboring a doubled clone constituting at least 30%. CNA, copy number alteration; Seq. mut., sequence mutation; pwy, pathway; NH, near haploid; mNH, masked near haploid; LH, low hypodiploid; mLH, masked low hypodiploid; ND, near diploid.

Gene Hypodiploid subtype

n= Normal (%)

Deleted or mutated

(%)

Two-sided P values

Bonferroni step down adjusted

P values

CDKN2A/B, CNA NH 50 76 24 1.57x10-6 2.51x10-5

mNH 18 83.3 16.7

LH 26 88.5 11.5

mLH 8 37.5 62.5

ND 22 22.7 77.3

Histone cluster, 6p22, CNA NH 50 82 18 0.206 1

mNH 18 77.8 22.2

LH 26 96.2 3.8

mLH 8 100 0

ND 22 90.9 9.1

JAK1, Seq. mut. NH 50 100 0 0.097 1

mNH 18 100 0

LH 26 100 0

mLH 8 100 0

ND 22 90.9 9.1

FLT3 (Signaling), Seq. mut. NH 50 90 10 0.218 1

mNH 18 94.4 5.6

LH 26 100 0

mLH 8 100 0

ND 22 100 0

KRAS (Signaling), Seq. mut. NH 50 96 4 0.373 1

mNH 18 100 0

LH 26 100 0

mLH 8 100 0

ND 22 90.9 9.1

NF1 (Signaling), CNA and seq. mut. NH 50 56 44 2.77x10-4 3.6x10-3

mNH 18 55.6 44.4

LH 26 92.3 7.7

mLH 8 87.5 12.5

ND 22 95.5 4.5

NRAS (Signaling), Seq. mut. NH 50 86 14 0.181 1

mNH 18 83.3 16.7

LH 26 100 0

mLH 8 100 0

ND 22 81.8 18.2

PTPN11 (Signaling), Seq. mut. NH 50 98 2 0.242 1

mNH 18 100 0

LH 26 100 0

mLH 8 100 0

ND 22 90.9 9.1

Signaling combined NH 50 30 70 3.29x10-8 6.25x10-7

mNH 18 27.8 72.2

LH 26 96.2 3.8

mLH 8 87.5 12.5

ND 22 68.2 31.8


30

Gene Hypodiploid subtype

n= Normal (%)

Deleted or mutated

(%)

Two-sided P values

Bonferroni step down adjusted

P values

PAG1, CNA and seq. mut. NH 50 88 12 0.294 1

mNH 18 94.4 5.6

LH 26 96.2 3.8

mLH 8 100 0

ND 22 100 0

RB1, CNA and seq. mut. NH 50 90 10 1.28x10-4 1.79x10-3

mNH 18 94.4 5.6

LH 26 57.7 42.3

mLH 8 62.5 37.5

ND 22 0 0

TP53, Seq. mut. NH 50 98 2 4.65x10-19 1.02x10-17

mNH 18 94.4 5.6

LH 26 3.8 96.2

mLH 8 25 75

ND 22 95.5 4.5

IKZF1 (B-pwy), CNA and seq. mut. NH 50 98 2 0.656 1

mNH 18 94.4 5.6

LH 26 96.2 3.8

mLH 8 100 0

ND 22 90.9 9.1

IKZF2 (B-pwy), CNA and seq. mut. NH 50 100 0 8.69x10-12 1.83x10-10

mNH 18 94.4 5.6

LH 26 38.5 61.5

mLH 8 75 25

ND 22 100 0

IKZF3 (B-pwy), CNA and seq. mut. NH 50 86 14 0.135 1

mNH 18 88.9 11.1

LH 26 100 0

mLH 8 87.5 12.5

ND 22 100 0

PAX5 (B-pwy), CNA and seq. mut. NH 50 90 10 1.25x10-7 2.12x10-6

mNH 18 100 0

LH 26 92.3 7.7

mLH 8 100 0

ND 22 40.9 59.1

EBF1 (B-pwy), CNA NH 50 100 0 0.322 1

mNH 18 100 0

LH 26 100 0

mLH 8 100 0

ND 22 95.5 4.5

VPREB1 (B-pwy), CNA NH 50 98 2 0.044 0.485

mNH 18 88.9 11.1

LH 26 92.3 7.7

mLH 8 100 0

ND 22 77.3 22.7

B-pathway combined NH 50 76 24 4.63x10-5 6.95x10-4

mNH 18 66.7 33.3

LH 26 26.9 73.1

mLH 8 62.5 37.5

ND 22 27.3 72.7


31

Supplementary Table 14: Differential expression analysis – NH versus masked NH.

See Excel Table: “Table_S14_NH_vs_mNH_Limma.xlsx”

Differential expression analysis performed by limma with estimation of false discovery rate (FDR) at 0.05 between near haploid (NH) and masked near haploid (mNH) cases. No statistically significant differences were identified between those two hypodiploid subgroups. Masked hypodiploid cases here refer to cases with either a pure doubled hypodiploid clone or cases harboring a doubled clone constituting at least 30%.

Supplementary Table 15: Differential expression analysis – LH versus masked LH.

See Excel Table: “Table_S15_LH_vs_mLH_Limma.xlsx”

Differential expression analysis performed by limma with estimation of false discovery rate (FDR) at 0.05 between low hypodiploid (LH) and masked low hypodiploid (mLH) cases. No statistically significant differences were identified between those two hypodiploid subgroups. Masked hypodiploid cases here refer to cases with either a pure doubled hypodiploid clone or cases harboring a doubled clone constituting at least 30%.


32

Supplementary Table 16: TP53 mutations in adult ALL.

LH, low hypodiploid; H47, >47 chromosomes; NH, near haploid; D, diagnosis; R, relapse; Homo, homozygous; Het, heterozygous; LFS, Li-Fraumeni Syndrome.

Seq ID ALL subgroup

Status TP53 mutation (NM_000546.4)

Homo or het

Status LFS associated or sporadic

Predicted effect Domain Dominant negative

ADT003 LH D R248Q Homo Somatic LFS and sporadic DNA contact DNA binding Yes

ADT017 LH D V173M Homo Somatic LFS and sporadic Deleterious DNA binding Yes

ADT018 LH D V173M Homo No germline LFS and sporadic Deleterious DNA binding Yes

ADT027 LH D Y220H Homo No germline Sporadic Deleterious DNA binding No

ADT028 LH D R249T Homo Somatic Sporadic Deleterious DNA binding N/A

ADT040 T-ALL D and R R175H Homo No germline LFS and sporadic Conformational DNA binding Yes

ADT044 N/A R L265P Homo No germline LFS and sporadic Deleterious DNA binding Yes

ADT044 N/A R R267Q Homo No germline LFS and sporadic Deleterious DNA binding N/A

ADT074 H47 R R213* Homo No germline LFS and sporadic Deleterious DNA binding No

ADT076 Other R R282fs Het No germline Sporadic Truncating

ADT084 Other R L145P Het Somatic Sporadic Deleterious DNA binding N/A

ADT084 Other R G187_E6splice_region Homo Somatic

ADT085 LH D Y220C Homo Somatic LFS and sporadic Deleterious DNA binding Yes

ADT121 Other D GinsR282 Het No germline

ADT122 Other D P219L Het No germline Sporadic Deleterious DNA binding No

ADT122 Other D R273C Het No germline LFS and sporadic Deleterious DNA binding Yes

Adult_Hypo2 LH D R273H Homo No germline LFS and sporadic DNA contact DNA binding Yes

Adult_Hypo3 LH D R249S Het No germline Sporadic Conformational DNA binding Yes

Adult_Hypo4 LH D R273fs Homo No germline Sporadic Truncating

Adult_Hypo5 NH D R290fs Het No germline Sporadic Truncating

Adult_Hypo6 LH D G187_E6splice_region Homo No germline Sporadic


33

Supplementary Table 17: Copy number alterations and mutations in hypodiploid ALL vs non-hypodiploid ALL.

Abnormalities are deletions unless otherwise indicated. The St. Jude (SJ) cohort was studied in Ref29 and consisted of 258 childhood ALL cases divided into high hyperdiploid (H50; >50 chromosomes; n=44), TCF3-PBX1 (n=17), ETV6-RUNX1 (n=50), MLL-rearranged (n=24), BCR-ABL1 (PH; n=21), hypodiploid (Hypo; mainly near diploid cases with a dicentric chromosome; n=10), and other (n=92). The hypodiploid ALL cohort is divided into the near haploid (NH), low hypodiploid (LH) and near diploid (ND) subgroups. § Genes that were sequenced in the hypodiploid ALL cohort but not in the SJ cohort (genes that only are targeted by sequence mutations and not by copy number alteration and that were not sequenced in the SJ cohort are shaded in gray); † Copy number alteration (CNA); *Sequence mutation; **B cell pathway lesions include deletions or sequence mutations involving BLNK, EBF1, IKZF1, IKZF2, IKZF3, LEF1, PAX5, RAG1/2, and TCF3. VPREB1 may be considered part of the B cell pathway but is located in the immunoglobulin lambda light chain locus at 22q11.22, and is commonly deleted upon rearrangement of this locus. The biologic significance of VPREB1 deletions in B-ALL is thereby unclear, and the frequency of B cell pathway lesions is thus shown excluding and including VPREB1 alterations. iAmp21, internal amplification of chromosome 21; pwy, pathway.

Lesion Location SJ cohort

% H50 % TCF3-PBX1

% ETV6-RUNX1

% MLL % PH % Hypo % Other % NH % LH % ND %

n= 258 44 17 50 24 21 10 92 68 34 22

JAK1 * § 1p32.3-p31.3

0 0 0 0 2 9.1

PDE4B 1p31.2 2 0.8 0 0 0 0 2 4.0 0 0 0 0 0 0 0 0 1 1.5 0 0 0 0

NRAS * § 1p13.1

10 14.7 0 0 4 18.2

ADAR 1q22 2 0.8 0 0 0 0 0 0 0 0 0 0 0 0 2 2.2 0 0 0 0 0 0

LOC440742 1q44 2 0.8 0 0 0 0 0 0 0 0 0 0 0 0 2 2.2 0 0 0 0 0 0

1q gain 1q23.3-1qtel 30 11.6 13 29.5 16 94.1 0 0 0 0 0 0 0 0 1 1.1 0 0 0 0 0 0

IKZF2 † or * § 2q34 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1.5 18 52.9 0 0

ARPP-21 3p22.3 8 3.1 1 2.3 0 0 2 4.0 0 0 1 4.8 2 20 2 2.2 1 1.5 0 0 3 13.6

FHIT 3p14.2 12 4.7 0 0 0 0 6 12.0 0 0 2 9.5 1 10 3 3.3 0 0 0 0 0 0

FLNB 3p14.3 7 2.7 1 2.3 0 0 1 2.0 0 0 1 4.8 1 10 3 3.3 0 0 0 0 1 4.5

BTLA/CD200 3q13.2 16 6.2 0 0 0 0 8 16.0 0 0 5 23.8 1 10 2 2.2 2 2.9 0 0 0 0

RASA2 3q22-q23 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2.9 0 0 0 0

MBNL1 3q25.1 9 3.5 2 4.5 0 0 3 6.0 0 0 2 9.5 1 10 1 1.1 0 0 0 0 0 0

TBL1XR1 3q26.32 15 5.8 1 2.3 0 0 8 16.0 1 4.2 1 4.8 0 0 4 4.3 0 0 2 5.9 0 0

IL1RAP 3q28 3 1.2 0 0 0 0 1 2.0 0 0 1 4.8 1 10 0 0 0 0 0 0 0 0

ARHGAP24 4q21.23 2 0.8 0 0 0 0 0 0 0 0 0 0 1 10 1 1.1 0 0 0 0 0 0

NR3C2 4q31.23 10 3.9 0 0 0 0 6 12.0 0 0 0 0 1 10 3 3.3 0 0 0 0 1 4.5

LEF1 4q25 5 1.9 0 0 0 0 2 4.0 0 0 0 0 1 10 2 2.2 0 0 0 0 0 0


34


% H50 % TCF3-PBX1

% ETV6-RUNX1


FBXW7 4q31.3 5 1.9 0 0 0 0 1 2.0 0 0 1 4.8 1 10 2 2.2 1 1.5 0 0 0 0

EBF1 5q33.3 12 4.7 1 2.3 0 0 5 10.0 0 0 3 14.3 1 10 2 2.2 0 0 0 0 1 4.5

Histone cluster 6p22.2 21 8.1 1 2.3 0 0 3 6.0 0 0 3 14.3 3 30 11 12.0 6 8.8 1 2.9 2 9.1

GRIK2 6q16 11 4.3 1 2.3 1 5.9 7 14.0 0 0 0 0 0 0 2 2.2 0 0 0 0 0 0

EPHA7 6q16.1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2.9 0 0 0 0

ARMC2/SESN1 6q21 13 5.0 0 0 0 0 8 16.0 0 0 0 0 0 0 5 5.4 0 0 0 0 0 0

ARID1B 6q25.1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2.9 0 0 1 4.5

4LOC389437 6q25.3 7 2.7 0 0 0 0 4 8.0 0 0 0 0 1 10 2 2.2 0 0 0 0 0 0

IKZF1 † or * 7p13 48 18.6 4 9.1 0 0 0 0 1 4.2 16 76.2 5 50 22 24 3 4.4 1 2.9 2 9.1

CDK6 7q21.2 8 3.1 1 2.3 0 0 0 0 0 0 2 9.5 3 30 2 2.2 0 0 1 2.9 1 4.5

MSRA 8p23 6 2.3 0 0 0 0 2 4.0 0 0 1 4.8 2 20 1 1.1 0 0 0 0 0 0

TOX 8q12.1 11 4.3 0 0 0 0 5 10.0 0 0 1 4.8 0 0 5 5.4 0 0 0 0 0 0

PAG1 † or * § 8q21.13 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8 11.8 1 2.9 0 0

CCDC26 8q24.21 5 1.9 1 2.3 0 0 0 0 0 0 0 0 0 0 4 4.3 0 0 0 0 0 0

JAK2 * § 9p24

1 1.5 0 0 0 0

CDKN2A/B 9p21.3 87 33.7 9 20.5 6 35.3 15 30.0 4 16.7 11 52.4 10 100 32 35 15 22.1 8 23.5 17 77.3

PAX5 † or * 9p13.2 83 32.2 4 9.1 8 47.1 17 34.0 5 20.8 11 52.4 10 100 28 30 5 7.4 2 5.9 13 59.1

ABL1 9q34.13 5 1.9 0 0 0 0 0 0 0 0 4 19.0 1 10 0 0 0 0 0 0 0 0

ADARB2 10p15.2 1 0.4 0 0 0 0 0 0 0 0 1 4.8 0 0 0 0 0 0 0 0 0 0

COPEB/KLF6 10p15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

BLNK 10q24.1 3 1.2 0 0 0 0 2 4.0 0 0 0 0 0 0 1 1.1 0 0 1 2.9 0 0

ADD3 10q25.2 14 5.4 1 2.3 0 0 4 8.0 0 0 5 23.8 0 0 4 4.3 0 0 0 0 1 4.5

FAM53B 10q26.13 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2.9 0 0 0 0

RAG1/2 11p12 15 5.8 0 0 0 0 8 16.0 1 4.2 0 0 0 0 6 6.5 1 1.5 0 0 0 0

NUP160/PTPRJ 11p11.2 1 0.4 0 0 0 0 0 0 0 0 0 0 0 0 1 1.1 0 0 0 0 0 0

GAB2 11q14.1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2.9 1 2.9 0 0

ATM 11q22.3 7 2.7 0 0 0 0 2 4.0 0 0 1 4.8 0 0 4 4.3 0 0 0 0 0 0

CUL5 11q22.3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2.9 0 0 0 0

ETV6 † or * § 12p13.2 63 24.4 5 11.4 0 0 34 68.0 2 8.3 2 9.5 2 20 18 20 5 7.4 0 0 2 9.1

KRAS * § 12p12.1

2 2.9 0 0 2 9.1

BTG1 12q21.33 18 7.0 0 0 0 0 7 14.0 0 0 4 19.0 1 10 6 6.5 0 0 0 0 1 4.5

PTPN11 * § 12q24

1 1.5 0 0 2 9.1

FLT3 * § 13q12

6 8.8 0 0 0 0

ZMYM5 13q12.11 5 1.9 1 2.3 0 0 2 4.0 0 0 0 0 0 0 2 2.2 1 1.5 0 0 0 0

PDS5B/APRIN 13q12.3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2.9 0 0 0 0


35


% H50 % TCF3-PBX1

% ETV6-RUNX1


ELF1 13q14.11 12 4.7 2 4.5 2 11.8 4 8.0 1 4.2 0 0 1 10 2 2.2 1 1.5 0 0 1 4.5

SERP2/TSC22D1 13q14 15 5.8 2 4.5 2 11.8 4 8.0 1 4.2 2 9.5 1 10 3 3.3 0 0 0 0 0 0

RB1 † or * § 13q14.2 15 5.8 3 6.8 2 11.8 2 4.0 2 8.3 4 19.0 0 0 2 2.2 6 8.8 14 41.2 0 0

DLEU2/7/mir15/-16a 13q14 16 6.2 5 11.4 2 11.8 3 6.0 3 12.5 1 4.8 0 0 2 2.2 0 0 0 0 0 0

ATP10A 15q12 5 1.9 0 0 0 0 1 2.0 0 0 1 4.8 1 10 2 2.2 0 0 0 0 0 0

SPRED1 (5’) 15q14 6 2.3 0 0 0 0 0 0 0 0 1 4.8 1 10 4 4.3 1 1.5 0 0 0 0

LTK 15q15.1 6 2.3 0 0 0 0 3 6.0 0 0 0 0 1 10 2 2.2 0 0 0 0 0 0

ANKRD11 16q24.3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 5.9 0 0

TP53 * § 17p13.1

2 2.9 31 91.2 1 4.5

NF1 † or * § 17q11.2 8 3.1 1 2.3 0 0 2 4.0 0 0 0 0 1 10 4 4.3 44.1 3 8.8 1 4.5

IKZF3 † or * § 17q21.1 3 1.2 0 0 0 0 0 0 0 0 0 0 2 20 1 1.1 9 13.2 1 2.9 0 0

SMAD2 18q21.1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 5.9 0 0

TCF3 19p13.3 17 6.6 1 2.3 16 94.1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

C20orf194 20p13 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2.9 0 0 0 0

C20orf94 20p12.2 20 7.8 2 4.5 0 0 7 14.0 0 0 7 33.3 0 0 4 4.3 1 1.5 0 0 0 0

ERG 21q22 14 5.4 0 0 0 0 0 0 0 0 0 0 0 0 14 15 1 1.5 0 0 0 0

iAmp21 21, varies 11 4.3 0 0 0 0 5 10.0 0 0 0 0 0 0 6 6.5 0 0 0 0 1 4.5

VPREB1 22q11.22 80 31.0 7 15.9 1 5.9 35 70.0 1 4.2 7 33.3 3 30 26 28 3 4.4 2 5.9 5 22.7

IL3RA Xp22.33 18 7.0 1 2.3 0 0 6 12.0 0 0 0 0 1 10 10 11 0 0 0 0 0 0

CRLF2 § Xp22.3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2.9 0 0 2 9.1

DMD Xp21.1 11 4.3 1 2.3 0 0 4 8.0 0 0 0 0 0 0 6 6.5 0 0 2 5.9 2 9.1

B pwy ** 137 53.1 11 25.0 17 100 27 54.0 6 25.0 16 76.2 10 100 50 54 16 23.5 22 64.7 14 63.6

B pwy with VPREB1 169 65.5 16 36.4 17 100 42 84.0 6 25.0 16 76.2 10 100 62 67 18 26.5 23 67.6 16 72.7


36

Supplementary Table 18: TP53 mutations in pediatric hypodiploid ALL.

Codons R248, R273 and R282 are hot-spots in LFS. D, diagnosis; R, relapse; Homo, homozygous; Het, heterozygous; LFS, Li-Fraumeni Syndrome; LH, low hypodiploid; NH, near haploid.


37

Seq ID Subgroup TP53 mutation (NM_000546.4)

Homo or het

Status LFS associated or sporadic

Predicted effect

Domain Dominant negative

SJHYPO003-D LH R213* Homo Non-tumor LFS and sporadic Deleterious DNA-binding

SJHYPO004-D LH D49fs Homo Non-tumor Sporadic Truncating Proline-rich

SJHYPO005-D LH G245S Homo Non-tumor LFS and sporadic Deleterious DNA-binding

SJHYPO009-D & R LH R306* Homo Somatic LFS and sporadic Truncating None

SJHYPO012-D LH R248Q Homo Non-tumor LFS and sporadic DNA contact DNA-binding Yes

SJHYPO013-D LH R282fs Homo Somatic Sporadic Truncating DNA-binding

SJHYPO014-D LH C176S Het Somatic Sporadic Deleterious DNA-binding Yes

SJHYPO022-D LH R306fs Het Somatic Sporadic Truncating None

SJHYPO025-D LH F113fs Homo Non-tumor Sporadic Truncating DNA-binding

SJHYPO026-D LH T284>KRRSEETT Het Somatic DNA-binding

SJHYPO027-D LH R306* Homo Non-tumor LFS and sporadic Truncating None

SJHYPO029-D LH L137fs Het Somatic Sporadic Truncating DNA-binding

SJHYPO048-D LH R248W Homo Non-tumor LFS and sporadic DNA contact DNA-binding Yes

SJHYPO051-D LH F109fs Homo Non-tumor Sporadic Truncating DNA-binding

SJHYPO052-D LH exon1-exon7 splicing N/A N/A N/A N/A

SJHYPO053-D LH PinsR282 Homo Somatic

DNA-binding

SJHYPO055-D LH T125R Homo Somatic LFS and sporadic Deleterious DNA-binding

SJHYPO061-D LH R174_C176>R Homo Somatic DNA-binding

SJHYPO062-D NH A88fs Homo Somatic In COSMIC at aa Truncating Proline-rich

SJHYPO063-D LH R280K Homo Non-tumor LFS and sporadic DNA binding DNA-binding Yes

SJHYPO064-D LH R282fs Homo Somatic In COSMIC at aa Truncating DNA-binding

SJHYPO068-D LH R248W Het Somatic LFS and sporadic DNA contact DNA-binding Yes

SJHYPO074-D LH R273C Homo Somatic LFS and sporadic DNA contact DNA-binding

SJHYPO077-D LH Y163N Homo Somatic Sporadic Deleterious DNA-binding Yes

SJHYPO078-D LH R306* Homo Somatic LFS and sporadic Truncating None

SJHYPO079-D LH L130H Homo Non-tumor Sporadic Deleterious DNA-binding

SJHYPO080-D LH R273H Homo Somatic LFS and sporadic DNA contact DNA-binding Yes

SJHYPO083-D LH GinsR282 Homo Somatic DNA-binding

SJHYPO084-D LH Y220C Homo Somatic LFS and sporadic Deleterious DNA-binding Yes

SJHYPO093-D LH R248W Het Somatic LFS and sporadic DNA contact DNA-binding Yes

SJHYPO096-D ND R282>RLA Homo Somatic DNA-binding

SJHYPO119-D LH R273H Homo Non-tumor LFS and sporadic DNA contact DNA-binding Yes

SJHYPO120-D LH R280S Homo Non-tumor Sporadic DNA binding DNA-binding Yes

SJHYPO126-D LH I162fs Homo Non-tumor Sporadic Truncating DNA-binding


38

Supplementary Table 19: IKZF1, IKZF2 and RB1 deletions in adult ALL.

Number (N) and percentage of cases with deletion in the respective gene are indicated. PH, BCR-ABL1 positive; H47, >47 chromosomes; H50, >50 chromosomes; MLL, mixed lineage leukemia; LH, low hypodiploid.

ALL subtype IKZF1

deletion (N)

IKZF1 deletion

(%)

IKZF2 deletion

(N)

IKZF2 deletion

(%)

RB1 deletion

(N)

RB1 deletion

(%)

Low hypodiploid (N=11) 0 0 3 27.3 2 18.2

Near haploid (N=1) 0 0 1 100 1 100

H50 (N=4) 0 0 0 0 0 0

MLL (N=3) 0 0 0 0 0 0

PH (N=31) 17 54.8 0 0 4 12.9

ERG (N=4) 1 25 0 0 2 50

H47 (N=2) 0 0 0 0 0 0

Other (N=40) 7 17.5 0 0 3 7.5

Bi-phenotypic (N=1) 0 0 0 0 0 0

N/A (N=4) 0 0 0 0 0 0

T-ALL (N=16) 0 0 0 0 0 0

Total non-LH (N=106) 25 23.6 1 0.9 10 9.4


39

Supplementary Table 20: Alterations targeting histone modifiers in next-generation sequenced hypodiploid ALL.

SNV, single nucleotide variant; Indel, insertion/deletion mutation; CNV, copy number variation; DEL, deletion; D, diagnosis; R, relapse; G, remission; NH, near haploid; LH, low hypodiploid.

Sample Gene

Mutation type Mutation class Status Histone modifier type

Hypodiploid ALL subgroup

SJHYPO002-D CREBBP91

Indel K389_M395>K Somatic Histone writer NH

SJHYPO006-D CREBBP Focal CNV DEL Somatic Histone writer NH

SJHYPO032-D CREBBP SNV R1169C Somatic Histone writer NH

SJHYPO036-D CREBBP Indel P1279_E21splice Somatic Histone writer NH

SJHYPO037-R CREBBP SNV R1446C Appearing at R Histone writer NH

SJHYPO040-D CREBBP Indel P1279_E21splice Somatic Histone writer NH

SJHYPO056-D CREBBP Focal CNV DEL Somatic Histone writer NH

SJHYPO117-D & R CREBBP SNV Q1500P In D and R, no G Histone writer NH

SJHYPO001-D EHMT2, Ref67

SNV E883Q Somatic Histone writer NH

SJHYPO006-D PRDM1, Ref67

SNV E7_UTR_3 Somatic Histone writer NH

SJHYPO029-D MLL2, Ref57

SNV V4642I Somatic Histone writer NH

SJHYPO032-D WHSC1, Ref60

SNV E1099K Somatic Histone writer NH

SJHYPO044-D EZH2, Ref92

SNV N675K Somatic Histone writer NH

SJHYPO117-R EZH2 SNV R684H Appearing at R Histone writer NH

SJHYPO117-R EZH2 SNV G159R Appearing at R Histone writer NH

SJHYPO055-D UBR461,62

SNV Q879_E19splice_region Somatic Histone writer LH

SJHYPO126-D UBR4 SNV R1349H Present in G Histone writer LH

SJHYPO056-D NSD1, Ref60

SNV E23_UTR_3 Somatic Histone writer NH

SJHYPO013-D USP7, Ref63

SNV A381T Somatic Histone eraser LH

SJHYPO032-D KDM1A67

SNV Q417* Somatic Histone eraser NH

SJHYPO119-D USP22, Ref69

Fusion DEL Somatic Histone eraser LH

SJHYPO124-D HDAC2, Ref71

SNV S118P Somatic Histone eraser NH

SJHYPO022-D BRDT60

SNV R532Q Somatic Histone reader LH

SJHYPO123-D SFMBT2, Ref60

Focal CNV DEL Somatic Histone reader NH

SJHYPO026-D ASXL3 SNV T1243A Somatic Histone binder LH

SJHYPO040-D NFYC SNV P240L Somatic Binds histone writer NH

SJHYPO012-D PHF12, Ref79

SNV E986A Somatic Binds histone eraser LH

SJHYPO041-D CHD3, Ref80

SNV D93_E2splice_region Somatic Binds histone eraser NH

SJHYPO044-D CHD4, Ref80

SNV N1113I Somatic Binds histone eraser NH


40

Sample Gene

Mutation type Mutation class Status Histone modifier type

Hypodiploid ALL subgroup

SJHYPO039-D CDC6, Ref83

SNV E402Q Somatic Histone DNA modifier NH

SJHYPO046-D TET1, Ref83

SNV E12_UTR_3 Somatic Histone DNA modifier NH

SJHYPO120-D MBD5, Ref85

SNV S1097I Somatic Histone DNA modifier LH

SJHYPO125-D TET3, Ref83

SNV G795D Somatic Histone DNA modifier LH

SJHYPO046-D ARID1A87

SNV P1384S Somatic Histone reorder chromatin NH

SJHYPO006-D HIST1H2BK SNV G14S Somatic Histone NH


41

Supplementary Table 21: Differential expression analysis – NH versus LH.

See Excel Table: “Table_S21_NH_vs_LH_Limma.xlsx”

Differential expression analysis performed by limma with estimation of false discovery rate (FDR) at 0.05 between near haploid (NH) and low hypodiploid (LH) cases. More than 15,000 probesets showed differential expression between these two hypodiploid subgroups.

Supplementary Table 22: Gene set enrichment analysis (GSEA) – NH versus LH.

See Excel Table: “Table_S22_NH_vs_LH_GSEA.xlsx”

GSEA analysis comparing near haploid (NH) and low hypodiploid (LH) ALL, leaving 671 gene sets significant with an FDR cutoff at 0.25.


42

Supplementary Table 23: Ex vivo drug study of PI3K/mTOR and MEK inhibitors on hypodiploid ALL cells.

IC50 values for the respective samples and drugs are shown. The concentration range tested for the different drugs are indicated. “>” indicates if an IC50 was not reached with the highest concentration tested. NT, not tested.

Hypodiploid subgroup

Generic ID Bez235 (0.03125-1uM)

GDC-0941 (0.02-5uM)

Mek162 (0.03125-1uM)

PD0325901 (0.1024-10uM)

near haploid SJHYPO037-X1 0.095 0.067 0.209 NT

near haploid SJHYPO037-X2 0.096 0.041 0.244 NT

near haploid SJHYPO054-X2 NT NT NT >10

near haploid SJHYPO054-X3 0.033 0.027 0.514 >10

near haploid SJHYPO123-X1 NT 0.079 >1 >10

near haploid SJHYPO123-X2 0.075 0.093 >1 >10

near haploid SJHYPO123-X3 0.075 NT NT NT

low hypodiploid SJHYPO077-X1 NT 0.027 NT <0.1024

low hypodiploid SJHYPO120-X1 0.109 0.501 >1 0.637

low hypodiploid SJHYPO120-X3 0.072 0.499 >1 0.155

near haploid NALM-16 0.261 0.673 >1 >10


43

Supplementary Table 24: Sequences of shRNAs.

shRNA ID Sequences of the guide strands of the shRNA

Ikzf2-4422 ATGGCACAAGATACAGAAAAA

Ikzf2-8315 TAGGTCAGGTTTAAATCAATA

Ikzf3-449 TTCGATGAAAGTGAAAGATGA

Ikzf3-1586 CTCCATCAAAGTGATCAACAA

Luc-1309 (Firefly luciferase) CCCGCCTGAAGTCTCTGATTAA


44

Supplementary Table 25: Single nucleotide variations identified by mRNA seq of NALM-16.

See Excel Table: “Table_S25_NALM-16_mRNA-seq_variations.xlsx”

RNA-seq (transcriptome sequencing) was carried out for the near haploid ALL cell line NALM-16. Single nucleotide variations are listed. Assessment of functional impact of missense variations calculated by POLYPHEN and SIFT is included, as well as comparisons with a local database of sequence variations obtained from whole genome sequencing of tumor and normal DNA from 254 children (The SJCRH – Washington University Pediatric Cancer Genome Project (PCGP)93. Column definition is listed below: A: GeneName: HUGO gene symbol B: Chr: Chromosome C: HG19_Pos: Chromosome position in hg19 coordinates D: Class: Classification based on amino acid change pattern. Exon refers to variations in non-coding RNA genes. E: AAChange: Predicted amino acid change for the variation F: ProteinGI: NCBI protein GI number G: mRNA_acc: Refseq accession number H: ReferenceAllele: The allele represented in the reference human genome. Reference allele is marked as – for an insertion. I: MutantAllele: Mutant allele J: Flanking: 20bp[reference allele/mutant allele]20bp K: Freq: Frequency of reads with the variation L: SIFTResult: Deleterious status assigned by SIFT M: SIFTScore: SIFT score N: pph2result: Deleterious status assigned by polyPHEN2 O: pph2score: PolyPHEN2 score P: PCGP+-2: Variation identified not at the specific site, but within 2bp, in at least two whole genome sequenced sample from the PCGP. Q: COSMIC_OMIM_VALID_CLINIC+-2: Variation identified not at the specific site, but within 2bp, in COSMIC or OMIM. R: COSMIC_OMIM_VALID_CLINIC_pmid: Pubmed ID


45

Supplementary Table 26: Primer sequences used for targeted gene resequencing and NF1 deletion mapping.

See Excel Table: “Table_S26_Primers.xlsx”

Supplementary Table 27: Murine lymphoid precursor cells used for gene expression profiling.

Bone marrow harvested from wild-type C57BL/6 mice was flow sorted based on the surface marker scheme below.

Differentiation stage

Explanation Surface markers used for flow cytometric cell sorting

CLP Common lymphoid precursor Sca1low

, Lin-, IL7Rα

+, cKIT

low

Hardy Fraction A pre-pro-B B220+, CD43

+, CD24

-, BP-1

-

Hardy Fraction B Pro-B B220+, CD43

+, CD24

+, BP-1

-

Hardy Fraction C Pre-B early B220+, CD43

+, CD24

+, BP-1

+

Hardy Fraction D Pre-B late B220+, CD43

-, IgM

-, IgD

-

Hardy Fraction E Immature B cells B220+, CD43

-, IgM

+, IgD

-

Hardy Fraction F Mature B cells B220-bright, CD43-, IgM

+, IgD

+


46

Supplementary Table 28: Antibodies used for biochemical studies.

Antibody Catalogue number

Company Purpose

pERK 9101 Cell Signaling Technology Primary antibody - Flow analysis and immunoblotting

pAKT 4060 Cell Signaling Technology Primary antibody - Flow analysis

pS6 2211 Cell Signaling Technology Primary antibody - Flow analysis

pStat5 9351 Cell Signaling Technology Primary antibody - Flow analysis

pTyr 9411 Cell Signaling Technology Primary antibody - Flow analysis

IgG control 5415 Cell Signaling Technology Primary antibody - Flow analysis

b-Actin 4967 Cell Signaling Technology Primary antibody - Flow analysis

pmTOR 44-1125G Life Technologies Primary antibody - Flow analysis

p4EBP1 44-1170G Life Technologies Primary antibody - Flow analysis

Bcl-2 1017-1 Epitomics Primary antibody - Flow analysis

Bcl-xl 1018-1 Epitomics Primary antibody - Flow analysis

Mcl-1 1239-1 Epitomics Primary antibody - Flow analysis

p53 1047-1 Epitomics Primary antibody - Flow analysis

p53 2524 Cell Signaling Technology Primary antibody - Immunoblotting

Mouse anti-Ras 05-516 Millipore Primary antibody - Flow analysis

Polyclonal goat anti-rabbit Immunoglobulin/HRP P0448 DakoCytomation Primary antibody - Flow analysis

Sheep anti mouse IgG HRP NA931V GE Healthcare (UK) Primary antibody - Flow analysis

anti-rabbit IgG-FITC 711-096-152 Jackson Immunoresearch Secondary antibody

anti mouse IgG-APC 115-096-146 Jackson Immunoresearch Secondary antibody

anti rabbit IgG-Alexa 647 A-21246 Life Technologies Secondary antibody

phospho-STAT5 (Tyr 694)-Alexa 647 612599 BD Biosciences Directly conjugated primary antibody - Flow analysis

pBTK (Tyr 551)-Alexa 647 558134 BD Biosciences Directly conjugated primary antibody - Flow analysis

CD45 557833 BD Pharmingen Directly conjugated primary antibody - Flow analysis

CD19 557921 BD Pharmingen Directly conjugated primary antibody - Flow analysis

CD16/CD32 553142 BD Biosciences Used to block Fc receptors

sc-68, Neurofibromin (N) sc-68 Santa Cruz Biotechnology, Inc. Immunoblotting; N-terminal epitope of NF1

sc-67, Neurofibromin (D) sc-67 Santa Cruz Biotechnology, Inc. Immunoblotting; C-terminal epitope of NF1

Aiolos sc-101982 Santa Cruz Biotechnology, Inc. Immunoblotting

Helios sc-9866 Santa Cruz Biotechnology, Inc. Immunoblotting


47

Supplementary Table 29: Association between aneuploidy and event free survival (EFS).

Estimated EFS in percentage with standard error within parenthesis. Information is missing for 17 hypodiploid ALL cases. Masked hypodiploid cases here refer to cases with either a pure doubled hypodiploid clone or cases harboring a doubled clone constituting at least 30%.

P values calculated by a Log-rank Test. NH, near haploid; LH, low hypodiploid. Masked and non-masked cases separated

Hypodiploid subgroup n= Year 1 Year 2 Year 5 P value

Near haploid 43 79.6 (6.5) 57.1 (8.2) 54.2 (13.0) 0.11

Masked near haploid 17 87.1 (8.7) 77.4 (13.0) 77.4 (26.0)

Low hypodiploid 19 68.4 (10.3) 52.1 (11.4) 41.7 (18.4)

Masked low hypodiploid 7 66.7 (17.2) 66.7 (27.2) No Data

Near diploid 21 90.5 (6.2) 90.5 (6.2) 80.7 (8.9)

Masked and non-masked cases combined


NH and masked NH 60 81.7 (5.3) 61.8 (7.2) 59.3 (12.6) 0.035

LH and masked LH 26 68.5 (9.1) 54.9 (11.1) 44.0 (19.0)

Near diploid 21 90.5 (6.2) 90.5 (6.2) 80.7 (8.9)

Comparison between near haploid and low hypodiploid ALL, excluding near diploid ALL


NH and masked NH 60 81.7 (5.3) 61.8 (7.2) 59.3 (12.6) 0.29

LH and masked LH 26 68.5 (9.1) 54.9 (11.1) 44.0 (19.0)


48

Supplementary Table 30: Association between aneuploidy and cumulative incidence of any relapse. Cumulative incidence (CIN) of any relapse in percentage with standard error within parenthesis. Information is missing for 17 hypodiploid ALL cases. Masked hypodiploid cases here refer to cases with either a pure doubled hypodiploid clone or cases harboring a doubled clone constituting at least 30%. P values calculated by Gray's Test. NH, near haploid; LH, low hypodiploid.

Masked and non-masked cases separated


Near haploid 43 20.4 (6.5) 37.3 (8.1) 40.2 (8.3) 0.10

Masked near haploid 17 12.9 (8.9) 20.2 (10.9) 20.2 (10.9)

Low hypodiploid 19 31.6 (11.0) 47.9 (12.0) 47.9 (12.0)

Masked low hypodiploid 7 16.7 (17.0) 16.7 (17.0) No Data

Near diploid 21 5.0 (5.0) 5.0 (5.0) 15.3 (8.4)

Masked and non-masked cases combined


NH and masked NH 60 18.3 (5.3) 33.7 (6.9) 36.3 (7.1) 0.056

LH and masked LH 26 27.5 (9.1) 41.0 (10.5) 41.0 (10.5)

Near diploid 21 5.0 (5.0) 5.0 (5.0) 15.3 (8.4)

Comparison between near haploid and low hypodiploid ALL, excluding near diploid ALL


NH and masked NH 60 18.3 (5.3) 33.7 (6.9) 36.3 (7.1) 0.49

LH and masked LH 26 27.5 (9.1) 41.0 (10.5) 41.0 (10.5)


49

Supplementary Table 31: Association between aneuploidy and minimal residual disease.

Number of cases with negative (Neg) and positive (Pos) minimal residual disease (MRD), respectively. Information is missing for 33 hypodiploid ALL cases. Masked hypodiploid cases here refer to cases with either a pure doubled hypodiploid clone or cases harboring a doubled clone constituting at least 30%. NH, near haploid; LH, low hypodiploid. P values were calculated by an Exact Chi-Square test.

Masked and non-masked cases separated (P = 0.16) Hypodiploid subgroup n= MRD Neg (< 0.01%) MRD Pos (≥0.01%)

Near haploid 41 56.1% 43.9%

Masked near haploid 14 71.4% 28.6%

Low hypodiploid 14 50% 50%

Masked low hypodiploid 7 71.4% 2 (28.6%)

Near diploid 16 87.5% 2 (12.5%)

Masked and non-masked cases combined (P = 0.098) Hypodiploid subgroup n= MRD Neg (< 0.01%) MRD Pos (≥0.01%)

NH and masked NH 55 60% 40%

LH and masked LH 21 57.1% 42.9%

Near diploid 16 87.5% 12.5%

Comparison between near haploid and low hypodiploid ALL, excluding near diploid ALL (P = 0.82) Hypodiploid subgroup n= MRD Neg (< 0.01%) MRD Pos (≥0.01%)

NH and masked NH 55 60% 40%

LH and masked LH 21 57.1% 42.9%


50

Supplementary Table 32: Association between copy number alterations/mutations and event free survival (EFS).

Estimated EFS in % with standard error (SE) within parenthesis. P values calculated by a Log-rank Test. Signaling indicates that gene is involved in RTK- or Ras signaling.


51

Factors n= Year 1 Year 2 Year 5 P value

CDKN2A/B

Normal 70 81.6 (4.8) 64.0 (6.5) 61.8 (10.6) 0.81

Altered 37 77.9 (7.0) 71.6 (8.0) 59.9 (10.1)

Histone cluster (6p22)

Normal 93 78.3 (4.5) 64.8 (5.7) 57.6 (8.0) 0.35

Altered 14 92.9 (6.6) 78.6 (10.5) 78.6 (16.3)

FLT3 (Signaling)

Normal 102 79.4 (4.2) 65.2 (5.3) 58.9 (7.6) 0.16

Altered 5 100 (0.0) 100 (0.0) 100 (0.0)

KRAS (Signaling)

Normal 105 80.8 (4.0) 67.0 (5.1) 60.7 (7.6) 0.54

Altered 2 50.0 (25.0) 50.0 (25.0) 50.0 (25.0)

NF1 (Signaling)

Normal 76 81.1 (4.6) 67.5 (5.9) 59.3 (8.7) 0.92

Altered 31 77.6 (8.2) 64.3 (9.9) 64.3 (13.6)

NRAS (Signaling)

Normal 94 78.8 (4.4) 66.4 (5.4) 59.6 (7.9) 0.45

Altered 13 90.9 (8.3) 68.2 (14.5) 68.2 (19.2)

PTPN11 (Signaling)

Normal 104 80.6 (4.0) 67.7 (5.1) 61.4 (7.5) 0.13

Altered 3 66.7 (22.2) 33.3 (19.2) 33.3 (27.2)

Signaling combined

Normal 57 80.5 (5.2) 68.9 (6.6) 58.8 (9.4) 0.98

Altered 50 79.9 (6.1) 63.8 (7.8) 63.8 (11.6)

IKZF1 (B pathway)

Normal 104 79.6 (4.1) 66.7 (5.2) 60.3 (7.8) 0.77

Altered 3 100 (0.0) 66.7 (22.2) 66.7 (22.2)

IKZF2 (B pathway)

Normal 94 84.1 (4.0) 68.4 (5.4) 63.9 (7.5) 0.043

Altered 13 53.8 (12.9) 53.8 (13.8) 26.9 (23.0)

IKZF3 (B pathway)

Normal 97 78.1 (4.4) 63.4 (5.4) 58.3 (7.4) 0.12

Altered 10 100 (0.0) 100 (0.0) 83.3 (34.0)

PAX5 (B pathway)

Normal 90 77.4 (4.6) 62.0 (5.9) 53.9 (9.2) 0.014

Altered 17 94.1 (5.5) 88.2 (7.6) 88.2 (9.1)

VPREB1 (B pathway)

Normal 97 78.2 (4.4) 65.6 (5.4) 58.7 (8.0) 0.30

Altered 10 100 (0.0) 77.8 (13.9) 77.8 (16.4)

B pathway combined

Normal 61 76.4 (5.8) 57.7 (7.1) 52.7 (9.7) 0.076

Altered 46 84.7 (5.3) 77.4 (6.7) 69.9 (10.6)

RB1

Normal 89 81.1 (4.3) 68.0 (5.4) 61.1 (7.6) 0.62

Altered 18 77.4 (10.6) 60.3 (14.4) 60.3 (26.9)

TP53

Normal 83 83.1 (4.3) 68.4 (5.7) 63.3 (7.8) 0.31

Altered 24 70.8 (9.0) 61.1 (11.0) 45.8 (19.5)

PAG1

Normal 100 81.0 (4.1) 69.8 (5.2) 63.3 (7.5) 0.034

Altered 7 71.4 (15.6) 28.6 (13.9) No Data


52

Supplementary Table 33: Association between copy number alterations/mutations and cumulative incidence (CIN) of any relapse.

CIN of any relapse in % with SE within parenthesis. P values calculated by Gray's Test. Signaling indicates that gene is involved in RTK- or Ras signaling.


53

Factors n= Year 1 Year 2 Year 5 P value

CDKN2A/B

Normal 70 18.4 (4.8) 34.0 (6.2) 36.2 (6.4) 0.26

Altered 36 17.1 (6.5) 20.5 (7.1) 27.7 (8.2)

Histone cluster (6p22)

Normal 92 19.7 (4.3) 30.6 (5.2) 35.5 (5.6) 0.55

Altered 14 7.1 (7.1) 21.4 (11.4) 21.4 (11.4)

FLT3 (Signaling)

Normal 101 18.7 (4.0) 30.7 (4.9) 34.9 (5.2) 0.16

Altered 5 0 0 0

KRAS (Signaling)

Normal 105 18.2 (3.9) 29.7 (4.8) 33.8 (5.1) 0.47

Altered 1 0 0 0

NF1 (Signaling)

Normal 75 16.4 (4.4) 28.5 (5.5) 34.1 (5.9) 0.81

Altered 31 22.4 (8.3) 31.6 (9.6) 31.6 (9.6)

NRAS (Signaling)

Normal 93 19.2 (4.2) 29.2 (5.0) 33.7 (5.3) 0.64

Altered 13 9.1 (9.1) 31.8 (16.4) 31.8 (16.4)

PTPN11 (Signaling)

Normal 104 18.4 (3.9) 28.9 (4.8) 33.1 (5.1) 0.67

Altered 2 0 50.0 (50.0) 50.0 (50.0)

Signaling combined

Normal 57 17.7 (5.1) 27.2 (6.1) 34.1 (6.7) 0.93

Altered 49 18.4 (6.0) 32.3 (7.6) 32.3 (7.6)

IKZF1 (B pathway)

Normal 103 18.5 (4.0) 29.2 (4.8) 33.5 (5.1) 0.90

Altered 3 0 33.3 (33.3) 33.3 (33.3)

IKZF2 (B pathway)

Normal 93 15.0 (3.9) 28.2 (5.1) 32.7 (5.4) 0.30

Altered 13 38.5 (14.2) 38.5 (14.2) 38.5 (14.2)

IKZF3 (B pathway)

Normal 96 20.0 (4.2) 32.3 (5.1) 35.3 (5.3) 0.15

Altered 10 0 0 16.7 (16.7)

PAX5 (B pathway)

Normal 90 21.4 (4.5) 33.9 (5.4) 39.2 (5.8) 0.0086

Altered 16 0 6.3 (6.3) 6.3 (6.3)

VPREB1 (B pathway)

Normal 96 19.8 (4.2) 30.0 (5.0) 34.6 (5.4) 0.42

Altered 10 0 22.2 (14.8) 22.2 (14.8)

B pathway combined

Normal 61 23.6 (5.8) 38.1 (6.9) 43.1 (7.2) 0.033

Altered 45 11.2 (4.8) 18.6 (6.0) 21.5 (6.5)

RB1

Normal 88 18.0 (4.2) 28.5 (5.1) 33.3 (5.5) 0.81

Altered 18 16.7 (9.1) 33.8 (13.8) 33.8 (13.8)

TP53

Normal 82 15.9 (4.2) 27.8 (5.4) 32.9 (5.8) 0.59

Altered 24 25.0 (9.1) 34.7 (10.4) 34.7 (10.4)

PAG1

Normal 99 17.1 (3.9) 25.9 (4.7) 30.3 (5.1) 0.023

Altered 7 28.6 (18.6) 71.4 (20.0) No Data


54

Supplementary Table 34: Multivariable analysis of copy number alterations/mutations, clinical features and association with cumulative incidence of any relapse.

Fine & Gray’s modeling of CIN of any relapse identified PAG1 alteration as the only gene alteration independently associated with poor outcome. WBC, white blood cell count; MRD, minimal residual disease. HR, hazard ratio; CI, confidence interval.

Factors HR HR low 95% CI

HR high 95% CI

P

PAX5 altered vs normal 0.138 0.02 1.06 0.057

PAG1 altered vs normal 3.412 1.03 11.3 0.044

WBC <100 vs ≥100 0.576 0.20 1.62 0.30

MRD positive (< 0.01%) vs Negative (≥0.01%) 3.863 1.54 9.67 0.0039


55

SUPPLEMENTARY FIGURES

Supplementary Figure 1: Coverage plots for next-generation sequenced hypodiploid ALL cases.

a-c, Different colors represent different fold coverage, as indicated. SJHYPO052-D and –G underwent whole genome sequencing, while exome sequencing was performed for SJHYPO052-R, explaining the gap seen around SJHYPO052 in panel c.


56


57

Supplementary Figure 2: Circos plots of whole genome sequenced hypodiploid ALL.

Circos94 plots depicting structural genetic variants, including DNA copy number alterations, intra- and inter-chromosomal translocations, and sequence alterations. Loss-of-heterozygosity, orange; amplification, red; deletion, blue; Sequence mutations in Refseq genes: non-silent single nucleotide variants, brown; insertion/deletions, red; genes at structural variant breakpoints: genes involved in in-frame fusions, pink; others, blue.


58


59


60


61


62

Supplementary Figure 3: Mutation spectrum of next-generation sequenced hypodiploid ALL.

Next-generation sequenced cases are depicted from left to right. Colored bars represent number of specific lesions identified in each case as indicated. WGS, whole genome sequencing; WES, whole exome sequencing; SNV, single nucleotide variation; aa, amino acid; CDS, coding DNA sequence; UTR, untranslated leader region; HQ, high quality; CNV, copy number variation; Amp, amplification; Del, deletion; Mb, megabases.


63

Supplementary Figure 4: Protein domain and alteration plots for targets of sequence mutations in hypodiploid ALL.


64

Supplementary Figure 5: Mapping of NF1 deletions. a, Top: Schematic of the NF1 gene with direction indicated by arrows and exons by vertical lines. The intragenic deletions and amplification of NF1 are depicted for each hypodiploid ALL case harboring a copy number alteration in this gene. Heterozygous deletions are shown as solid lines and homozygous deletions as dotted lines. The majority of focal deletions are accompanied by loss of the entire other chromosomal copy, leading to a bi-allelic loss. The intragenic NF1 amplification gives rise to copy-neutral loss-of-heterozygosity in SJHYPO120. b, Electropherogram showing the fusion point at the genomic level for one case. A 3 base pair (bp) insertion of non-consensus bases is present between the intron 14 to intron 35 fusion. Together with the presence of partially conserved heptamer recombination signal sequences (RSS) immediately internal to the genomic breakpoints, this is suggestive of a RAG mediated recombination event. c, Transcriptome sequencing (mRNA seq) data from the hypodiploid ALL cell line NALM-16. Read depth (red) and GC content (blue) for all NF1 exons are shown, with no coverage of exons 15-35. d, Schematic of the full length NF1 gene (top), NF1 gene with homozygous deletion from intron 14 to intron 35 (middle), and two putative open reading frames (ORF1 and ORF2) present in the NALM-16 NF1 transcript. Putative ORF1 is translated from the canonical NF1 start site, and has a premature stop codon in exon 36 downstream of the deletion. Putative ORF2 has an alternative start site in exon 37, downstream of the deleted region. The deleted region is depicted by a gray box, and ORFs as white boxes. e, NALM-16 NF1 RNA seq raw data presented in the Bambino viewer95. The corresponding paired reads spanning over the breakpoint between exon 14 (upper) and exon 36 (lower) are shown in the top and bottom panels, respectively. Read 1-5 indicate reads in the top and bottom panels that are the same read, spanning the splice site.


65


66

Supplementary Figure 6: Immunoblot analysis of NF1. a-b, Immunoblot analysis on the cell lines NALM-16 and THP-1 using the antibody sc-68 (a), raised against the N-terminus of NF1, and sc-67 (b) raised against the C-terminus of NF1. The size of full length NF1 is 250kDa, and the predicted sizes of putative NF1 mutant ORFs in NALM-16 are 62kDa (mutant ORF1, N-terminal part of wild-type NF1) and 115kDa (mutant ORF2, C-terminal part of wild-type NF1), respectively. Full length, wild-type NF1 is not present in NALM-16, but detected in the control THP-1. Only a nonspecific band, present also in THP-1, is seen at the size of mutant putative ORF1 (a), and no band is detected for mutant putative ORF2 (b), indicating that the NF1 deletion leads to loss of NF1 protein production.


67

Supplementary Figure 7: Validation of mutations in NRAS and PTPN11 in non-tumor samples in near haploid ALL.

a and b, Electropherograms of forward and reverse DNA sequences covering the NRAS p.Gly12Ser substitution in SJHYPO020 (a) and PTPN11 p.Gly503Arg in SJHYPO036 (b). The only available non-tumor DNA was obtained from hematopoietic cells from the respective patient, and it is thus not known if the mutations were inherited or acquired in the hematopoietic compartment prior to the development of leukemia. The respective mutated codons are shown in upper case letters. a, SJHYPO020-D (P1) is the sorted tumor population (CD45-dim, CD19 positive (+)); SJHYPO020-G is a remission bone marrow sample from this patient; P2 is the sorted CD45 positive, CD7 positive fraction from a bone marrow sample taken at diagnosis; P3 is the sorted CD45 positive, CD7 negative fraction from the same diagnosis sample. b, SJHYPO036-D and –G represent samples taken at diagnosis and remission, respectively. c, Fluorescence activated cell sorting (FACS) plots showing the gating for the cell sorting of an SJHYPO020 bone marrow sample taken at diagnosis.


68

Supplementary Figure 8: PAG1 deletions correlate with PAG1 expression levels. a, Heatmap showing SNP microarray data for the area covering PAG1 on chromosome 8q21.12. A focal deletion in PAG1 was first detected in the relapse sample for SJHYPO056, while this deletion was not detected at diagnosis (D vs R*). b, Top: Schematic of the PAG1 gene with direction indicated by arrows and exons by vertical lines. WGL log2 ratio copy number data visualized in the UCSC web browser (http://genome.ucsc.edu/). The pink vertical lines indicate probe intensities, with lines below the respective black zero lines correspond to a loss of genetic material. Double-headed arrows indicate the extent of the deletions. Note the lack of focal deletion in SJHYPO056-D but deletion at relapse. c, Relative gene expression levels of the PAG1 transcript in hypodiploid ALL samples either wild-type (WT) for PAG1 or harboring a PAG1 deletion (Del) as indicated, as assessed by three PAG1 specific probe sets from Affymetrix GeneChip HT HG-U133+ PM microarrays.


69

Supplementary Figure 9: Mutant p53 fails to stimulate p21 in hypodiploid ALL. a, Flow cytometry analysis of p53 (left panel) and p21 (right panel) levels in cells from hypodiploid ALL xenograft SJHYPO120-X, harboring a p.Arg280Ser p53 substitution, and the cell line Reh (TEL-AML1 ALL harboring wild-type p53). Cells were treated with increasing concentrations of etoposide to activate p53, as indicated. p53 levels were already high in the p53 mutant cells, and etoposide treatment did not lead to increased p21 levels in these cells, while stimulation was seen in Reh. b, Histological examination of sternum stained for p53 (left panel) and p21 (right panel) from mice xenografted with primary hypodiploid ALL tumor cells either mutant (upper) or wild-type (lower) for TP53 as indicated. Scale bar corresponds to 50 microns.


70

Supplementary Figure 10: IKZF1 and IKZF2 deletions in adult ALL. a-b, SNP 6.0 microarray heatmaps showing focal deletions of IKZF1 (a) and IKZF2 (b) in the adult ALL cohort. Blue indicates DNA loss. PH+, Philadelphia chromosome (BCR-ABL1) positive ALL; LH, low hypodiploid; NH, near haploid.


71

Supplementary Figure 11: Expression of Ikzf1, Ikzf2 and Ikzf3 during murine lymphoid development. a-c, Gene expression levels of the Ikaros family genes Ikzf1 (a), Ikzf2 (b) and Ikzf3 (c) in murine cells flow sorted into Hardy Fractions as assessed by 2-3 probesets per gene from Affymetrix GeneChip MG-430 2.0 microarrays. One-way analysis of variance was performed to test for significant differences between the groups. CLP, common lymphoid precursor; Hardy Fraction A, pre-pro-B; B, proB; C, preB early; D, preB late; E, immature B; F, mature B cells.


72

Supplementary Figure 12: CD19 levels and degree of antigen receptor rearrangements in hypodiploid ALL.

a, Comparison of CD19 expression level on near haploid and low hypodiploid ALL tumor cells. All near haploid (N=47) and low hypodiploid (N=19) cases with available CD19 expression data from flow cytometry studies are compared. There is a significant association between the level of CD19 expression and hypodiploid ALL subgroup. b, Percentage of cases with a rearrangement in the antigen receptor loci at 2p11.2 (IGK@), 7p14.1 (TRG@), 7q34 (TRB@), 14q11.2 (TRA@), 14q32.33 (IGH@) and/or 22q11.22 (IGL@). c, Heatmap showing SNP 6.0 microarray data for the area covering TRG@ (the T cell receptor gamma locus) on chromosome 7p14.1. Light blue of the entire region shown indicates either 7p loss (in near diploid cases) or whole chromosome 7 loss. Focal deletions (light or dark blue) indicate a rearrangement at the TRG@ locus. AgR, antigen receptor rearrangement; LH, low hypodiploid. d, Gene set enrichment analysis demonstrates enrichment for Hardy Panel fraction B (pro-B cell stage) in low hypodiploid ALL compared with near haploid ALL. The gene set HARDYWTB_500UP includes the top 500 probesets upregulated in Hardy Panel B compared with the other Hardy Panel fractions, identified using limma.


73


74

Supplementary Figure 13: RB1 alterations in pediatric hypodiploid ALL and adult ALL. a, Protein domain plot of RB1 with alterations identified in pediatric hypodiploid ALL. b-c, SNP 6.0 microarray heatmaps showing focal deletions of RB1 in pediatric hypodiploid ALL (b) and the adult ALL cohort (c). A case with a simultaneous RB1 deletion and sequence mutation is indicated by a Y in b. Blue indicates DNA loss. mNH, masked near haploid; LH, low hypodiploid; NH, near haploid; PH+, Philadelphia chromosome (BCR-ABL1) positive ALL.


75

Supplementary Figure 14: Tumor suppressor gene pathway alterations in hypodiploid ALL. CDKN2A/CDKN2B are tumor suppressor genes functioning upstream of TP53 and RB1. The Total percentages indicate cases with both CDKN2A/B deletions and either TP53 (left) or RB1 (right) alterations for each hypodiploid subgroup. Genes in boxes have been subject of targeted resequencing, while genes in ovals have not been sequenced. Genes shaded in gray do not harbor any known alterations.


76

Supplementary Figure 15: Deletions and sequence mutations in genes encoding histones and histone modifiers. a, SNP 6.0 microarray heatmap showing focal deletions in the histone cluster at chromosome 6p22 in hypodiploid ALL. The minimal region of deletion involved genes HIST1H2BE, HIST1H4D, HIST1H3D, HIST1H2AD and HIST1H2BF. Blue indicates DNA loss. Masked hypodiploid cases do here refer to cases with either a pure doubled hypodiploid clone or cases harboring a doubled clone constituting at least 30%. mNH, masked near haploid; LH, low hypodiploid; ND, near diploid. b, Protein domain and alteration plot of CREBBP.


77

Supplementary Figure 16: GEP restricted to probes on chromosomes showing identical patterns of aneuploidy.

a-b, Unsupervised principal component analysis (PCA) of gene expression data from all hypodiploid ALL cases with available high quality RNA (N=94). Near haploid/masked near haploid, low hypodiploid/masked low hypodiploid and near diploid cases form three distinct clusters by PCA also when restricting the analysis to commonly aneuploid chromosomes (a) or only chromosome 21 (b), which always retains both the maternal and paternal chromosomal copies.


78

Supplementary Figure 17: Flow cytometric analysis of signaling pathways in hypodiploid ALL. Spleen cells from mice transplanted with primary human hypodiploid ALL samples or the hypodiploid ALL cell line NALM-16 (non-transplanted) were analyzed for the presence of the indicated proteins. Healthy donor is a control, and indicates cells from a peripheral blood sample from a non-cancerous individual.


79

Supplementary Figure 18: Ikzf2 and Ikzf3 knockdown efficiency assessed by immunoblot analysis. a-b, Immunoblot analysis on the murine cell lines Ba/F3 (a) and Arf-/- pre-B (b) using the antibody sc-9866 detecting Helios (a), and sc-101982 detecting Aiolos (b). Luc-1309 indicates a control shRNA specific for Firefly luciferase mRNA. The cells expressing shRNAs Ikzf2-4422, Ikzf2-8315, Ikzf3-449 and Ikzf3-1586 were used for downstream analyses. Knockdown did not influence cell viability, cell cycle distribution or proliferation (data not shown).


80

Supplementary Figure 19: Flow cytometric analysis of signaling pathways in hematopoietic cell lines.

Flow cytometric analyses detecting levels of pERK (a) and pS6 (b) in murine cell lines after knockdown of Ikzf2 (in Ba/F3, left panel) and Ikzf3 (in Arf-/- pre-B cells, right panel) and stimulation with PMA (50nM, 15 minutes). Two independent shRNAs per gene were employed. Luc-1309 indicates a control shRNA specific for Firefly luciferase mRNA.


81

Supplementary Figure 20: The importance of optimal normalization of SNP microarray data.

a-c, SNP 6.0 microarray data for 10 hypodiploid ALL diagnosis (D) and matched remission (G)

samples are presented from left to right in each of the three panels. Chromosomes are shown

from 1-22, X and Y from top to bottom. a, Normalization is performed using quantile

normalization in dChip, a median centering approach that borrows information across arrays,

and the hypodiploid genomes are erroneously normalized. b, The same data set presented after

performance of reference normalization96 in which only chromosomes known or predicted to be

diploid are used as reference chromosomes to guide normalization of the entire array, and in

which normalization of each array is performed independently of other samples. HYPO053,

HYPO055 and HYPO084 contains substantial proportions of a doubled clone and are

normalized as masked low hypodiploid cases. a-b; Red indicates gain of genetic material, and

blue indicates loss. c, Loss-of-heterozygosity (indicated in dark blue) visualization for the same

samples in dChip. Each tumor sample was directly compared to its matched remission sample.


82

Supplementary Figure 21: Immunohistochemistry and FACS analyses of tissue from mice xenografted with human primary hypodiploid ALL cells.

a-f, Selected tissues stained for human CD45 (left) and with hematoxylin and eosin (HE) stain (right) in each panel. Scale bar corresponds to 50 microns. Spleen, meninges and sternal marrow from SJHYPO072-X2 (a-c) and SJHYPO120-X1 (d-f) are shown. g-h, FACS analysis of bone marrow from SJHYPO072-X2 (g) and -X3 (h). Cells are stained with DAPI, for mouse CD45 (PE-Cy7 conjugated antibody), and human CD45 (FITC conjugated), CD19 (APC) and CD3 (PE).


83

Supplementary Figure 22: Copy number analysis of primary hypodiploid ALL samples versus xenografted leukemic samples.

a-c, Copy number analysis comparing related hypodiploid ALL diagnosis (D) and xenograft (X1-3) samples. The focal deletions that were present at diagnosis were retained in the xenograft clones. a, The masked near haploid case SJHYPO072-D harbored three homozygous focal deletions (in the Histone cluster at 6p22.1, PAG1 and IKZF3). The other corresponding chromosomal copy of chromosomes 6, 8 and 17 was lost prior to reduplication of the near haploid genome, giving rise to copy neutral loss-of-heterozygosity of these chromosomes, with focal homozygous deletions of the respective gene. b, SJHYPO039-D is a near haploid case with the only focal deletion present in ETV6. c, The near haploid case SJHYPO123-D harbored a focal deletion only in NF1, with gain of 4 lesions in the xenograft. Blue indicates loss of genetic material.


84

SUPPLEMENTARY REFERENCES

1. Li, F.P. et al. A cancer family syndrome in twenty-four kindreds. Cancer research 48,

5358-62 (1988). 2. Tinat, J. et al. 2009 version of the Chompret criteria for Li Fraumeni syndrome. Journal

of clinical oncology : official journal of the American Society of Clinical Oncology 27, e108-9; author reply e110 (2009).

3. Chompret, A. et al. P53 germline mutations in childhood cancers and cancer risk for carrier individuals. Br J Cancer 82, 1932-7 (2000).

4. Chompret, A. The Li-Fraumeni syndrome. Biochimie 84, 75-82 (2002). 5. Birch, J.M. et al. Prevalence and diversity of constitutional mutations in the p53 gene

among 21 Li-Fraumeni families. Cancer research 54, 1298-304 (1994). 6. Eeles, R.A. Germline mutations in the TP53 gene. Cancer Surv 25, 101-24 (1995). 7. Chompret, A. et al. Sensitivity and predictive value of criteria for p53 germline mutation

screening. J Med Genet 38, 43-7 (2001). 8. Nichols, K.E., Malkin, D., Garber, J.E., Fraumeni, J.F., Jr. & Li, F.P. Germ-line p53

mutations predispose to a wide spectrum of early-onset cancers. Cancer Epidemiol Biomarkers Prev 10, 83-7 (2001).

9. Olivier, M. et al. Li-Fraumeni and related syndromes: correlation between tumor type, family structure, and TP53 genotype. Cancer research 63, 6643-50 (2003).

10. Varley, J.M. Germline TP53 mutations and Li-Fraumeni syndrome. Human mutation 21, 313-20 (2003).

11. Wong, P. et al. Prevalence of early onset colorectal cancer in 397 patients with classic Li-Fraumeni syndrome. Gastroenterology 130, 73-9 (2006).

12. Gonzalez, K.D. et al. Beyond Li Fraumeni Syndrome: clinical characteristics of families with p53 germline mutations. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 27, 1250-6 (2009).

13. Villani, A. et al. Biochemical and imaging surveillance in germline TP53 mutation carriers with Li-Fraumeni syndrome: a prospective observational study. Lancet Oncol 12, 559-67 (2011).

14. Tong, W., Zhang, J. & Lodish, H.F. Lnk inhibits erythropoiesis and Epo-dependent JAK2 activation and downstream signaling pathways. Blood 105, 4604-12 (2005).

15. Roberts, K.G. et al. Genetic alterations activating kinase and cytokine receptor signaling in high-risk acute lymphoblastic leukemia. Cancer Cell 22, 153-66 (2012).

16. Campalans, A. et al. XRCC1 interactions with multiple DNA glycosylases: a model for its recruitment to base excision repair. DNA Repair (Amst) 4, 826-35 (2005).

17. Cano, C.E. et al. Tumor protein 53-induced nuclear protein 1 is a major mediator of p53 antioxidant function. Cancer Res 69, 219-26 (2009).

18. Soulier, J. Fanconi anemia. Hematology Am Soc Hematol Educ Program 2011, 492-7 (2011).

19. Ellis, M.J. et al. Whole-genome analysis informs breast cancer response to aromatase inhibition. Nature 486, 353-60 (2012).

20. Fujimoto, A. et al. Whole-genome sequencing of liver cancers identifies etiological influences on mutation patterns and recurrent mutations in chromatin regulators. Nat Genet 44, 760-4 (2012).

21. Zimmermann, S. & Peters, S. Going beyond EGFR. Ann Oncol 23 Suppl 10, x197-x203 (2012).

22. Mullighan, C.G. et al. Genome-wide analysis of genetic alterations in acute lymphoblastic leukaemia. Nature 446, 758-64 (2007).


85

23. Zhang, J. et al. Key pathways are frequently mutated in high-risk childhood acute lymphoblastic leukemia: a report from the Children's Oncology Group. Blood 118, 3080-7 (2011).

24. Mullighan, C.G. et al. JAK mutations in high-risk childhood acute lymphoblastic leukemia. Proc Natl Acad Sci U S A 106, 9414-8 (2009).

25. Harvey, R.C. et al. Rearrangement of CRLF2 is associated with mutation of JAK kinases, alteration of IKZF1, Hispanic/Latino ethnicity, and a poor outcome in pediatric B-progenitor acute lymphoblastic leukemia. Blood 115, 5312-21 (2010).

26. Mullighan, C.G. et al. Rearrangement of CRLF2 in B-progenitor- and Down syndrome-associated acute lymphoblastic leukemia. Nat Genet 41, 1243-6 (2009).

27. Zhang, A. et al. Identification of a novel family of ankyrin repeats containing cofactors for p160 nuclear receptor coactivators. J Biol Chem 279, 33799-805 (2004).

28. Neilsen, P.M. et al. Identification of ANKRD11 as a p53 coactivator. J Cell Sci 121, 3541-52 (2008).

29. Mullighan, C.G. et al. Deletion of IKZF1 and prognosis in acute lymphoblastic leukemia. N Engl J Med 360, 470-80 (2009).

30. Nagl, N.G., Jr. et al. The p270 (ARID1A/SMARCF1) subunit of mammalian SWI/SNF-related complexes is essential for normal cell cycle arrest. Cancer Res 65, 9236-44 (2005).

31. Nagl, N.G., Jr., Zweitzig, D.R., Thimmapaya, B., Beck, G.R., Jr. & Moran, E. The c-myc gene is a direct target of mammalian SWI/SNF-related complexes during differentiation-associated cell cycle arrest. Cancer Res 66, 1289-93 (2006).

32. Mullighan, C.G. et al. Genomic analysis of the clonal origins of relapsed acute lymphoblastic leukemia. Science 322, 1377-80 (2008).

33. Rakhilin, S.V. et al. A network of control mediated by regulator of calcium/calmodulin-dependent signaling. Science 306, 698-701 (2004).

34. Ehrlich, E.S. et al. Regulation of Hsp90 client proteins by a Cullin5-RING E3 ubiquitin ligase. Proc Natl Acad Sci U S A 106, 20330-5 (2009).

35. Kizil, C., Otto, G.W., Geisler, R., Nusslein-Volhard, C. & Antos, C.L. Simplet controls cell proliferation and gene transcription during zebrafish caudal fin regeneration. Dev Biol 325, 329-40 (2009).

36. Thermes, V. et al. Medaka simplet (FAM53B) belongs to a family of novel vertebrate genes controlling cell proliferation. Development 133, 1881-90 (2006).

37. Nikitin, E.A. et al. Expression level of lipoprotein lipase and dystrophin genes predict survival in B-cell chronic lymphocytic leukemia. Leuk Lymphoma 48, 912-22 (2007).

38. Nakanishi, H., Nakamura, T., Canaani, E. & Croce, C.M. ALL1 fusion proteins induce deregulation of EphA7 and ERK phosphorylation in human acute leukemias. Proc Natl Acad Sci U S A 104, 14442-7 (2007).

39. Nishida, K. et al. Gab-family adapter proteins act downstream of cytokine and growth factor receptors and T- and B-cell antigen receptors. Blood 93, 1809-16 (1999).

40. Xu, D. et al. A germline gain-of-function mutation in Ptpn11 (Shp-2) phosphatase induces myeloproliferative disease by aberrant activation of hematopoietic stem cells. Blood 116, 3611-21 (2010).

41. Geck, P., Sonnenschein, C. & Soto, A.M. The D13S171 marker, misannotated to BRCA2, links the AS3 gene to various cancers. Am J Hum Genet 69, 461-3 (2001).

42. Harada, H. et al. Polymorphism and allelic loss at the AS3 locus on 13q12-13 in esophageal squamous cell carcinoma. Int J Oncol 18, 1003-7 (2001).

43. Murthy, S., Agoulnik, I.U. & Weigel, N.L. Androgen receptor signaling and vitamin D receptor action in prostate cancer cells. Prostate 64, 362-72 (2005).

44. Reis, E.M. et al. Large-scale transcriptome analyses reveal new genetic marker candidates of head, neck, and thyroid cancer. Cancer Res 65, 1693-9 (2005).


86

45. Seo, M.J. et al. New approaches to pathogenic gene function discovery with human squamous cell cervical carcinoma by gene ontology. Gynecol Oncol 96, 621-9 (2005).

46. Zhang, Y. et al. Correlation of genomic and expression alterations of AS3 with esophageal squamous cell carcinoma. J Genet Genomics 35, 267-71 (2008).

47. Maekawa, M. et al. A novel mammalian Ras GTPase-activating protein which has phospholipid-binding and Btk homology regions. Mol Cell Biol 14, 6879-85 (1994).

48. Maekawa, M., Nakamura, S. & Hattori, S. Purification of a novel ras GTPase-activating protein from rat brain. J Biol Chem 268, 22948-52 (1993).

49. Lockyer, P.J. et al. Distinct subcellular localisations of the putative inositol 1,3,4,5-tetrakisphosphate receptors GAP1IP4BP and GAP1m result from the GAP1IP4BP PH domain directing plasma membrane targeting. Curr Biol 7, 1007-10 (1997).

50. Eppert, K. et al. MADR2 maps to 18q21 and encodes a TGFbeta-regulated MAD-related protein that is functionally mutated in colorectal carcinoma. Cell 86, 543-52 (1996).

51. Riggins, G.J. et al. Mad-related genes in the human. Nat Genet 13, 347-9 (1996). 52. Uchida, K. et al. Somatic in vivo alterations of the JV18-1 gene at 18q21 in human lung

cancers. Cancer Res 56, 5583-5 (1996). 53. Tachibana, M. et al. Histone methyltransferases G9a and GLP form heteromeric

complexes and are both crucial for methylation of euchromatin at H3-K9. Genes Dev 19, 815-26 (2005).

54. Chen, X., El Gazzar, M., Yoza, B.K. & McCall, C.E. The NF-kappaB factor RelB and histone H3 lysine methyltransferase G9a directly interact to generate epigenetic silencing in endotoxin tolerance. J Biol Chem 284, 27857-65 (2009).

55. Keller, A.D. & Maniatis, T. Identification and characterization of a novel repressor of beta-interferon gene expression. Genes Dev 5, 868-79 (1991).

56. Gyory, I., Wu, J., Fejer, G., Seto, E. & Wright, K.L. PRDI-BF1 recruits the histone H3 methyltransferase G9a in transcriptional silencing. Nat Immunol 5, 299-308 (2004).

57. Kouzarides, T. Chromatin modifications and their function. Cell 128, 693-705 (2007). 58. FitzGerald, K.T. & Diaz, M.O. MLL2: A new mammalian member of the trx/MLL family of

genes. Genomics 59, 187-92 (1999). 59. Martinez-Garcia, E. et al. The MMSET histone methyl transferase switches global

histone methylation and alters gene expression in t(4;14) multiple myeloma cells. Blood 117, 211-20 (2011).

60. Yun, M., Wu, J., Workman, J.L. & Li, B. Readers of histone modifications. Cell Res 21, 564-78 (2011).

61. An, J.Y. et al. UBR2 mediates transcriptional silencing during spermatogenesis via histone ubiquitination. Proc Natl Acad Sci U S A 107, 1912-7 (2010).

62. Tasaki, T. et al. A family of mammalian E3 ubiquitin ligases that contain the UBR box motif and recognize N-degrons. Mol Cell Biol 25, 7120-36 (2005).

63. van der Knaap, J.A. et al. GMP synthetase stimulates histone H2B deubiquitylation by the epigenetic silencer USP7. Mol Cell 17, 695-707 (2005).

64. Song, M.S. et al. The deubiquitinylation and localization of PTEN are regulated by a HAUSP-PML network. Nature 455, 813-7 (2008).

65. Hussain, S., Zhang, Y. & Galardy, P.J. DUBs and cancer: the role of deubiquitinating enzymes as oncogenes, non-oncogenes and tumor suppressors. Cell cycle 8, 1688-97 (2009).

66. Shi, Y. et al. Histone demethylation mediated by the nuclear amine oxidase homolog LSD1. Cell 119, 941-53 (2004).

67. Arrowsmith, C.H., Bountra, C., Fish, P.V., Lee, K. & Schapira, M. Epigenetic protein families: a new frontier for drug discovery. Nat Rev Drug Discov 11, 384-400 (2012).

68. Lynch, J.T., Harris, W.J. & Somervaille, T.C. LSD1 inhibition: a therapeutic strategy in cancer? Expert Opin Ther Targets (2012).


87

69. Zhao, Y. et al. A TFTC/STAGA module mediates histone H2A and H2B deubiquitination, coactivates nuclear receptors, and counteracts heterochromatin silencing. Mol Cell 29, 92-101 (2008).

70. Liu, Y.L. et al. USP22 acts as an oncogene by the activation of BMI-1-mediated INK4a/ARF pathway and Akt pathway. Cell Biochem Biophys 62, 229-35 (2012).

71. Fullgrabe, J., Kavanagh, E. & Joseph, B. Histone onco-modifications. Oncogene 30, 3391-403 (2011).

72. Cea, M. et al. New Insights into the Treatment of Multiple Myeloma with Histone Deacetylase Inhibitors. Curr Pharm Des (2012).

73. Diyabalanage, H.V., Granda, M.L. & Hooker, J.M. Combination Therapy: Histone Deacetylase Inhibitors and Platinum-based Chemotherapeutics for Cancer. Cancer letters (2012).

74. Johnstone, R.W. Histone-deacetylase inhibitors: novel drugs for the treatment of cancer. Nat Rev Drug Discov 1, 287-99 (2002).

75. Bonasio, R., Lecona, E. & Reinberg, D. MBT domain proteins in development and disease. Semin Cell Dev Biol 21, 221-30 (2010).

76. Chetcuti, A., Adams, L.J., Mitchell, P.B. & Schofield, P.R. Altered gene expression in mice treated with the mood stabilizer sodium valproate. Int J Neuropsychopharmacol 9, 267-76 (2006).

77. Aravind, L. & Iyer, L.M. The HARE-HTH and associated domains: novel modules in the coordination of epigenetic DNA and protein modifications. Cell cycle 11, 119-31 (2012).

78. Fossati, A., Dolfini, D., Donati, G. & Mantovani, R. NF-Y recruits Ash2L to impart H3K4 trimethylation on CCAAT promoters. PLoS One 6, e17220 (2011).

79. Jelinic, P., Pellegrino, J. & David, G. A novel mammalian complex containing Sin3B mitigates histone acetylation and RNA polymerase II progression within transcribed loci. Mol Cell Biol 31, 54-62 (2011).

80. Schuettengruber, B., Martinez, A.M., Iovino, N. & Cavalli, G. Trithorax group proteins: switching genes on and keeping them active. Nat Rev Mol Cell Biol 12, 799-814 (2011).

81. Bouazoune, K. & Brehm, A. ATP-dependent chromatin remodeling complexes in Drosophila. Chromosome Res 14, 433-49 (2006).

82. Unhavaithaya, Y. et al. MEP-1 and a homolog of the NURD complex component Mi-2 act together to maintain germline-soma distinctions in C. elegans. Cell 111, 991-1002 (2002).

83. Alabert, C. & Groth, A. Chromatin replication and epigenome maintenance. Nat Rev Mol Cell Biol 13, 153-67 (2012).

84. Wu, H. & Zhang, Y. Mechanisms and functions of Tet protein-mediated 5-methylcytosine oxidation. Genes Dev 25, 2436-52 (2011).

85. Laget, S. et al. The human proteins MBD5 and MBD6 associate with heterochromatin but they do not bind methylated DNA. PLoS One 5, e11982 (2010).

86. Nie, Z. et al. A specificity and targeting subunit of a human SWI/SNF family-related chromatin-remodeling complex. Mol Cell Biol 20, 8879-88 (2000).

87. Lans, H., Marteijn, J.A. & Vermeulen, W. ATP-dependent chromatin remodeling in the DNA-damage response. Epigenetics Chromatin 5, 4 (2012).

88. Kohno, S., Minowada, J. & Sandberg, A.A. Chromosome evolution of near-haploid clones in an established human acute lymphoblastic leukemia cell line (NALM-16). J Natl Cancer Inst 64, 485-93 (1980).

89. Tsuchiya, S. et al. Establishment and characterization of a human acute monocytic leukemia cell line (THP-1). Int J Cancer 26, 171-6 (1980).

90. Robinson, G. et al. Novel mutations target distinct subgroups of medulloblastoma. Nature 488, 43-8 (2012).


88

91. Goodman, R.H. & Smolik, S. CBP/p300 in cell growth, transformation, and development. Genes Dev 14, 1553-77 (2000).

92. Margueron, R. & Reinberg, D. The Polycomb complex PRC2 and its mark in life. Nature 469, 343-9 (2011).

93. Downing, J.R. et al. The Pediatric Cancer Genome Project. Nat Genet 44, 619-22 (2012).

94. Krzywinski, M. et al. Circos: an information aesthetic for comparative genomics. Genome research 19, 1639-45 (2009).

95. Edmonson, M.N. et al. Bambino: a variant detector and alignment viewer for next-generation sequencing data in the SAM/BAM format. Bioinformatics 27, 865-6 (2011).

96. Pounds, S. et al. Reference alignment of SNP microarray signals for copy number analysis of tumors. Bioinformatics 25, 315-21 (2009).


SUPPLEMENTARY INFORMATION FOR THE GENOMIC … · 1 SUPPLEMENTARY INFORMATION FOR THE GENOMIC...

Documents

Transcript of SUPPLEMENTARY INFORMATION FOR THE GENOMIC … · 1 SUPPLEMENTARY INFORMATION FOR THE GENOMIC...