SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional...
Transcript of SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional...
![Page 1: SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional …hyper.ahajournals.org/content/suppl/2015/08/03/... · · 2015-08-03SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional Effect](https://reader031.fdocuments.net/reader031/viewer/2022022502/5aad07977f8b9a2b4c8df17e/html5/thumbnails/1.jpg)
SUPPLEMENTAL MATERIALS
Dose-dependent Bidirectional Effect of Angiotensin IV on Abdominal
Aortic Aneurysm via Variable Angiotensin Receptor Stimulation
By:
Jing Kong, Kai Zhang, Xiao Meng, Yun Zhang*, Cheng Zhang*
From:
The key Laboratory of Cardiovascular Remodeling and Function Research,
Chinese Ministry of Education and Chinese Ministry of Health, and The State
and Shandong Province Joint Key Laboratory of Translational Cardiovascular
Medicine, Qilu Hospital of Shandong University, Jinan, China
Running Title: Bidirectional Effect of Ang IV on AAA
*Corresponding author: Cheng Zhang, MD, PhD, FESC,
[email protected], or Yun Zhang, MD, PhD, FACC, FESC, FASE,
[email protected], Department of Cardiology, Qilu Hospital, Shandong
University, No. 107, Wen Hua Xi Road, Jinan, Shandong, 250012, China. Tel.:
+86-531-82169139; Fax: +86-531-86169356
![Page 2: SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional …hyper.ahajournals.org/content/suppl/2015/08/03/... · · 2015-08-03SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional Effect](https://reader031.fdocuments.net/reader031/viewer/2022022502/5aad07977f8b9a2b4c8df17e/html5/thumbnails/2.jpg)
SUPPLEMENTAL MATERIALS
Supplemental Materials and Methods
Animal protocol
All animal experimental procedures were approved by the Institutional Animal
Care and Use Committee at Shandong University and performed in
accordance with the Animal Management Rules of the Chinese Ministry of
Health. Two hundred and forty male apolipoprotein E-knockout (ApoE-/-) mice
aged 6-8 weeks on a C57BL/6J background were purchased from Beijing
Huafukang Animal Experimental Center. All mice were kept on a 12-hr
light/12-hr dark cycle with food and water freely available, and were fed on a
high-fat diet (0.25% cholesterol and 15% cocoa butter) for 8 weeks.
In the first part of the in vivo study, in order to examine the dose-effect of
angiotensin IV (Ang IV) on Ang II-induced abdominal aortic aneurysm (AAA),
mice were randomly divided into 5 groups after a 4-week high-fat diet feeding
(n=20 per group), and were treated with continuous subcutaneous infusion of
different agents via an osmotic pump (Alzet model 2004, Alza Corp., Palo Alto,
CA, USA) for 28 days. The control group received infusion of saline, the no
treatment group received infusion of only Ang II (1.44 mg/kg per day, Lintai
Biological Technology Company, Xi’an, China), the low-dose Ang IV group
received infusion of Ang II (1.44 mg/kg per day) plus Ang IV (0.72 mg/kg per
day, Lintai Biological Technology Company, Xi’an China), the medium-dose
Ang IV group received infusion of Ang II (1.44 mg/kg per day) plus Ang IV (1.44
mg/kg per day), and the high-dose Ang IV group received infusion of Ang II
(1.44 mg/kg per day) plus Ang IV (2.88 mg/kg per day)1, 2. All mice underwent
euthanasia after 28-day infusion and the aortic tissues were extracted for
further investigation.
In the second part of the in vivo study, in order to elaborate the role of type
4 Ang receptor (AT4R) in the effect of Ang IV on Ang II-induced AAA, sixty mice
were randomly divided into 3 groups (n=20 per group): a no treatment group
that received infusion of only Ang II (1.44 mg/kg per day), a medium-dose Ang
IV group that received infusion of Ang II (1.44 mg/kg per day) plus Ang IV (1.44
mg/kg per day), a divalinal-Ang IV group that received infusion of Ang II (1.44
mg/kg per day) plus Ang IV (1.44 mg/kg per day) and AT4R antagonist
divalinal-Ang IV (1.44mg/kg per day, Lintai Biological Technology Company,
Xi’an, China). These agents were continuously infused into mice
subcutaneously via an osmotic pump for 28 days and then the aortic tissues
were extracted from all mice after euthanasia.
In the third part of the in vivo study, in order to acquire a full assessment of
the effects of different doses of Ang IV alone on AAA formation in the absence
of Ang II, eighty mice were randomly divided into 4 groups (n=20 per group):
the control group, the low-dose Ang IV group, the medium-dose Ang IV group
and the high-dose Ang IV group, receiving infusion of saline and different
doses of Ang IV (0.72 mg/kg per day, 1.44 mg/kg per day and 2.88 mg/kg per
day), respectively, via an osmotic pump for 28 days.
![Page 3: SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional …hyper.ahajournals.org/content/suppl/2015/08/03/... · · 2015-08-03SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional Effect](https://reader031.fdocuments.net/reader031/viewer/2022022502/5aad07977f8b9a2b4c8df17e/html5/thumbnails/3.jpg)
Blood pressure measurement
Systolic blood pressure (SBP) was measured by a pulse based tail-cuff
method with a photoelectric device (Natsume, Tokyo, Japan) every week in all
mice after initiation of the experiment. Blood pressure was reported as a mean
of 3 consecutive measurements.
To examine the accuracy of SBP by noninvasive tail-cuff technique, SBP
was measured simultaneously by radiotelemetry (HD-X11 Transmitter, Data
Sciences International, St Paul, MN) and tail-cuff in 7 conscious mice, and by a
Millar catheter (SPR-869,Millar Instruments Inc., Houston, TX) and tail-cuff in
4 Wistar rats after anesthesia. The protocol for SBP measurement using
telemetry technique was concordant with previous reports3. In brief, after
anesthesia, the catheter of the telemetric transducer was inserted into the left
common carotid artery of mice and advanced to the thoracic aorta, and the
body of the transducer was secured in a subcutaneous pouch along the right
flank of the mice through the same ventral neck incision. All mice were allowed
to recover from surgery for 1 week before SBP measurement. Transient blood
pressure elevation was induced by Ang II injection (0.5μg/g, every 2 hr). Blood
pressure measurements were acquired simultaneously with telemetry and
tail-cuff device.
For measurement of blood pressure with Millar catheter technique, rats
were placed on a heat-controlled operating pad after anesthesia to maintain
body temperature. A midline incision was made overlying the trachea down to
the xyphoid bone. A Millar SPR-869 microtip catheter was inserted into the
right common carotid artery and advanced into the aorta4. Transient blood
pressure elevation was induced by Ang II injection (0.5μg/g, every half an
hour)5. Blood pressure was recorded simultaneously by Millar catheter and
tail-cuff techniques under anesthesia.
Biochemical studies
Fasting blood samples of mice were collected before euthanasia. Serum
concentrations of total cholesterol, triglycerides, low-density lipoprotein
cholesterol and high-density lipoprotein cholesterol were determined by a
commercially available enzymatic assay using a biochemistry automatic
analyzer (HITACHI 7170A, Hitachi, Tokyo, Japan).
AAA quantification
After exsanguination and saline perfusion of ApoE-/- mice, the aortas were
removed and fixed in 4% paraformaldehyde overnight. The adventitia was
removed the next day, and the maximal diameter of the abdominal aorta was
measured by use of Image-Pro Plus 6.0 (Media Cybernetics, USA) for
aneurysm quantification. AAA was defined as ≥ 50% enlargement of the
external diameter of the abdominal aorta as compared with the control group6.
Two independent individuals blinded to the experiment were responsible for
the measurement of abdominal aortas.
Histology and morphology
Aortic segments from the aortic arch to the renal arteries were removed and
![Page 4: SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional …hyper.ahajournals.org/content/suppl/2015/08/03/... · · 2015-08-03SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional Effect](https://reader031.fdocuments.net/reader031/viewer/2022022502/5aad07977f8b9a2b4c8df17e/html5/thumbnails/4.jpg)
embedded in OCT compound, and serial cross cryosections (5 μm thick) from
the proximal to the distal region of the aneurysm were prepared for histological
and morphological analysis.
Aortic sections of different groups were stained by hematoxylin and eosin
for morphologic assessment. Elastic fiber integrity of the abdominal aorta was
visualized by use of a Verhoeff-Van Gieson staining kit (Gemed Scientific Inc.,
USA) according to manufacturer’s instruction. Masson’s trichrome staining
was used for examination of the aortic collagen content.
Immunohistochemical staining
Immunohistochemic staining was performed to measure the relative content of
macrophages (Anti-Monocyte + Macrophage antibody, MOMA-2, diluted 1:100,
AbD Serotec, UK), smooth muscle cells (SMCs, α SM-actin, diluted 1:200,
Abcam, UK), matrix metalloproteinase 2 (MMP-2, diluted 1:100, Abcam, Hong
Kong; or diluted 1:100, Proteintech Group, USA), MMP-9 (diluted 1:100,
Abcam, Hong Kong; or diluted 1:100, Proteintech Group, USA), monocyte
chemoattractant protein 1 (MCP-1, diluted 1:100, Abcam, Hong Kong; or
diluted 1:50, Proteintech Group, USA) and interleukin 6 (IL-6, diluted 1:100,
Abcam, Hong Kong; or diluted 1:200, Proteintech Group, USA) in tissue
sections of AAA. Immunoreactivity was visualized after incubation with the
appropriate horseradish peroxidase-conjugated secondary antibodies and
then with 3’, 3’-diaminobenzidine.
The ratios of the positive staining area of macrophages, SMCs, MMP-2,
MMP-9, MCP-1 and IL-6 to the aortic cross sectional area were calculated by
use of Image-Pro Plus 6.0 respectively. Appropriate negative controls using
isotype Ig G were applied.
Cell culture and treatment
Human primary aortic SMCs (hASMCs) were from the American Type Culture
Collection and were cultured in SMC medium (SclenCell, USA) containing 2%
fetal bovine serum, 1% SMC growth supplement, 100 U/ml penicillin and 10
mg/ml streptomycin. Cells at 80% confluence from passages 4 to 6 were used.
After 24-hr serum starvation, cells seeded in 6-wells were divided into 5 groups:
a control group that received no drug stimulation, a no treatment group that
received only stimulation of Ang II (10-7 mol/L), a low-dose Ang IV group that
received treatment of Ang II (10-7 mol/L) + Ang IV (10-9 mol/L), a medium-dose
Ang IV group that received treatment of Ang II (10-7 mol/L) + Ang IV (10-7
mol/L), and a high-dose Ang IV group that received treatment of Ang II (10-7
mol/L) + Ang IV (10-5 mol/L)7, 8.
To further study the role of Akt signaling in the effect of Ang IV against
Ang II, cells were cultivated with Akt inhibitor A6730 (10 μmol/L, Sigma-Aldrich
Company, St. Louis, MA, USA) for 1 hr before adding Ang II (10-7 mol/L) and
Ang IV (10-9 mol/L), and were harvested after a further 24-hr stimulation.
To study the interaction of Ang IV with AT1R in the absence of Ang II
stimulation, cells were seeded in 6-wells after serum starvation for 24 hrs and
were divided into four groups that received no drug stimulation, a low-dose
![Page 5: SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional …hyper.ahajournals.org/content/suppl/2015/08/03/... · · 2015-08-03SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional Effect](https://reader031.fdocuments.net/reader031/viewer/2022022502/5aad07977f8b9a2b4c8df17e/html5/thumbnails/5.jpg)
Ang IV (10-9 mol/L), a medium-dose Ang IV (10-7 mol/L) and a high-dose Ang
IV (10-5 mol/L) stimulation respectively for 24 hrs. To clarify whether the effects
of high dose Ang IV may mimic that of Ang II, the impacts of high dose Ang IV
on collagen, MMPs and proinflammatory cytokine expression were examined
further in the presence of AT1R antagonist losartan (10-5 M) for 24 hrs9.
Quantitative Real-Time Polymerase Chain Reaction (RT-PCR) analysis
Total RNA was extracted from suprarenal aortas of ApoE-/- mice or cultured
hASMCs by use of Trizol reagent (Invitrogen, Karlsruhe, Germany) according
to the manufacturer’s protocol. The mRNA expression levels of AT1R, AT2R,
AT4R in vivo and in vitro were determined by means of SYBR Green
technology (Bio-Rad, USA) using β-actin as an internal control. Quantitative
values were obtained from the threshold cycle value (Ct) and the 2-△△Ct method
was used to determine relative gene expression levels. Briefly, the extracted
mRNA was dissolved in RNase free water, and concentrations of the total RNA
were tested using a spectrophotometer. One microgram of mRNA was used
for reverse transcription using an iScript cDNA synthesis kit (Bio-Rad, USA)
containing a mixture of oligo (dT) and random primers. Amplification was
performed using an iCycler iQ real-time PCR detection system; the program
ran for 40 cycles at 95°C for 5 seconds, 58°C for 10 seconds, and 72°C for 30
seconds. The primer sequences were presented in Table S3.
Western blot analysis
Total proteins were extracted from the suprarenal aortas of ApoE-/- mice or
hSMCs. Western blot was performed according to standard protocols, with
10% sodium dodecyl sulfate-polyacrylamide gel (SDS/PAGE), and
soluble protein was transferred to nitrocellulose membranes, which were
incubated with primary antibodies including rabbit β-actin antibody (1:1000,
Cell Signaling Technology, USA), rabbit MMP-2 antibody (1:1000, Abcam,
Hong Kong), rabbit MMP-9 antibody (1:1000, Abcam, Hong Kong), rabbit IL-6
antibody (1:1000, Abcam, Hong Kong), rabbit MCP-1 antibody (1:1000, Abcam,
Hong Kong), rabbit intercellular adhesion molecule 1 (ICAM-1) antibody (1:500,
Abcam, Hong Kong), rabbit type I collagen antibody (1:500, Abcam, UK),
rabbit type III collagen antibody (1:500, Abcam, UK), rabbit AT1R antibody
(1:1000, Abcam, Hong Kong), rabbit AT2R antibody (1:500, Abcam, Hong
Kong), rabbit AT4R antibody (1:500, Cell Signaling Technology, MA, USA),
rabbit phosphorylated Akt (p-Akt) antibody (1:1000, Cell Signaling Technology,
MA, USA), rabbit Akt antibody (1:1000, Cell Signaling Technology, MA, USA),
rabbit nuclear factor κB antibody (NF-κB p65, 1:1000, Cell Signaling
Technology, MA, USA). Specific conjugated peroxidase-labeled secondary
antibodies were used to detect primary antibodies, and the immunoreactive
bands were visualized by ECL reagents (Millipore Corp., MA, USA). Protein
expression levels were determined by densitometry. All experiments were
repeated for three times and the mean values derived.
Zymography
Zymography was performed by use of a MMP gelatin zymography kit (GenMed
![Page 6: SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional …hyper.ahajournals.org/content/suppl/2015/08/03/... · · 2015-08-03SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional Effect](https://reader031.fdocuments.net/reader031/viewer/2022022502/5aad07977f8b9a2b4c8df17e/html5/thumbnails/6.jpg)
Scientific Inc., USA). Briefly, aortic protein extracts (30 mg) from mice without
boiling were separated by 10% SDS-PAGE polymerized in the presence of
0.1% gelatin to measure the activities of MMP-2 and MMP-9. Gels were
washed with renaturing buffer for 2 hr and further incubated with developing
buffer at 37°C for 20 hr. After incubation, gels were stained with Coomassie
Brilliant Blue, and then destained with destaining buffer until clear white bands
appeared on the blue background. Gel images were captured by use of a
Kodak Imager (Eastman Kodak Company, New York, USA), and the unstained,
translucent digested regions represented areas of MMP activity.
Multiple reaction monitoring mass spectrum (MRM-MS) technique
To clarify whether exogenously infused Ang II may be catalyzed into Ang IV in
the mouse circulation, the serum Ang IV concentration was monitored using
MRM-MS technique in 15 mice (5 mice from the control group, the no
treatment group and the medium-dose Ang IV group, respectively). Serum
Aliquots of serum were added in Microcon devices YM-10 (Millipore). The
device was centrifuged at 12,000 g at 4°C for 30 min. All following
centrifugation steps were preformed under the same conditions. The
concentrate was diluted with 300µL deionized water and the device
centrifuged. Subsequently, 300µL of 50 mM ammonium bicarbonate were
added to the concentrate followed by centrifugation. The combined filtrates
were desalted on Symmetry C18 (Waters, Delaware, USA). The peptide
content was lyophilized and stored at -80 °C until use.
200µg heavy isotope-labeled peptide was ordered from BANKPEPTIDE
LTD (Hefei, China). Each sample was dissolved using 40µL of standard 2
fmol/µL heavy isotope-labeled peptide solution. MRM experiments were
performed on a 6500 QTRAP hybrid triple quadrupole/linear ion trap mass
spectrometer (AB Sciex, Foster City, CA) interfaced with an Eksigent nano 1D
plus system (Waters, Milford, MA). 10 µL of tryptic digests were injected using
the partial loop injection mode onto a UPLC Symmetry trap column (180 µm i.d.
x 2 cm packed with 5 µm C18 resin; Waters) and then separated by RP-HPLC
on a column (75 µm i.d.) packed in-house with 15 cm of Magic C18 3µm
reversed-phase resin (Michrom Bioresources, Auburn, CA). Chromatography
was performed with Solvent A (Milli-Q (Millipore, Billerica, MA) water with 2%
acetonitrile and 0.1% formic acid) and Solvent B (90% acetonitrile with 0.1%
formic acid). Peptides were eluted at 300 nL/min for 5% B for 3min, 5–10% B
over 5 min, 10–15% B over 27 min, 15–40% B over 35 min, 40–80% B over 1
min, 80% B for 5 min before returning to 5% B over 15 min. MRM data were
acquired with a Ionspray voltage of 2,100 V, curtain gas of 20 p.s.i.
Declustering potential value was predicted by SKYLINE. Pause between MS
was 5ms. MRM transitions were monitored using unit resolution in both Q1 and
Q3 quadrupoles to maximize specificity. Data analysis were performed using
SKYLINE (version 2.6).
Statistical analysis
Statistical analyses involved use of SPSS 16.0 (SPSS Inc, Chicago, IL).
![Page 7: SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional …hyper.ahajournals.org/content/suppl/2015/08/03/... · · 2015-08-03SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional Effect](https://reader031.fdocuments.net/reader031/viewer/2022022502/5aad07977f8b9a2b4c8df17e/html5/thumbnails/7.jpg)
Continuous variables were reported as mean SEM and categorical variables
as numbers and percentages. One-way ANOVA with least significant
difference post-hoc analysis and chi-square tests was used for multiple
comparisons. Correlation coefficients and slopes of regression lines were
derived between simultaneous blood pressure measurements by tail-cuff and
radiotelemetry or Millar catheter techniques. Bland-Altman analysis was used
to assess the agreement between blood pressure measurements by two
techniques and the 95% limits of agreement were estimated as the mean
difference ± 1.96 SD. P<0.05 was considered statistically significant.
Sources of Funding
This study was supported by research grants from National 973 Basic
Research Program (2011CB503906, 2012CB518603, 2013CB530703),
National High-tech Research and Development Program of China
(2012AA02A510), Program of Introducing Talents of Discipline to Universities
(B07035), the State Program of National Natural Science Foundation of China
for Innovative Research Group (81321061), International Collaboration and
Exchange Program of China (81320108004), and the grants of the National
Natural Science Foundation of China (61331001, 81425004, 91339109,
81173251, 81270350, 81300234) , and Shandong Province Science
Foundation for Distinguished Young Scholars (ZR2012HQ029).
Reference
1. Vinh A, Widdop RE, Drummond GR, Gaspari TA. Chronic angiotensin iv
treatment reverses endothelial dysfunction in apoe-deficient mice.
Cardiovascular research. 2008;77:178-187.
2. Vinh A, Widdop RE, Chai SY, Gaspari TA. Angiotensin iv-evoked
vasoprotection is conserved in advanced atheroma. Atherosclerosis.
2008;200:37-44.
3. Whitesall SE, Hoff JB, Vollmer AP, D'Alecy LG. Comparison of
simultaneous measurement of mouse systolic arterial blood pressure by
radiotelemetry and tail-cuff methods. American journal of physiology.
Heart and circulatory physiology. 2004;286:H2408-2415.
4. Hao P, Yang J, Liu Y, Zhang M, Zhang K, Gao F, Chen Y, Zhang C,
Zhang Y. Combination of angiotensin-(1-7) with perindopril is better than
single therapy in ameliorating diabetic cardiomyopathy. Scientific
reports. 2015;5:8794.
5. Wakisaka Y, Chu Y, Miller JD, Rosenberg GA, Heistad DD. Critical role
for copper/zinc-superoxide dismutase in preventing spontaneous
intracerebral hemorrhage during acute and chronic hypertension in
mice. Stroke; a journal of cerebral circulation. 2010;41:790-797.
6. King VL, Trivedi DB, Gitlin JM, Loftin CD. Selective cyclooxygenase-2
inhibition with celecoxib decreases angiotensin ii-induced abdominal
![Page 8: SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional …hyper.ahajournals.org/content/suppl/2015/08/03/... · · 2015-08-03SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional Effect](https://reader031.fdocuments.net/reader031/viewer/2022022502/5aad07977f8b9a2b4c8df17e/html5/thumbnails/8.jpg)
aortic aneurysm formation in mice. Arterioscler Thromb Vasc Biol.
2006;26:1137-1143.
7. Yang JM, Dong M, Meng X, Zhao YX, Yang XY, Liu XL, Hao PP, Li JJ,
Wang XP, Zhang K, Gao F, Zhao XQ, Zhang MX, Zhang Y, Zhang C.
Angiotensin-(1-7) dose-dependently inhibits atherosclerotic lesion
formation and enhances plaque stability by targeting vascular cells.
Arterioscler Thromb Vasc Biol. 2013;33:1978-1985.
8. Esteban V, Ruperez M, Sanchez-Lopez E, Rodriguez-Vita J, Lorenzo O,
Demaegdt H, Vanderheyden P, Egido J, Ruiz-Ortega M. Angiotensin iv
activates the nuclear transcription factor-kappab and related
proinflammatory genes in vascular smooth muscle cells. Circ Res.
2005;96:965-973.
9. Li XC, Campbell DJ, Ohishi M, Yuan S, Zhuo JL. At1 receptor-activated
signaling mediates angiotensin iv-induced renal cortical
vasoconstriction in rats. American journal of physiology. Renal
physiology. 2006;290:F1024-1033.
![Page 9: SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional …hyper.ahajournals.org/content/suppl/2015/08/03/... · · 2015-08-03SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional Effect](https://reader031.fdocuments.net/reader031/viewer/2022022502/5aad07977f8b9a2b4c8df17e/html5/thumbnails/9.jpg)
Supplemental Tables
Table S1. Characteristics of mice in part one in vivo study
Parameters
Control
(n=20)
No
treatment(n=20)
Low-dose
Ang IV(n=20)
Medium-dose
Ang IV(n=20)
High-dose
Ang IV(n=20)
Weight(g) 27.82 ± 1.16 24.00 ± 0.76 24.76 ± 1.39 24.81 ± 1.68 24.23 ± 0.94
TC(mmol/l) 25.57 ± 2.24 23.89 ± 1.88 25.47 ± 2.63 28.91 ± 2.23 27.53 ± 2.80
TG(mmol/l) 0.86 ± 0.09 1.08 ± 0.21 0.86 ± 0.14 0.93 ± 0.10 0.92 ± 0.14
HDL-C(mmol/l) 4.76 ± 0.34 4.64 ± 0.66 6.10 ± 0.29 5.70 ± 0.52 5.18 ± 0.28
LDL-C(mmol/l) 3.38 ± 0.33 3.12 ± 0.25 3.21 ± 0.46 3.95 ± 0.33 3.82 ± 0.54
SBP 0W (mmHg) 108.8 ± 4.6 109.2 ± 5.2 102.2 ± 3.9 106.0 ± 5.3 100.7 ± 2.8
SBP 4W (mmHg) 103.2 ± 3.1 132.3 ± 5.4*† 136.0 ± 2.6*
† 142.0 ± 5.5*
† 131.8 ± 5.0*
†
TC: total cholesterol; TG, triglycerides; HDL-C, high-density lipoprotein
cholesterol; LDL-C, low-density lipoprotein cholesterol; SBP, systolic blood
pressure. *P<0.05 vs. SBP 0W in the same group; †P<0.05 vs.control
![Page 10: SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional …hyper.ahajournals.org/content/suppl/2015/08/03/... · · 2015-08-03SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional Effect](https://reader031.fdocuments.net/reader031/viewer/2022022502/5aad07977f8b9a2b4c8df17e/html5/thumbnails/10.jpg)
Table S2. Characteristics of mice in part two in vivo study
Parameters
No
treatment(n=20)
Medium-dose
Ang IV(n=20)
Divalinal-
Ang IV(n=20)
Weight(g) 26.96 ± 0.42 25.91 ± 1.10 24.39 ± 1.33
TC(mmol/l) 25.66 ± 2.01 28.17 ± 2.84 27.22 ± 1.38
TG(mmol/l) 1.20 ± 0.27 1.03 ± 0.10 1.25 ± 0.29
HDL-C(mmol/l) 5.25 ± 0.77 5.45 ± 0.61 6.77 ± 0.46
LDL-C(mmol/l) 3.25 ± 0.32 3.87 ± 0.43 3.43 ± 0.23
SBP 0W (mmHg) 98.8 ± 2.9 102.6 ± 4.5 105.8 ± 4.2
SBP 4W (mmHg) 154.2 ± 4.9* 157.7 ± 6.0* 158.4 ± 4.9*
*P<0.05 vs. SBP 0W in the same group.
![Page 11: SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional …hyper.ahajournals.org/content/suppl/2015/08/03/... · · 2015-08-03SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional Effect](https://reader031.fdocuments.net/reader031/viewer/2022022502/5aad07977f8b9a2b4c8df17e/html5/thumbnails/11.jpg)
Table S3. Primers used for RT-PCR analysis
Primers Sequences 5’-3’
hASMCs
AT1R
sense ATTTAGCACTGGCTGACTTATGC
antisense CAGCGGTATTCCATAGCTGTG
AT2R
sense TATGGCCTGTTTGTCCTCATTG
antisense CCATTGGGCATATTTCTCAGGT
AT4R
sense AGTGCAACTGGTTACAGGCAG
antisense ACCACGATGACAAAAGCACAG
β-actin
sense CTGGAACGGTGAAGGTGACA
antisense GGGACTTCC TGTAACAATGCA
AAA tissues
AT1R
sense TTGTCCACCCGATGAAGTCTC
antisense AAAAGCGCAAACAGTGATATTGG
AT2R
![Page 12: SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional …hyper.ahajournals.org/content/suppl/2015/08/03/... · · 2015-08-03SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional Effect](https://reader031.fdocuments.net/reader031/viewer/2022022502/5aad07977f8b9a2b4c8df17e/html5/thumbnails/12.jpg)
sense ATGATTGGCTTTTTGGACCTGT
antisense AAGGGTAGATGACCGATTGGT
AT4R
sense TTTACCAATGATCGGCTTCAGC
antisense TCGAACCTCGGGGCTCATATT
β-actin
sense CACTGTGCCCATCTACGA
antisense GTAGTCTGTCAGGTCCCG
![Page 13: SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional …hyper.ahajournals.org/content/suppl/2015/08/03/... · · 2015-08-03SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional Effect](https://reader031.fdocuments.net/reader031/viewer/2022022502/5aad07977f8b9a2b4c8df17e/html5/thumbnails/13.jpg)
Figure S1
Figure S1:Comparison of systolic blood pressure (SBP) measurements
by tail-cuff and radiotelemetry or Millar catheter techniques. (A) Linear
regression of SBP by tail-cuff and radiotelemetry techniques. (B)
Bland–Altman analysis of SBP measured by tail-cuff and telemetry techniques.
The dotted lines represent the average difference between tail-cuff and
radiotelemetry measurements and the solid lines represent the upper and
lower 95% confidence limits of agreement. (C) Linear regression of SBP by
tail-cuff and Millar catheter techniques. (D) Bland–Altman analysis of SBP
measured by tail-cuff and Millar catheter techniques. The dotted lines
represent the average difference between tail-cuff and Millar catheter
measurements and the solid lines represent the upper and lower 95%
confidence limits of agreement.
![Page 14: SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional …hyper.ahajournals.org/content/suppl/2015/08/03/... · · 2015-08-03SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional Effect](https://reader031.fdocuments.net/reader031/viewer/2022022502/5aad07977f8b9a2b4c8df17e/html5/thumbnails/14.jpg)
Figure S2
Figure S2. Effect of different doses of angiotensin IV (Ang IV) on
abdominal aortic aneurysm (AAA) formation in apolipoprotein
E-knockout (ApoE-/-) mice in the absence of Ang II. (A) Representative
photographs of abdominal aortic specimens in the 4 groups of mice who
received treatment with saline, low-dose, medium-dose and high-dose Ang IV,
respectively, in the absence of Ang II. (B) Maximal abdominal aortic diameters
in the 4 groups of mice.
![Page 15: SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional …hyper.ahajournals.org/content/suppl/2015/08/03/... · · 2015-08-03SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional Effect](https://reader031.fdocuments.net/reader031/viewer/2022022502/5aad07977f8b9a2b4c8df17e/html5/thumbnails/15.jpg)
Figure S3
Figure S3. Effect of angiotensin IV (Ang IV) on matrix metalloproteinases
(MMPs) and proinflammatory cytokines in Ang II-infused apolipoprotein
E-knockout (ApoE-/-) mice. (A) Representative immunostaining of MMP-2,
MMP-9, monocyte chemoattractant (MCP-1) and interleukin 6 (IL-6) in AAA of
4 groups of mice. (B and C) Quantitative analysis of positive MMP-2, MMP-9,
MCP-1 and IL-6 staining in 4 groups of mice. Bar: 50μm. *P <0.05 vs. no
treatment group; #P <0.05 vs. medium-dose group.
![Page 16: SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional …hyper.ahajournals.org/content/suppl/2015/08/03/... · · 2015-08-03SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional Effect](https://reader031.fdocuments.net/reader031/viewer/2022022502/5aad07977f8b9a2b4c8df17e/html5/thumbnails/16.jpg)
Figure S4
Figure S4. Effect of angiotensin IV (Ang IV) on the expression of
collagen, matrix metalloproteinases (MMPs), proinflammatory cytokines,
signaling proteins and Ang receptors in Ang II-stimulated human aortic
smooth muscle cells (hASMCs). (A) Representative western blot of type I
and III collagen levels in 5 groups of cells. (B to C) Quantitative analysis of type
I and III collagen levels. (D) Representative western blot of protein expression
of MMP-2, MMP-9, monocyte chemoattractant protein 1 (MCP-1), interleukin 6
(IL-6), and intercellular adhesion molecule 1 (ICAM-1), and (E to I) their
quantitative analysis. (J to L) Relative mRNA expression of type 1 angiotensin
![Page 17: SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional …hyper.ahajournals.org/content/suppl/2015/08/03/... · · 2015-08-03SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional Effect](https://reader031.fdocuments.net/reader031/viewer/2022022502/5aad07977f8b9a2b4c8df17e/html5/thumbnails/17.jpg)
receptor (AT1R), AT2R and AT4R. (M) Representative western blot of
phosphorylated Akt (p-Akt), Akt, and nuclear factor-ƙB (NF-ƙB) p65, AT1R,
AT2R, AT4R and (N to R) their quantification. *P <0.05 vs. control group; #P <
0.05 vs. no treatment group; &P<0.05 vs. low-dose Ang IV group.
Figure S5
Figure S5. Effect of divalinal-angiotensin IV (Ang IV) on the expression of
matrix metalloproteinases (MMPs) and proinflammatory cytokines in Ang
II-infused apolipoprotein E-knockout (ApoE-/-) mice. (A) Representative
immunostaining of MMP-2, MMP-9, monocyte chemoattractant protein 1
(MCP-1) and interleukin 6 (IL-6) in aortic aneurysm tissues of 3 groups of mice.
(B to C) Quantitative analysis of positive MMP-2, MMP-9, MCP-1 and IL-6
staining in 3 groups of mice. Bar: 50μm. *P <0.05 vs. no treatment group; #P
<0.05 vs. medium-dose Ang IV group.
![Page 18: SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional …hyper.ahajournals.org/content/suppl/2015/08/03/... · · 2015-08-03SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional Effect](https://reader031.fdocuments.net/reader031/viewer/2022022502/5aad07977f8b9a2b4c8df17e/html5/thumbnails/18.jpg)
Figure S6
Figure S6. Effect of divalinal-angiotensin IV (Ang IV) on signaling
proteins and Ang receptors in Ang II-infused apolipoprotein E-knockout
(ApoE-/-) mice. (A) Representative western blot of phosphorylated Akt (p-Akt),
Akt, and nuclear factor-ƙB (NF-ƙB) p65 expression in abdominal aortas of 3
groups of mice and (B to C) their quantification. (D to F) Relative mRNA
expression of type 1 angiotensin receptor (AT1R), AT2R and AT4R. (G)
Representative western blot of AT1R, AT2R and AT4R expression in abdominal
aortas of 3 groups of mice and (H to J) their quantification. *P <0.05 vs. no
treatment group; #P <0.05 vs. medium-dose Ang IV group.
![Page 19: SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional …hyper.ahajournals.org/content/suppl/2015/08/03/... · · 2015-08-03SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional Effect](https://reader031.fdocuments.net/reader031/viewer/2022022502/5aad07977f8b9a2b4c8df17e/html5/thumbnails/19.jpg)
Figure S7
Figure S7. Effect of angiotensin IV (Ang IV) on type 1 angiotensin
receptor (AT1R) mRNA expression in human aortic smooth muscle cells
(hASMCs) without Ang II stimulation and serum Ang IV concentration
monitoring by MRM-MS in mice. (A) Relative mRNA expression of AT1R in
hASMCs receiving three doses of Ang IV but without Ang II stimulation. (B)
Serum concentration of Ang IV in three groups of mice. *P <0.05 vs. control, #P <0.05 vs. no treatment.
Figure S8
![Page 20: SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional …hyper.ahajournals.org/content/suppl/2015/08/03/... · · 2015-08-03SUPPLEMENTAL MATERIALS Dose-dependent Bidirectional Effect](https://reader031.fdocuments.net/reader031/viewer/2022022502/5aad07977f8b9a2b4c8df17e/html5/thumbnails/20.jpg)
Figure S8. Effect of angiotensin IV (Ang IV) on the expression of collagen,
matrix metalloproteinases (MMPs) and proinflammatory cytokines in
human aortic smooth muscle cells (hASMCs) in the absence of Ang II
stimulation. (A) Representative western blot of type I and III collagen levels in
4 groups of cells. (B to C) Quantitative analysis of type I and III collagen levels.
(D) Representative western blot of protein expression of MMP-2, MMP-9,
monocyte chemoattractant protein 1 (MCP-1), interleukin 6 (IL-6), and
intercellular adhesion molecule 1 (ICAM-1) and (E to I) their quantitative
analysis. *P <0.05 vs. control, #P <0.05 vs. Ang II,&P <0.05 vs. Ang IV.