Supplemental Information The Dendritic Cell Receptor ...€¦ · (E) Mouse embryonic fibroblasts...

SUPPLEMENTAL DOCUMENT Zhang et al Clec9A Recognition of Damaged Cells

Immunity, Volume 36

Supplemental Information

The Dendritic Cell Receptor Clec9A Binds

Damaged Cells via Exposed Actin Filaments Jian-Guo Zhang, Peter E. Czabotar, Antonia N. Policheni, Irina Caminschi, Soo San Wan, Susie Kitsoulis, Kirsteen M. Tullett, Adeline Y. Robin, Rajini Brammananth, Mark F. van Delft, Jinhua Lu, Lorraine A. O’Reilly, Emma C. Josefsson, Benjamin T. Kile, Wei Jin Chin Justine D. Mintern, Maya A. Olshina, Wilson Wong, Jake Baum, Mark D. Wright, David C.S. Huang, Narla Mohandas, Ross L. Coppel, Peter M. Colman, Nicos A. Nicola, Ken Shortman, and Mireille H. Lahoud SUPPLEMENTAL FIGURES Figure S1, related to Figure 1. Generation and Binding Activity of Soluble Recombinant Ectodomains of Clec9A. Figure S2, related to Figure 2. Analysis of Human Erythrocytic Spectrin and Mouse Apoptotic Thymocyte Spectrin by Size-Exclusion Chromatography and SDS-PAGE. Figure S3, related to Figure 3. Clec9A Binds to a Spectrin-Actin Complex. Figure S4, related to Figure 4. Clec9A Binds to Actin Complexed with Recombinant Actin Binding Domains. Figure S5, related to Figure 6. Further Structural Observations of hCLEC9A-CTLD. SUPPLEMENTAL TABLES Table S1, related to Figure 1. Proteomic Analysis of Clec9A interacting proteins isolated from mouse thymocytes and human 293F cells. Table S2, related to Figure 2 and Figure S2. Proteomic Analysis of Human Erythrocytic Spectrin. Table S3, related to Figure 3. Proteomic Analysis of Mouse Erythrocytic Spectrin Isolated at 4oC or at 37oC (Bands A-E), and of Non-erythrocytic Spectrin Isolated from Human 293F Cells (Bands F-H). Table S4, related to Figure 6. Crystallographic Statistics for the CLEC9A CTLD Structure. SUPPLEMENTAL EXPERIMENTAL PROCEDURES SUPPLEMENTAL REFERENCES


Figure S1, related to Figure 1. Generation and Binding Activity of Soluble Recombinant Ectodomains of Clec9A. (A) A schematic representation of the endogenous and recombinant soluble mClec9A proteins. The endogenous protein includes the Clec9A extracellular domains, the transmembrane (TM) and the cytoplasmic (cyto) domains. Three forms of recombinant soluble mClec9A protein were generated: mClec9A-ecto which consists of the full Clec9A ectodomain, a FLAG tag and a biotinylation consensus sequence (predicted mol wt of 27 kDa); mClec9A-CTLD which consists of the Clec9A-CTLD, FLAG tag and biotinylation consensus sequence (predicted mol wt of 19.7 kDa); mClec9A-stalk which consists of the Clec9A-stalk region, FLAG tag and biotinylation consensus sequence (predicted mol wt of 12 kDa). (B) Western blot analysis of endogenous mClec9A expression. DCs were produced from cultures of bone marrow with Flt3L (Naik et al., 2005) and DC lysates electrophoresed under non-reducing (N) and reducing (R) conditions. Blots were hybridised using anti-mClec9A Ab (24/04-10B4) and binding detected using HRP conjugated anti-rat Ig and Enhanced Chemiluminescence-Plus (Amersham). mClec9A was observed to migrate as a dimer under non-reducing conditions.


(C) Western blot analysis of biotinylated recombinant soluble mClec9A protein. Biotinylated mClec9A-ecto and mClec9A-CTLD were electrophoresed under nonreducing (N) and reducing (R) conditions, and proteins detected using SA-HRP and Enhanced Chemiluminescence (Amersham). Recombinant mClec9A-ecto, like endogenous mClec9A, was observed to migrate as a dimer under nonreducing conditions and as a monomer under reducing conditions whereas mClec9A-CTLD migrated as a monomer under all conditions (B, C). (D) Mouse thymocytes were γ-irradiated (5Gy) then cultured for 3.5 hr or 16 hr to follow the progress of apoptotic death. Samples were incubated with biotinylated mClec9A-ecto (solid line) or biotinylated Cire-ecto as a background control (dashed line) and binding detected using SA-PE. Thymocytes were stained with Annexin V-FITC, analysed by flow cytometry, and gated as Annexin V- (viable), Annexin V+ PI- (early apoptotic) or Annexin V+ PI+ (late apoptotic) cells for analysis of Clec9A binding. (E) Mouse embryonic fibroblasts (MEFs) overexpressing Noxa to inactivate Mcl-1(van Delft et al., 2006) were induced to undergo apoptosis by treatment with 2.5 µM ABT-737 for 16 hr. Control untreated MEFs (viable) and ABT-737-treated MEFs (late apoptotic) were harvested and incubated with mClec9A-ecto (solid line), hCLEC9A-ecto (solid line), or Cire-ecto (background control, dashed line). Binding was detected using biotinylated anti-FLAG mAb, SA-PE and flow cytometry. 90% of the untreated MEFs were viable whereas 95% of the ABT-737 treated MEFs were dead (based on PI staining). (F) Viable or freeze-thawed mouse fibroblasts (3T3 cell line) were incubated with biotinylated mClec9A or hCLEC9A ectodomains (solid line), or with biotinylated control (Cire-ecto, dashed line). Binding in (F)-(I) was detected using SA-PE and flow cytometry. (G) Human 293T cells were freeze-thawed then incubated with biotinylated mClec9A-ecto, hCLEC9A-ecto (solid line) or Cire-ecto (dashed line) in the absence or presence of 5 mM EDTA (solid line). (H) Control untreated MEFs (viable) and ABT-737 treated MEFs (2.5 µM ABT-737 for 16 hr; late apoptotic) were incubated in PBS alone or in the presence of DNaseI, RNaseA, protease K or trypsin. Cells were washed extensively to remove nucleases and proteases, then incubated with biotinylated mClec9A-ecto (solid line), or biotinylated Cire-ecto as a control (dashed line). 80% of the untreated MEFs were viable whereas 97% of the ABT-737 treated MEFs were dead (PI staining). (I) Mouse red blood cells (RBC) were isolated, permeabilised with PBS containing 0.15% saponin and 1 x EDTA-free complete protease inhibitors (Roche), and repeatedly washed using the saponin-containing buffer in order to generate saponin-permeabilised RBC ghosts. Viable RBC and saponin-ghosts were incubated with biotinylated mClec9A-ecto (solid line), or biotinylated Cire-ecto as a background control (dashed line).


Figure S2, related to Figure 2. Analysis of Human Erythrocytic Spectrin and Mouse Apoptotic Thymocyte Spectrin by Size-Exclusion Chromatography and SDS-PAGE. (A) Analysis of human erythrocyte spectrin (Sigma) by SDS-PAGE and mass spectrometry. Spectrin (5µg) was analysed by SDS-PAGE on a NuPAGE Novex 4-12% Bis-Tris gel (Invitrogen) under reducing conditions and protein bands visualized by the SimplyBlue staining (Invitrogen). Protein bands A to E were then excised from the gel and subjected to mass spectrometry analysis. (B) Analysis of human erythrocyte spectrin (Sigma) by size-exclusion chromatography (SEC). Spectrin was chromatographed on a Superose 6 column (300 x 10 mm) at a flowrate of 0.4 ml/min and column fractions at 0.4 ml collected for analysis. (C) Mouse Clec9A binding to SEC fractions of human erythrocytic spectrin. Spectrin fractions from SEC (B) were coated onto ELISA plates, and incubated with mClec9A-ecto (0.3 µg/ml). Binding was detected using anti-FLAG-HRP. Clec9A binding to human spectrin is shown as a control.


(D) Analysis of human erythrocytic spectrin fractions by SDS-PAGE. Spectrin fractions collected from SEC (B) were analysed by SDS-PAGE on a NuPAGE Novex 4-12% Bis-Tris gel (Invitrogen) under reducing conditions and protein bands visualized by silver staining. Fraction numbers are indicated above the lanes. (E) Analysis of apoptotic thymocyte spectrin by SEC. Mouse thymocytes were γ-irradiated (5Gy) then cultured for 3.5 hr. Spectrin was extracted and chromatographed on a Superose 6 column (300 x 10 mm) at a flowrate of 0.4 ml/min and column fractions at 0.4 ml collected for analysis. (F) Mouse Clec9A binding to SEC fractions of apoptotic thymocyte spectrin. Fractions collected from SEC (E) were coated onto ELISA plates, and incubated with mClec9A-ecto and mClec12A-ecto (0.3 µg/ml). Binding was detected using anti-FLAG-HRP. (G) Analysis of apoptotic thymocyte spectrin fractions by SDS-PAGE. Fractions from SEC (E) were analysed by SDS-PAGE on a NuPAGE Novex 4-12% Bis-Tris gel (Invitrogen) under reducing conditions and protein bands visualized by silver staining. Fraction numbers are indicated above the lanes. (H) Human erythrocytic spectrin (Sigma) was coated onto ELISA plates. mClec9A-ecto and mClec12A-ecto binding to spectrin was performed in PBS at the indicated pH. Binding was detected using anti-FLAG-HRP.


Figure S3, related to Figure 3. Clec9A Binds to a Spectrin-Actin Complex. (A) Mouse erythrocytic spectrin was isolated at 4oC, and analysed by SEC (top panel), before dissociation by treatment at 37oC in spectrin extraction buffer for 1 hr and analysis by SEC using a Superose 6 column (bottom panel). (B) Clec9A binding to SEC fractions of erythrocytic spectrin dissociated at 37oC. Fractions of the dissociated spectrin (A) were coated onto ELISA plates, and binding of mClec9A-ecto (0.3µg/ml) or the control protein mClec12A-ecto detected. (C) Fractions of the dissociated spectrin (A) were analysed by SDS-PAGE under reducing conditions and protein bands visualised by silver staining. (D) Re-association of mouse erythrocyte spectrin with actin. Fractions 25-29 of the dissociated spectrin collected from SEC (A, C) and demonstrated to have no binding activity to Clec9A (B) were concentrated in the presence of either BSA or actin to promote spectrin re-association. Spectrin re-associated in the presence of BSA or actin was then chromatographed on a Superose 6 column, and fractions collected for subsequent analysis for Clec9A binding activity by ELISA (E) and by SDS-PAGE (F).


(E) mClec9A binding to SEC fractions of reassociated spectrin. Fractions of erythrocytic spectrin reassociated in the presence of BSA or actin (D) were coated onto ELISA plates, and binding of mClec9A-ecto (0.3 µg/ml) detected. (F) Analysis of SEC fractions of reassociated spectrin fractions by SDS-PAGE. Fractions of erythrocytic spectrin reassociated in the presence of BSA or actin (D) were analysed by SDS-PAGE under reducing conditions and protein bands visualized by silver staining.


Figure S4, related to Figure 4. Clec9A Binds to Actin Complexed with Recombinant Actin Binding Domains. (A) Mouse Clec9A binding to recombinant GST-tagged domains of erythrocytic spectrin, αI and βI, in the presence and absence of muscle actin. Spectrin domains were incubated in the presence and absence of actin at 30oC, then coated onto ELISA plates, and incubated with mClec9A-ecto (2 µg/ml), or with mClec12A-ecto (2 µg/ml) and mCire-ecto (2 µg/ml) as controls. Binding was detected using anti-FLAG-HRP. Clec9A bound only to the βI N-4 domains of erythrocytic spectrin that had been pre-incubated with actin.


(B) Clec9A binding to dead cells is inhibited by pre-incubation of Clec9A with GST-tagged erythrocytic spectrin βI N plus actin. mClec9A-ecto was incubated with actin, ABD, or pre-associated ABD-actin complexes including spectrin βI N plus actin, spectrin βII N plus actin and α-α-actinin 1 N plus actin, before incubation with late apoptotic (PI+) thymocytes. Binding of mClec9A-ecto (5 µg/ml; solid line) in the presence or absence of ABD (100 µg/ml) and actin (100 µg/ml), or the control Cire-ecto (dashed line) was detected using a FITC-conjugated anti-FLAG mAb and flow cytometry. (C) Clec9A binding to recombinant GST-tagged α-actinin 1 N and Cofilin-1 in the presence or absence of actin. Pre-associated ABD plus muscle actin were coated onto ELISA plates, and binding of mClec9A-ecto (1 µg/ml) or mClec12A-ecto detected using anti-FLAG-HRP.

Figure S5, related to Figure 6. Further Structural Observations of hCLEC9A-CTLD. (A) Validation of the hCLEC9A-CTLD (S225D) used for structural determination. In order to confirm biological activity of the glycosylation modified hCLEC9A-CTLD (S225D), human 293F cells were freeze-thawed to induce membrane disruption then incubated with the original hCLEC9A-CTLD, or hCLEC9A-CTLD (S225D) at 5 µg/ml (solid lines). Binding was detected using FITC-conjugated anti-FLAG mAb, and flow cytometry. Staining with secondary reagents alone is demonstrated (dashed line). This confirmed that the hCLEC9A-CTLD (S225D) maintained binding activity to dead cells. (B) Crystal packing mediated by W131 and W227. (C) W131 and W227 (detailed in blue) are spatially located near the native N-linked glycosylation sites on the human CLEC9A CTLD (N223, detailed in green) and the mouse CLEC9A CTLD (N159; equivalent human residue, H135, detailed in purple). (D) Co-ordination of Ca2+ ion by CLEC9A. (E) Thermofluor assay of CLEC9A. The melting temperatures (Tm) of hCLEC9A-CTLD (S225D) incubated in the presence of EDTA, Ca2+ or Mg2+ were determined. CLEC9A is less stable in the presence of EDTA (6mM EDTA; with a negative Tm difference of -3 +/- 2°C; n=3; green bar) and


stabilised in the presence of Ca2+(2.47mM CaCl2; with a positive Tm difference of +15.5 +/- 2.5°C; n=2; purple bar). CLEC9A stability was not affected by the presence of Mg2+ (1.24mM MgSO4; with a Tm difference of +1 +/- 0oC; n=2; blue bar). Tm differences were calculated by comparing the Tm of incubated CLEC9A to the Tm of CLEC9A in standard buffer conditions (42°C in Tris buffered saline). (F) Location of lysines mutated to alanine to test the role of basic residues in ligand binding. Mutated residues are shown in blue on chain A of the CLEC9A-CTLD as a CLEC8A-like dimer (Top View; related to Figure 6C). Equivalent residues on chain B are coloured green. Data are mean ± SEM.


Table S1, related to Figure 1. Proteomic Analysis of Clec9A interacting proteins isolated from

mouse thymocytes and human 293F cells. Clec9A interacting proteins were isolated by

incubation of FLAG-tagged Clec9A-ecto with lysates of mouse thymocytes or a suspension adapted

subline of human 293 cells (Freestyle human 293F) and affinity purification using anti-FLAG resin.

Protein complexes were analysed by SDS-PAGE under reducing conditions, and a protein band of

220-300 kDa was excised and subjected to mass spectrometry analysis. The five most abundant

proteins are described below.

Protein name Accession

number Mol wt (kDa) Unique

peptides Mouse Thymocytes

Cation-independent mannose-6-phosphate receptor precursor

Q07113

281 kDa 26

Spectrin alpha chain, brain P16546 285 kDa 12 Spectrin beta chain, brain 1 Q62261 275 10 Myosin-XVIIIa Q9JMH9 234 kDa 8 Filamin, alpha A2AM91 281 7 Human 293F cells

Spectrin beta chain, brain 1 Q01082 275 25 Translational activator GCN1 Q92616 293 25 (SPTAN1)Isoform 2 of Q13813 Q13813-2 285 24 Filamin A Q60FE5 278 24 Myosin-9 P35579 227 9


Table S2, related to Figure 2 and Figure S2. Proteomic Analysis of Human Erythrocytic

Spectrin. Proteins included if samples had greater or equal to 10 peptides.

Protein name Accession

number Mol wt (kDa) Unique

peptides Band A Spectrin alpha chain, erythrocyte P02549; P08032 280 146 Spectrin beta chain, erythrocyte P11277; B2RX08 246; 268 kDa 140 Clathrin heavy chain 1 Q00610 192 25 Band B Spectrin alpha chain, erythrocyte P02549; P08032 280 160 Spectrin beta chain, erythrocyte P11277; B2RX08 246; 268 kDa 154 Clathrin heavy chain 1 Q00610 192 20 Transitional endoplasmic reticulum

ATPase Q01853 89 10

Band C Spectrin beta chain, erythrocyte P11277; B2RX08 246; 268 kDa 82 Spectrin alpha chain, erythrocyte P02549; P08032 280 78 Transitional endoplasmic reticulum

ATPase Q01853 89 32

Beta-adducin Q9QYB8 81 16 26S proteasome non-ATPase

regulatory subunit 1 Q99460 106 16

26S proteasome non-ATPase regulatory subunit 2

Q8VDM4 100 13

AP-2 complex subunit alpha-1 O95782 108 13 Ankyrin-1 Q02357 204 10 Band D Spectrin beta chain, erythrocyte P11277; B2RX08 246; 268 kDa 50 Spectrin alpha chain, erythrocyte P02549; P08032 280 37 Erythrocyte protein band 4.1 A2A839; P11171 72; 97 kDa 28 Heat shock cognate 71 kDa protein P63017 71 14 Band E Actin, cytoplasmic 1 P60710 42 20 Spectrin alpha chain, erythrocyte P02549; P08032 280 18 Tropomodulin-1 P28289 41 16 Spectrin beta chain, erythrocyte P11277; B2RX08 246; 268 kDa 15 26S proteasome non-ATPase

regulatory subunit 11 O00231 47 15

26S proteasome non-ATPase regulatory subunit 6

Q15008 46 15

26S protease regulatory subunit 10B P62334 44 11


Table S3, related to Figure 3. Proteomic Analysis of Mouse Erythrocytic Spectrin Isolated at

4oC or at 37oC (Bands A-E), and of Non-erythrocytic Spectrin Isolated from Human 293F

Cells (Bands F-H). Proteins included if one of the samples had greater or equal to 10 peptides for

at least one of the samples.

Protein Accession

number Mol wt (kDa)

Unique Peptides

(4oC)

Unique Peptides (37oC)

Band A Spectrin alpha chain, erythrocyte P08032 280 81 78 Spectrin beta 1 B2RX08 268 55 66 E3 ubiquitin-protein ligase UBR4 Q5T4S7 574 18 17 Band B Spectrin alpha chain, erythrocyte P08032 280 221 214 Spectrin beta 1 B2RX08 268 177 191 Ankyrin-1 Q02357 204 4 17 Band C Spectrin alpha chain, erythrocyte P08032 280 97 85 Spectrin beta 1 B2RX08 268 85 84 Beta-adducin Q9QYB8 81 28 23 Transitional endoplasmic reticulum

ATPase Q01853 89 27 25

Erythrocyte protein band 4.1 A2A839 72 17 19 Endoplasmin P08113 92 15 16 Ankyrin-1 Q02357 204 15 18 Alpha-adducin Q9QYC0 81 11 8 Band 3 anion transport protein P04919 103 10 7 Band D Spectrin beta 1 B2RX08 268 46 40 Spectrin alpha chain, erythrocyte P08032 280 41 36 Erythrocyte protein band 4.1 A2A839 72 38 37 78 kDa glucose-regulated protein P20029 72 22 26 Heat shock cognate 71 kDa protein P63017 71 21 20 Alpha-adducin Q9QYC0 81 18 15 Ankyrin-1 Q02357 204 16 10 Beta-adducin Q9QYB8 81 12 9 Acylamino-acid-releasing enzyme Q8R146 82 12 10 Putative uncharacterized protein

(Fragment) Q3TH46 77 12 12

Erythrocyte membrane protein band 4.2

P49222 77 4 11

Band E Actin, cytoplasmic 1 P60710 42 23 21 Spectrin beta 1 B2RX08 268 11 10 Spectrin alpha chain, erythrocyte P08032 280 10 13 Tropomodulin-1 P28289 41 9 10 Erythrocyte protein band 4.1 A2A839 72 8 18 Fructose-bisphosphate aldolase A P05064 39 3 10 Band F Spectrin alpha chain, brain Q13813 285 263 Spectrin beta chain, brain 1 Q01082 275 217


Filamin-A P21333 281 96 Spectrin beta chain, brain 2 O15020 271 47 Filamin-B O75369 278 36 Lamin-B1 P20700 66 11 Hemoglobin subunit beta P68871 16 10 Band G Lamin-B1 P20700 66 79 Lamin-B2 Q03252 68 65 Prelamin-A/C P02545-2 65 45 Heat shock 70 kDa protein 1A/1B P08107 70 38 Dihydrolipoyllysine-residue

acetyltransferase component of pyruvate dehydrogenase complex, mitochondrial

P10515 69 24

X-ray repair cross-complementing protein 6

P12956 70 17

Spectrin beta chain, brain 1 Q01082 275 10 Insulin-like growth factor 2 mRNA-

binding protein 1 Q9NZI8 63 10

Plastin-3 P13797 71 10 Band H Actin, cytoplasmic 1 P60709 42 28 Heterogeneous nuclear

ribonucleoproteins C1/C2 P07910 34 15

Interleukin enhancer-binding factor 2 Q12905 43 14 Tubulin beta chain P07437 50 11 Lamin-B1 P20700 66 10 Sterol-4-alpha-carboxylate 3-

dehydrogenase, decarboxylating Q15738 42 10


Table S4, related to Figure 6. Crystallographic Statistics for the CLEC9A CTLD Structure.

Values in brackets represent highest resolution shell.

Data Collection

Space group P 21 Cell Dimensions a, b, c (Å) 42.2, 53.8, 57.4

β = 109.4° Wavelength (Å) 1.1271 Resolution (Å) 20.00 - 1.64

(1.74 - 1.64) Rmerge 0.11 (0.76) I/σI 8.3 (2.1)

Completeness (%) 97.2 (93.5) Redundancy 3.8 (3.6)

Refinement

Resolution (Å) 20.0 - 1.64 (1.67 - 1.64)

No. reflections R work 56633 (2446) No. reflections Rfree 2843 (129)

R work 0.19 (0.32) R free 0.22 (0.33)

No. atoms Protein

Water/ions

1975 334

R.m.s. deviations Bond lengths (Å) Bond angles (°)

0.006 1.012


SUPPLEMENTAL EXPERIMENTAL PROCEDURES

Recombinant Expression of Soluble Clec9A

Three versions of soluble Clec9A were generated, a full Clec9A ectodomain (Clec9A-ecto; stalk

and CTLD), a Clec9A CTLD only (Clec9A-CTLD) and a Clec9A stalk only (Clec9A-stalk). cDNA

containing the required ectodomain region was amplified from the original Clec9A cDNA using

Advantage high fidelity 2 polymerase (Clontech, MountainView, CA) or HotStar HiFidelity

polymerase (Qiagen, Victoria, Australia) and the listed primers.

Construct Primers used for amplification of Clec9A ectodomain regions Clec9A region

mClec9A-ecto Forward: 5’-TAGTAGACGCGTGAGCAGCAGGAAAGACTCATC-3’ Reverse: 5’-TAGTAGACGCGTTCAGATGCAGGATCCAAATGC-3’

67-EQQ...SCI-264

mClec9A-CTLD Forward: 5’- TAGTAGACGCGTGGTAGTGACTGCAGCCCTTGT-3’ Reverse 5’-TAGTAGACGCGTTCAGATGCAGGATCCAAATGC-3’

131-GSD...SCI-264

mClec9A-stalk Forward: 5'-TAGTAGACGCGTGAGCAGCAGGAAAGACTCATC-3' Reverse: 5'-TAGTAGACGCGTACTACCTGTTTCCTTGCTGTCCAG-3'

67-EQQ...TGS-132

hCLEC9A-ecto Forward: 5’-TAGTAGACGCGTCAGCAGCAAGAAAAACTCATC-3’ Reverse: 5’-TAGTAGACGCGTTCAGACAGAGGATCTCAACGC-3’

67-QQQ...SSV-241

hCLEC9A-CTLD Forward:5’- TAGTAGACGCGTAACAGCAGTCCTTGTCCAAACAAT-3’ Reverse: 5’-TAGTAGACGCGTTCAGACAGAGGATCTCAACGC-3’

109-NSS...SSV-241

hCLEC9A-stalk Forward: 5'-TAGTAGACGCGTCAGCAGCAAGAAAAACTCATC-3' Reverse: 5'-TAGTAGACGCGTGCTGTTATGGGCTGAACTTAATGA-3'

67-QQQ...HNS-110

hCLEC9A-CTLD (S225D)

Synthesised gene 110-SSP...SSV-241

hCLEC9A-ecto (W131A; W227A)

Synthesised gene 67-QQQ...SSV-241

hCLEC9A-ecto (K166A)








hCLEC9A-CTLD (S225D; W131A; W227A)

Synthesised gene 110-SSP...SSC-241

The amplified cDNA was subcloned into a pEF-Bos vector modified to contain the biotinylation

consensus sequence (a peptide consensus sequence NSGLHHILDAQKMVWNHR recognised

specifically by E coli biotin holoenzyme synthetase BirA) and the FLAG epitope. The resulting

fusion constructs thus included (in order of N-terminus): the IL-3 signal sequence (to ensure

secretion), the biotinylation consensus peptide sequence, a FLAG-tag, and Clec9A cDNA fragment.

As controls, expression constructs encoding the ectodomains of mouse Clec12A and Cire were


similarly generated. Recombinant proteins were expressed in mammalian 293T or FreeStyle 293F

cells by transient transfection, followed by culture in protein-free/ serum-free media: X-Vivo-10

(BioWhittaker, Walkersville, MD) or FreeStyle Expression Media (Invitrogen, Victoria, Australia)

respectively. Media containing the secreted recombinant protein was assayed for the presence of

soluble mClec9A by reactivity with anti-mClec9A mAb (24/04-10B4), concentrated 100-fold using

a 10,000 molecular weight cutoff centrifugal device (Millipore, Billerica, MA) and either used

directly or enzymatically biotinylated using BirA enzyme (Avidity, Aurora, CO). Where required,

Clec9A soluble proteins were purified by affinity chromomatography using an anti-FLAG M2

agarose resin (Sigma, Castle Hill, Australia) and elution with 100 µg/ml FLAG peptide (Auspep,

Victoria, Australia), and further purified by size-exclusion chromatography using a pre-packed

Superdex 200 column (GE Healthcare, Rydalmere, Australia).

Recombinant expression of mutated hCLEC9A

Expression constructs encoding hCLEC9A-ecto or hCLEC9A-CTLD with specific mutations, and

fused to either the FLAG epitope or the FLAG epitope and a biotinylation consensus sequence,

were synthesised (GeneArt, Germany) and sublconed into pcDNA3.1+ (Invitrogen). The resulting

fusion constructs for hCLEC9A-CTLD (S225D) thus included (in order of N-terminus): the IL-3

signal sequence (to ensure secretion), a FLAG-tag, and hCLEC9A-CTLD (S225D). The resulting

fusion constructs for hCLEC9A-ecto (W131A; W227A) included the IL-3 signal sequence, the

biotinylation consensus peptide sequence, a FLAG-tag, and hCLEC9A-ecto (W131A; W227A).

Recombinant proteins were expressed in FreeStyle 293F cells and hCLEC9A soluble proteins

purified from the secreted media by affinity chromomatography using an anti-FLAG M2 agarose

resin, and further purified by size-exclusion chromatography using a pre-packed Superdex 200

column.


Circular Dichroism was performed to compare the structural profiles of the glycosylation-null

hCLEC9A-CTLD (S225D) and the tryptophan mutated hCLEC9A-CTLD (S225D; W131A;

W227A). The Far-UV CD spectra, averaged over five accumulation scans from 260 to 190 nm,

of the wild-type and mutated proteins were recorded at 20oC in 10 mM phosphate buffer, pH 7.0,

containing 100 mM NaCl in a 0.1 cm path length quartz cuvette on a Jasco J815 CD

spectropolarimeter equipped with a thermostated cell holder and interfaced with a Peltier unit.

Mutation of hCLEC9A-CTLD (W131A; W227A) did not result in any significant changes in the

secondary structure of the protein. Analysis of the spectra for contributions of particular secondary

structural elements, performed using an online CD analyzing program

(http://dichroweb.cryst.bbk.ac.uk, (Whitmore and Wallace, 2008;Whitmore and Wallace, 2004)),

also resulted in similar secondary structures with 7% alpha-Helix, 25% beta-Sheet, 19% Turns, and

48% unordered estimated for both proteins.

Isolation of Cellular Spectrin

Isolation of erythrocytic spectrin from mouse erythrocytes was performed (Ungewickell and

Gratzer, 1978; Gratzer, 1982). In brief, erythrocytes were lysed for 30 min at 4oC in a hypotonic

lysis buffer (5 mM sodium phosphate, pH7.6, 1 mM PMSF, 1 x EDTA-free protease cocktail

(Roche, Victoria, Australia)) and erythrocyte membranes washed repeatedly using the lysis buffer.

Spectrin was extracted by resuspension of erythrocyte ghosts in a spectrin extraction buffer (0.3

mM sodium phosphate, 0.1 mM EDTA, 0.1 mM PMSF) and overnight dialysis at 4oC against

spectrin extraction buffer. Membrane fragments were removed by ultracentrifugation (90000g, 30

min, 4oC) and the supernatant containing spectrin harvested for further analysis. Isolation of non-

erythroid spectrin from frozen pellets of human 293F cells (1 x 108 cells) or from irradiated

thymocytes was performed as for erythrocytic spectrin, with the addition of 50U/ml benzonase

(Novagen) in the lysis buffer. Spectrin samples were further purified by size exclusion

http://dichroweb.cryst.bbk.ac.uk/�


chromatography using a Superose 6 column (300 x 10 mm) at a flow rate of 0.4 mL/min in PBS

containing 10% glycerol, 1 mM EDTA, 1 mM DTT and 0.1 mM PMSF. Column fractions of 0.4

mL were collected for analysis.

Reassociation of cellular spectrins with actin was performed by collecting fractions of dissociated

spectrin following SEC, and concentrating them in the presence of 10 µg/ml of either bovine

muscle actin or a control protein BSA, in PBS containing 10% glycerol, 0.1 mM PMSF, 1 mM

EDTA, 1 mM DTT. The spectrin-actin and spectrin- BSA samples were then incubated at 30oC for

2.5 hr, then further purified by SEC using a Superose 6 column (300 x 10 mm) at a flow rate of 0.4

ml/min as above, and 0.4 ml fractions collected for analysis.

Generation of Recombinant Domains of Spectrin and Other Cytoskeletal Proteins

Recombinant GST-tagged cofilin-1 and fragments of erythrocytic spectrin (spectrin βI) were

expressed as previously described (Pei et al., 2005; Wong et al., 2011). The The Actin Binding

Domains (ABD) of human Spectrin beta II (spectrin beta chain, brain 1 isoform 1; beta-fodrin,

NM_003128.2) and of human alpha-actinin I (alpha-actinin-1 isoform a; alpha-actinin cytoskeletal

isoform, NM_001130004.1) were expressed as glutathione S-transferase (GST) fusion proteins

using E. coli BL21 (DE3). In brief, cDNA containing the ABD regions were amplified from 293F

cell cDNA using HotStar HiFidelity polymerase (Qiagen) using the primers listed below, and

subcloned into a modified pGex2T vector (GE Healthcare).


Construct Primers used for amplification of actin binding domains of spectrin family

memnbers Protein region

Spectrin-beta II-ABD Forward: 5’- TAGTAGGGCGCGCCATATGACGACCACAGTAGCCACAGACTATGAC -3’ Reverse: 5’- TAGTAGGGCGCGCCTACAGAAGGTCAGAGGCAAGTGATTCATA -3’

1-ATG...DLL-315

Alpha-actinin I-ABD Forward: 5’- TAGTAGGGCGCGCCATATGGACCATTATGATTCTCAGCAAACC -3’ Reverse 5’- TAGTAGGGCGCGCCTAATCACTGGCCAGCTTCTCGTAGTC -3’

1-ATG...ASD-285

Protein expression was induced using 0.1 mM isopropyl-β-thiogalactopyranoside (IPTG) for 5 hr at

19oC, and IPTG-induced cells lysed with lysis buffer (phosphate-buffered saline containing 0.2

mg/mL lysozyme, 1% Triton-X 100, 30 µg/mL DNase I, 1 mM PMSF). GST-tagged proteins were

purified by affinity chromatography using Glutathione-Sepharose 4B resin (GE Healthcare) and

elution with 50mM Tris-HCl, pH8.0, 150mM NaCl containing 50mM reduced glutathione (Sigma),

and further purified by size-exclusion chromatography using a Superose 6 column (300 x 10 mm) at

a flow rate of 0.4 ml/min in 50 mM Tris-HCl, pH 8.0 containing 150 mM NaCl.

Reassociation studies were performed by incubating GST-tagged spectrin and actinin proteins in the

presence or absence of bovine muscle actin (Sigma) or platelet actin (>99% purity, Cytoskeleton) in

PBS, for 2 hr on ice at a concentration of 0.2 mg/ml per protein, unless otherwise stated. Proteins

were diluted to 10 µg/ml in PBS for coating onto ELISA plates.

ELISA

ELISA plates (Costar) were coated overnight at 4°C with either commercially available erythrocytic

spectrin (Sigma), bovine muscle actin (Sigma) or platelet actin (>99%pure, Cytoskeleton) at 10

µg/ml, or with cellular spectrins (10 µg/ml) or complexes containing GST-tagged spectrin

fragments, (10 µg spectrin fragment/ml) or with SEC fractions of spectrin (50 µl). Bovine muscle

actin and platelet actin appeared to have comparable purity on SDS-PAGE analysis. Unbound

proteins were then washed away (PBS-0.05%Tween 20). ELISA plates were blocked (1% BSA in

PBS), then incubated with FLAG-tagged Clec9A ectodomain fragments or controls (mClec12A-


ecto , mCire /DC-Sign-ecto). Binding was detected by incubation with an anti-FLAG antibody M2-

conjugated to HRP (Sigma-Aldrich), and visualized by the addition of the HRP substrate ABTS,

followed by measurement of absorbance at 405-490 nm (Vmax Kinetic Microplate Reader,

Molecular Devices).

Thermofluor assays

Thermofluor assays were performed to determine protein stability (Phillips and de la Pena, 2011).

hCLEC9A-CTLD (S225D) was incubated in Tris buffered saline in the presence or absence of 6

mM EDTA, 1.24 mM MgSO4 or 2.47 mM CaCl2 for 1hr at 4°C. Thermofluor assays were

performed using 18.4 µM hCLEC9A-CTLD and Sypro Orange (1:1250 dilution, Invitrogen) in a

total volume of 25µL. Thermal denaturation curves were measured on a C1000 thermocycler

equipped with a CFX384 Real-Time System fluorescence reader (BIORAD). A temperature

gradient of 1°C/min from 25°C to 95°C was applied to the samples, and fluorescence measured

every degree step using the FRET channel. The melting temperature (Tm) of each sample was

calculated by determining the inflexion point of each thermal denaturation curves (BIORAD). Tm

differences were calculated by subtracting the Tm of the incubated CLEC9A from the Tm of

CLEC9A in the Tris buffered saline condition.

Cellular binding assays using soluble Clec9A

Binding assays were performed in binding buffer (PBS containing 0.2%BSA and 0.02% sodium

azide), on ice. Cells were washed 3 times with PBS to remove serum proteins, then resuspended in

binding buffer. Cells were incubated with either (1) biotinylated soluble Clec9A and controls, and

detected with Streptavidin (SA)-PE, or (2) soluble FLAG-tagged Clec9A and detected either with

FITC conjugated rat anti-FLAG mAb 9H1, or with biotinylated rat anti-FLAG mAb 9H1 and SA-

PE. Live cells were gated on forward and side scatter, or by PI exclusion, whereas dead cells were


gated on forward and side scatter, or by PI inclusion. Analysis of soluble Clec9A binding was

performed by flow cytometry using a FACScan (Becton Dickinson). The specificity of the binding

was demonstrated by comparison to binding to other soluble FLAG-tagged C-type lectins, mouse

Cire/ mDCSign (Caminschi et al., 2001) and Clec12A (Pyz et al., 2008).

Mouse platelets

Venous blood was obtained from C57BL/6 mice by cardiac puncture into 0.1 volume of Aster Jandl

citrate-based anticoagulant (Aster and Jandl, 1964) (85 mM sodium citrate, 69 mM citric acid, 20

mg/ml glucose, pH 4.6). Platelet rich plasma was obtained by centrifugation of the murine blood at

125g for 8 min, followed by centrifugation of the supernatant buffy coat at 125g for 8 min. Platelets

were washed by two sequential centrifugations at 860g for 5 min in 140 mM NaCl, 5 mM KCl, 12

mM trisodium citrate, 10 mM glucose, 12.5 mM sucrose, pH 6.0 the platelet pellet resuspended in

10 mM HEPES, 140 Mm NaCl, 3 mM KCl, 0.5 mM MgCl2, 10 mM glucose and 0.5 mM NaHCO3,

pH 7.4. Washed platelets were treated with 0.5 µM ABT-737 for 90 min at 37 °C. Control or ABT-

737 treated platelets were incubated with 5 µg/ml of Flag-tagged recombinant proteins mClec9A or

hClec9A for 30 min at room temperature. Anti-Flag-FITC secondary antibodies were added to the

platelets and incubated for 30 min at room temperature. Samples were diluted out in PBS

containing 0.2% BSA and analyzed on a FACSCalibur flow cytometer. ABT-737 treated platelets

were confirmed to be AnnexinV-APC positive, and resting control platelets AnnexinV-APC

negative.

Confocal microscopy

A mouse fibroblast cell line (NIH 3T3) or primary embryonic fibroblasts were cultured on glass

coverslips, fixed, permeabilised using PBS containing 0.3% Triton X-100 and incubated either with

biotinylated mClec9A-ecto, or biotinylated Cire-ecto as a background control and binding detected


using SA-Alexa594 or SA-Alexa488. Cells were counterstained either with DAPI alone, or with

rabbit anti-actin Ab (Sigma A5060) and an anti-rabbit Ig-Alexa488 Ab, or with phalloidin-

Alexa594 (Invitrogen) and analysed by confocal microscopy using a Leica SP2 (Wilson et al.,

2003).

Mass Spectrometry analysis

Protein bands were excised from SimplyBlue (Invitrogen) stained gels and subjected to manual in-

gel digestion. The gel bands were reduced with 10 mM DTT (Calbiochem, Merck, VIC, Australia)

for 30 min, alkykated for 30 min with 50 mM iodoacetic acid (Fluka, Sigma-Aldrich, NSW,

Australia) and digested with 375ng trypsin (Worthington, Lakewood, NJ) for 16hr at 37oC. The

extracted peptide solutions (0.1% formic acid) were then concentrated to approximately 10µl by

centrifugal lyophilisation using a SpeedVac AES 1010 (Savant). Digests were then subjected to

MS/MS analysis on the LTQ-Orbitrap (Thermo Fischer Scientific) mass spectrometer.

Extracted peptides were injected and fractionated by nanoflow reversed-phase liquid

chromatography on a nano LC system (1200 series, Agilent, USA) using a nano flow reversed-

phase-HPLC (Model 1200, Agilent). Fractionation was performed using a nano-Acquity (C18) 150

mm x 0.15 mm I.D. RP-UPLC column (Waters) developed with a linear 60 min gradient from 0-

100% Buffer B (0.1% (v/v) aqueous formic acid / 60% (v/v) acetonitrile) with a flow rate of 0.8

µl/min at 45°C, where Buffer A was 0.1% (v/v) aqueous formic acid. The capillary HPLC was

coupled on-line to the LTQ-Orbitrap mass spectrometer equipped with a nano-electrospray ion

source (Thermo Fisher Scientific). Positive ion mode was used for data-dependent acquisition.

Survey MS scans were acquired with the resolution set to 30,000. Each scan was recalibrated in

real time by co-injecting an internal standard from ambient air into the C-trap (Olsen et al., 2005).


The five most intense ions per cycle were fragmented and analysed in the linear trap. Target ions

already selected for MS/MS were dynamically excluded for 180s.

Acquired MS/MS spectra for each instrument RAW file were extracted to DTA files (peak lists)

using extract-msn as part of BioWorks 3.3.1 (Thermo Fisher Scientific). The parameters used to

create the peak lists were as follows: minimum mass 700; maximum mass 7000; no merging of

scans; 10 peaks minimum and Total Ion Current (TIC) of 100. The PeakListExtractor program

(JPSF in-house software) was used for generating Mascot generic files (MGF format) from the

DTA files. Peak lists were searched against the LudwigNR protein sequence database (10753

sequence entries) (version Q409m1 – http://www.ludwig.edu.au/archive/ludwigNR/ludwigNR.pdf)

using the Mascot search algorithm (v2.2.04, Matrix Science, U.K.)(perkins DN, 1999, vol 20, 3551-

3567). The search parameters were as follows: carboxymethylation of cysteine as a fixed

modification (+58 Da) as well as variable modifications consisting of NH2-terminal acetylation

(+42 Da) and oxidation of methionine (+16 Da), and the allowance for up to three missed tryptic

cleavage sites (trypsin/P). Precursor and fragment ion mass tolerance values were +-20ppm and

0.8Da respectively.

SUPPLEMENTAL REFERENCES Aster, R.H., and Jandl, J.H. (1964). Platelet Sequestration in Man. I. Methods. J Clin Invest 43,

843-855.

Naik, S.H., Proietto, A.I., Wilson, N.S., Dakic, A., Schnorrer, P., Fuchsberger, M., Lahoud, M.H.,

O'Keeffe, M., Shao, Q.X., Chen, W.F., et al. (2005). Cutting edge: generation of splenic CD8+ and

CD8- dendritic cell equivalents in Fms-like tyrosine kinase 3 ligand bone marrow cultures. J

Immunol 174, 6592-6597.

http://www.ludwig.edu.au/archive/ludwigNR/ludwigNR.pdf�


Olsen, J.V., de Godoy, L.M., Li, G., Macek, B., Mortensen, P., Pesch, R., Makarov, A., Lange, O.,

Horning, S., and Mann, M. (2005). Parts per million mass accuracy on an Orbitrap mass

spectrometer via lock mass injection into a C-trap. Mol Cell Proteomics 4, 2010-2021.

Phillips, K., and de la Pena, A.H. (2011). The combined use of the Thermofluor assay and

ThermoQ analytical software for the determination of protein stability and buffer optimization as an

aid in protein crystallization. Curr Protoc Mol Biol Chapter 10, Unit10 28.

Whitmore, L., and Wallace, B.A. (2004). DICHROWEB, an online server for protein secondary

structure analyses from circular dichroism spectroscopic data. Nucleic Acids Res 32, W668-673.

Whitmore, L., and Wallace, B.A. (2008). Protein secondary structure analyses from circular

dichroism spectroscopy: methods and reference databases. Biopolymers 89, 392-400.

Wilson, N.S., El-Sukkari, D., Belz, G.T., Smith, C.M., Steptoe, R.J., Heath, W.R., Shortman, K.,

and Villadangos, J.A. (2003). Most lymphoid organ dendritic cell types are phenotypically and

functionally immature. Blood 102, 2187-2194.

Supplemental Information The Dendritic Cell Receptor ...€¦ · (E) Mouse embryonic fibroblasts...

Documents

Transcript of Supplemental Information The Dendritic Cell Receptor ...€¦ · (E) Mouse embryonic fibroblasts...