1

Cell Stem Cell, Volume 8

Supplemental Information

Defects in Trophoblast Cell Lineage Account for

the Impaired In Vivo Development of Cloned Embryos

Generated by Somatic Nuclear Transfer

Jiangwei Lin, Linyu Shi, Man Zhang, Hui Yang, Yiren Qin, Jun Zhang, Daoqing Gong, Xuan

Zhang, Dangsheng Li, and Jinsong Li

Inventory of Supplemental Information

1. Supplemental Figures and Legends

Figure S1, related to Figure 1 and Table 1

Figure S2, related to Figure 1 and Table 1

2. Table S1, related to Figure S2

3. Supplemental Experimental Procedures

2

3

Figure S1. Distribution of NT-Derived Cells and Tetraploid Cells at

Blastocyst Stage and Later Stages of NTICM/FD4N (1:2) Embryos,

related to Figure 1 and Table 1.

(A) Wholemount confocal image of NTICM/FD4N blastocyst. From left

to right: green fluorescence (marker of cloned-derived cells), red

fluorescence (immunostaining with antibody against Oct4), blue

fluorescence (nuclear dye Hoechst 33342) and overlay.

(B) Total cell number of ICM (Oct4 positive cells) and cell number of

cloned-derived ICM (Oct4-GFP double-positive cells) (n=10).

(C) Wholemount confocal image of NTICM/FD4N blastocyst. From left

to right: green fluorescence (marker of cloned derivatives), red

fluorescence (immunostaining with antibody against Cdx2), blue

fluorescence (nuclear dye Hoechst 33342) and overlay.

(D) Total cell number of trophectoderm (Cdx2 positive cells) and cell

number of trophoblast cells derived from cloned ICM (Cdx2-GFP

double-positive cells) (n=10).

(E) Fetus and placenta collected on Day 12.5 of gestation. The fetus is

strongly green fluorescent. Arrow indicates non-GFP-expressing

extra-embryonic tissues, which are mostly from tetraploid embryos.

(F) Section through placenta of 12.5 dpc. Green-fluorescent cells highly

contributed to labyrinth and chorionic plate of placenta. Scale bar,

500µm

4

(G) Wholemount immunostaining image of fetus collected on Day 12.5 of

gestation, fluorescence for GFP and Hoechst33342. Arrows indicate

tetraploid derivatives (GFP-negative cells). Box is magnified in H.

Scale bar, 500µm.

(H) GFP-negative cells. Scale bar, 50µm.

(I) Mouse and placenta collected on Day 19.5 of gestation. The mouse is

strongly green fluorescent. Arrow indicates the placenta, in which,

only a small region displayed green fluorescent (arrowhead).

(J) Section through placenta of 19.5 dpc. Green-fluorescent cells were

observed in labyrinthine layer and chorionic plate of placenta. Scale

bar, 500µm.

(K) The presence of non-GFP-expressing cells in the gut of one clonal

mouse. Box is magnified in L. Scale bar, 100µm.

(L) GFP-negative cells. Scale bar, 10µm.

5

6

Figure S2. Characterizations of the Cloned or Clonal mice, related to

Figure 1 and Table 1.

(A) Adult clonal mice derived from aggregated embryos between one

cloned ICM (wild-type B6D2F1 background) and two tetraploid

embryos (ICR background) exhibit black coat. Arrow indicates a

small batch of white hairs displayed in one of 29 survived clonal mice

from NTICM/FD4N (1:2), reflecting the contamination of tetraploid

cells (ICR) in clonal mice at very low frequency.

(B) Clonal mice derived from aggregated embryos between one cloned

ICM (GFP-transgenic B6D2F1 background) and two tetraploid

embryos (wild-type B6D2F2 background) show strongly green

fluorescent. Arrow indicates non-GFP-expressing placenta, which are

mostly derived from tetraploid embryos.

(C) SSLP analyses were performed using genomic DNA isolated from

cloned mice (from one-step NT) and clonal mice (from

NTICM/FD4N). Genomic DNA from B6D2F1, ICR, C57BL/6 and

DBA mice served as control. C-1 and C-2 denote the cloned mice

from one-step NT. T-1 and T-2 denote the clonal mice from

NTICM/FD4N.

(D) A cloned mouse placenta stained by hematoxylin-and-eosin (HE)

reveals expansion of spongiotrophoblast layer. Yellow broken lines

are the boundary between the spongiotrophoblast layer and labyrinth

7

layer.

(E) A placenta derived from NTICM/FD4N aggregated embryo stained

by HE shows a normal-looking histology.

(F) A FD control placenta stained by HE.

(G) Compared with FD placentae, transcription levels of three imprinted

genes (Igf2r, Peg1 and Grb10/Meg1) and four nonimprinted genes

(Vegfr2, Igfbp2, Esx1 and Cpe) are significantly reduced in cloned

placentae (n=8), but greatly increased in placentae (n=8) from

NTICM/FD4N. Bottom left, two imprinted genes (Igf2 and Dlk1) are

normally expressed in placentae derived from different groups.

Bottom right, transcription levels for two imprinted genes (Meg3/Gtl2

and Dcn) are significantly lower in cloned placentae compared with

FD controls, and not significantly improved in placentae from

NTICM/FD4N.

(H) Transcription levels for imprinted genes (H19, Grb10/Meg1, Peg1,

Igf2, Igf2r, Meg3/Gtl2, Dlk1 and Dcn) and kidney-specific gene

(Cdh16) in cloned (n=4) and clonal (n=4, from NTICM/FD4N)

kidney. Three imprinted genes (Igf2, Igf2r, and Dcn) are normally and

four genes (including three imprinted genes: H19, Grb10/Meg1 and

D1K1and the kidney-specific gene: Cdh16) are aberrantly expressed

in both cloned and clonal kidney. The transcript levels for the other

two imprinted genes (Peg1 and Meg3/Gtl2) are significantly

8

increased in clonal kidney.

(I) Transcription levels for imprinted genes (H19, Grb10/Meg1, Peg1,

Igf2, Igf2r, Meg3/Gtl2, Dlk1 and Dcn) and heart-specific gene (Myh6)

in cloned (n=4) and clonal (n=4, from NTICM/FD4N) heart. Three

imprinted genes (Igf2, Meg3/Gtl2 and Dcn) are normally and one

imprinted gene (Peg1) is aberrantly expressed in both cloned and

clonal heart. Two imprinted genes (H19 and Grb10) are aberrantly

expressed in clonal heart and three genes (including two imprinted

genes: Igf2r and Dlk1 and heart-specific gene: Myh6) are abnormally

expressed in cloned heart.

(J) Transcription levels for imprinted genes (H19, Grb10/Meg1, Peg1,

Igf2, Igf2r, Meg3/Gtl2, Dlk1 and Dcn) and liver-specific gene (Alb) in

cloned and clonal liver. Six imprinted genes (H19, Grb10/Meg1,

Peg1, Igf2, Igf2r and Meg3/Gtl2) and the liver-specific gene (Alb) are

normally and one imprinted gene (Dlk1) is aberrantly expressed in

both cloned and clonal liver. The other one imprinted gene (Dcn) is

abnormally expressed in clonal liver.

Scale bar, 200 µm (D-F); *: 0.01<p<0.05; **: 0.01<p<0.001; ***:

p<0.001.

9

Table S1. Oligonucleotide Primers Used for Quantitative RT-PCR,

related to Figure S2.

Target genes

Primer sequence (Forward) Primer sequence (Reverse)

Igf2r TAGTTGCAGCTCTTTGCACG ACAGCTCAAACCTGAAGCG Peg1 GGCTCCTCTATGATGGCCG AAGCCTTTCTGAACAGCCAGC Vegfr2 GGCAGGTCTGAGGGTTCTCT

G CAAAGCTAAAATACTGAGGACTTGGG

Igfbp2 CCTCAAGTCAGGCATGAAGGA

GCAGGGAGTAGAGATGTTCCA

Esx1 TTGCTAGAGTGGAGCTTGCC GCCTAAATGGTGGAGGCATTC Cpe TGAGAAAGAAGGCGGTCCT

A TTTGGAAAATTGCGTCATCA

Igf2 CTAAGACTTGGATCCCAGAACC

GTTCTTCTCCTTGGGTTCTTTC

Dlk1 ACTTGCGTGGACCTGGAGAA

CTGTTGGTTGCGGCTACGAT

Meg3/Gtl2 TTGCACATTTCCTGTGGGAC AAGCACCATGAGCCACTAGG Dcn CATACTCAAATAAGGCTTCA

CCAA AAAGTTGTCTGTAGTTGTGAACTGA

β-Actin AAGTGTGACGTTGACATCCG

GATCCACATCTGCTGGAAGG

H19 CATGTCTGGGCCTTTGAA TTGGCTCCAGGATGATGT Grb10/Meg1

TCCAAGTGGAGAGTACCATGC

TACGGATCTGCTCATCTTCG

Cdh16 CTCCAGCCTCTCAACGATTCC

GGTGCGTGAACACAAGAATGA

Myh6 GCCCAGTACCTCCGAAAGTC GCCTTAACATACTCCTCCTTGTC

Alb AAGACCCCAGTGAGTGAGCATG

GCTTGTGCTTCACCAGCTCAGC

Gapdh CACTCTTCCACCTTCGATGC CTCTTGCTCAGTGTCCTTGC

10

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

Nuclear Transfer

Nuclear transfer was performed as described (Wakayama et al., 1998)

with modifications (Li et al., 2004; Kishigami et al., 2006). Briefly,

metaphase II-arrested oocytes were collected from superovulated B6D2F1

females (8-10 wks) and cumulus cells were removed using hyaluronidase.

The oocytes were enucleated in a droplet of HEPES-CZB medium

containing 5 µg/ml cytochalasin B (CB) using a blunt Piezo-driven pipette.

After enucleation, the spindle-free oocytes were washed extensively and

maintained in CZB medium up to 2 h before nucleus injection. The CCs

from wild-type or GFP transgenic mice (B6D2F1) were aspirated in and

out of the injection pipette to remove the cytoplasmic material and then

injected into enucleated oocytes. The reconstructed oocytes were cultured

in CZB medium for 1 h and then activated for 5-6 h in activation medium

containing 10 mM Sr2+, 5 ng/ml trichostatin A (TSA) and 5 µg/ml CB.

Following activation, all of the reconstructed embryos were cultured in

KSOM medium supplemented with 5 ng/ml TSA for another 3-4 hours

and maintained in KSOM medium with amino acids at 37 ºC under 5%

CO2 in air.

11

Derivation of Tetraploid Embryos

For providing fertilization-derived (FD) tetraploid embryos, ICR or

B6D2F1 females were superovulated and mated with ICR or B6D2F1

males, respectively. Two-cell stage embryos were obtained 44 h after

HCG injection. To generate tetraploid embryos, we electrofused two-cell

embryos to produce one-cell tetraploid embryos. Two-cell embryos were

aligned using an alternating current in 0.3 M mannitol solution, and a

single direct current pulse of 1 000 V/cm was applied for 20 µs. After

electrofusion, the embryos were returned to KSOM medium with amino

acids, and the fused embryos were cultured for one day to reach the

four-cell stage.

Isolating the ICM of Cloned or FD Blastocysts

ICM was isolated by immunosurgery as described (Solter and Knowles,

1975). The zona pellucida of cloned or FD blastocysts was removed using

acid Tyrode solution. Blastocysts were incubated with rabbit anti-mouse

serum (Sigma, diluted 1:1 with KSOM) for 30 minutes. After washed

thoroughly, all blastocysts were exposed to guinea pig serum (diluted 1:1

with KSOM) for 30 minutes. The outer TE cells were lysed within a few

minutes. The dead TE cells could be removed by gently pipetting the

ICMs in a pipette, with a diameter of 40-60 µm.

12

Aggregating ICM or Embryo with Tetraploid Embryos

The aggregation plate was prepared as described (Nagy, et al., 2003)

using an aggregation needle. To generate aggregated embryos, the zona

pellucida was removed using acid Tyrode solution. One to three four-cell

stage tetraploid embryos were placed into each of the depressions in the

aggregation plate. One cloned eight-cell stage embryo, one cloned ICM

or one fertilized ICM was placed into one depression. To improve the

aggregation efficiency, embryos in each depression should be physically

attached. The aggregates were cultured in a humidified incubator with 5%

CO2 at 37 ºC for 24-36 hours to reach the blastocyst stage. Successfully

aggregated embryos were transferred into the uterine horns of

2.5-day-postcoitum (dpc) pseudopregnant ICR females mated with

vasectomized males. On Day 19.5 of gestation, the recipient females were

subjected to cesarean section, and live pups were nursed by lactating ICR

females.

Immunostaining

The blastocysts were fixed in PBS supplemented with 4%

paraformaldehyde for 15 min at room temperature (RT). The blastocysts

were then permeabilized using 0.1% Triton X-100 in PBS for 15 min at

RT and blocked for 30 min in 3% BSA in PBS. All primary antibodies

against Oct3/4 (sc-5279, Santa Cruz) and Cdx2 (MU392A, Biogenex)

13

were diluted in the same blocking buffer and incubated with the samples

overnight at 4 ºC. The blastocysts were treated with a fluorescently

coupled secondary antibody and then incubated for 1 h at RT. The nuclei

were stained with Hoechst 33342 (Sigma) for 3 min at RT.

The placentae and fetuses were fixed in 4% paraformaldehyde, frozen in

Tissue-Freezing medium, sectioned at a thickness of 10 microns. The

sections were stained with primary rabbit antibody against EGFP (MBL,

1:1000) for one hour at 37 ºC. After rinsing, sections were incubated for

one hour at 37 ºC with a secondary goat anti-rabbit FITC-labled antibody

(Jackson, 1:500). The nuclei were counterstained with Hoechst 33342.

Simple Sequence Length Polymorphism (SSLP)

Genomic DNA was isolated from the fetuses with Phenol: Chloroform:

Isoamyl alcohol (25:24:1) using standard protocol. The simple sequence

length polymorphism (SSLP) analysis were performed for D1Mit46、

D2Mit102 and D6Mit15 using PCR. PCR reaction mixtures were

denatured at 94°C for 5 minutes and cycled at 94°C for 30 seconds, 55℃

~60°C for 30 seconds, and 72°C for 30 seconds followed by final

extension at 72°C for 10 minutes after completion of 40~45 cycles. The

PCR primers sequences for SSLP were obtained from the Mouse Genome

Informatics website (The Jackson Laboratory,

http://www.informatics.jax.org).

14

Quantitative RT-PCR

Total RNAs were extracted from placentae and organs using Trizol

Reagent (Invitrogen), following homogenization by power homogenizer.

cDNA was synthesized from 1μg of total RNA using ReverTra Ace First

Strand cDNA Synthesis kit (Toyobo) with oligo dT as a primer. Gene

expression levels were measured by BioRad CFX96 system using SYBR

Green Realtime PCR Mast Mix (Toyobo). PCR reaction mixtures were

denatured at 94°C for 5 minutes and cycled at 94°C 10 seconds, 60°C for

20 seconds, and 72°C for 20 seconds followed by final extension (Melt

Curve detection) at 72°C to 94°C for 10 minutes after completion of 40

cycles. And all the gene expression levels are normalized by β-Actin and

Gapdh in placentae and fetuses, respectively. Primers used for

quantitations are chosen from PrimeBank (pga.mgh.harvard.edu) and

listed in Supplemental Table 1 (Inoue et al., 2002; Ogawa et al., 2006;

Singh et al., 2006; Naidu et al., 2010).

Statistical Analysis

We compared the efficiency of birth rates between groups using

Chi-square test. Differences of gene expression levels between groups

were analyzed by means of Student t-test. All statistical analyses were

done applying SPSS software 13.0.

15

Supplemental References

Inoue, K., Kohda, T., Lee, J., Ogonuki, N., Mochida, K., Noguchi, Y.,

Tanemura, K., Kaneko-Ishino, T., Ishino, F., and Ogura, A. (2002).

Science 295, 297.

Kishigami, S., Mizutani, E., Ohta, H., Hikichi, T., Van Thuan, N.,

Wakayama, S., Bui, H.T., and Wakayama, T. (2006). Biochem. Bioph.

Res. Co. 340, 183-189.

Li, J., Ishii, T., Feinstein, P., Mombaerts, P. (2004). Nature 428, 393-399.

Nagy, A., Gertsenstein, M., Vintersten, K., and Behringer, R. (2003).

New York, Cold Spring Harbor Laboratory Press, pp. 483-484.

Naidu, S., Peterson, M.L., Spear, B.T. (2010). Gene 499, 95-102.

Ogawa, H., Wu, Q., Komiyama, J., Obata, Y, and Kono, T. (2006). FEBS

Lett. 580, 5377-5384.

Singh, U., Kalinina, E., Konno, T., Sun, T., Ohta, H., Wakayama, T.,

Soares, M.J., Hemberger, M., and Fundele, R.H. (2006). Differentiation

74, 648-660.

Solter, D., and Knowles, B.B. (1975). Proc. Natl. Acad. Sci. USA 72,

5099-5102.

16

Wakayama, T., Perry, A.C.F., Zuccotti, M., Johnson, K.R., Yanagimachi,

R. (1998). Nature 394, 369-374.