Developmental Cell 12

Supplemental Data

A Critical Function for the Actin Cytoskeleton

in Targeted Exocytosis of Prefusion Vesicles

during Myoblast Fusion Sangjoon Kim, Khurts Shilagardi, Shiliang Zhang, Sabrina N. Hong, Kristin L. Sens, Jinyan Bo, Guillermo A. Gonzalez, and Elizabeth H. Chen

Supplemental Experimental Procedures

Immunohistochemistry

The following antibodies were used: rabbit anti-MHC (1:1000) (Kiehart and Feghali,

1986); rabbit anti-Dmef2 (1:800) (Nguyen et al., 1994); rabbit anti-Lmd (1:800) (Duan et

al., 2001); guinea pig anti-Kr (1:3000) (Kosman et al., 1998); rabbit anti-Sns (1:1000)

(Galletta et al., 2004); rat anti-Titin (1:5000) (Machado and Andrew, 2000); rabbit anti-

Eve (1:1000) (Azpiazu and Frasch, 1993); rabbit anti-Ants (1:2000) (Chen and Olson,

2001); rabbit anti-GFP (1:500) (Invitrogen); rabbit anti-β-gal (1:1500) (Cappel); and

mouse anti-β-gal (1:1000) (Promega). A rat anti-Sltr antibody was generated against a C-

terminal peptide GCRLVNDLETKFGKRFHNVT (Bio-Synthesis) and used at 1:250.

This antibody detects no signal in sltr mutant embryos (data not shown). Secondary

antibodies used at 1:300 were: Cy2-, Cy3-, and Cy5-conjugated (Jackson) and

biotinylated antibodies (Vector Laboratories) made in goat. Vectastain ABC kit (Vector

Laboratories) and the TSA system (Perkin Elmer) were used to amplify fluorescent

signals.

Molecular Biology

Constructs were prepared as follows:

For S2 cell transfection: Full-length sltr cDNAs was amplified by PCR with 5’ primers

containing a Flag tag and subcloned into the pAc-V5 His expression vector (Invitrogen).

The full-length cDNAs for Wasp and Crk cDNA were subcloned in-frame into pAc-V5.

For GST pull-downs: Full-length cDNAs for Crk or fragments of sltr were PCR

amplified and subcloned in-frame into the pGEX-2T vector (Pharmacia). For rescuing

constructs: Full-length sltr cDNA was restriction digested from the EST clone and

subcloned into the transformation vector, pUAST. sltr deletion and point-mutation

constructs were prepared using standard PCR procedures (Stratagene) to introduce

necessary changes on the original EST clone and subcloned into pAc-V5 or pUAST. All

constructs were verified by sequencing analysis.

RT-PCR analyses for C2C12 cells were performed as follows. Total RNA from mouse

subconfluent C2C12 culture was isolated using RNeasy Mini kit (Qiagen). The RT

reaction was performed with 1.2µg of total RNA using SuperScript TM First-Strand

Synthesis system (Invitrogen) according to manufacturer’s instructions. RT reaction was

followed by PCR with 2µl of RT-product as a template and the following gene-specific

primers: mN-WASP: forward 5’-TGACTATGTCTTCAGCAGTGGTGC-3’ and reverse

5’-CAGATTTCCTTTGTCGTCGGC-3’; mWIP: forward 5’-

AACCGAGGTGCTTTTGG-3’ and reverse 5’-TGCTTTCCCACTCATCTTCACAC-3’;

and mWIRE: forward 5’-TCAGTAGAGATGAGCAGCGGAATC-3’, and reverse 5’-

GGTGTTGGAGGCAATGGTTTC’. PCR products of mGAPDH were used as a loading

control.

RT-PCR analyses of sltr isoforms in Drosophila were performed essentially as described

above for C2C12 cells. Fly embryos, larvae and adults were ground in buffer RLT

(Qiagen kit) using Pellet Pestle with RNase free tips (Kontes, Glass Company) and

homogenized by passing through QIAshredder columns (Qiagen). Total RNA from

homogenates was isolated and RT reactions were performed with 3µg of total RNA,

followed by PCR (26 cycles) with 2µl of RT-product as a template and the following

oligonucleotides as specific primers:

ABF-5’ - 5’ATCGCACTGAATCAGAAGTCAGC-3’;

E-5’ - 5’CCCGAAGATTCGTATCCATCG-3’;

CD-5’ - 5’CAACTTGCGAACTGAGCGCAAC-3’;

3-3’ - 5’CTGCTGAGCGGATGAGTTCGTTG-3’;

8-5’ - 5’ATCTGAACAATATCGGCGGATC-3’;

8-3’ - 5’GAGCTGCTGCCAAACTGATGC-3’;

8ins-3’ - 5’CCAGTACTTCACTCGGTCCTG-3’.

In order to distinguish between RB and RA/RF or RC and RD transcripts, RT-PCR

products produced by primer pairs ABF-5’/3-3’ or CD-5’/3-3’ were subjected to

sequencing. To compare the abundance of transcripts with or without E8, ABF-5’, CD’-5

and E-5’ primers were paired with either 8-3’ or 8ins-3’ (specific for E8) for PCR. Signal

intensity of the bands was compared using the NIH Image software. The mean value of

the intensity for each specific band was quantified as a percentage of the total intensity of

all specific bands. Embryo and adult values were calculated independently.

Biochemistry

For G-actin binding assay, monomeric G-actin (Cytoskeleton) was used at a

concentration below the barbed end critical concentration (0.03µM) and pull-down

experiments were performed in the General Actin buffer (5mM Tris pH 8.0, 1mM MgCl2,

0.2mM ATP, 1mM EGTA, 0.2mM DTT).

For F-actin co-sedimentation assay, F-actin was polymerized from G-actin, and incubated

with ~10µM of each recombinant protein in the actin polymerization buffer (50mM KCl,

2mM MgCl2, 5mM Tris pH 8.0, 1mM ATP, 0.2mM DTT) for 1 hour at 4oC, and

centrifuged at 200,000g for 30 minutes. The resulting precipitates and supernatants were

subjected to SDS–PAGE and western blot with specific antibodies.

For immunoprecipitation (IP) experiments or GST-PD assays with cell extracts, target

proteins were expressed in S2R+ cells. Cells were harvested, washed with PBS, and

incubated in NP40-Triton buffer (NTB, 10mM Tris pH 7.4, 150mM NaCl, 1mM EDTA,

1% TritonX-100, 0.5% NP40) for 30 min at 4OC with agitation. After centrifugation,

cleared supernatants were subjected to IP, co-IP and/or GST-PD.

RNA Interference in C2C12 Cells

Approximately 1x105 cells were seeded in each well of the 24-well tissue culture dish and

incubated overnight. On day 2, cells were transfected with 50 pmol of annealed siRNA

using the Lipofectamine TM 2000 (Invitrogen) according to manufacturer’s instructions.

On day 3, cells were trypsinized, counted and seeded with equal density onto the 6-well

tissue culture plate and incubated overnight. On day 4, a second round of transfection

with 250

pmol of siRNA was performed. On day 6, the cells were washed and differentiated. Three

days post-differentiation, the cells were subjected to immunostaining and the fusion index

was determined. The following target sequences were used for siRNA design: mN-

WASP 5’-AACAAGAGCTATACAATAACT-3’ and mWIP 5’-

AACCGCCAACAGGGATAATGA-3’. The mWIRE siRNA was purchased from

Qiagen, Cat.# SI00859299. For latruncullin A treatment, myoblasts were incubated in

differentiation medium containing 40 nM of latruncullin A.

Northern Blot

2µg of total RNA was loaded for each sample and separated on 1% denaturing agarose

gel. Separated RNA was transferred to the membrane and subjected to blotting according

to manufacturer’s manual (DIG-High Prime DNA Labeling and Detection Kit, Roche).

Electron Microscopy with High-Pressure Freezing High-pressure freezing and freeze substitution were performed as described (McDonald,

1999; McDonald et al. 2000). Briefly, embryos were rapidly frozen using a Bal-Tec

device. Freeze-substitution was followed using 1% osmium tetroxide and 0.1% uranyl

acetate in 98% acetone and 2% methanol on dry ice. The substituted samples were then

embedded in EPON. Sectioning and lead staining were proceeded as described for

conventional EM.

Supplemental References Azpiazu, N., and Frasch, M. (1993). tinman and bagpipe: two homeo box genes that

determine cell fates in the dorsal mesoderm of Drosophila. Genes Dev 7, 1325-1340.

Galletta, B.J., Chakravarti, M., Banerjee, R., and Abmayr, S.M. (2004). SNS: adhesive properties, localization requirements and ectodomain dependence in S2 cells and embryonic myoblasts. Mech. Dev. 121, 1455–1468. Kiehart, D. P., and Feghali, R. (1986). Cytoplasmic myosin from Drosophila

melanogaster. J Cell Biol 103, 1517-1525.

Kosman, D., Small, S., and Reinitz, J. (1998). Rapid preparation of a panel of polyclonal

antibodies to Drosophila segmentation proteins. Dev Genes Evol 208, 290-294.

Machado, C., and Andrew, D. J. (2000). D-Titin: a giant protein with dual roles in

chromosomes and muscles. J Cell Biol 151, 639-652.

McDonald, K.L. (1999). High pressure freezing for preservation of high resolution fine

structure and antigenicity for immunolabeling, Methods in Molecular Biology 117, 77-

97.

McDonald, K.L., D.J. Sharp & W. Rickoll. (2000) Preparing thin sections of Drosophila

for examination in the transmission electron microscope. In, Drosophila: A Laboratory

Manual, 2nd Ed., W. Sullivan, M. Ashburner & S. Hawley (eds.), pp. 245-271.

Figure S1. Myoblast Fusion Defect in sltr Mutant Embryos Visualized by Electron Microscopy (A) A multinucleated syncytium containing five nuclei (n1-5) in a stage 14 wild type embryo (schematic in A’). (B) A cluster of unfused myoblasts in a late stage 14 sltr mutant embryo. In this cluster, the founder cell (F) and eight fusion competent cells (1-8) attached to the founder cell remain mononucleated (schematic in B’).

Figure S2. mRNA and Protein Isoforms of sltr (CG13503) (A) Genomic organization of sltr and predicted mRNA isoforms by BDGP. Black boxes represent exons, and the red box represents a predicted, alternatively spliced, exon 8 (E8). Orange stripes indicate the translational start and stop. The size of mRNAs and the protein isoforms they encode is shown on the right. Numbers in blue indicate the size of RC and RE without E8, in which cases the E8 box is crossed off. Green-boxed transcripts are the ones expressed in the embryo, including RF, RC (without E8) and RE (without E8). Arrows indicate locations of RT-PCR primers. The cDNA fragment used as a probe for Northern blot is shown on the top and marked as NB probe. NT: not transcribed (see panels C and D). (B) Northern blot analysis of embryo, larvae and adult total RNA. Note that there are two major clusters of bands of sltr transcripts in the embryo that are likely to correspond to RF (3.7kb) (top band) and RC(-E8)(3.2kb) and/or RE(-E8)(3.1kb) (bottom band(s)) (see panel C). There is little sltr transcript in the larvae. In adult, the major sltr transcripts are of high molecular weight, such as RA and RF. However, there is a small amount of lower molecular weight transcripts, such as RC and RE (also see panel C). rp49: loading control. (C) RT-PCR analyses with embryo or adult total RNA. Note that in the embryo, no PCR product is detected when the 3’ primer is within E8 (8ins-3’), suggesting that the mRNA isoforms in the embryo do not contain E8. Low-level E8-containing transcripts are detected in adult (see lane ABF/8ins-3’ in “Adult”). The absence or low abundance of E8-containing transcripts in embryo or adult was confirmed with two more sets of primer (data not shown).

(D) RF, RC (no E8) and RE (no E8) are the main sltr transcripts expressed in the embryo. Abundance of individual isoform was quantified based on RT-PCR. The bars represent the percentage of a specific transcript out of the total sltr mRNA. RC and RE transcripts without E8 are expressed in the embryo (labeled as (-E8) in blue). The zero value for RB and RD isoforms was based on sequencing analyses (see Supplemental Materials and Methods) and the absence of the isoform-specific PCR product (not shown).

Figure S3. Localization of Sltr Mutant Proteins in the Embryo Sltr mutant proteins were expressed in the embryonic mesoderm using a twi-GAL4 driver. Embryos were stained with α-Sltr (A, A’’, B, B’’, C and C’’), α-GFP (D and D’’), α-Sns (A’, A’’, B’, B’’, C’, C’’, D’ and D’’), and α-β-gal (not shown). Mutant embryos were distinguished by the absence of balancer β-gal expression. Note that Sltr mutant proteins (green) largely co-localize with Sns (red).

Figure S4. Vesicle Trafficking in sltr Mutant and Actin Foci in Wild Type Embryos Conventional EM (A, A’) and high-pressure freezing (HPF) EM (B, B’) micrographs of sltr mutant embryos. (C-D’) ImmunoEM of wild type embryos. (A) Prefusion vesicles (arrows) are observed in the vicinity of Golgi (marked by a star) and associated with microtubules (arrowheads) (schematic drawing in A’). Note that there is an increase number of vesicles in sltr mutant compared to wild type embryos

(Figure 6E-F”). Moreover, the vesicles appear scattered and are routed randomly to the plasma membrane. (B) An example of sltr mutant embryo prepared by HPF. Vesicles (arrow) associated with microtubules (arrowheads) near the tip of a filopodium (schematic drawing in B’). (C-D’) Two examples of immunoEM micrographs showing actin foci adjacent to the plasma membrane. Arrow: actin-coated vesicles. Arrowhead: naked vesicles. (C) The actin-rich patch (dotted area) is immediately adjacent to the plasma membrane (schematic drawing in C’). In contrast, the cytoplasmic area is devoid of actin. (D) The same section as that in Figure 6G-G’ is shown. However, neighboring myoblasts are included here. Note that all vesicles within actin-rich patches are coated with actin, whereas vesicles outside of the foci are barely visible at this magnification. Scale bars: 500 nm.

Figure S5. Intact Plasma Membranes between Founder and Fusion Competent Cells in sltr Mutant Embryos High-pressure freezing (HPF) EM micrographs of sltr mutant embryos. Schematic drawings of A, D, E and F are shown in A’, D’, E’ and F’. (A-A”) A stage 14 sltr mutant embryo. Note prefusion vesicles aligned along intact membranes.

(B) A stage 14 wild type embryo. Multinucleated myotubes have already formed, one of which is indicated by an arrow. Dorsal is pointed by arrowhead. VN: ventral nerve cord. (C) A late stage 14 sltr mutant embryo. Note clusters of myoblasts attached to single precursor cells (arrows). The apposing plasma membranes between any muscle precursor and its surrounding fusion competent cells are intact and two examples are shown in D-F”. (D, D’) Close-up view of boxed area in C. F: founder/muscle precursor cell. 1-6: six fusion competent cells surrounding the precursor cell. (E-E’) Close-up view of the top box in D. Note the completely intact plasma membrane between the founder and the fusion competent cell. The boxed area in E is enlarged in E”. (F-F’) Close-up view of the bottom box in D. Membranes at cell contact sites are also intact without any discontinuity (fusion pore). The boxed area in F is enlarged in F”. Scale bars: 2um in B, C and D; 500 nm in E and F; 250nm in A, A”, E” and F”.