Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana...

Characterization of a Cruciferin Deficient Mutant , ssp- 1, of Arabidopsis thaliana

Jane Sung Yun Lee

A thesis submitted in conformity with the requirements for the degree of Master of Science

Graduate Department of Botany University of Toronto

O Copyright by Jane Sung Yun Lee 2000

National Library !*m ofCanada Bibliothèque nationale du Canada

Acquisitions and Acquisitions et Bibliographie Sewices services bibliographiques

395 Wellington Strwt 395, nie Wellington Ottawa ON K1A ON4 OttawaON K I A W Canada Canada

The author has granted a non- exclusive licence allowing the National Library of Canada to reproduce, loan, distriiute or sell copies of this thesis in microform, paper or electronic formats.

The author retains ownership of the copyight in this thesis. Neither the thesis nor substantid extracts fiom it may be printed or otherwise reproduced without the author's permission.

L'auteur a accordé une licence non exclusive permettant a la Bibliothèque nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la forme de microfiche/film, de reproduction sur papier ou sur format électronique.

L'auteur conserve la propriété du droit d'auteur qui protège cette thèse. Ni la thèse ni des extraite substantiels de celle-ci ne doivent être imprimés ou autrement reproduits sans son autorisation.

ABSTRACT

C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana

Master of Science 2000

Jane Sung Yun Lee

Ssp-7 is a mutant deficient in the accumulation of a major seed

storage protein, the 12s cruciferins. The mutation is caused by a G-A

transition in the CRU3 gene, resulting in a premature stop codon. Ssp-1

seeds contain 20-27% less protein than wild type seeds. To determine if the

level of expression of a transgene in this mutant background would be

greater than that found in wild type, the mutant was transformed with the

phytohernagg lutinin (PHA) gene and PHA expression was quantified . The

PHA transformants were also crossed to wild type so that each transgene

would be in the same copy number and chromosomal context. PHA levels in

seeds varied from 0.17% to 1.5% of the total seed protein. One of the

transformants gave five times the level of expression compared to its

backcross. Therefore a mutant such as ssp-1 may prove useful for

overexpression of foreign proteins.

ACKNOWLEDGMENTS

I would like to express my gratitude to my supervisor, Dr. Dan Riggs

for his patience. tutelage and confidence in my scientific abilities. I also

need to thank my cornmittee members, Dr. Peter McCourt and Dr. Thomas

Berleth. for their always helpful direction and suggestions. I would also like to

express my appreciation to Dr. Clare Hasenkampf for her guidance,

encouragement and infectious enthusiasm for science. Recognition should

be given to Dr. Camille Steber for her assistance on SSLPs and transgenics,

Dr. Majid Ghassemian for doing some initial studies and the lipid analysis

and Annette Rzepczyk for technical training. To my fellow graduate students

and lab mates, Najeeb Siddiqui, Scott Douglas and Rhoda De Guzman, I am

grateful for your friendship and support and your useful input and scientific

troubleshooting. I would also like to acknowledge my parents and Raymin

Chen for their strong moral and emotional support and unwavering faith in

me, without which I could never have accomplished as much as I have.

TABLE OF CONTENTS

Page ABSTRACT ................................................................................... ii

ACKNOW LEDGMENTS ................................................................... iii

TABLE OF CONTENTS ................................................................... iv

LIST OF TABLES ........................................................................... vi

LIST OF FIGURES ......................................................................... vii

INTRODUCTION ............................................................................ 1

MATERIALS AND METHODS ........................................................... 24

Seed Lots ........................................................................... - 24 ................................ Single Pot Plantings of Arabidopsis fhaliana 24

........................................................ Isolation of Seed Proteins 24 ........................................... Quantitation of Seed Protein Levels 25

.......................... Isolation and Quantitation of Seed Starch Levels 26 Germination and Growth of Arabidopsis thaliana

............................................... for Screening of F2 plants 27 ....................................... Screening of F2 lndividuals of Crosses 27

............................................................. Isolation of Plant DNA 28 Southern Blotting of F2 Individuals ............................................ -30 Probes and Hybridization ....................................................... 31 PCR for SSLP analysis ........................................................... 32 Production of DNA constructs ................................................. 34 Transformation of E.coli .......................................................... 35 Transformation of Agrobacterium .............................................. 36 Arabidopsis transformation ...................................................... 38 Selection of transformants ....................................................... 39 Immunoblotting .................................................................... -39 Screening for Homozygotes ..................................................... 41 TA cloning ........................................................................... -41 Large Scale DNA Preparation .......................... ... ................. 42

......................................... Autosequencing Preparation of DNA 44 .................. Subcloning and Analysis of the ssp- I CRU3 sequence 45

Crossing PHA homozygote to Wild Type Arabidopsis thaliana ......... 45 PHA Levels in Transgenic Plants .............................................. 46

TABLE OF CONTENTS

Page RESULTS .................................................................................... -48

Preface ............................................................................... 48 Biochemical Characterization of ssp4 ....................................... 49 Screening for F2 ssp4 mutants ............................................... 55

............................... The ssp-1 mutation maps to chromosome 4 55 ................... The wild type CRU3 gene rescues the ssp-1 mutation 60

ssp4 has a premature stop codon .......................................... 60 The empty container hypothesis ............................................... 65 Strategy for testing the empty container hypothesis ...................... 66 Homozygote t ransformants ...................................................... 66 Homozygote bac kcross ........................................................... 70 PHA assay .......................................................................... -71

DISCUSSION ................................................................................ 76

SUMMARY AND CONCLUSIONS ...................................................... 90

LITERATURE CITED ...................................................................... 91

TABLE

LIST OF TABLES

Page

................... Chernical Composition of Cereal. Legume and Oil Seeds 6

SSLP primers and RFLP probes used in rnapping ssp-1 .................... 30

Segregation Patterns from SSLPs and RFLPs of ssp-1 mutants .......... 59

Primers used for PCR amplification of the ssp-1 CRU3 gene ......................................................................... for sequencing 62

Summary of Results for PHA Transformants .................................... 68

Summary of Results for PHA backcross ......................................... 71

vii

FIGURE

LIST OF FIGURES

Page

SDS-PAGE of seed extracts from various F2 individuais from crosses between s s p l and Col or Ler ..................................... 48

Comparison of seed protein levels from A . thaliana ecotypes ......................... col and ler with a seed storage protein mutant ssp-1 52

Comparison of seed starch levels from A . thaliana ecotypes ......................... col and ler with a seed storage protein mutant ssp-1 53

Previous lipid analysis of col and s s p l seeds showing the fatty ........................... acid composition of the lipid fraction from the seed 54

............................ SSLP analysis using primers nga 8 and nga 11 39 57

The ssp-1 mutation is linked to chromosome 4 ................................. 58

SDS-PAGE of seed extracts from ssp-1 plants transformed with a construct containing the wild type CRU3 gene ................................. 60

Sequencing strategy for the cru3 gene in s s p l ................................ 63

Wild type nucleotide sequence of CRU3 with 1 kb of upstream Prornoter ................................................................................. -64

10.Arabidopsis seeds do not contain any endogenous PHA .................... 65

. 11 Determination of copy number for transformants ............................... 69

. ......................... 12 PHA copy number in the backcross F3 homozygotes 72

13 . Analysis of PHA expression in primary transformants and their backcrosses ................................................................. 74

14 . Quanütation of PHA levels in primary transfonnants and their backcrosses ................................................................. 75

Introduction i

Introduction

Unlike humans and animals which do not have a haploid multicellular

stage, plants undergo a phenomena called alternation of generations in their

life cycle where haploid and diploid multicellular stages reproduce each other

(Raven et al., 1981). In the general life cycle of plants, specialized cells of

the diploid multicelluar organism or sporophyte divide meiotically to produce

haploid spores. Mitotic divisions of these spores result in a haploid

multicellular organism called the gametophyte, which forms gametes by

mitosis. The fusion of male and female gametes in fertilization produces the

diploid zygote that will develop into an embryo that will complete the cycle by

giving rise to a sporophyte. The plant body that is observed in nature

represents the sporophyte phase of the life cycle for vascular plants (e.g. lily)

and the gametophyte phase of non-vascular plants (e.g. moss).

In angiosperms, the sporophyte will produce flowers complete with

anthers and an ovary where spores will form and eventually give rise to

gametes. In the anthers, pollen mother cells develop and divide meiotically

to give rise to haploid microspores (Esau. 1977). The haploid microspores

divide by mitosis to form pollen grains containing two sperm cells. Within the

ovule, one megaspore mother cell develops and divides meiotically to give

rise to four megaspores of which only one survives to become the embryo

sac containing an egg (Esau. 1977). Fertilization or fusion of the gametes

l ntroduction i

results in a diploid zygote which develops into the embryo, encased in a seed

coat.

Pollination occurs when the pollen attaches to the stigma, stimulating

pollen tube germination. The pollen tube enters the embryo sac through the

micropyle and the two sperm cells from the pollen are carried into the ovule.

In the embryo sac, one sperm cell fuses with the egg, forming the zygote,

and the other sperm cell fuses with two polar nuclei. forming the primary

triploid endosperm nucleus. This is termed double fertilization and is unique

to flowering plants. The zygote divides in an organized pattern resulting in a

highly polarized cell with a distal or chalazal (shoot) end and a proximal or

micropylar (root) end. At this point the endosperm starts to divide before the

embryo undergoes any further cell division (West and Harada, 1993). In this

proembryo phase, the first division is asymmetric in the transverse plane

forming an apical or terminal cell which will develop into the embryo proper

(Esau. 1977). The basal cell contributes rnostly to the suspensor that

anchors the embryo to the embryo sac and pushes it into the endosperm.

The suspensor cells divide by transverse divisions and longitudinal divisions

in the embryo proper create a four-celled or quadrant embryo not much

bigger than the suspensor (Raven et al., 1981). The embryo grows and

expands beyond the suspensor and enters the octant stage, as transverse

divisions create an eight celled embryo. Periclinal divisions result in an outer

layer of cells. the protoderm, that represents the onset of the formation of the

Introduction 3

dermal system (Esau, 1977). As the embryo expands by longitudinal

divisions in this early globular stage, the protoderm accommodates the

increase by repeatedly dividing anticlinally. allowing it to remain a single layer

of cells. The onset of cell division in relation to the initiation of the formation

and enlargement of the cotyledons, causes the top of the embryo proper to

flatten. The cells divide longitudinally to form the procambium and the cells

next to these divide transversely to form the ground meristem which become

visible after the globular stage. The growth of the cotyledons result in a heart

shaped embryo in dicots and a cylindrical embryo in monocots (Raven et al..

1981). The upper cell of the suspensor becomes the hypophysis cell whose

subsequent derivatives form a portion of the root apical meristem. The shoot

apical meristem forms between the cotyledons and the endosperm also

starts to form around the embryo. The basal cell of the suspensor also has a

role in nutrient uptake as its filliform apparatus (infolding of the membrane)

increases the surfacr area for nutrient absorption. More transverse divisions

followed by cell enlargement help to f o n the torpedo stage of the embryo

that can then develop into a mature embryo with hypocotyl, epicotyl and

radicle. The expansion of the embryo slowly crushes the suspensor and the

suspensor begins to degenerate. The mature ovule becomes the seed coat

to provide protection to the embryo. Therefore the seed houses part of the

development of the sporophyte (as the ernbryo) and is essential for the

germination of the next generation of plants.

Introduction 4

Plant seeds contain high levels of reserves that provide a source of

energy, carbon and reduced nitrogen for germination of seeds and seedling

growth. The storage of nutrient reserves is one of the primary functions of the

seed. Depending on the species, the seed contains varying amounts of

carbohydrates, lipids and proteins (refer to Table 1 ). The amount of protein in

the seed accounts for 8-15% of the dry weight in cereals and 20-40% of the

dry weight in legumes and oil rape seeds (Shewry et al.. 1995). Seed

development in most plants can be divided into 2 phases: an initial phase of

active cell division and morphogenesis, followed by a preparatory phase for

seed dormancy and germination characterized by the accumulation of seed

storage proteins and other reserves (Meinke, 1994). Seeds remain white until

the late globular stage of embryogenesis when the seed coat and embryo

begin to appear pale green. Beyond the torpedo stage the embryo is

completely green and the seed coat is translucent. Pigments are made

through various biosynthetic pathways to give the seed coat its final color.

The mature seed dehydrates to approximately 5-15% water by weight and

the seed remains quiescent until conditions are favorable for germination.

Plant hormones such as abscisic acid and gibberellins have an important role

in seed dormancy.

The seed develops from the ovule as a consequence of double fertilization

and growth of the ovule is followed by growth of the endosperm before the

embryo enlarges. The endosperm is the primary site for nutrient storage in

Introduction 5

seeds and can persist after embryo maturation as seen in monocots so the

seedling can use it after germination. Altematively, the endosperm may be

absorbed, as in dicots, where the food is restocked into the cotyledons

before the seed completes development (Lopes and Larkins, 1993). Starch

is the main source of carbon, while the seed is still green, and exists as two

a-glucan polymers, the linear amylose and the more highly branched

amylopectin. These polymers of glucose are synthesized and packed in

plastids called amyloplasts. In the cytoplasm, sucrose is cleaved by

sucrose synthase to form UDP-glucose and fructose. UDP phosphorylase

and enzymes from the glycolytic pathway convert these sugars to glucose-1-

phosphate, which is then used to produce ADP-glucose by the enzyme,

AD?-glucose phosphorylase, using ATP. ADP-glucose is then transported

into the amyloplasts (Martin and Smith, 1995). 60th amylose and

amylopectin chains are made similariy as many different forms of starch

synthase create a-1, 4 linkages between a between glucose and a growing

glucan chain, releasing AD P. Different isoforms of starch branching

enzymes (SBEs) then break some of the original linkages to produce

branches having a-1, 6 linkages. SBEs favor longer lengths of glucan chains

that develop into the highly branched amylopectin (Lopes and Larkins, 1 993).

These starch molecules exist as starch grains that anse as single or multiple

granules in amyloplasts. The proportions of the two forms of starch are

dependent on the activity of starch synthase and starch branching enzymes

Introduction 6

Table 1. Chernical Composition of Cereal, Legume and Oil Seeds

Seed Type Protein Carbohydrate Li pid Ash

CEREALS

Bariey

Maize

Oats

Rice

Sorghum

W heat

LEGUMES

Soybean

French bean

Broad bean

Pea

OIL

Cotton 19 19

Sunflower 25 40

Flax 22 40

Canola 25 5 43 7 - - - - - - - - --

reproduced from Habben and Larkins, 1995, additional numbers from Kiegel and Galili, 1995

lnt roduction 7

(Martin and Smith, 1995).Starch synthesis occurs in the endosperm, and

during germination starch grains are hydrolyzed and their contents are

broken down by a-amylase and maltase.

Lipids, mostly in the forrn of triacylglycerols (TAGs), are densely

stored in oil bodies in the seed and can be another source of carbon. Free

fatty acids rarely exist in the plant cell as they are usually esterified to

glycerol (Ohlorogge and Browse, 1995). The synthesis of the fatty acid

backbones occurs in undifferentiated plastids in the seed by a group of

enzymes collectively called fatty acid synthase. Two chains, each composed

of 2 to 18 carbon units, are linked to an acyl carrier protein (ACP). The fatty

acids are cleaved from ACP and exported into the cytoplasm where they are

then linked to CO-enzyme A (Battey et al., 1989). In the endoplasmic

reticulum (ER), the fatty acids are transferred to glycerol-3-phosphate,

producing a phosphatidic acid. The phosphate is removed, leaving a

diacylglycerol, and another fatty acid is added in a reaction catalyzed by

diacylglycerol acyltransferase (Ohl rogge and Browse, 1 995). These lipids

are then packaged into oil bodies which are hydrolyzed by lipases to glycerol

and fatty acids at the time of germination.

Seed storage proteins are copiously synthesized and are sinks for

nitrogen. They accumulate almost exclusively during the cell expansion

phase in the embryonic cotyledons and/or the endosperm. Since most seed

storage proteins contain sulphur, low levels of available sulphur can limit their

Introduction Y

synthesis. Most plants contain groups of storage proteins that are both high

and low in sulphur, providing flexibility in dealing with sulphur levels. This is

just an example of the high polymorphism exhibited by seed storage protein

genes. This high level of polymorphism is produced by two main methods-

posttranslational processing and the existence of multigene families (Shewry

et al., 1995). Seed storage protein fractions are usually made of a mixture of

polypeptides that can be split into different groups based on relatedness and

chemical properties. There are four classifications of seed storage proteins

that are based on solubility or extraction methods: These are the albumins

(water), globulins (dilute saline), prolamins (alcohol/water mixture) and the

glutelins (alkalifdilute acid). Their genes are developmentally regulated and

these proteins are produced on ribosomes attached to the ER. An N-

terminal signal peptide directs the translocation of the proteins into the lumen

of the ER (Casey et al., 1997). They are then folded into their proper

conformation by chaperone proteins, shipped to the Golgi apparatus and into

a vesicle. The vesicle then fuses with the vacuolar membrane. which

pinches off to form a vacuole containing the seed storage proteins. The

vacuole then fragments producing the protein bodies that exist in mature

seeds until germination. Hydrolytic enzymes, such as proteinases and

peptidases, are targeted to the protein bodies and are produced at this time

so that the emerging seedling can metabolize the resewes for carbon and

nitrogen sources until it can become photosynthetically competent.

Introduction 9

Currently the most harvested plant organs by man, seeds are the

major source of protein for most of the world. For example, about 70% of al1

food for human consurnption cornes from seeds (Kiegel and Galili. 1995). As

a part of these reserves, seed storage proteins have been utilized as a

primary source of nutrition for humans and livestock and have a crucial role

in supplying essential amino acids (Yamauchi and Minamikawa, 1998).

Although proteins usually have metabolic or structural roles, there are one or

more groups of seed storage proteins whose sole function is to provide the

seed or seedling with a store of amino acids during germination or

embryogenesis (Shewry et al., 1995). Seeds are also harvested as the raw

materials for food processing and other industries. For example, soybean

protein is used in infant formula (Kriz and Larkins, 1991) and the malting of

barley is used in the production of alcoholic beverages (Shewry et al., 1994).

The advent of genetic engineering and advances in gene manipulation

methods create the potential for great advances in the biological sciences

with many practical applications. The use of these techniques is of particular

interest to many industries, including agriculture, as improvement of

agronomic crops provides a means to increase their value by altering the

composition of plant or seed products. Additionally , novel and desirable

traits can be introduced to increase the yield andlor quality of commercial

products. These alterations also may provide resistance to pathogens,

insects, herbicides, desiccation or other environmental stresses such as high

Introduction 10

salt concentrations or cold temperatures. For example, seed oils are used

for vegetable oils, cosmetics, surfactants and lubricants but the number of

applications frorn a certain crop is restricted due to limited variability of fatty

acids (Ivy et al., 1998). There have been attempts to rnodify the fatty acid

composition of transgenic plants in order to increase the number of

applications of seed oils that are economically favorable. The composition of

lipids in some oil rape seeds have been modified such that the levels of

desired oils were increased thereby improving taste ( K r k and Larkins, 1991).

Crops are often attacked by insects and other pests that may

irrevocably damage months or even years of work. The spraying of

insecticides may negatively affect even more plants directly or indirectly (e.g.

contamination of soi1 or water table). If plants could be given the ability to

ward off these attacks then the farmer could inexpensively Save their crops.

Cotton crops have been modified to provide resistance to certain insects by

transfer of the gene encoding a toxin from Bacilius thuringiensis (Bt) (Perlak

et al., 1990). Field tests have been performed and confirm that plants

expressing the Bt gene were capable of effectively controlling the infestation

of tobacco budworm, pink bollworm and cotton bollworrn (Wilson et al., 1992,

Benedict et al., 1996, Halcomb et al., 1996) without significant loss in

agronomic performance and yield (Jenkins et al., 1997). Bt cotton made up

approximately 13% of the total US cotton crop in 1996 and the Bt gene has

Introduction I I

also been introduced into corn, canola and potato (Lynch et al, 1999. Moran

et al., 1998, Ramachandran et al., 1998).

Weeds also pose a similar problem as their growth depletes the

available nutrients, water and space for the desired crop. Application of

herbicides may have similar affects on crop plants as insecticides.

Therefore, herbicide resistant plants have also been generated by the

introduction of genes that encode bacterial enzymes that inactivate the

herbicides (Stalker et al., 1988). For example, sugar cane is a monocot that

can be stably transformed and is a valuable crop grown mainly in the tropics

and subtropics. The bar gene encodes an enzyme called phosphinothricin

acetyltransferase (PAT) that can give plants the ability to detoxify

phosphinothricin (PPT) and its derivatives, which are active ingredients in

herbicides (Hartman et al., 1994). Sugarcane has successfully been

transformed with the bar gene and was found to be resistant to a herbicide

called lgnite (Gallo-Meagher and Irvine, 1996). Herbicide evaluations were

performed under greenhouse and small plot conditions and individuals with a

high and intermediate levels of resistance were found (Enriquez-Obregon et

al., 1998). However, field tests have not been performed and agronornic and

sugar quality characteristics have not been studied.

Rice (Oryza sativa L.) has also been genetically engineered to be sait

and cold tolerant by introduction of the choline oxidase codA gene from the

soi1 bacteria Arthrobacter globformis (Sakamoto et al., 1998). This enzyme

lnt roduction 13

is responsible for the synthesis of çlycinebetaine, a quarternary ammonium

compound. Glycinebetaine acts as a compatible solute that ailows cells to

adjust their osmotic potential. It is also known to protect proteins from salt

induced dissociation of subunits, which is important in plants as it can protect

photosystem II under conditions of salt stress (0.15m NaCI) and at low

temperatures (Sakamoto et al.. 1 998).

The quality of a crop can also be improved by identifying the

molecular basis of traits and using biotechnology to improve them. The

breadmaking quality of milled flour from wheat has been a popular trait to

modify because of its commercial value. The breadrnaking quality is

dependent on the combination of elasticity and extensibility of the dough that

enables the entrapment of carbon dioxide for fermentation and is largely

determined by the arnount and properties of gliadins and glutenins (Shewry

et al., 1994). It has been shown that high molecular weight (HMW) glutenins

are important for breadmaking quality. Increasing the total amount of HMW

subunits or increasing cysteine residues to increase crosslinking between

polymers has been shown to improve this trait (Shewry et al., 1994). A novel

hybrid subunit (a fusion of two native HMW glutenin subunit genes) under the

controi of a native prornoter was used to transform wheat (Bechl and

Anderson, 1996). The recombinant protein accumulated to native levels and

increasing the number of transgene copies seerned to increase the amount

Introduction 13

of HMW glutenins produced, which enhanced the strength of the bread

dough (Bechl and Anderson. 1996).

Plants provide an economic alternative for the large-scale production

of recombinant proteins and altered lipids for industrial and pharmaceutical

uses. Proteins produced in Ecoli are not glycosylated nor processed, and

many recombinant proteins can be degraded by proteases or may prove to

be toxic to the bacteria. Eukaryotic systems such as yeast and insect and

mammalian cell cultures can carry out glycosylation and processing

accurately, but only transgenic animals are capable of performing correct

post-translational modifications such as complex glycosylation (Kusnadi et

al., 1997). However, in the latter case, feeding and sheltering the animals

will be an expense. For plants, the cost of biomass production is low and it is

easy to scale up production simply by increasing acreage (Kusnadi et al.,

1 997). Plants also have the ability to compartmentalize recombinant proteins

in organelles or other available storage organs. There are established

practices for efficient harvesting, transportation, sorting and processing of

plants that offer an edge over other systems (Kusnadi et al ., 1 997). Also, the

purification of recombinant protein from plant tissue can be eiiminated by

direct delivery of the protein if the organ harboring the protein is used as feed

or food.

A major goal of agricultural biotechnology is to provide a basis for

improving nutritional quality of traditional crops. Potentially, seeds could ~e

Introduction 1 1

used to house the overproduction of foreign proteins of economic value.

These seeds can be easily hawested and their contents extracted by

established and efficient processes. The composition of these proteins is an

important agronornic trait that potentially could be modified using

biotechnology. Plant breeding to increase the nutritional value of crops has

not been very successful for any given species due to the lack of genes

encoding seed storage proteins with high levels of essential amino acids. It

is now possible to produce transgenic plants in a variety of species by

various methods such as electroporation or Agrobacterium-rnediated

transformation. Therefore, many attempts have been made to alter traits or

increase the nutritional value of crops using transgenic plants. One direct

method is the modification of the coding region of existing seed storage

proteins. Unfortunately, this created another problern related to the three

dimensional structure of the protein (Kusnadi et al., 1997). Seed storage

proteins assume specific conformations and modifications may affect the

structure and proper deposition of these proteins within the seed. In vitro

mutagenesis has been used to increase the methionine content of phaseolin

(a protein naturally occuring in the bean) and the gene was then inserted

into tobacco. Although the gene was transcribed, the quantity of the modified

protein was much less than normal phaseolin in tobacco and was quickly

degraded during transport to protein bodies (Hoffman et al., 1988). Genes

encoding zeins have also been modified to increase the lysine content in

Introduction 15

transgenic tobacco. Using the phaseolin promoter, modified a-zein was

synthesized in transgenic tobacco but after one hour was degraded due to

protein instability (Ohtani et al., 1991). There have also been examples of

increasing the amount of free amino acids in plants. Aspartate kinase (AK) is

an enzyme in the biosynthetic pathway of the aspartate family and a few AU

isoforms are inhibited by threonine or lysine as a form of feedback inhibition.

lntroduction of the E.coliAK gene encoding a desensitized enzyme was used

to transform tobacco, as these mutants in bariey, maize and carrot

expressing desensitized isozymes, were shown to overproduce free

threonine (Shaul and Galili. 1992). The transfonants were not affected by

threonine or lysine (10 PM) (enough to inhibit endogenous AK activity) and

an increase in free threonine was correlated to an increase AK activity (Shaul

and Galili, 1992). This increase of free threonine in the leaves elevates the

nutritional quality at the plant level but using tissue specific promoters, it may

be possible to target these desensitized enzymes to the seed.

An alternative approach to improving nutritional quality has been to

transfer a gene for a protein rich in an essential amino acid into the crop of

interest. For example, the maize 15 kD zein contains the highest number of

methionines of al1 the zeins (Hoffman et al., 1987). The gene for this protein

was attached to phaseolin flanking regions and used to transforrn tobacco,

where the protein was correctly processed and accumulated in the ernbryo

and endosperm (Hoffman et al., 1987).

Introduction 16

Barley has limiting levels of lysine but the Hiproly strain was found to

have increased levels of chymotrypsin inhibitors (CI) that are high in lysine

(Shewry et al., 1994). Transgenic tobacco plants containing chimeric CI-

21gus genes displayed tissue specific expression. Under a stronger

endosperm-specific promoter, such as the HMW glutenin subunit gene

promoter, expression of CI-2 (1 1.59 % Lys) may have an impact on lysine

content of a transgenic cereal grain (Shewry et al., 1994). Legumin is a pea

seed storage protein that is rich in lysine was expressed in transgenic rice

under the control of the rice glutenin promoter (Sindhu et al., 1997). It was

demonstrated that the protein was properiy processed and was found in the

endosperm of rice (up to 4.24% of the total protein) thereby increasing its

lysine content and its nutritional value (Sindhu et al., 1997). The most

common example is the 2s albumin of Brazil nut which has been analyzed

and found to contain 20% methionine residues. This protein is synthesized

as a single precursor then proteolytically cleaved to form 9 kDa and 3 kDa

polypeptide chains which are then linked by two disulphide bonds. The Brazii

nut 2s albumin has been widely exploited in biotechnology to increase the

methionine content of many species of plants. In tobacco, the cDNA of the

intermediate for the 25 albumin subunits was attached to the phaseolin

promoter (Altenbach et al., 1989). There was an increase of methionine

content of the seed extract but the recombinant protein only accounted for a

srnall fraction of the total extractable protein in the seed. Also, a chimeric

Introduction 17

gene consisting of the coding and the 5' flanking regions of Arabidopsis 2s

albumin gene and the Brazil nut 2s albumin gene was constructed and used

to transform tobacco, Arabidopsis thaliana and Brassica napus. However, in

these plants, the level of expression was too low to quantify accurately (De

Clerq et al., 1990). Canola was also transformed with a chimeric gene

composed of regulatory regions from the phaseolin gene fused to a

sequence encoding a 17 kDa precursor of the Brazil nut 2s albumin and

expressed at low levels. The gene product only accounted for a srnall

portion of up to 4% of the total protein content but due to the high methionine

content (18.8%) of the Brazil nut 2s albumin. the total methionine content

was raised to 33% (Altenbach et al., 1992). However, the Brazii nut 2s

albumin was found to be an allergen (Nordlee et al., 1996) and may not be a

feasible protein to enhance nutrition for crops intended for human

consumption. A 10 kDa sunflower seed albumin was found to contain 16%

methionine residues and was found not to be an allergen (Korrt et al ., 1 991 ).

The cDNA of the sunflower precursor was attached to the pea vicilin gene

promoter and introduced into lupins (Molvig et al., 1997). This doubled the

original methionine levels of the seed extract from 0.199% to 0.386% (by

weight) but again only accounted for a small percentage of the total protein

(Molvig et al., 1997).

Therefore in al1 of these examples, although the inserted genes were

expressed, the level cf expression was restricted. It has been theorized that

Introduction 18

the limited success of such experiments may be due to high expression

levels of endogenous protein targeted to the seed and a bias towards the

accumulation of natural reserves. If the seed could be partially emptied of

some of these proteins then a void would be made which could be filled by

foreign or genetically engineered proteins. This has become known as the

'empty container' hypothesis.

The composition of seeds has already been discussed but alterations

in the level of one component can affect the other components. Often there

is compensation within the seed, with one class of macrornolecules

experiencing an increase in its level in order to offset the decrease in another

class. For example. it is known that the r mutation giving n'se to the wrinkleQ

phenotype in peas results in decreased legumin seed storage protein and an

increase in lipids (Giroux et al., 1994). There is also a mutant in Arabidopsis,

shrunken seed 1 (ssel), that is defective in the biogenesis of protein and oil

bodies (Lin et al., 1999). Unlike wild type seeds, starch is favored over

proteins and lipids in ssellssel seeds. It has been shown that SSEI is not a

direct inhibitor of starch synthesis, implying that protein and oil body

proliferation is associated with a decline in starch accumulation and that

starch formation is a default storage deposition pathway (Lin et al.. 1999).

Also, in soybean there is an inverse relationship between seed storage

protein concentration and oil or seed yield (Escalante and Wilcox, 1993 and

references within). It is obvious that there must be some form of regulation of

Introduction 19

the levels of the macromolecular seed contents. Perhaps this regulation

occurs at multiple levels and involves one or more sensors for seed filling.

Maybe there is a total level of both proteins and lipids programrned into the

sensors, such that protein and lipid levels are adjusted to fiIl the seed for this

predetermined amount of space and starch accumulation is repressed. If

protein and lipid levels cannot be modified to accommodate any changes in

the seed, the default pathway, starch production, takes over to make up the

difference but has a maximum production capacity. This might explain the

shrunken phenotype of ssel, as there was not enough starch production to

compensate for the complete absence of protein bodies and the dramatic

decrease in oil bodies (Lin et al., 1999).

However. decreasing the level of a specific seed storage component

may not necessarily affect other components. When B. napus was

transformed with an antisense gene for CruA (encoding a cruciferin), the total

protein and lipid levels did not differ significantly but an increase in napins

(2s albumins) was observed (Kohno-Murase et al.. 1995). Similady, when B.

napus was transformed with an antisense gene for NapA (encoding a napin),

an increase in cruciferins was observed, with no change in total protein or

lipid levels (Kohno-Murase et al., 1994). However, these authors did find that

the fatty acid composition of the lipids had changed. So it appears the plant

can control the levels of seed macromolecules, as well as the composition of

the macromolecules. So there must be regulation of proteins and lipids within

Introduction 20

their own biosynthetic pathways that determines their composition. Such a

sensor might control the composition of the proteins and lipids individually.

When one of the seed components changes in composition, the composition

of the other could be rnodified accordingly perhaps due to an interaction

between certain intermediates of the two biosynthetic pathways. If there is a

decrease in total seed storage proteins (al1 classes). this might result in an

increase in total lipids (al1 fatty acids) or vice versa. However, if only one

component of seed storage protein decreases, another seed storage protein

can compensate and lipid levels may remain the same, but the fatty acid

composition of the lipids may change. So if a mutation somehow affected or

bypassed this sensor, than it would be possible to generate a seed with

lower amounts of protein without changing the total lipid content. Starch

content would also remain the same since the sensor would not initiate the

change in protein level and hence would not result in the upregulation of

starch production. This would result in the production of a partially empty

container.

The crucifer Arabidopsis thaliana is considered to be a model plant

system in plant biology. Its small genome size, low abundance of repetitive

sequences, well defined RFLP maps, rapid generation tirne and the

extensive knowledge of its genetics make it a useful tool for plant molecular

genetic analysis. Also, the ease of mutagenesis and transformation make it a

useful system for testing the empty container hypothesis. There are two

Introduction 2 I

classes of seed storage proteins in A. thaliana: the 12s globulins called

cruciferins and the 1-7s albumins also referred to as napins. One of the

major seed proteins in A.thaliana is a family of 125 cruciferins. Cruciferins

are hexameric complexes composed of 6 subunit pairs- one acidic (a) and

basic (B) chain linked by disulphide bonds (Pang et al., 1988). Each pair of

cdp subunits are proteolytically cleaved from the same precursor protein after

disulphide bond formation (Higgins, 1984). Three different precursors exist,

coded for by three different genes: CRA. CR8 and CRC (Pang et al., 1988).

To conform to the community standards for naming genes (Meinke and

Koornneef, 1997), and because the symbol CRC is taken by the crab's claw

mutation, CRA, CRB and CRC will hereafter be termed CRUI, CRU2 and

CRU3.

To determine the validity of the 'empty container' hypothesis, mutants

that are defective in the accumulation of seed storage proteins must first be

identified. In Arabidopsis, several mutants have been identified that cause

similar defects in ernbryogenesis. Two mutations, abi3 (abscisic acid

insensitive) and fus3 (anthocyanin biosynthesis) are defective in the

accumulation of the two major seed storage proteins, the 12s cruciferins and

the 2s napins at both the protein and mRNA levels (Nambara et al., 1995,

Baumlein et a1.,1994). This suggests that AB13 and FUS3 gene products

control seed storage protein expression. However, both mutations cause

pleiotropic effects that show they may regulate the expression of many

Introduction - 7 - 7

different genes associated with seed maturation. Therefore, the use of these

types of mutants in this study would be difficult as more than one gene is

aff ected.

It would be more useful to find a seed storage protein mutant that is

defective in only one class of seed storage proteins that does not affect other

traits that may increase the complexity of experiments and interpretation of

results. Hence, A. thaliana seeds were mutagenized by ethylmet hane

sulfonate (EMS) and screened specifically for a seed storage protein mutant.

A mutant was identified through the examination of seed extracts by SDS-

PAGE as the gel profile of the mutant seeds displayed two missing bands at

35 kDa and 25 kDa. Ssp- 7 (seed storage protein mutant 1) is a recessive,

non-lethal mutation deficient in the accumulation of the 12s cruciferins, with

no other observable phenotypic effects. Since each dB pair of subunits

originate from the same polypeptide precursor, it is most likely that the

mutation only involves one gene. RNA gel blots were performed using RNA

preparations from the siliques of wild type and ssp-1 plants. The blots were

probed for each of the three genes establishing that only mRNA from one

gene, CRU3, was missing in the ssp-1 mutant. Therefore, the mutation must

occur in the CRU3 gene or in a regulatory gene controlling CRU3 expression

(transcription factor). Through the efforts of the Arabidopsis Genome

Initiative (AGI), the CRU3 gene has been sequenced and found to reside on

chromosome 4.

Introduction 23

The objectives of this project were three-fold. First, mapping of the

sçp-l mutation was undertaken to determine if the mutation is allelic to

CRU3. Second, a molecular and biochemical characterization of the mutant

was to be performed. Finally, a major goal was to test the feasibility of the

empty container hypothesis by introducing a reporter gene construct into the

ssp-1 mutant and rneasuring reporter gene expression levels as compared to

wild type.

Materials and Methods 24

Materials and Methods

Seed Lots

Seed lots from Landsberg erecta, Landsberg erecta x ssp-7,

Columbia, Columbia x ssp- 7 and ssp- 7 Arabidopsis thaliana plants were

obtained from Dr. Peter McCourt (University of Toronto).

Sinqle Pot Plantinas of Arabidopsis thaliana

The required number of 4" square pots were filled with freshly mixed

Premier Pro-mix PGX@ professional plug and germination growing medium.

For each type of Arabidopsis thaliana required, 20 seeds were suspended in

1 ml of water and the seeds were spread evenly on the surface of the

prewetted soi1 using a pasteur pipette. The single pot plantings were covered

with plastic wrap and vernalized at 4 ' ~ for 3-4 d prior to transferring the pots

to room temperature under white light (16 h photoperiod) at room

temperature (RT) for germination and growth.

Isolation of Seed Proteins

Crude seed protein extracts were made from the seeds of mature

plants. Approxirnately 100 seeds were ground in a Kontes mini-homogenizer

tube and pestle in 75 ul of denaturing buffer (2% SDS, 0.7'/0 P-

mercaptoethanol, 40 mM Tris pH 8.6, 17% glycerol) at 1 0 0 ~ ~ for 3-4 min.

The seed protein extract was clanfied in a ~orvall" MC-12 microfuge at

12,000 rpm for 2 min and the clarified extract was stored at -20 '~ until use.

Materials and Methods 2s

Quantitation of Seed Protein Levels

Seeds were collected from dry siliques of single pot plantings of

Columbia, Landsberg erecta and ssp-7 Arabidopsis thaliana plants. One

week was allowed for after-ripening to occur and seed protein extracts were

made from counted (100 seeds) and weighed seeds (-15 mg) from each

ecotype and ssp-7. Seed protein levels in these extracts were quantitated by

the Lowry assay (Lowry et al., 1951). Aliquots of 5, 10 and 15 pl of each

seed protein extract were taken and the volume was adjusted to 100 pl with

sterile deionized water. Seed proteins were precipitated in 5 volumes (500 pl)

of cold acetone at -20'~ for 1 h. The proteins were pelleted in a microfuge

at 4 ' ~ and washed with 90% cold acetone, air dried, then resuspended in 0.5

ml of 2% Na2C03 in 0.1 M NaOH. Another microfuge tube with 0.5 ml of 20h

NapCOa in 01 .M NaOH was used as a blank. The samples were left standing

for 30 min with occasional vortexing. During this incubation time, 10 ml of

reagent 2 was made (9.6 ml 20h Na2C03 in 0.1 M NaOH, 192 pl 1%

potassium tartrate, 192 pl of 0.5% CuSO$. Before adding 0.5 ml of reagent

2, it was incubated at RT for 10 min. After reagent 2 was added, the

samples were incubated at RT for 10 min with occasional vortexing. The

addition of 100 pl of Folin reagent and incubation at room temperature for 30

min resulted in color development. The absorbante was measured at an

optical density of 700 nm in a LKB Biochrom Ultrospec II UVhisible light

spectrophotometer. This experiment waç repeated three times giving three


sets of data for each volume of seed extract used. A t-test was done

according to Sokal and Rohlf (1987) to test the difference in means between

results for ssp-1 and Ler or ssp- 7 and Col.

Isolation and Quantitation of Seed Starch Levels

Seeds were collected from dry siliques of single pot plantings of

Columbia, Landsberg erecta and ssp-7 Arabidopsis thaliana plants. One

week was allowed for after-ripening to occur and seed starch extracts were

made from counted (100 seeds) and weighed seeds (-15 mg) from each

ecotype and ssp-7. The protocol from Tissue and Wright (1995) was modified

as follows: The weighed or counted seeds were placed in Kontes mini-

homogenizer tubes and frozen in liquid nitrogen then ground into a fine

powder. The tubes were transferred from liquid nitrogen to ice and 1 ml of

l2:3:l MCW (methanol, chloroform, water) was added to each tube. The

tubes were shaken for 10 min, then spun for 10 min at 4 ' ~ . The supernatant

(soluble sugars) was decanted and 1 ml of l2:3:l MCW was added to each

of the tubes containing the starch pellet. The tubes were shaken and

centrifuged as before and the supernatant was discarded again. The starch

pellets were air dried overnight in a fumehood. In the fumehood, 1 ml of 35%

perchloric acid was added to the dry starch pellets. shaken and left to sit for

1 h to digest polysaccharides into sugars. The tubes were spun and the

supernatant not containing the starch was transferred to an 8 ml çtarstedt

tube. A series of tubes containing 0, 0.2, 0.4. 0.6, 0.8 and 1 mg of glucose


(from a stock solution of 1 mg/ml) were used as a standard. After the addition

of 1 ml of 5% phenol, the tubes were vortexed briefly and 5 ml of sulfuric acid

was added to each tube. The tubes were vortexed and allowed to sit for 5

min to develop color. The absorbance of 1 ml from each tube was measured

at 490 nm. A t-test was done as before for protein levels comparing results

for ssp-1 and Ler or ssp-1 and Col.

Germination and Growth of Arabido~sis thaliana for Screeninfi plants

For each of the two crosses, Columbia x ssp-7 and Landsberg x ssp-

1, 80 seeds were counted and surfaced sterilized through a series of wash

solutions: 30 min in sterile deionized water, 5 min in 95% ethanol, 5 min in

10% bleach, 0.05% SDS and 5 washes of sterile deionized water. The

seeds were plated ont0 100 x 25 mm deep petri dishes of growth media (GM:

lx MS salts (Murashige and Skoog, 1962), 0.5 g/L MES pH 5.7, 30 g/L

sucrose, 0.1 mg/ml myoinositol, 1 uglml thiamine, 0.5 ug/ml pyridoxine, 0.5

uglul nicotinic acid, 0.8O/0 phytagar). The plates were wrapped in foil,

incubated at 4% for 3-4 days, then transferred to a tissue culture incubator

(16 h photoperiod with white light, 25'~). One week after germination,

individual seedlings were transferred to Kord cells filled with Premier Pro-mix

PGP growing medium.

Screeninq of individuals of Crosses

Each F2 seedling was grown to maturity and seeds were collected

from their mature, dry siliques. Seed protein extracts were made from the

Mate rials and Methods 28

seeds of each individual plant as described above. These seed extracts

were subjected to electrophoresis in a 15% polyacrylamide gel by SDS-

PAGE (Sambrook et al., 1989) at 100 V for 2 h in SDS-PAGE running buffer

(0.02 M Tris pH 7.5, 0.2 M Glycine, 0.1% SDS) using a BioRad mini-2D gel

apparatus. The polyacrylamide gel was fixed in destain solution (9% acetic

acid, 25% rnethanol) for 10 min, stained in 0.5% Coomassie brilliant blue in

destain for 1 h, then destained overnight. The gel was then dried in a Novex

Dry EaseTM mini-gel dryer using Novex Gel Dtynf drying solution.

Isolation of Plant DNA

Single pot plantings of each Col x ssp-7 and Ler x ssp-7 F2 progeny

that displayed the ssp-7 gel phenotype, as well as parental Col and Ler

ecotypes and ssp-1 were made and used for DNA preparations. These

plants were allowed to bolt and DNA was isolated before they formed

siliques. Each plant from a single pot was rernoved gently from the soi1 and

washed thoroughly with water to remove any residual soil. The protocol for

maize DNA miniprep by Dellaporta et al. (1985) was scaled up as follows:

After plants were frozen in liquid nitrogen, a mortar and pestle were used to

grind the plants into a fine powder. The powder was poured into a Servall'"

Omnimixer homogenizer tube containing 15 ml of extraction buffer (100 mM

Tris-HCI pH 8.0, 50 mM EDTA pH 8.0, 500 rnM NaCI, 10 mM P-

mercaptoethanol) at 65'~. The cells were homogenized by grinding with the

Omnimixer at medium speed for 20 s, then mixed with 1 ml of 20% SDS in a


stenle Falcon 50 ml conical tube. The tubes were shaken vigorously to mix

the contents and were incubated at 65'~ for 10 min. The tubes were

transferred to ice and 5.0 ml of 5 M potassium acetate was added. The

contents of the tubes were mixed thoroughly and then incubated on ice for 20

min. The extracts were transferred to 30 ml Corex tubes and centrifuged in a

Dupont ~orvall' RC 5C Plus centrifuge at 9,000 rpm in a HB4 swinging

bucket rotor. The supernatant containing the DNA was filtered through

~iracloth' (Calbiochem) into a 30 ml Corex centrifuge tube containing 10 ml

of isopropanol. The samples were mixed and incubated at - 2 0 ' ~ for 30 min,

then centrifuged at 9,000 rprn for 15 min to pellet the DNA. After discarding

the supernatant, the pelleted DNA was resuspended in 750 pl of 10X TE pH

8.0 (100 mM Tris, 10 mM EDTA) and centrifuged to remove any insoluble

debris. The supernatant was transferred to a clean sterile 1.5 ml Eppendorf

tube. The DNA was precipitated by the addition of 75 pl of 3 M sodium

acetate pH 5.2 and 500 pl of ethanol, then pelleted in a microfuge at 12,000

rprn for 30 S. The DNA pellet was washed in 80°h ethanol, vacuum dried in a

Savant SVCl O0 speed vac and resuspended in 200 pl of 1 X TE pH 8.0 (1 0

mM Tris, 1 mM EDTA). In order to check the quality of the DNA preparation,

a 1 pl aliquot of each DNA sample was digested with 1 pl EcoRl (Gibco), 1 pl

RNase (1 mglml) and 2 pl React 3 buffer in a total volume of 20 pl at 37'~ for

1 h. The digests were then electrophoresed on a 0.goA agarose gel in 0.5X

TBE (45 mM Tris, 45 mM boric acid and 1 mM EDTA) using a BioRad mini-


gel electrophoresis apparatus for 1 h at 100 V and visualized by staining with

ethidium bromide.

For PCR amplification, DNA was made from single leaves of plants.

Following the protocol of Mckinney et al. (1995), a young leaf approximately

0.5 cm wide was ground briefly in a Kontes mini-homgenizer tube with a

pestle. Following the addition of 100 pl of freshly prepared extraction buffer

(50 mM Tris-HCI pH 8.0,200 mM NaCI. 0.2 mM EDTA, 0.5% SDS, 100 pg/ml

proteinase K), the leaf was ground again and the homogenate was incubated

at 37'~ for 30 min. The leaf DNA was then extracted with 50 pl each of

phenol and chloroform-isoamyl alcohol (24: 1 ). DNA precipitation was

facilitated by using 0.1 volumes of 3 M sodium acetate pH 5.2 and 2 volumes

of cold 10O0/0 ethanol and incubating on ice for 15 min. The DNA was

pelleted in a microfuge at 12,000 rpm for 3 min, then washed twice with 70%

ethanol and vacuum desiccated in a speed vac. The dried pellet was

resuspended in 100 pl of 1 X TE.

Southern Blottiri-F2 - Individuals

Genomic DNA (-5-6pg) was digested with EcoRl in a total volume of

30 pl. Samples were electrophoresed on 0.9% agarose gels with a h Hind III

marker at 100 V until30 min after the bromophenol blue dye had run off the

gel. The Dupont Genescreenm salt transfer protocol was used for the

transfer of the DNA from the gel to the hybridizaüon transfer membrane. The

gel was trimmed and measured, then agitated in 0.25 N HCI for 10 min. A

Materials and Methods 3 1

piece of Genescreenm was cut to the same size then prewet in 10X SSC

(1.5 M NaCI, 0.1 5 M sodium citrate pH 7.0) for 15 min. The gels were rinsed

in deionized water then incubated in GenescreenThL denaturant (0.4 N NaOH,

0.6 M NaCI) for 30 min with gentle rocking. The gels were washed twice with

GenescreenTM neutralizer (1.5 M NaCI, 0.5 M Tris-HCI pH 7.5) for 15 min

each with gentle rocking. Whatman 3MM paper and paper towels were cut

to the same size as the gel and a longer piece of 3MM to serve as the wick.

The capillary blot device (Sambrook et al., 1989) was set up using 10X SSC

as the transfer solution and left overnight. After the transfer was completed,

the membrane was removed and agitated in 0.4 N NaOH for 1 min,

neutralized in 0.2 M Tris-HCI pH 7.5, 1X SSC (0.1 5 M NaCI, 0.015 M sodium

citrate pH 7.0) for 1 min then baked for 2 h in vacuum oven at 80 '~ .

Probes and Hvbridization

The Arabidopsis mapping set (ARMS) are subcloned DNA markers

that detect restriction fragment length polymorphisms (RFLPs) in Ler versus

Col after EcoRl digestion. A chromosome 4 specific sequence, ARMS d l 04C

(CD3-71) (Fabri and Schaffner, 1994) was used as the probe for

hybridization and was made according to standard random oligonucleotide

labeling protocol (Feinberg and Vogelstein, 1 983) using (CX~~P) -~CTP and

was added to 0.62 mg/ml of salmon sperm DNA in 5X SSC to serve as a

competitor. After prehybridization of the blot in a Hybaid bottle containing

50% formamide prehybridization solution (1% SDS, 2X SSC. 10% dextran


sulphate-Na salt, 50% deionized formamide) at 4 2 ' ~ for 1-1.5 h, most of the

prehybridization solution was poured out leaving only 10-1 5 ml to which the

denatured radioactive probe was added. Hybridization was allowed to

proceed overnight at 4 2 ' ~ in a Hybaid Micro-4 Hybridization oven. The blot

was washed for 10 min in each of 2X SSC/0.2% SDS at 4 2 ' ~ ~ 1 X SSC/0.2°/~

SDS, 0.5X SSC/0.20h SDS and 0.2X SSC/O.âO/~ SDS, al1 at 65 '~. The blot

was exposed to a piece of Kodak scientific imaging film (XARQ) with an

intensifying screen at - 7 0 ' ~ for 3-4 days (time varies depending on the

radioactivity) and the autoradiogram was developed.

PCR for SSLP analvsis

DNA from each mutant F2 individual from either cross, one wild type

Fa from each cross, ssp-7 and parental Col and Ler plants were used in PCR

reactions for simple sequence length polymorphism (SSLP) analysis. SSLPs

detect polymorphisms. based on microsatellites. between ecotypes by PCR

and agarose gel electrophoresis. A 1 pl aliquot of template DNA (0.1-0.5 pg)

from each plant was put into a 50 pl PCR reaction of 1 pl of fonvard primer

(10 PM), 1 pl of reverse primer (10 PM), 5 pl of 10X PCR buffer (Gibco), 4 pl

2.5 mM dNTPs, 1.5 pl 50 mM MgCl2 sterile deionized water and 0.5 pl (2.5

units) of Taq polymerase (Gibco). The PCR reactions were topped with 2

drops of light mineral oil (Sigma) and placed in a PTC-1 OOTM Programmable

Thermal Controller (MJ Research Inc.). The following cycling parameters

were used: 1 cycle at 9 4 ' ~ for 2 min, followed by 40 cycles of 9 4 ' ~ for 15 s,

Mate rials and Methods 3 3

5 3 ' ~ for 30 S. 72'~ for 1 min. Extension was then carried out at 72'~ for 5

min. The prirners used were obtained from Research Genetics Inc. and are

listed as follows: nga 8, nga 1139 and nga 11 11 (from Bell & Ecker, 1994).

Table 2 lists the map locations and sequences of the primers. The PCR

products and segregation patterns were visualized on 2-4% agarose gels,

depending on the size of the fragment. For 2-4% agarose gels, the agarose,

0.5X TBE and ethidiurn brornide were ail mixed in a Erlenmeyer flask. The

mixture was heated in a microwave until the agarose dissolved. The flask

with the agarose was placed in a water bath set at 55% for 10-1 5 min before

the gel was poured to eliminate most of the small bubbles produced during

heating .


Table 2. SSLP primers and RFLP probes used in mapping ssp-1

Probe

nga I l l 1

nga 1 1 39

CD3-7 1 (PCITd 1 04)

F- TAGCCGGATGAGTTGGTACC R- m c c l - r G T G r r G C A r r C C

Location (CM) Tel4N = 0.0

1 NIA

Sequence Ex pected bands 7

Location on chromosome 4 given relative to position of Tel4N. The bigger the distance between loci, the greater the chance of recombination by the occurrence of crossing over between them. The O/* of gametes in which recombination occurs is equal to the genetic map distance in centimorgans (CM). The closer two loci are to each other, the greater the probability of the loci segregating together.

Production of DNA constructs

Both the CRU3 gene (Pang et al., 1988) and the PHA gene (Riggs et

al., 1989) were cloned previously in other labs. The vector chosen was

pGPTV-HPT (obtained from Dr. Detlef Bleeker) that contains two selectable

marker genes for kanamycin and hygromycin resistance. Approximately 10

pg of a CRU3 EcoRl fragment was digested with Sal I (Gibco), resolved on a

0.9% agarose slot gel at 100V for 1 h and the 6.3 kb CRU3 EcoRI/Sal I

fragment was cut out with a razor blade and gel purified using the Qiagen

Mate rials and Methods 3 5

Qiax II Gel Extraction Kit. The same amount of vector, pGPTV-HPT, was

also digested with the same enzymes, EcoRl and Sal 1, and the 11.8 kb

pGPTV-HPT fragment was also isolated in the same manner. Similady, the

plasmid, pDR214, containing the PHA gene and the vector, pGPTV-HPT,

were digested with EcoRl and Hind III (Gibco) then electrophoresed on a

0.9O/0 agarose gel. The 2.8 kb PHA fragment and the 1 1.8 kb pGPTV-HPT

fragment were also gel purified using the Qiagen kit. The ligation of CRU3

Sal IEcoRI to pGPTV-HPT Sal IlEcoRl and PHA EcoRllHind III to pGPTV-

HPT EcoRllHind III was performed in a total volume of 20 pl containing 2

units T4 ligase (Gibco) and 4 pl 5x T4 ligase buffer. These ligations were

incu bated at room temperature overnight.

Transformation of E.Coli

Competent E.coli, strain XI 1 -bluet was prepared using CaCI2 and

aliquots were frozen in liquid nitrogen and stored at - 7 0 ' ~ (Sambrook et al.,

1 989). For each construct, two 200 pl aliquots of thawed cells were pipetted

into cold sterile 1.5 ml Eppendorf tubes on ice. With one tube serving as a

control, 8 pl of the ligation was added to the other tube of cells. The tubes

were incubated on ice for 30 min. heat shocked at 42% for 90 s and then

placed in ice for 2 min. After adding 800 pl of LB to each tube, cells were

grown 1 h at 37% in a ab-line" Orbit Environ shaker. Aliquots of 50, 150

and 250 pl were plated on LB + kanarnycin (kan, 50 pglml) and incubated

overnight at 37'~. Randomly picked colonies were used to inoculate 2 ml


minicultures of LB + kan50 and were growri overnight at 3 7 ' ~ in an orbital

shaker at 250 rpm. Plasmid DNA was isolated from minicultures by the

alkaline lysis method (Sambrook et al., 1989). The CRU3 construct was

digested with Sal I and EcoRl and PHA construct with EcoRl and Hind III to

validate the selection of the correct construct.

Transformation of Aarobacterium

The gentamycin resistant Agrobacterium tumefaciens strain GV3101

was obtained from Dr. Peter McCourt. GV3101 was grown in 5 ml of LE3 +

gentamycin (gentJO pg/ml) overnight at 28'~ in the orbital shaker at 250

rpm. A 250 ml Erlenmeyer flask containing 50 ml of LB + gent was

inoculated using 2 ml of the overnight culture and was shaken at 28'~ until

the ODsoo was between 0.5 and 1 .O. The culture was chilled on ice and

centrifuged at 3,000 rpm for 5 min in 2 sterile 30 ml Corex tubes. The

harvested cells were resuspended in 1 ml of ice-cold 20 mM CaCI2 (500 pl

per tube), then 0.1 ml aliquots were transferred to pre-chilled 1.5 ml

Eppendorf tubes. These cells were frozen in liquid nitrogen and stored at -

70'~ until used.

GV3101 was transforrned by the direct freeze-thaw rnethod (An et al.,

1988) with 1 pg of either the CRU3 and the PHA constructs. Aliquots of 50,

150 and 200 pl were plated on LB + gent (10 pg/ml) + kan (50 pglml) and

incubated at 28'~ for 2-4 days. The Agrobacterium colonies were used to

inoculate minicultures of 2 ml of LB + gent + kan. These cultures were


assayed for the correct constructs by the plasmid quick screen procedure

based on the alkaline lysis procedure (An et al., 1988). Approximately 1 ml

of each culture was transferred to a separate 1.5 ml Eppendorf tube and

centrifuged for 30 S. After discarding the supematant. the bacterial pellet

was resuspended in 0.1 ml of ice cold solution 1 (4 mg/ml lysozyme, 50 mM

glucose, 10 mM EDTA, 25 mM Tris-HCI pH 8.0) and incubated at RT for 10

min. A 0.2 ml aliquot of solution 2 (1% SDS. 0.2 N NaOH) was added to

each tube and the tubes were shaken gently. After incubating at RT for 10

min, 30 pl of phenol equilibrated with solution II was added to each tube,

then gently vortexed. Next. 150 pl of 3 M sodium acetate, pH 4.8 was

added to each tube and the tubes were stored at -20°C for 15 min. The

tubes were centrifuged for 3 min and the supematant was transferred to a

new Eppendorf tube. The tube now containing the supernatant was filled

with ice-cold 95% ethanol, mixed by inversion and stored at -80°C for 15

min. As before, the supematant was collected after centrifugation. To each

tube, 0.5 ml of 0.3 M sodium acetate, pH 7.0 was added then filled with ice-

cold 95% ethanol. The tubes were incubated at -80°C for 15 min and

centrifuged as before. The supernatant was discarded and the pellet was

washed with ice-cold 70% ethanol then briefly dned in a vacuum dessicator.

The dry pellet was resuspended in 50 pl of TE. A 5 pl aliquot from each tube

was used in diagnostic restriction digests.

Materials and Methods 3s

Arabidopsis transformation

Twenty ssp-7 seeds were surfaced sterilized and plated on GM as

before, then transferred to soil. Once the bolts began to emerge from the

plants they were cut to promote secondary growth. Four days after clipping,

a 5 ml LB + gent + kan of Agrobacterium containing the correct construct was

started and was grown for 2 days at 2 8 ' ~ in the orbital shaker. One day

prior to infiltration, 300 pl of the 5 ml culture was used to inoculate a 300 ml

culture. The cells were harvested at 5,000 rpm for 10 min and resuspended

at an ODsoo of -0.8 in 3 volumes of infiltration medium ( 0.5X MS pH 5.7,

5.0°h sucrose, 1X 65 vitarnins, 0.044 pM benzylaminopurine, 0.03% Silwet

(Lehle seeds) (Bent and Clough, 1997). The Agrobacterium culture was then

placed in a 1 L beaker and ssp-7 plants were inverted into the solution,

stems and rosette leaves fully submerged for 4 min. The plants were

removed from the solution and placed on their side in a plastic flat and

covered with saran wrap. The plants were uncovered and set upright the

next day and allowed to grow. To increase transformation efficiency, these

plants were redipped into Agrobacterium harboring the correct construct

suspended in infiltration media (as done before) 2-6 days after the initial

transformation. These Agrobacterium infected plants were allowed to grow

and mature. The seeds were harvested frorn dry siliques and stored at RT in

labeled Eppendorf tubes.


Selection of transformants

Approximately 150-200 seeds from each of the Agrobacferium

infected plants were counted and surface sterilized in 20°h bleach, 0.1 % SDS

for 1 min, 7OoA ethanol, 0.1% SDS for 5 min and then washed 4-5 times in

sterile water. The seeds were resuspended in 400 pl of sterile deionized

water and transferred to a 100 x 15 mm hygromycin selection plate (0.5X

MS, 5 mM MES pH 5.7. 15 pglml hygromycin b). To spread the seeds evenly

over the surface of the media, 0.8% agar was used. After solidification of the

top agar, the plates were wrapped in foi1 and the seeds were vernalized for 4

days at 4 ' ~ . The plates were then transferred to the TC incubator and

allowed to germinate. Seedlings susceptible to hygromycin germinated but

soon becarne bleached and died. The dark green hygromycin resistant

seedlings that formed true leaves and had roots penetrating into the agar

were transferred to soil. These resistant seedlings (Tl generation) were

grown to rnaturity and their seeds harvested.

lmmunoblottinq

An immunoblot was performed to examine PHA levels in bean seed

protein extracts and wild type Arabidopsis thaliana extracts (previousl y made

in the lab of Dr. Riggs). Seed protein extracts were made frorn the seeds of

PHA transformants and a second immunoblot was done using a few of these

seed protein extracts to confirrn successful transformation. Initially, the

samples were run on a 15% polyacrylarnide gel by SDS-PAGE in duplicate at


100 V until the protein dye was run off the gel. Half the gel was fixed.

stained, destained and dried. The other identical half was used for an

immunoblot. Using a BioRad mini-gel apparatus. the proteins were

transferred to a piece of nitrocellulose (BioRad) at 100 V for 1 h in cold

transfer buffer (25 mM Tris, 192 mM glycine. 15% methanol). Upon

completion of transfer, the nitrocellulose was transferred to a small (100 ml)

plastic container containing 50 ml of 3% gelatin in 1X TTBS (20 mM Tris pH

7.5. 0.5 M NaCI, O.lO/~ Tween 20) and was incubated for 30 min on a rocker

platform. The plastic container holding the blot and gelatinmBS solution

was transferred to 4 ' ~ ovemight. The next day, the gelatin was liquefied by

placing the container in a 37% waterbath for 5 min. After discarding the

gelatinfiTBS solution. 30 ml of 1% gelatin, 1X TTBS and 10 pl of rabbit

antibody raised against ?HA (1 :3000), designated 880-4 was added (Voelker

et al., 1987). The primary antibody reaction was carried out for 1 h with

gentle rocking, then the blot was washed 4 times with 1X TTBS. Another 30

ml of 1% gelatin in 1 X TTBS was added to the blot with 10 pl of blotting

grade affinity purified goat anti-rabbit IgG conjugated to alkaline phosphatase

(1 :3000) (BioRad). The secondary antibody was incubated with the blot for 1

h, then washed 4 times with 1X TTBS. Developer (0.1 M Tris-HCI pH 9.5,

0.1 M NaCI, 50 mM MgCI2 containing 44 pl of 75 mglrnl nitroblue tetrazolium

chloride (NBT) and 33 pl of 50 mglml 5-Bromo-4-chloro-3-indolyl phosphate

p-toludine salt (BCIP) was made and added after decanting the TTBS. Once

Materials and Methods -41

colored bands were visible, the developer was discarded and the blot was

washed 4-5 times with 1X TE. The immunoblot was then air dried on

Whatman 3MM paper and sealed in a plastic Seal-a-mealJ bag.

Screeninq for Homozvqotes

Approximately 100 seeds of each PHA T2 generation plants were

surface sterilized in 95% ethanol for 5 min. The ethanol was discarded using

a pasteur pipette and the seeds were vacuum dried in a speed vac. The

dried seeds were plated on separate hygromycin selection plates for each

plant. After vemalization of the seeds for 4 days at 4 ' ~ . the plates were

transferred to the TC incubator. The seeds were allowed to germinate and

grow until the seedlings formed true leaves. Six of the healthiest looking

seedlings for each PHA transformant were transferred to soi1 and allowed to

grow to maturity. Each plant was given a designation and seeds were

hanrested from each plant. T2 generation seeds from each of theçe T2

plants. about 100-300 seeds, were surfaced sterilized and plated on

hygromycin selection plates as before. A homozygote containing one

transgene locus would produce offspring, al1 of which would be resistant to

hygrornycin. Once a homozygote was found, that seed lot was used to grow

plants for DNA preparations and crossing.

TA cloninq

The nucleotide sequence of the wild type CRU3 gene has been

determined (Pang et al., 1988). Primers were designed such that the mutant


(ssp-7) cru3 gene could be amplified in two ovedapping sections (made by

Cortec DNA Services Laboratones Inc., see Fig 6, Table 3). Primers 2 and

10 amplified a 2kb fragment of the gene while 9 and 12 amplified a 1.5 kb

fragment (see Table 3 for primers). Using a 1 pl aliquot of a ssp-1 leaf DNA

preparation as template DNA, 50 pl PCR reactions were set up as before

using pairs of primers: CRU3 2.11 0 and CRU3 9/12. Each PCR product was

then ligated into pCR2.1 "sing an lnvitrogen TA cloning kit. One ShotTM

cells provided in the kit were transformed with the ligation mix and plated on

2xYT + ampicillin (50 pg/ pl) + color substrate (300 pl 2xYT, 8 pl of 200 mM

IPTG, 50 pl of 20 mglm1 X-GaVplate). Colonies were used to inoculate 2 ml

mini-cultures of 2xYT + ampicillin which were shaken at 37'~ overnight.

Mini-lysate preparations were subjected to cleavage with EcoRl then

visualized on an agarose gel stained with ethidium bromide to ascertain if the

correct inserts were obtained.

Larcie Scale Plasmid DNA Pre~aration

Once the correct constnict was identified, the remaining 1 ml of

culture was used to inoculate 200 ml of 2xYT + amp50. The culture was

shaken at 37'~ overnight. The next day, cells were harvested into two 40 ml

polypropylene centrifuge tubes in a Dupont ~orvall" RC 5C Plus centrifuge at

6,000 rpm for 5 min. This step was repeated until al1 the cells were

harvested. The following procedure is based on the alkaline lysis large scale

plasmid preparation (Sambrook et al.. 1989). The harvested cells in one tube


were resuspended in 4 mi of 50mM glucose, 1 mM EDTA pH 8.0, 10 mM Tris

pH 8.0 by vortexing then transferred to the other tube to resuspend the

second pellet. Two volumes of freshly made 0.1% SDS, 0.2 M NaOH was

added to the tube and mixed gently by inversion. After incubation on ice for

5 min, 1.5 volumes of 3 M potassium acetate, 1 1.5% acetic acid was added,

gentiy mixed and the tube was incubated on ice for another 5 min. The lysed

cells were spun at 8,000 rpm for 10 min then the supematant was filtered

through a piece of ~iracloth" (Calbiochem) into a new 40 ml polypropylene

tube. The tube was then filled with absolute (10Ook) ethanol and nucleic

acids were allowed to precipitate on ice for 15 min. The precipitate was

pelleted at 8,000 rprn for 5 min and resuspended in 10 ml of 1X TE pH 8.0.

RNA was precipitated using 2 g of ammonium acetate and incubating on ice

for 15 min. The RNA was then sedimented at 8,000 rpm for 5 min. The

supernatant was poured into a clean 30 ml Corex centrifuge tube and filled

with 100% ethanol. After 15 min on ice, the tubes were spun at 8,000 rpm

for 5 min. The DNA pellet was resuspended in 4 ml of 1X TE pH 8.0 and

extracted twice with one-half volume of phenol and chloroform-

isoamylalcohol (241). The plasmid DNA was precipitated on ice for 10 min

using 0.1 volumes of 3M sodium acetate pH 5.2 and 2 volumes of 100%

ethanol. After the DNA was collected at 5,000 rprn for 5 min and washed

twice with 70% ethanol. the pellet was vacuum dried in a speed vac and

resuspended in 400 pl of 1 X TE.

Materials and Methods u

Autosequencincr Preparation of DNA

DNA sequencing was performed by the Core Molecular Biology

Facility at York University and Cortec at Queen's University. The modified

minilysate preparation of DNA from the large scale plasmid preparation was

used to prepare the DNA for sequencing. A volume containing approximately

15 pg of DNA was pipetted into a 1.5 ml Eppendorf tube and the volume was

adjusted to 100 pl with sterile deionized water. After 5 pl of RNase A (1

mglml) was added, the DNA was incubated at room temperature for 10 min.

A volume of 2.5 pl of 20% SDS and 2 pl of proteinase K (20 mg/ml) was

added and the DNA was incubated for 15 min at 5 5 ' ~ . The sarnples were

extracted twice with one-half volume of phenol and one-half volume

chloroform-isoamyl alcohol (24:l) and once with an equal volume of

chloroform-isoamyl alcohol (243). The DNA was precipitated at room

temperature for 15 min after the addition of 0.1 volumes of sodium acetate

pH 5.2 and 2.5 volumes of 100% ethanol. After spinning at 12,000 rpm in a

microfuge, the pelleted DNA was washed twice with 70% ethanol, vacuum

dried and resuspended in 25 pl of sterile deionized water. A 10 pl aliquot

was diluted (15X) with 140 pl of sterile deionized water. A 5 pl aliquot of the

diluted DNA was used for a test digest and the rest (1 45 pl) was used to take

OD readings at 260 nm and 280 nm using quartz cuvettes. Since a

0D26d0D280 ratio of 1.8 is equivalent to pure DNA, only samples with ratios

greater than 1.7 were used for autosequencing. Universal primers in the


multiple cloning site and gene specific primers were used to amplify up to

500 bp of both ends of each fragment.

Subcloninq and Analvsis of the SSD-1 CRU3 semence

The restriction maps of each fragment were known from the wild type

sequence (Genbank). The orientation of the fragments was determined by

diagnostic digests with Spe I for CRU3 2/10 and Bam HI for CRU3 9/12. Spe

I and Hind III fragments were cut out of the plasmid cariying CRU3 2/10 and

the vector was religated and used to transform subcloning efficiency DH5a

Ecoli cells (Gibco). The first 500 bp of each subclone was sequenced as

before, using universal primers in the multiple cloning sequence. The last

section of CRU3 2/10 required the production of primers for sequencing. The

last section of CRU3 9/12 was sequenced by cutting out a Barn HI fragment.

The fully sequenced ssp-7 mutant CRU3 gene was compared to the wild

type CRU3 gene using the MacVector program.

Crossina PHA homozvqote to Wild Tvpe Arabidopsis thaliana

Single pot plantings were made of each potential homozygote and of

wild type Columbia plants. A bud that has yet to flower of a Col plant was

chosen and any other interfering parts of the plant such as other buds,

leaves and siliques. were cut from that stem. The bud of the wild type plant

was carefull y dissected under a dissecting microscope using watch maker's

forceps, leaving only an undamaged carpe1 (stigma. style and ovary). The

anthers of a slightly open flower from one of the putative homozygotes was


then dissected and used to dust fine yellow pollen ont0 the stigma. The

cross was then marked with a label on a piece of sewing thread tied loosely

at the base of the carpel. If the cross was successful, a silique would f o m in

a week. When the silique was dry, the seeds were collected. The seeds

were plated on hygromycin selection media and the seedlings were

transferred to soil and allowed tu self. The F2 seeds were plated on

hygromycin selection media and segregation data was examined. The

hygromycin seedlings were transferred to soil from plates and segregation

ratios of hygromycin resistant to hygromycin susceptible seedlings was

recorded. DNA was isolated from the mature plants and these DNA

preparations were used in Southern blot analysis of the progeny frorn the

cross using a P"-radiolabeled 0.8 kb Xba IIEcoRV piece of PHA as a probe.

PHA Levels in Transqenic Plants

Crude seed protein extracts were made from the seeds of

homozygote PHA transformants and the homozygote backcross. These

extracts were run on a 15% polyacrylamide gel by SDS-PAGE, along with a

standard of 10 ng, 25 ng, 50 ng and 100 ng of PHA (Boehringer Mannheim).

An immunoblot was performed and the blot was probed with the 880-4

antibody (refer to section on immunoblotting). The immunoblot was analyzed

using a Bio-Rad Model GS-700 lrnaging Densitometer and Bio-Rad Multi-

AnalystTM software. The known concentrations of PHA were used to

generate a standard curve. When analyzing the samples, the same area


was measured in al1 lanes and the values were adjusted for local

background. Most lanes had several bands appearing at lower molecular

weights than the band for purified PHA. These were processing products of

?HA and were still indicative of PHA expression. The same size

densitometry window (area measured) was used to analyze al1 lanes of a

single blot and included bands from these processing products. The levels of

PHA present in each lane (analyzing al1 bands in a single lane) were

estimated by cornparison to the standard.

Results -18

Results

Preface

Ssp-1 is a mutant, identified from an EMS mutagenized seed lot. It is

defective in the accumulation of one of the 12s cruciferins. The misçing

protein is usually represented by two bands that are absent in the gel profile

from SDS-PAGE of ssp-llssp-7 seed extracts (Figure 1). Three genes,

CRUI, CRU2 and CRU3, encode precursors that are cleaved into the a and

p subunits of the cruciferin. Previous studies show that only the CRU3

transcript is missing in ssp-7 plants. The CRU3 gene has been cloned,

sequenced and mapped to chromosome 4. near cer2.

Figure 1. SDS-PAGE of seed extracts from various Fa individuals from crosses behiveen ssp-1 and Col or Ler. The ssp-1 mutation is visualized in its gel profile as two missing bands at 35 kDa and 25 kDa. Wild type and ssp-1 gel profile are marked and other lanes are Fps from crosses. Only the second to last lanes on each side show the mutant profile.

Results -19

Bioc hemical Characterization of ssp-7

In order to generate an empty container to test the 'empty

container' hypothesis. the mutant must have significant reduction in the total

amount of storage protein within the seed. To ascertain how much of the total

seed storage protein the missing protein constituted, seed protein levels in

seeds of Col and Ler ecotypes, and the ssp-l mutant lines were quantified

using the Lowry assay. The procedure (starting from seed protein extraction

from the same seed lots) was repeated three times for both weighed

(-1 5mg) and counted seeds (1 00) in order to give three sets of data for each

aliquot of extract used. Col and Ler ecotypes exhibited higher protein levels

than the mutant ssp-7 for both weighed and counted seed protein extracts

(Figure 2). However, the results from the counted seed protein extract gave

lower standard deviations between the three trials for al1 plants and hence

rnay be considered to be more accurate (Figure 28). The reason for this

discrepancy rnay be due to the slight differences in weight of seeds used, as

M.1 mg difference may constitute hundreds of seeds. The weighed seed

extract trials suggest that ssp-7 contains about 79% of the total seed protein

content in Ler seeds and 76% in Col seeds. The protein concentration from

counted seed extracts indicates that ssp- 7 has 870h of proteins in Ler seeds

and 73% of protein in Col seeds. Therefore, ssp-1 has 13-21% less seed

storage proteins than Ler and 24-27% than Col. Results of the t-test show

that for weighed seeds there is no significant difference between ssp-1 and

Results 50

Ler or ssp-1 and Col for 5 and 15 pl but there was a 80°h confidence level

that protein levels in ssp- 1 are significantly different from both Ler and Col for

10 pl. For counted seed thals. only Col and ssp-1 showed significant

differences with 95% confidence levels in protein levels for 5 and 10 pl but

not for 15 pl or between values for Ler and ssp-1. The inaccuracies due to

weighing and also srnail sarnple size can probably account for the lower

confidence levels of the other volumes. Repetition of this experiment to

increase the number of samples would resolve the inaccuracy. Although not

al1 of the trials generated statistically significant differences, the trend is that

ssp-7 appears to have less seed protein than wild type.

To determine if any other seed component levels had also changed,

starch levels in Col, Ler and ssp-7 seeds were also assayed (Figure 3). The

same sampling method used for the protein assay was used. The counted

seed trials gave approxirnately 5 ng starch/seed for Col and -3 ng

starchkeed for Ler and ssp-1 and in weighed seed trials the results were 9%,

1 1 O/O and 10% starch respectively. Although the standard of deviation was

lower in the counted seed trials, results from both sampling methods show no

significant difference in starch content between seeds from Col and Ler

ecotypes as well as ssp-1. This is confirmed by the results of the t-test with a

confidence of 95% that these deviations occurred purely by chance and not

due to any difference between populations.

A previous study done by Majid Ghassemian (Dr. Peter McCourt,

Department of Botany, University of Toronto) on the lipid content revealed

that there were only a few differences in types of lipids produced by ssp-1

seeds as compared to wild type col seeds (Figure 4). There was three times

more 16: 1 cis and an increase in the l8:l fatty acids levels in ssp- 1 versus

wildtype Col seeds (Figure 4). It has been shown that the same soluble

desaturase is responsible for both events (Mazliak, 1994) and resulting

increases in these fatty acids may be a result of the mutant trying to

compensate for lower levels of other fatty acids or the deficiency of 12s

cruciferins in the seed.

Results 5 2

Figure 2.

ul of protein extract used

Comparison of seed protein levels from A.thaliana ecotypes col and ler with a seed storage protein mutant ssp-1. Error bars represent standard deviations from 3 trials for each sample for each aliquot used. A) Protein levels in extracts made from weighed (-15mg) seeds, B) Protein levels in extracts made from counted (100) seeds

Results 53

Figure 3. Cornparison of seed starch levels from AJhaliana ecotypes col and ler with a seed storage protein mutant ssp-1. Error bars represent standard deviations from 12 trials for each plant. A) Starch levels (% starch of fresh weight) levels in extracts made from weighed (-15mg) seeds, B) Starch levels (ngkeed) in extracts made from counted (100) seeds

Results

Figure 4. Previous lip composition of the lip

d anelysis of col and ssp-1 seeds showing d fraction from the seed.

Results 55

Screeninqfor F2 - SSD-1 mutants

In order to map the ssp-1 mutation, molecular mapping strategies

were employed using both RFLP and SSLP technologies. The original ssp-1

mutant, created in a Ler genetic background, was crossed to a different

ecotype, Col, resulting in a jumbling of markers such that the chromosomes

are a combination of regions from both ecotypes. Therefore, two

populations of plants were screened: Col x ssp-1 and Ler x ssp-7. Crude

seed storage protein extracts were made from the seeds of F2 individuals

from both crosses. These seed storage protein extracts were analyzed by

SDS-PAGE for the ssp-1 gel phenotype (Figure 1). Since the mutation is

recessive, a ratio of 3 wild type: 1 ssp-llssp-7 Fa individuals was expected.

Out of 75 plants screened Col x ssp-1 gave rise to 10 mutants (7.5:1 ratio)

and Ler x ssp-7 gave rise to 20 mutants out of 95 plants (4.75:l ratio). Dr.

McCourt tested the germination efficiency of the plants on MS with gibberellic

acid (GA) and found it to be 100%. Deviation from the expected 3:1 ratio

was observed and perhaps environmen ta1 conditions such as heat, humidity

and application of pesticides negatively affected the growth of ssp- 1 mutants.

Once the ssp-llssp-7 F2 mutants were identified, single pot plantings of were

made in order to grow plants for DNA preparations.

The ssp-1 mutation maPs to chromosome 4

Mapping was accomplished by simple sequence length pol ymorp hism

(SSLP) analysis using leaf DNA preparations made from plants grown from

the seeds of F2 mutants, as well as parental Col and Ler plants. Previous

RNA gel blots demonstrated that the CRU3 transcript is missing from the

mutant (Riggs, personal communication). The wild type CRU3 gene has

been cloned, sequenced and mapped to chromosome 4 near cer2 (74.5 CM).

Since the wild type gene is located on chromosome 4, three primers also

located on chromosome 4 were used for SSLP analysis (refer to Materials

and Methods, Table 2). After the primers were used to arnplify the DNA using

PCR, the products were visualized on a high percentage (2-4%) agarose

gels (Figure 5). Two of the primers, nga 8 and nga 1111, gave random

segregation patterns for the ssp-l/ssp-7 F2 mutants (see Table 3). For

primer nga 1139, the ssp-1 mutation segregated with Col for nearly al1 the

mutant ssp- l/ssp- 1 F2 plants, exhibiting a low frequency of recombination. It

is uncomrnon for crossing over to occur between the location of the marker

and the mutation, sa the genetic distance between them rnust be low.

Therefore the marker rnust be located close to the mutant gene, establishing

linkage to chromosome 4, close to the position of 83.14cM (Figure 5).

RFLP analysis was used to confirm the results from the SSLP

analysis. DNA gel blots of EcoRl-digested genomic DNA made from single

pot plantings of F2 ssp1/ssp-I mutants and parental Col and Ler were

hybridized with one of the Schaffner Arabidopsis restriction mapping set

(ARMS) probes, CD3-71 (pCTTdl04) labeled with P~~ (refer to Materials and

Methods, Table 2). The resulting autoradiogram shows bands at 2.6 kb for

Results 57

the Col parent and at 4.8 kb for the Ler parent (Figure 6). Nearly al1 the

mutants gave bands identical to Col confirming the segregation pattern seen

in SSLPs (Figure 6). Again, the genetic distance between the marker (CD3-

71) and the mutant gene must be close enough so that there is infrequent

genetic recombination. The results of the DNA gel blots substantiate the

conclusion from the SSLP analysis: the ssp-1 mutation is Iinked to

chromosome 4. The segregation patterns of each FÎ plant tested are listed

in Table 3. These results indicate that the ssp-1 mutation is located on the

distal arm of chromosome 4, near map position 83 CM. These results have

recently been confirmed by the AGI sequence of a BAC clone containing the

wild type CRU3 gene (Genbank accession no. AL021 749).

Figure 5. SSLP analysis using primers nga 8 and nga 1139. PCR products visualized by ethidiurn bromide fluorescence following agarose gel electrophoresis. Lanes marked Ler contain parental Landsberg erecta DNA and unmarked lanes contain various mutant Fz DNA samples. Analysis with nga 1139 shows the ssp-1 mutation is linked to chromosome 4.

Results 58

- K z: coi x sspl mutants $ ler x ssp l mutants

i & - ' " ' s ; G G 0 0 - O

r+-*

Figure 6. The ssp-1 mutation is linked to chromosome 4. A DNA gel blot of parental Ler, Col and F2 SSP-1 mutant DNA frorn crosses as shown using probe CD3-71. The resulting segregation pattern reinforces findings of the SSLPs that the mutation is on chromosome 4, near 83.33 CM.

Table 3. Segregation Patterns from SSLPs and RFLP of ssp-l mutants L = Ler, C = Col, H = Heterozygous; All markers are located on chromosome 4 where Tel4N=O.

1

t ssp- 7 I C C C C

Individual Primer and Segregation Pattern

L36 L40 L48 L50 L52 L56 L64 L66

L

L67 L75 L79 L82 L9 1 L95

nga 8 24.18 CM

C L H L H C H C

nga 1111 29.64 CM

nga 11 39 83.1 4 CM

C L

not tested not tested

C C

CD3-71 83.33 CM

C L C L H C H C C L


C C

C C

not tested C

not tested C C C

C H C C C

not tested C

not tested H C


C C

H C C C C C

Results 60

The wild Wpe CRU3 gene rescues the ssp-1 mutation

The ssp-1 mutant was transformed with a wild type CRU3 gene using

the vector pGPN-HPT. After selection on hygromycin plates, plants were

grown to rnaturity and allowed to self. Seeds of putative transformants were

collected and used to produce seed protein extracts. These extracts were

analyzed by SDS-polyacrylamide gel electrophoresis (Figure 7). The missing

protein bands at 35 kDa and 25 kDa both reappear in the transformants,

hence the wild type copy of the CRU3 gene rescued the mutation.

transformants 0)

Figure 7. SDS-PAGE of seed extracts from ssp-1 plants transformed with a construct containing the wild type CRU3 gene. The wild type copy rescues the mutation as seen by the reappearance of the 2 missing bands seen in ssp-1.

ssp-7 has a premature stop codon

Since the wild type copy of CRU3 rescues the ssp-1 mutant, the

mutation must exist in the CRU3 structural gene and not in a regulatory gene

controlling CRU3 expression. Therefore, sequencing the mutant gene may

Results 6 1

identify the nature of the mutation. Initially, primers were designed and used

to amplify the mutant CRU3 gene in two overiapping fragments using primer

pairs of 2/10 and 9/12 (Table 4). The PCR amplified fragments were cloned

using a TA cloning kit (Invitrogen) which provides primer sites for

sequencing. The fragments were sequenced from both sides using Ml3

reverse and T7 primers (Figure 8). Sequencing was only reliable up to 500

bp. Therefore, each PCR fragment had to be further subcloned in order to

obtain the full sequence of the CRU3 gene. Figure 8 shows the location of

the restriction sites used to subclone the fragments and additional areas

which were sequenced using primers. The product from primer pair 2/10

was subcloned using Spe I and Hind III, and 9/12 was subcloned using Pst 1

and Bam HI (Figure 8). The first pass sequence revealed two possible point

mutations in the promoter region, and some single base pair mutations and

insertions leading to two possible stop codons. Therefore, the promoter area

and the area containing the first premature stop codon were arnplified using

primers 4/5 and 618, cloned and resequenced (see Figure 8, Table 4). The

second pass sequence revealed no mutations. The rest of the gene was then

resequenced. Figure 8 also shows the subsequent sequencing strategies

such that the whole gene was resequenced to confimi the initial findings.

The gene was amplified using primers 2/5 (1.1 kb product) and 4/12 (2.4 kb

product), cloned and sequenced from both directions. The sequencing was

reliable up to 750bp. The 2.4 kb clone was cut with Cla I and Barn HI

resulting in a 1.3kb fragment which was then subcloned and sequenced. The

mutant gene was found to differ at only one site when compared to the wild

type CRU3 sequence. This single base pair mutation occurs at position

2796, where a guanine is replaced with an adenine in the mutant, turning a

tryptophan codon (TGG) into a premature stop codon (TGA) in the reading

frame. The entire gene sequence is shown in Figure 9.

Table 4. Primers used for PCR amplification of the ssp-1 CRU3 gene for sequencing

Primer Sequence

1 CRU3 1302/1325 5' CAGAGTACCATCTGAAGATCACGG 3'

2 CRU3 203812057 5' CGAACGCTCATGCTAAGCTG 3'

4 CRU3 286312881 5' GACATATGCGGAGAGTGAG 3'

5 CRU3 31 46131 27 5' CAAGTGACTGCCTCGCAAGG 3'

6 CRU3 325613275 5' CCACCCTCAGCTCCGATGTG 3' 1

7 CRU3 377513796 1 5' GTGGAACATGTGAGACGCGGAG 3' I

9

10

1 1

12

CRU3 382513843

CRU3 41 26141 06

CRU3 507615057

CRU3 530915290

5' CCACTGGATCTACAACTCAGG 3'

5' CTATGACCTGTGCGTCGAACC 3'

5' ACAATCTCCTCGATCAACTG 3'

5' GCTCAAGCTACAGTAGATGG 3'

Results 63

1 Spe 1 (2470) Hind 111 (2940) 5 6 Cla 1 (3440) Pst 1 (4315) Barn HL (4750) 11 12

Figure 8. Sequencing strategy for the CRU3 gene in ssp-1. The restriction sites used to subclone the mutant CRU3 gene for sequencing are shown. Arrows show the direction of sequencing. Double arrowheads represent the sequencing of same area but from both directions. Triangle arrowheads represent the first pass sequencing and open arrowheads represent any subsequent sequencing. Primers locations are shown on the map and those used for sequencing are labeled above the arrow (numbers corresponding to CRU3 specific primers are listed in Table 4). BAP3 is a plant homologue of the mammalian prohibitin gene which is associated with antiproliferative activity (tumor suppression) (Snedden and Fromm, 1997).

Results 64

. . . . . . . . . A - > . ~ W < A 7 A . T W T - - ~ . ~ - A T A 7 A 7 - A CA, ' ~ A . : A t Y ? Y T ? ~ M A - A - A - . U T i " - A 7 ; r ' I ' C I 7 W A T A - W A l l j l A : ; - f M * y * Z A Y : > P * f X Y ! l A . L

-AAA -&-?:-A 75-A ;.-A.:M ;-a;;;*7-AA;-rE-MMMA 'M:?:A,:A :M ';TC > X I ' A A < I > ? Z b f M ;=,:A X Y 7 7 * ; ? A ? 7 I A IM > T ; - X ' A E : : r 7 : : ; ; ; d : ; . : ' . ' ! l = : ; ; - : J ' . ' L : ; ; ' : ; r : ; : ~ ; ~ : : p ; ; 7 A

YA 'l?-.l:- -YA:-.;UhïM 777-2 ~ ? . - W : f M T M * . ~ ~ X ~ M T , A - A Sih-rT7-ZF-XA.T7.T7-.I-A i--TA-+'AT.7A ;:.I ~ . . - - : ; : H : T K F E * : ; F ~ T : ~ E : ~ A Y : : : L A : ~ T ; L L ~ A L ? L E :

A 7 h ? M T e - - X A ;A- -+--A>-w,Z.y&..U.-4Y-M ;F '&&-&.&.-A 2 , : T A .-.LX-.- . . A . A. a.. A ----- . r . . A - E X M - M 'MX ;-A- A >:A i A - 7 - . : ; N ; F : : : ? E Z A P C : ~ P - ; : : E - : L : ~ A A : Q : : : . : : : : : . , '

'A >-+-AM?:AAML":. . . . . . . . . . . . . . . A L U ? T A 9 > 7 7 A r C 7 h A T - A I . ' X 7 Y L T A M - - X A - : ? Z W + A . i r ? i f E A '

Figure 9. Wild type nucleotide and amino acid sequence of CRU3 with 1 kb of upstream promoter. The asterisk (*) represents the stop codon. Putative CAAT and TATA boxes are underlined in the promoter region. The polyadenylation signal is also underlined. The mutant version of the gene has a single base pair mutation from guanine (bold, underlined) to adenine at position 2796, creating a premature stop codon.

Resuits 65

A. B.

Arabidopsis bean Arabidopsis bean

-0

Figure 10. Arabidopsis seed do not contain endogenous PHA. Two aliquots of seed extracts from wild type Arabidopsis and from bean were run side by side. The second lane for each sample represents twice the amount of extract used in the first. The first lane is the molecular weight standard. A) Coomassie stained gel 6) Immunoblot. Only bean extracts show the presence of PHA (doublet due to PHA-E and PHA-L).

The emptv container hvpothesis

The second goal of this project was to determine if foreign proteins

can be overexpressed in seed storage protein mutants defective in seed

filling. The Lowry assay demonstrated that ssp-7 seeds contain 20-25% less

protein than wild type seeds and therefore an ssp-1 seed may act as the

'empty container'. To gauge the usefulness of the ssp-7 genetic background

as an empty container, 1 transformed ssp-1 plants with a DNA construct

using a reporter gene encoding phytohemagglutinin (PHA). PHA is a

naturally occurring seed protein native to the bean and hence already has

elements that target this polypeptide to the protein bodies of the seed.

lmmunoblots with seed extracts from bean and wild type Arabidopsis

Results 66

established that wild type seeds of Arabidopsis thaliana do not contain any

PHA (Figure 10). Thus, PHA can be used as a reporter to test the empty

container hypothesis.

Strateciv for testins the hv~othesis

Due to the nature of Agrobacteriummediated transformation, the

transgenes are inserted into the genome at random. Therefore it is

necessary to determine the copy number of the PHA gene in each

transformant in order to be able to compare how much PHA is actually being

produced on a per gene basis. It is also necessary to backcross the

transformants to wild type. Such a cross would eliminate the ssp-1 mutation

and a copy of PHA would exist in a wild type genetic background in the same

chromosornal context and copy number. This is important in order to

compare levels of PHA in the homozygote transformant with the homozygote

backcross and determine if PHA is actually expressed to a greater extent in

the 'empty container'.

Homozvqote transforrnants

Ssp-1 plants were transformed with the PHA construct and 14

transformants (Tl generation) were selected on hygromycin plates, allowed

to self and make T2 seeds. The Tg seeds were then plated on hygromycin

and the T2 segregation ratios were recorded (Table 5). Individual T2 plants

were transferred to soi1 and allowed to mature. The TJ seeds from each

individual were plated on hygromycin and the segregation ratios were

Results 67

recorded (Table 5). A homozygote would be expected to have 100°h

hygromycin resistant offspring. These resistant seedlings were dark green in

color, with roots penetrating the agar and formed true leaves. These plants

were transferred to soi1 and used for DNA preparations for Southern blots to

determine transgene copy number (Figure 11). A sumrnary of results for al1

the homozygote transformants and their copy numbers are listed in Table 5.

The genetic data does not correspond well to the copy number possibly due

to initiai inclusion of ungerminated (inviable) seeds in as hygromycin

susceptible seeds in the calculation of the segregation ratios and exclusion of

green seedlings that may be resistant but did not develop true leaves or have

their roots growing into the media. Another possibility is that since the ratios

were obtained prior to DNA analysis, not enough seeds were screened to

accurately reflect actual segregation patterns as increased copy numbers

also increases the complexity of the genetics.

Results 68

Table 5. Summary of Results for PHA Transformants

RI bands (kb) represents the sizes of the fragments of EcoRl digested DNA hybridizing with the PHA probe. ~ y g ~ = hygrornycin resistance, H ~ ~ ~ = susceptible to hygromycin.

Tl

PHA1

PHA2

T2 Ratio ~ ~ g ~ : ~ y g ~

121

9: 1

T3

(% hyg ) R

89 95 96

T2 individual

A B A

Gene copy #

4

2

R I bands (kb)

4.9, 5.3 7.3 10.9

4.8, 9.4

Resu lts 69

Figure 11. Determination of copy number of PHA transformants. DNA gel blots of homozygote F3 transformant genomic DNA digested with EcoRl and in some cases EcoRüHindlll to verify that the whole transgene was inserted. The inserted fragment containing the PHA gene is the bottom 2.8 kb piece. An 0.8kb EcoRVXbal fragment containing most of the PHA gene was used as a probe. All transformants (PHA designation was omitted from the labels) have more than one copy.

Results 70

Homozvqote backcross

The PHA homozygotes were crossed to the wild type. Columbia. The

FI seeds from the cross were plated on hygromycin and expected to give

100% hygromycin resistant seedlings as each progeny should get at least

one copy of the PHA gene (Table 6). The seeds from individual FI plants

were used to grow up F2 individuals and the segregation ratios were

recorded in Table 6. Aphid infestations, damping off as well as some other

environmental factors played a role in the incompletion of this section of this

research. All plants were successfully crossed, but many of their progeny

died off at various stages leaving only a few crosses left for analysis. Only

crosses for which there is information from the Fz generation are listed in

Table 6. Hygromycin resistant F2 seedlings were transferred to soit and

allowed to self. The Fg seeds collected from ihese individuals were grown on

hygromycin and 100% hygromycin resistance should indicate a homozygote.

Plantings of F3 homozygote plants were grown for the purposes of making

genomic DNA and to collect seeds to make crude protein extracts. Genomic

DNA was made for Southern blots to determine PHA gene copy number

(Figure 12). Again the segregation ratios do not match the copy numbers

seen in the DNA gel blot. The pattern seen in the DNA gel blots from the

backcross homozygote plants matches that of the homozygote PHA

transformants demonstrating that the PHA gene is in the same copy number

and same chrornosomal context.

Results 7 I

Table 6. Summary of Results for PHA Backcrosses

cross

PHA1 backcrossA

PHA7 backcrossA 1 100% 1 2.7:1 1 NIA 1 NIA 1 NIA

P HA4 backcrossA

PHA11 backcrossA

~ y g ~ = hygromycin resistance, ~ y g ' = susceptible to hygrornycin, N A = information unavailable RI Bands are the fragments from EcoRl digested genomic DNA that hybridized with the PHA probe.

FI HygR 100%

PHA assav

Despite the unusual segregation ratios for some of the plants, the

1 00%

100%

results of the DNA gel blots for the transformants and their backcrosses

FZ ratio ~ y g ~ : HygS

1 4.9: 1

seem to indicate that the transformants were homozygotes, as the

3.8:1

1 1.8:1

PHAl 4 backcrossA

generation of the same pattern in the backcross would be otherwise

F3

~ y g ~ NIA

3.7:1 98%

improbable. Since the segregation data does not correspond to gene copy

1 0O0/~ 1 0O0/o NIA

number, the seeds of the hemizygotes were used in the PHA assay to

PHA Copy number

4

NIA

compare expression between the PHA transformants and the progeny of

RI Bands (kb)

5, 5.5, 7.3, 11

4

NIA

their backcross with Columbia. Crude protein extracts were prepared from

4.8, 5.3, 7, 10.8

NIA

NIA NIA

Resul ts 72

Figure 12. PHA copy number in the backcross FI homozygotes. A DNA gel blot was probed with the same 0.8kb EcoRVXbal fragment of the PHA gene that was used for the PHA homozygote transformants. Two individuals from each backcross were analyzed using digestions with EcoRl and EcoRVHindlll. The latter digests gave the expected band at 2.8kb representing the intact transgene.

approximately 100-200 seeds from each individual seed lot. Aliquots of 2 pl

and 4 pl were used to perform a Lowry assay to determine protein

concentration of the crude extracts. An SDS-PAGE was loaded with 20 pg

of protein from each sample as well as known amounts of purified PHA

(Figurel3). An immunoblot of the SDS-PAGE was done and incubated with

the 880-4 antibody (Figure 13). The immunoblots were then analyzed by

densitometry using the known amounts of PHA to create a standard curve.

The PHA levels ranged from 0.5Oh to 1.4% of the total protein in

Resu lts 73

transformants, similar to the levels in the backcrosses of 0.17% to 1.5%.

Since no signal was detected for PHA8, the data obtained for PHA8 and its

backcrosses was not analyzed as no comparison can be made. The

backcrosses of transfomants PHA1, PHA4 and PHAlO al1 exhibited higher

amounts of PHA, whereas results for PHA2, PHA7 and PHAl 1 revealed

higher expression of PHA than seen in their corresponding backcrosses

(Figure 14). An interesting trend has emerged as the former set of plants

have 3 or 4 transgene copies while the latter al1 have only two (Table 5 and

6). The results from PHA7 backcross B may not be authentic as the

cruciferin bands are not seen in the corresponding SDS-PAGE (Figure 13).

The only valid explanation seems to be human error in the preparation of

samples. For many of the sets of plants, the levels of PHA detected did not

differ greatly. Only PHA2 displayed a significant enhancement of PHA

expression (1% of the total seed protein) in comparison to its backcrosses

(0.2% of the total seed protein). Therefore. there is some evidence to support

the validity the empty container hypothesis.

Results 74

Q (II

1A 2 O

. - X U 0 n

m m (II

P X 0 m n 9 x a

Figure 13. Analysis of ?HA expression in primary transformants and their backcrosses. 1A, 2A) Coomassie blue stained SDS-PAGE of 20 pg of crude seed protein extracts run with long, 25ng, 50ng and lOOng of purified PHA (not detected). IB, 28) lmmunoblot of an identical SOS-PAGE gel as seen in 1A and 2A probed with antibody 880-4.

--- - - -- --

% total seed protein - - A

0 R B 8 t L i u e a , PHA1

PHA1 backcross A

PHAl backcross 6

PHA2

PHA2 backcross A

PHA2 backcross B

PHA4

PHA4 backcross

PHA7

PHA backcross A

PHA backcross B

PHA10

PHAI 0 backcross

PHA11

PHAl 1 backcross - - - - - - -- - --- - - - - -- -- -A-

Discussion 7 6

Discussion

Many attempts have been made to genetically enhance seed crops to

increase their agronomic or nutritive value. The limited success of such

experiments may be attributed to the high levels of endogenous proteins of

the seed and a bias toward accumulation of natural reserves. If the seed

could be partially emptied, the void could be filled by foreign or genetically

engineered proteins. This became known as the 'empty container'

hypothesis. This project had three goals: First to map the ssp-l mutation,

second to characterize the mutation at the molecular and biochemical levels,

and third to test the viability of the empty container hypothesis.

In order to validate the hypothesis, a mutant defective in the

accumulation of seed storage proteins must first be identified. Ssp-7 is such

a mutant. Defective in the accumulation of a major seed storage protein, the

12s cruciferin, ssp-7 is missing two bands from its gel profile that represent

the a and p subunits of this protein. Since the subunits are proteolytically

cleaved from the same precursor, only one gene is suggested to be

defective. Previous RNA gel blots conf in that only mRNA from one of the 3

cruciferin genes, CRU3, is missing (Riggs, unpublished results). Therefore,

the mutation exists either in the CRU3 gene or in a regulatory gene

controlling CRU3 expression.

The ssp-7 mutation was mapped by both SSLPs and RFLPs to the

distal a m of chromosome 4 near 83 CM (Tel4N=O). CRU3 has already been

Discussion 7 7

cloned and mapped to chromosome 4, near cer2 (74.5 CM) (Riggs,

unpublished results). Therefore, the mapping data is consistent with a

mutation in the CRU3 gene rather than in a regulatory gene controlling its

expression. When ssp-7 was transformed using a construct containing the

CRW wild type gene, the missing protein bands in the gel profile reappeared

in ail the transformants. Therefore, the wild type gene rescued the ssp-7

mutation, confirming that the mutation exists in the CRW gene and not in a

regulatory gene.

The second goal was the molecular and biochemical characterization

of the ssp-7 mutation. The sequence of the wild type CRU3 gene has

already been detemined. Hence, sequencing the mutant copy may provide

answers as to the exact nature of the mutation as it could be in the promoter

or in the structural gene. The only difference between the wild type and

mutant CRU3 genes. was a single point mutation, in which an adenine

replaces a guanine near the end of the coding sequence of the gene (Figure

9). This transition mutation corresponds to that expected from the method of

mutagenesis (EMS). EMS is an alkylating agent that produces point

mutations but more specifically produces G-A transitions (Ahmed et al.,

1995). Therefore any tryptophan codons in the coding sequence can be

easily mutated, in frame, from TGG to TAG or TGA, with either producing

premature stop codons. This is the case in the ssp-7 cru3 gene that has a

tryptophan mutated to a premature stop codon at position 2796 in the

Discussion 78

sequence (Figure 9). The cru3 transcript in ssp-7 siliques is nearly

undetectable, suggesting that the premature stop codon may be affecting the

stability of the mRNA. The causes for this phenomenon are still not fully

understood, as it is not clear how prernature termination of translation can

cause the destabilization of transcripts. The sarne behavior has been shown

in other plants, such as the Sie4 pseudogene in soybean (Calvo et al., 1997),

the cer2 mutant in Arabidopsis (Xia et al., 1996) and the globulinl nuIl allele

(Glbl -NIHb) in maize (Bhattramakki and Kriz, 1996). It has also been shown

that the PHA pseudogene (Pdlecl) in Phaseolus vulgaris has a lower level of

transcript in transgenic tobacco than wild type, and repairing the frameshift

that causes the premature stop codon returns transcript levels back to

normal (Voelker et al., 1990). More recently, the accumulation of PHA mRNA

was found to be a direct result of the affect of a frarneshift or nonsense

codon on transcript stability (Voelker et al., 1990). Also in soybean, Kunitz

trypsin inhibitor (Kti3) transcripts for the nuIl mutant and wild type gene were

transcribed at the same rate, yet the mRNA for the nul1 mutant accumulated

to greatly reduced levels (Jofuku et al., 1989). This suggests that there is a

pathway that accelerates the decay of mRNA when nonsense mutations

occur within them. This type of pathway has already been found to exist in

yeast. The UPF1 gene encodes a trans-acting factor that accelerates the

degradation of mRNAs that specifically contain a premature stop codon due

to frarneshift or nonsense mutations (Leeds et al., 1991). A homologue of

Discussion 79

UPF1, RENTI, has been identified in mammals and contains the same

functional elements as the yeast gene (Perlick et al., 1996). Although there

is no direct evidence of this in plants, the fact that this pathway exists in other

eukaryotes is compelling. Previous evidence of premature stop codons

occurring at less than 60% of the coding sequence show that these

transcripts are recognized as abnormal and are rapidly degraded (Abler and

Green, 1996). Conversely, premature stop codons found to occur past 80%

of the coding sequence are not subjected to degradation and are translated

as usual (Abler and Green, 1996). If this is correct. then the ssp-1 cru3

transcript should be stable, as the mutation occurs at about 90°h of the

coding region. Although this is not the case, it is still probable that any

requirement for translation of a specific region in order to maintain transcript

stability is already present and more iikely the transcript was degraded by the

aforementioned pathway. It is possible that the machinery for degradation of

transcripts may recognize a cis factor in the last 10% of the mutant transcript

that is normally covered by ribosomes (Abler and Green, 1 996).

Biochemical analysis of the mutation showed that only the seed

protein fraction exhibits a significant difference relative to the wild type seed

protein levels. There was no significant difference in the levels of starch

within the seed for ssp-7, compared ta wild type. Also, the lipid component

of the seeds was analyzed and it was determined that the composition of

lipids was relatively unchanged. Antithetically, the protein fraction differed

Discussion 80

greatly between the ssp-1 and the wild type seeds. If a mutant, such as ssp-

1, is deficient in a major seed storage protein, one would expect to see the

lower levels of total protein that is seen in ssp-1 but the literature contradicts

this assumption. In previous studies, it has been demonstrated that if there

is a decrease in one type of seed storage protein, another type of protein is

overexpressed in order to compensate resulting in unchanged or increased

total protein levels. If a major endogenous seed protein could be repressed

then there may be an increase in other endogenous or transgene proteins.

The absence of lectin in one strain of Phaseolus vulgaris (bean), led to the

overproduction of phaseolin without any decrease in seed size or total seed

protein (Osborn and Bliss, 1985). Sirnilar results where reduction of one

protein fraction resulted in the increase of another, were found in corn, bariey

and soybean (Osbom et al., 1985). In another line of P.vulgaris, a gene for

the protein arcelin was introduced whose expression resulted in a 50%

decrease of phaseolin (Romero-Andreas et al., 1 986). Crosses were made

to create strains where arcelin and PHA genes were expressed in nuIl

phaseolin bean plants (Hartweck and Osbom, 1 997). Elevated arcelin and

PHA levels compensated for the lack of phaseolin without decreasing the

total amount of protein (Hartweck and Osbom, 1997). Finally, there is the

inverse relationship between napin and cruciferin in Brassica napus. The

introduction of antisense genes for either protein resulted in the increase in

the other without affecting the total protein or lipid content (Kohno-Murase et

Discussion 8 I

al., 1994, Kohno-Murase et al., 1995) and fatty acid composition (Kohno-

Murase et al., 1995). These results provide good evidence that some sort of

regulation of seed storage protein composition must exist, perhaps in the

form of a sensor that can detect the levels of macromolecules in the seed. If

abnormal levels were detected, the sensor would somehow modulate

expression patterns of seed components to compensate. The existence of a

sensor may explain, in part, why foreign transgenes are not expressed at

high levels. In addition to positional effects on transcriptional activation. the

transgene mRNA would be in competition with endogenous mRNAs and

would contribute a small percentage to the total which is measure by the

sensor. Also, because these are foreign mRNAs. they may be prone to

degradation. Thus, the transgenic seed may fiIl normally and low levels of

foreign protein could be considered normal.

The ssp-1 mutant is abnormal in that the cruciferins fail to accumulate

to normal levels and there appears to be no obvious increases in the other

proteins, nor in the lipids or starch levels. Hence, ssp-1 is a non-

cornpensating mutant which might have bypassed the sensor mechanism.

Molecular analysis revealed that the ssp-1 phenotype is due to the

introduction of a premature stop codon. Previous RNA gel blot experirnents

showed that there is very little CRU3 mRNA. Together, these results are

consistent with the interpretation that the CRU3 mRNA is unstable, and

suggests that the sensor operates at the level of transcriptional activation.

Discussion

A similar mutant was characterized in soybean. A mutant was found

to be lacking the 7s globulin (P-conglycinin) subunits produced by a single

recessive gene (Hayashi et al., 1998). These authors suggested that the

lack of 7s globulin subunits is not due to any defect in the structural gene but

occurs at the transcript level. either at the level of transcription or it may be

due to rapid degradation of transcripts (Hayashi et al., 1998). However,

transient expression of chimeric genes of 7s promoters and GUS in seeds,

and gel shift mobility assays using soybean embryo extracts both suggest

that transcription factors are present (Hayashi et al.. 1998). The gene was

not cloned or sequenced and hence the exact nature of the mutation is not

known, but this mutant also may provide an 'empty container' and be useful

in improving the quality of soybean.

The third goal of this project was to test if foreign proteins can be

overexpressed in seed storage protein mutants defective in seed filling. To

determine if çsp-1 can be useful as a 'empty container', the amount of protein

that is missing from its seeds must be determined. The Lowry assay

demonstrated that ssp-1 seeds contain less protein than wild type seeds and

therefore may act as the 'empty container'. To gauge the usefulness of the

ssp- 1 genetic background as an empty container, I transformed ssp- 1 plants

with a DNA construct using a seed specific gene from bean called

phytohemagglutinin (PHA) as the reporter gene.

Discussion 83

Only recently has a high level of expression of foreign proteins in

seeds been shown in transgenic experiments. Tobacco has been

transformed with many genes under the control of their own promoters. The

results have been limited as expression levels have been generally low:

0.2% of the total seed protein for soybean lectin (Okamuro et al., 1986).

0.02-0.05% for PHA-L (Voelker et al., 1989), 0.2% -0.9% for PSI lectin (de

Pater et al., 1996) and 0.5% for vicilin (Higgins et al., 1988). Perhaps these

findings were a result of using the genets own promoter which does not result

in high expression or that tobacco seeds cannot tolerate high expression

levels of foreign proteins. However, the maize 15 kD zein was placed under

the regulation of the French bean P-phaseolin gene flanking regions and

expressed in transgenic tobacco. The amount of zein accumulation varied

between 0.02% and 1.6% of the total seed protein (Hoffman et al.. 1987).

Similarly, the coding region of the Brazil nut methionine-rich 2s albumin gene

(18% Met) was also placed under the control of the phaseolin promoter and

in transgenic tobacco increased the levels of Met by 30% in the seed

proteins as compared to that of untransfoned plants (Altenbach et al.,

1989). The Brazil nut protein may represent up to 8% of the total salt-

extractable seed protein in tobacco. The Brazil nut albumin was also

expressed in transgenic canola which accurnulated the protein from 1.7% to

4.0% of the total seed protein and contained and increase of 33% Met

(Altenbach et al., 1992). Sunflower seed albumin is rich in methionine and

Discussion 81

cysteine and was transformed into lupin (Lupinus angustifolius L.) under

control of the pea vicilin gene. One transgenic plant expressed a single

tandem insertion of the gene that resulted in the accumulation of the protein

to 5% of extractable seed protein. This was accompanied by a 94% increase

in methionine content and 12% decrease in cysteine content as compared to

wild type (Molvig et al., 1997). The pea legumin gene under the control of

the rice glutenin promoter was expressed in the endosperrn of transgenic rice

plants to a maximum of 4.24% of the total protein (Sindhu et al., 1997).

Based on these results, it appears that the expression of foreign genes in

plants seems variable and may depend on factors such as the type of host

plant and the type of promoter used.

Recently, Goosens et al. (1 999A) transforrned bean and Arabidopsis

with the gene coding for arcelin. Arcelin is an abundant seed storage protein

(30-40% total seed protein) encoded for by 2 genes found in some wild type

bean genotypes and is related to PHA and a-amylase inhibitor genes. High

expression in the bean at 1525% and 145% of the total seed protein in

Arabidopsis was observed (Goosens et al., 1999A). Such a high level of

transgene expression in the seed has never been reported before. This

seems to suggest that an 'empty container' may not be needed as it is

possible to achieve high levels of expression without further modification of

any other seed protein fractions. However, Goosens et al. (1999A) used only

1-2 seeds per assay for bean which introduces a large probability of error. It

Discussion 85

has been previously shown in soybean that analysis of small seed samples

or individual seeds may not accurately reflect protein values for an individuai

plant, as protein content has been shown to Vary between seeds from

different parts of the plant (Escalante and Wilcox, 1993 and references

within).

Goosens et al. (19998) also examined the expression of the arcelin

gene in transgenic plants also carrying an antisense napin gene for

Arabidopsis. It was thought that expression levels couid be enhanced due to

the negative relationship between different protein fraction within the seed

(as discussed earlier). This research would also seem to test the empty

container hypothesis. This group reported that expression levels rose to 8-

25% of the total seed protein in transgenic plants carrying both the arcelin

gene and napin antisense gene as compared to transformants still producing

napin at wild type levels. The fact that they only used the highest expressing

lines of the transformants in their cornparisons rnust be considered in the

evaluation of the vaiidity of these results. The amount of expression varies

greatly between lines and does not have a strong correlation to transgene

copy number. Therefore, the comparison must consider other factors such

as the transgene insertion site, as it may play a role in determining the level

of expression of the transgene. However, what these findings do seem to

establish is that the seed has the biosynthetic capacity to direct its energy

towards the production of a foreign protein when an endogenous protein is

Discussion 36

repressed. This is supported by Kohno-Murase et al. (1994) where the

introduction of an antisense gene for napin into B.napus, resulted in the

increase of endogenous cruciferin, the other major seed protein in the seed.

Goosens et al. (19998) did not report seeing a significant increase in this

protein class. It can be theorized that once the resources are freed as a

consequence of the seed not producing napins, the available resources were

used in the production of arcelin as opposed to cruciferin. Perhaps the

arcelin gene out competed the cruciferin genes for factors and transcription

machinery. Evidence for this is the over 50°h decrease in phaseolin levels in

strains of Pwlgaris containing a novel arcelin gene, suggesting it may have

a stronger promoter than the endogenous protein (Romero-Andreas et al.,

1 986).

Now that it has been shown that the seed has the capacity to highly

express a foreign protein. what remains is to demonstrate whether or not

seeds c m be genetically rnodified in order to increase agronomic value

through increases in traits such yield, quality and nutritive value. If so, the

seed also has the potential to harbor and express genes for

biopharmaceuticals. I generated PHA transformants in the ssp-1 background

(the empty container) where the gene was placed under the control of its own

promoter. Arcelin and ?HA are related and so perhaps one rnight expect to

produce a line with same amount of expression seen in the study mentioned

previously. Unfortunately, the transgenic plants gave low expression levels

Discussion

of PHA ranging from 0.5% to 1.4% of the total seed protein but transgenic

plants with low levels of expression were also seen in the aforementioned

study. Therefore, further research needs to be performed to increase Our

understanding of how the expression of seed storage genes iç regulated. It

may be a matter of trial and error to find a transgenic line of plants with high

expression of the desired protein in the seed.

These PHA transfonants were backcrossed to Col to produce an

individual with the same ?HA transgene copy number and in the same

chromosomal context but in a wild type background (full container).

Theoretically, if the empty container hypothesis is correct then the

transformant should exhibit higher expression levels as compared to its

backcrosses. I found that the levels were actually lower in the wild type

genetic background versus the ssp-1 genetic background for transfonants

with 3 or 4 copies of the transgene (PHAl. PHA4. PHAIO). The amount of

expression of the transgene may be attributed to the copy number of the

inserted gene but a direct correlation was not observed in this or other

studies (Goosens et al.. f999B). Expression may also depend on the site of

integration of the transgene in the genome and there exists the possibility

that the transgene inserted itself into an area of the genome that cannot be

transcribed at high rates.

Results lending credibility to the empty container hypothesis were

seen for three of the transformants, PHA2, PHA7 and PHAI 1 and their

Discussion 8s

corresponding backcrosses. All of these plants carried 2 copies of the PHA

transgene. Only PHA2 showed a significant enhancement of expression ( I o h

of total seed protein) relative to levels of PHA accumulation in the seeds of

its backcrosses (0.2% of total seed protein) albeit overall expression of PHA

in each plant was extremely low. This provides potential evidence to support

the empty container hypothesis, as expression was five times greater in the

ssp-7 background as opposed to the wild type background. The results of

this research do not hold convincing arguments in favor of the empty

container hypothesis but do show some promise. Another attempt should be

made to gather concrete evidence that the empty container hypothesis is

valid. It would be wise to repeat these experiments with a few changes.

Firstly, it is important to identify a transformant with a single copy of the

inserted gene as it simplifies genetic analysis and quantification of

expression levels as the effects of multiple copy number are unknown. Also.

it would be beneficial to screen for a homozygote transgenic line that

expresses and accumulates the desired protein to high levels. It would be

interesting to also investigate if there is a molecular basis for the differences

in expression between transgenic lines containing the same copy number.

Nevertheless, these findings demonstrate that further research must be done

in order to gain a greater understanding into the control of seed storage gene

expression. This might provide clues on how scientists might manipulate

Discussion

genes to overproduce proteins for crop improvement and as a means for low

cost production of proteins of interest to pharmaceutical and other industries.

SUMMARY AND CONCLUSIONS

The ssp-1 mutation was mapped to chromosome 4 near the CRU3

gene, at position 83 CM. This research has determined that the molecular

basis for the deficiency is a single base pair mutation, a G-A transition, in the

CRU3 gene that results in a prernature stop codon. Not much is known about

how premature stop codons can affect transcript stability or degradation so,

future studies may prove useful in understanding this phenornenon.

The biochemical characterization of the mutant shows that the protein

content of ssp-Vssp-1 seeds is 20-27OI0 less than wild type whereas the other

protein fractions, the çtarch levels and lipid composition remain relatively

unchanged. Previous evidence dictates that when one protein is reduced

another one overexpresses itself to compensate. Therefore, ssp-1 can be

considered a novel non-compensating mutant.

PHA was successfully expressed in transgenic ssp-7 plants but at very

low levels of 0.5'' to 1.4% of the total seed protein. Such low expression has

been reported previously in different transgenic experiments. These PHA

transgenic plants were al1 backcrossed to see if the ssp-1 genetic background

could enhance expression of the reporter gene. One transformant with 2

transgene copies showed five times the PHA accumulation level in its seeds

than the seeds of its backcrosses. These results suggest that the empty

container hypothesis is indeed valid and future studies into the regulation and

control of seed storage proteins must be done.

References 9 I

References

Abler, M. L. and Green, P. L. (1996). Control of mRNA stability in higher plants. Plant Mol. Biol. 32: 63-78

Ahmad, M., Lin, C. and Cashmore, A. R. (1995). Mutations throughout an Arabidopsis blue-lig ht photoreceptor impair blue-light-responsive anthocyanin accumulation and inhibition of hypocotyl elongation. Plant J. 8 (5): 653-658

Altenbach, S. B., Pearson, K. W., Meeker, G., Staraci, L. and Sun, S. S. M. (1989). Enhancement of the methionine content of seed proteins by the expression of a chimeric gene encoding a methionine-rich protein in transgenic plants. Plant Mol. Biol. 13: 513-522

Altenbach, S. B., Kuo, C., Staraci, L., Pearson, K. W., Wainwright, C., Georgescu, A. and Townsend, J. (1 992). Accumulation of a Brazil nut albumin in seeds of transgenic canola results in enhanced levels of seed protein methionine. Plant Mol. Biol. 18: 235-245

An, G., Ebert, P. R., Mitra, A. and Ha, S. B. (1988). Binary vectors. Plant Molecular Bioloqy Manual A3: 1-1 O Kluwer Academic Publishers, Dordrecht

Battey, J. F., Schnid, K. M. and Ohlrogge, J. B. (1989). Genetic engineering for plant oils: potential and limitations. TIBTECH 7: 122- 126

Bâumlein, H., Miséra, S., LuerOen, H., Kollee, K., Horstmann, C., Wobus, U. and Müller, A. J. (1994). The FUS3 gene of Arabidopsis thaliana is a regulator of gene expression during late embryogenesis. Plant J. 6(3): 379-387

Bechl, A. E. and Anderson, O. Dm (1996). Expression of a novel high- molecular-weight glutenin subunit gene in transgenic wheat. Nature Biotechnology 14: 875-879

Bell, C. J. and Ecker, J. R. (1994). Assignment of 30 microsatellite loci to the lin kage map of Arabidopsis. Genomics 19: 1 37-1 44

References 92

Benedict, J. H o , Sachs, E. S., Altman, D. W., Deaton, W. R., Kohel, R. Jo, Ring, Do R. and Berberich, S. A. (1 996). Field performance of cottons expressing transgenic CrylA insecticidal proteins for resistance to Heliothis virencens and Helicoverpa zea (Lepidoptera: Noctuidae). J. Econ. Ent. 89 (1): 230-238

Bent, A and Clough, S. (1 997). Agrobacterium germ-line transformation: Transformation of Arabidopsis without tissue culture. Plant Molecular Biolocw Manual, Second edition Kluwer Acadernic Pubiishers, Dordchect

Bhattramakki, D. and Kriz, A. L. (1 996). Nucleotide sequence analysis of a novel globulinl nuIl allele from the Illinois high protein strain of maize. Plant Mol. Biot, 32: 121 5-1 21 9

Calvo, E. S., Wurtle, E o S. and Shoemaker, R o C. (1997). Cloning, mapping and analyses of expression of the Em-like gene family in soybean [Glycine max (L). Merr.] Theor. Appl. Genet. 94: 957-967

Casey, R., Bewley, J. Do and Greenwood, J. S. (1997). Protein storage and utilization in seeds. Plant Metabolism, Second edition pg. 539- 557 Addison Wesley Longman Limited Essex

DeClerq, A. Dmy Vandewiele, M o , Van Damme, Jo, Guerche, P., Van Montagu, M., Vandekerckhove, J. and Ktebbers, E. (1990). Stable accumulation of modified 2s albumin seed storage proteins with higher methionine contents in transgenic plants. Plant Physiol. 94: 970-979

Dellaporta, S. L., Wood, J. W. and Hicks, J o B o (1985). Maize DNA miniprep. Molecular Bioloav of Plants: A Laboratorv Course Manual Cold Spring Harbor Laboratory Press NY

de Pater, S., Pham, K., Klitsie, I and Kijne, J o (1996). The 22bp W1 element in the pea lectin promoter is necessary and as a multimer, sufficient for high gene expression in tobacco seeds. Plant Mol. Biol. 3251 5-523

Enriquez-Obregon, G. A., Vazquez-Padron, R. I., Prieto-Samsonov, D. L., De la Riva, G. A. and Selman-Housein, G. (1998). Herbicide- resistant sugarcane (Saccharum officinarum L.) plants by Agrobacterium-mediated transformation. Planta 206: 20-27

References 93

Esau, K. (1977). Anatomv of Seed Plants. Second edition. John Wiley & Sons, lnc. NY

Escalante, E. E. and Wilcox, J. Ra (1993). Variation in seed protein among nodes of normal- and high-protein soybean genotypes. Crop Sci. 33: 1164-1 166

Fabri, C. O. and Schaffner, A. R. (1994). An Arabidopsis thaliana RFLP mapping set to localize mutations to chromosomal regions. Plant J. 5 (1): 149-1 56

Feinberg, A. P. and Vogelstein, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132: 6-1 3

Gallo-Meagher, M. and Irvine, J. E. (1 996). Herbicide resistant transgenic sugarcane plants containing the bar Gene. Crop Sci. 36: 1367-1374

Giroux, M. J., Boyer, C., Feix, G. and Hannah, L. C. (1994). Coordinated transcriptional regulation of storage product genes in the maize endosperm. Plant Physiol. 106: 71 3-722

Goosens, A., Dillen, W., De Clerq, J., Van Montagu, M. and Angenon, G. (1 999A). The arcelin-5 gene of Phaseolus vulgaris directs high seed- specific expression in transg enic Phaseolus acutifolius and Arabidopsis plants. Plant Physiol. 120: 1 095-1 1 O4

Goosens, A., Van Montagu, M. and Angenon, G. (1999B). Co- introduction of an antisense gene for an endogenous seed storage protein can increase expression of a transgene in Arabidopsis thaliana seeds. FEBS Letters 456: 160-1 64

Habben, J. E. and Larkins, B. A. (1995). lmproving the protein quality in seeds. In Seed Develo~ment and Germination. edited by Kigel, J. and Galili, G. Marcel Dekker, New York pg 791 -81 0

Halcomb, J. La, Benedict, J. H., Cook, B. and Ring, D. R. (1996). Sumival and growth of bollworm and tobacco budworm on nontransgenic and transgenic cotton expressing a CrylA insecticidal protein (Lepidoptera: Noctuidae). Env. Ent. 25 (2): 250-255

Hartman, C. L., Lee, L., Day, P. R., and Turner, N. E. (1994). Herbicide resistant turfgrass (Agrostis palustris Huds.) by biolistic transformation. Biotechnology. 12: 9 1 9-923

References 94

Hartweck, L. M. and Osborn, T. C. (1997). Altering protein composition by genetically removing phaseolin from common bean seeds containing arcelin or phytohemagglutinin. Theor. Appl. Genet. 95: 101 2-1 01 7

Hayashi, M., Harada, K., Fujiwara, T. and Kitamura, K. (1998). Characterization of a 7 s globulin deficient mutant of soybean (Glycine max (L.) Merrill). Mol. Gen. Genet. 258: 208-214

Higgins, T. J. V. (1984). Synthesis and regulation of major proteins in seeds. Ann. Rev. Plant Phys. 35: 191 -221

Higgins, T. J. V., Newbigin, E. J., Spencer, D., Llewellyn, D. J. and Craig, S. (1 988). The sequence of a pea vicilin gene and its expression in transgenic tobacco plants. Plant Mol. Biol. 1 1 : 683-695

Hoffman, L. M., Donaldson, D. D., Bookland, Roger and Herrnan, E. M. (1987). Synthesis and protein body deposition of maize 15-kd zein in transgenic tobacco seeds. EMBO J. 6(11): 321 3-3221

Hoffman, L. M., Donaldson, D. D. and Herman, E. M. (1988). A modified storage protein is synthesized, processed, and degraded in the seeds of transgenic plants. Plant Mol. Biol. 1 1 : 71 7-729

Ivy, J. M., Beremand, P.D. and Thomas, T. L. (1998). Strategies for modifying fatty acid composition in transgenic plants. Biotech. and Gen. Eng. Reviews 15: 271-288

Jenkins, J. N., McCarty, J. C., Buehler, R. E., Kiser, J., Williams, C. and Wofford, T. (1997). Resistance of cotton with gendotoxin from Bacillus thuringiensis var. kurstaki on selected Lepidopteran insects. Agron. J. 89: 768-780

Jofuku, K. Dm, Schipper, R. D. and Goldberg, R. B. (1989). A frameshift mutation prevents kunitz trypsin Inhibitor mRNA accumulation in soybean embryos. Plant Cell 1 : 427-435

Kiegel, J and Galili, G. (1995). Seed develo~ment and oenination. Marcel Dekker Inc., New York

Kohno-Murase, J., Murase, M., Ichikawa, H. and Imamura, J. (1994). Effects of an antisense napin gene on seed storage compounds in transgenic Brassica napus seeds. Plant Mol. Biol. 26: 1 1 15-1 124

References 95

Kohno-Murase, J., Murase, M., Ichikawa, H. and Imamura, J. (1995). lmprovement in the quality of seed storage protein by transformation of Brassica napus with an antisense gene for cruciferin. Theor. Appl. Genet. 91: 627-631

Kortt, As A., Caldwell, Js B., Lilley, G. G. and Higgins, Tm J. V. (1991). Amino acid and complimentary DNA sequence of a methionine-rich 2s protein from sunflower seed (Helianthus annus L.). Eur. J. Biochem. 195: 329-

Kriz, A. L. and Larkins, B.A. (1 991). Biotechnology of seed crops: Genetic engineering of seed storage proteins. Hort. Sci. 26 (8): 1036-1 038

Kusnadi, A. R., Nikolov, 2. L. and Howard, J. A. (1997). Production of recombinant proteins in transgenic plants: Practical considerations. Biotech. 8ioeng. 56 (5): 473-484

Leeds, P., Peltz, S. W., Jacobson, A. and Culbertson, M. R. (1 991). The product of the yeast UPFI gene is required for rapid turnover of mRNAs containing a premature translational termination codon. Genes and Dev. 5: 2303-2314

Lin, Y., Lin, S., Nguyen, L. V., Rachubinski, R. A. and Goodman, H. M. (1999). The Pexl6p homolog SSEl and storage organelle formation in Arabidopsis seeds. Science 284: 328-330

Lopes, M. A. and Larkins, B. A. (1993). Endosperm origin, development, and function. Plant Cell 5: 1383-1399

Lowry, O. H., Rosebrough, N. J., Fm, A. L. and Randall, R. J. (1951). Protein measurement with the folin phenol reagent. J. Biol. Chem. 193: 265-275

Lynch, R. E., Wiseman, B. R., Plaisted, Dm and Warnick, Dm (1999). Evaluation of transgenic sweet corn hybrids expressing CrylA(b) toxin for resistance to corn earworrn and fall armyworm (Lepideptera: Noctuidae). J. Econ. Ent. 92(1):246-252

Martin, Ce and Smith, A. M. (1 995). Starch biosynthesis. Plant Ceil. 7: 971 - 985

Mazliak, P. (1994). Desaturation processes in fatty acid and acyl lipid biosynthesis. J. Plant Physiol. 143: 399-406

References (16

McKinney, E. C., Ali, N., Trau?, A., Feldmann, K. A., Belostotsky, D. A., McDowell, J. M. and Meagher, R. B. Sequence-based identification of T-DNA insertion mutations in Arabidopsis: actin mutants act2-1 and act4-1. Plant J. 8 (4): 61 3-622

Meinke, D. (1 994). Seed development in Arabidopsis thaliana. Arabidopsis. pg 253-295 Cold Spring Harbor Laboratory Press, New York

Meinke, D. and Koornneef, M. (1997). Community standards for Arabidopsis genetics. Plant J . 1 2(2): 247-253

Molvig, Lm, Tabe, Lm M., Eggum, B. O., Moore, A. E., Craig, S., Spencer, D. and Higgins, T. J. V. (1997). Enhanced methionine levels and increased nutritive value of seeds of transgenic lupins (Lupinus angustifolius L.) expressing a sunflower seed albumin gene. Proc. Natl. Acad. Sci. USA 94: 8393-8398

Moran, R., Garcia, R., Lopez, A., Zaldua, Z., Mena, J., Garcia, M., Armas, Ra, Somonte, Da, Rodriguez, J. Gomez, M. and Pimentel, E. (1 998). Transgenic sweet potato plants carrying the delta-endotoxin gene form Baci//us thuringiensis var. tenebrionis. Plant Sci. I N @ ) : 175-1 84

Murashige, T. and Skoog, Fm (1962). A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant 15: 473- 497

Nambara, E., Keith, K, McCourt, P. and Naito, S. (1995). A regulatory role for the AB13 gene in the establishment of embryo maturation in Arabidopsis thaliana. Development 1 21 (3) : 629-936

Nordlee, J. A., Taylor, S. Lm, Townsend, J. A., Thomas, L. A. and Bush, R. K. (1996). Identification of a Brazil-nut allergen in transgenic soybeans. N. Eng. J. Med. 334: 688-692

Ohlorogge, J. and Browse, J. (1995). Lipid Biosynthesis. Plant Cell 7: 957-970

Ohtani, T., Galili, Ga, Wallace, J. C., Thompson, G. A. and Larkins, B. A. (1 991). Normal and lysine-containing zeins are unstable in transgenic tobacco seeds. Plant Mol. Biol. 16: 117-128

References 97

Okamuro, J. K., Jofuku, K. D. and Goldberg R. B. (1986). Soybean seed lectin gene flanking nonseed protein genes are developmentally regulated in transformed tobacco plants. Proc. Natl. Acad. Sci. USA 83: 8240-8244

Osborn, T. C. and Bliss, F. A. (1985). Effects of genetically removing lectin seed protein on horticultural and seed characteristics of common bean. J. Amer. Soc. Hort. Sci. 11 O(4): 484-488

Osborn, T. C., Brown, J. W. S. and Bliss, F. A. (1985). Bean lectins. Theor. Appl. Genet. 70: 22-31

Pang, P. P., Pruitt, R. E. and Meyerowitz, E. M. (1988). Molecular cloning. genomic organization, expression and evolution of 12s seed storage protein genes of Arabidopsis thaliana. Plant Mol. Biol. 11 : 805-820

Perlak, F. J., Deaton, R. W., Armstrong, T. A., Fuchs, R. L., Sims, S. R., Greenplate, J. T. and Fischoff, O. A. (1990). lnsect resistant cotton plants. Biotechnology 8: 939-943

Perlick, H.A., Medghalchi, S. M., Spencer, F. A., Kendzior Jr., R. J. and Dietz, H. C. (1996). Mammalian orthologues of a yeast regulator of nonsense transcript stability. Proc. Natl. Acad. Sci. USA 93:10928- 10932

Ramachandran, S., Berntin, G. D., AII, J. N., Raymer, P. L. and Stewart, C. N. (1 998). Greenhouse and field evaluations of transgenic canola against diamond back moth, Plutella xyostella and corn earworm, Helicoverpa zea. Entomologia Experimentalis et Applicata. 88(1): 17- 24

Raven, P. H., Evert, R. F. and Curtis, H. (1981). Bioloqv of Plants. Third edition. Worth Publishers, lnc. NY

Riggs, C. D., Voelker, T. A. and Chrispeels, M. J. (1989). Cotyledon nuclear proteins bind to DNA fragments harboring regulatory elements of phytohemagglutinin genes. Plant Cell l(6): 609-622

References 98

Romero-Andreas, J., Yandell, B. S. and Bliss, F. A. (1986). Bean arcelin 1. lnheritance of a novel seed protein of Phaseolus vulgaris L. and its affect on seed composition. Theor. Appl. Genet. 72: 123-128

Sambrook, J., Fritsch, E. F. and Maniatis, Tm (1989). Molecular Clonina: A Laboratory Manual, Second Edition Cold Spring Harbor Laboratory Press NY

Sakamoto, A., Murata, A and Murata, N. (1998). Metabolic engineering of rice leading to biosynthesis of glycinebetaine and tolerance to sait and cold. Plant Mol. Biol. 38: 101 1-1 01 9

Shaul, 0. and Galili, G. (1992). Threonine overproduction in transgenic tobacco plants expressing a mutant desensitized aspartate kinase of Escherichia coli. Plant Physiol. 100: 1157-1 163

Shewry, P. R., Tatham, A. S., Halford, N. G., Barker, J. H. A., Hannappel, P. G., Thomas, M. and Kreis, M. (1994) Opportunities for manipulating the seed protein composition of wheat and bariey in order improve quality. Transgenic Research 3: 3-1 2

Shewry, P. RB, Napier, J. A. and Tatham, A. S. (1995). Seed storage proteins: Structures and biosynthesis. Plant Ce11 7:945-956

Sindhu, A. S., Zheng, Z. and Murai, N. (1997) The pea seed storage protein legumin was synthesized. processed and accumulated stably in transgenic rice endosperm. Plant Sci. 130: 189-1 96

Snedden, W. and Fromm, Hm (1997). Characterization of the plant homologue of prohibitin, a gene associated with antiproliferative activity in mammalian cells. Plant Mol. Biol. 33: 753-756

Sokal, R. R. and Rohalf, Fm J. (1987). Introduction to biostatistics. W. H. Freeman and Company, New York

Stalker, D.M., McBride, K. E. and Malyj, L. D. (1988). Herbicide resistance in transgenic plants expressing a bacterial detoxification gene. Science 242: 41 9-422

Tissue, D. T. and Wright, S. J. (1995). Effect of seasonal water availability on phenology and the annual shoot carbohydrate cycle of tropical forest shru bs. Functional Ecology 9: 5 1 8-527

References 99

Voelker, T. A., Sturm, A. and Chrispeels, M. J. (1987). Differences in expression between two seed lectin alleles obtained from normal and lectin deficient beans are maintained in transgenic tobacco. EMBO J. 6(12): 3571-3577

Voelker, T. A., Herman, E. M. and Chrispeels, M. J. (1989). In vitro mutated phytohemagglutinin genes expressed in tobacco seeds: Role of glycans in protein targeting and stability. Plant Cell 1 : 95-104

Voelker, T. A., Moreno, J. and Chrispeels, M. J. (1 990). Expression analysis of a pseudogene in transgenic tobacco: A frameshift mutation prevents mRNA accumulation. Plant Cell 2: 255-261

West, M. A. L. and Harada, J. J. (1993). Embryogenesis in Higher Plants: An Ovewiew. Plant Cell 5: 1 361 -1 369

Wilson, F. O., Flint, H. M., Deaton, W. R., Fischhoff, O. A., Perlak, F. J., Armstrong, T. A., Fuchs, R. L., Berberich, S. A., Park, N. J. and Stapp, B.R. (1992). Resistance of cotton lines containing a Bacillus thuringiensis toxin to pink bollworm (Lepidoptera: Gelechiidae) and other insects. J. Econ. Ent. 85 (4): 1517-1519

Xia, Y., Nikalau, B. J. and Schnable, P.S. (1996). Cloning and characterization of CER2, an Arabidopsis gene that affects cuticular wax accumulation. Plant Cell 8: 1 29 1-1 304

Yamauchi, D. and Minamikawa, T. (1998). lmprovement of the nutritional quality of legume seed storage proteins by molecular breeding. J. Plant Res. 11 1: 1-6

Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana...

Documents

Transcript of Sung...ABSTRACT C haracterization of a Cruciferin Deficient Mutant, ssp- 7, of Arabidopsis thaliana...