STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best...
Transcript of STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best...
![Page 1: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/1.jpg)
STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV) dsRNA
EXTRACTED FROM FORMALIN FIXED PARAFFIN EMBEDDED TISSUE
by
MOHAMED MAMDOUH HAMOUD
(Under the Direction of Pedro Villegas and Barry Harmon)
ABSTRACT
In first study, sequencing the hypervariable region of IBDV from formalin fixed paraffin
embedded tissues (FFPET) that originated from chickens experiencing immunosuppression;
located both in the USA and abroad, allowed accurate strain identification of IBDV. This allows
direct correlation between viral identity and tissue lesions. Several new emerging viruses that
don’t group with other known IBDV along with a unique variant virus that had 63 nucleotides
missing from its hypervariable region were identified.
The second project investigated why some positive acute +4 lesions of FFPET yielded no
RT-PCR detectable IBDV RNA. It was hypothesized that different formalin fixation conditions
have negative impact on RNA detection from FFPET. To study this, bursas with high viral loads
and maximum histological IBDV lesion score of 4 were fixed in formalin under various
conditions. Only tissues fixed in formalin with a pH of 7.0, 5 or 10% formaldehyde, storage
temperature of 25°C or less, and kept up to 2 weeks in formalin yielded detectable IBDV RNA
upon extraction. No RNA could be detected from tissues fixed under extreme temperature, pH or
formalin concentrations. Optimal fixation conditions for IHC detection of IBDV were in 10%
formalin, pH 7.0 and 4°C, where maximum intensity of immunostaining was observed.
![Page 2: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/2.jpg)
The third project’s goal was to produce a subunit vaccine against IBDV, without
manipulation of live or killed viral particles, to protect chicken against IBDV infection. The
Edgar strain of IBDV VP2 gene was obtained from frozen bursas, while the hypervariable region
of VP2 was obtained from FFPET. The two genes were cloned into Pichia pastoris and protein
production was confirmed by western blot analysis. Specific pathogen free 1-day old chicks
vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with
Edgar IBDV. There was no morbidity or mortality in the VP2 vaccinated birds compared to 90%
morbidity and 50% mortality in placebo vaccinated birds. Recombinant vaccines don’t totally
protect against viral replication in bursa as confirmed by high histopathological lesion scores and
immunohistochemical detection of IBDV in infected tissue. This was probably due to the high
viral dose and virulence of the challenge virus used.
INDEX WORDS: Infectious bursal disease, Chicken, VP2, formalin fixed paraffin embedded
tissue, immunohistochemistry, Pichia pastoris, recombinant vaccine
production, phylogenetic analysis
![Page 3: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/3.jpg)
STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV) dsRNA
EXTRACTED FROM FORMALIN FIXED PARAFFIN EMBEDDED TISSUE.
by
MOHAMED MAMDOUH HAMOUD
B.V.Sc Faculty of Veterinary Medicine, Cairo University, Egypt 1994
M.V.Sc Faculty of Veterinary Medicine, Cairo University, Egypt 1998
A Dissertation Submitted to the Graduate Faculty of The University of Georgia in Partial
Fulfillment of the Requirements for the Degree
DOCTOR OF PHILOSOPHY
ATHENS, GEORGIA
2006
![Page 4: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/4.jpg)
© 2006
Mohamed Mamdouh Hamoud
All Rights Reserved
![Page 5: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/5.jpg)
STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV) dsRNA
EXTRACTED FROM FORMALIN FIXED PARAFFIN EMBEDDED TISSUE.
by
MOHAMED MAMDOUH HAMOUD
Major Professor: Pedro Villegas Barry Harmon
Committee: Mark Jackwood
Zhen Fu Bruce LeRoy
Electronic Version Approved: Maureen Grasso Dean of the Graduate School The University of Georgia August 2006
![Page 6: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/6.jpg)
iv
DEDICATION
I would like to dedicate this work to my parents, my wife Rasha Tawfik, my
two wonderful daughters Salma and Yasmin for their unconditional love and
support. I also would like to dedicate this work to my twin brother and two sisters
for helping me be the person I am. It is their love and support that has made this
work possible. They have put up with me and my pursuit for this doctorate for so
long. I hope this dedication can be a simple thank you for all what they have gone
through.
![Page 7: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/7.jpg)
v
ACKNOWLEDGEMENTS
I would like to thank my professor Dr. Pedro Villegas for his support and guidance as a
mentor. I’ve really enjoyed working in his lab and have learned so much along the way. His
humanity and experience have gone a long way with me and has helped me through this. I would
also like to thank Dr. Barry Harmon, for his support and guidance as my co-major advisor. I
really appreciate your help. To my committee members, Dr. Mark Jackwood, Dr. Zhen Fu and
Dr. Bruce LeRoy; I really can not thank them enough. It was always helpful running to you to
seek advice when experiments did not want to work out.
I would like to thank Dr. Thomas P. Brown for believing in me and helping me come to
the Poultry Diagnostic Research Center, he gave me the chance to learn from an excellent
institution specializing in the area of avian diseases. Dr. Mary Pantin-Jackwood, Dr. Ivan
Alvarado, Dr. Francisco Perozo and Mrs. Linda Purvis thank you so much for your help and
assistance.
I would like to acknowledge the good people of PDRC both faculty and staff for their
contributions in me education and research.
![Page 8: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/8.jpg)
vi
TABLE OF CONTENTS
Page
ACKNOWLEDGEMENTS.............................................................................................................v
LIST OF TABLES....................................................................................................................... viii
LIST OF FIGURES .........................................................................................................................x
CHAPTER
1 INTRODUCTION .........................................................................................................1
Purpose of this study .................................................................................................1
2 LITERATURE REVIEW ..............................................................................................5
Part 1: Infectious Bursal Disease..............................................................................5
Part 2: IBDV Pathogenesis and Immunosuppression.............................................30
Part 3: Pichia pastoris ............................................................................................38
References ...............................................................................................................49
3 Identification of infectious bursal disease viruses from RNA extracted from paraffin
embedded tissue ......................................................................................................84
References ...............................................................................................................98
4 Detection of infectious bursal disease virus from formalin-fixed paraffin-embedded
tissue by immunohistochemistry and real-time reverse transcription-polymerase
chain reaction ........................................................................................................111
References .............................................................................................................125
![Page 9: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/9.jpg)
vii
5 Production of Infectious Bursal Disease (IBD) Viral protein 2 (VP2) and the
hypervariable region of VP2 in Pichia pastoris.....................................................136
References .............................................................................................................159
6 DISCUSSIONS AND CONCLUSIONS ...................................................................178
![Page 10: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/10.jpg)
viii
LIST OF TABLES
Page
Table 3.1: Number of IBDV strains isolated and identified from 2003-2005 according to
geographical origin of the paraffin embedded tissues.................................................107
Table 3.2: Distribution of IBDV strains in the United States of America from 2003-2005........108
Table 3.3: Distribution of IBDV strains in the world during 2003-2005 ....................................110
Table 4.1: Fixation conditions for bursal tissues from IBDV infected and control chickens......130
Table 4.2: Histopathology and IHC mean staining scores of 5 bursas of Fabricius from chickens
infected with IBDV and subjected to different fixation conditions ............................132
Table 4.3: Effect of fixation conditions on extraction of RNA from bursas of Fabricius from
chickens infected with IBDV ......................................................................................134
Table 5.1: Experimental design of immunization experiment. Different vaccines were
administered at 1-day of age with or without Freund’s adjuvant. Challenge was 3
weeks post vaccination. Experimental replicate had the following treatment groups
.....................................................................................................................................167
Table 5.2: Number of morbid and dead birds per total number in different vaccine and challenge
treatments ....................................................................................................................168
Table 5.3: Body weight and relative organ weights of 28 day old SPF chickens vaccinated or non
vaccinated against IBDV, one week post challenge....................................................169
Table 5.4: ELISA GMT at 28 days of age to IBDV following vaccination of 1-day-old SPF
chickens .......................................................................................................................170
![Page 11: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/11.jpg)
ix
Table 5.5: Real-time RT-PCR melting curve detection, histopathological lesion scores and IHC
mean staining scores for bursas of birds vaccinated or non vaccinated at 1-day of age
and challenged with Edgar or 2512 strains of IBDV at 21 days. Sampling was
performed 1 week post challenge. Data for individual bird’s bursa ...........................172
Table 5.6: Mean lymphocyte transformation indices of vaccinated and non-vaccinated birds
challenged or not challenged with 2512 or Edgar IBDV ............................................173
![Page 12: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/12.jpg)
x
LIST OF FIGURES
Page
Figure 3.1: Consensus nucleic acid phylogram of common IBDV vaccines and strains, in
addition to some field strains identified from paraffin embedded tissues deduced from
1000 trees by Neighbor-Joining method. Numbers at the forks indicate the number of
times (as a percentage) the groups consisting of the sequences which are to the right of
that fork occurred after the generation of 1000 trees. P-distance bar in bottom of
figure. Arrows indicate field cases identified in our laboratory which are labeled by
case number. Other isolates are identified with GeneBank accession numbers and trade
name. Samples without accession numbers were also extracted and sequenced in our
laboratory. Only 213 nucleotides were sequenced in case 087 A. ..............................105
Figure 3.2: Consensus amino acid phylogram of common IBDV vaccines and strains, in addition
to some field strains identified from paraffin embedded tissues deduced from 1000
trees by Neighbor-Joining method. Numbers at the forks indicate the number of times
(as a percentage) the groups consisting of the sequences which are to the right of that
fork occurred after the generation of 1000 trees. P-distance bar in bottom of figure.
Arrows indicate field cases identified in our laboratory which are labeled by case
number. Other isolates are identified with GeneBank accession numbers and trade
name. Samples without accession numbers were also extracted and sequenced in our
laboratory. Only 213 amino acids were deduced in isolate 087 A..............................106
![Page 13: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/13.jpg)
xi
Figure 4.1: Photomicrograph of Bursa of Fabricius. (IHC technique specificity control for IBDV
infected and non-infected tissues). 1a: Non infected tissue stained with IHC. 1b: IBDV
infected bursa stained with IHC. All tissues were fixed in 10% buffered formalin at a
temperature of 4°C and pH 7.0. IBDV infected controls show brown positive IHC
staining (indicated by arrow) of cortical intrafollicular lymphocytes. (100X) ..........128
Figure 4.2: : RT-PCR product of amplified VP2 fragment: lane a, molecular size marker; lane b,
amplified VP2 fragment from IBDV control positive; lane c, amplified VP2 fragment
from RNA extracted from a tissue block, lane d, negative RT- PCR control (primers
with water); lane e, negative extraction control from RNA extracted from an
uninfected tissue block ...............................................................................................128
Figure 4.3: Real time RT-PCR melting curve analysis for IBDV amplicons extracted from tissues
fixed in 10% buffered formalin at 4°C and submitted to different fixation durations
(hours). Melting curve peak after 24 hours storage was 83°C, but increased to 84°C
after 48-120 hours of storage, and after 2 weeks of storage, to 86°C, indicating
changes in nucleotide sequences. RT-control is the reverse transcriptase PCR control
for a known IBDV and extraction control is a known paraffin embedded block with
extractable IBDV genetic material. .............................................................................129
Figure 5.1: RT-PCR product of amplified VP2 and pVP2: lane 1, molecular size marker; lane 2,
3, 5 and 6 amplified VP2; lane 4, negative control; lane 8 and 9, amplified pVP2 ....174
![Page 14: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/14.jpg)
xii
Figure 5.2: Western blot analysis of recombinant proteins. Lane 1 Molecular weight marker, two
clones of yeast expressing pVP2 lanes 2 and 3, two clones of yeast expressing VP2
and negative control, yeast transformed with wild-type plasmid. The membrane was
immunoblotted with primary monoclonal antibodies against IBDV (ATCC HB9490)
.....................................................................................................................................174
Figure 5.3. Photomicrographs of bursa from SPF chickens stained with H&E that were Non-
vaccinated, non-challenged control (A); or diluent vaccinated and Edgar IBDV
challenged (B); X100 .................................................................................................175
Figure5.4: Photomicrographs of Thymus from SPF chickens stained with H&E were VP2
vaccinated and Edgar IBDV challenged (A); diluent vaccinated and Edgar IBDV
challenged (B); Non-vaccinated , non-challenged control (C). X100.........................176
Figure 5.5: Photomicrographs of bursas from SPF chickens stained with IHC that were
vaccinated and challenged with diluent (A); Vaccinated with diluent and challenged
with Edgar IBDV (B); Vaccinated with Pichia pastoris control and challenged with
Edgar ..........................................................................................................................177
![Page 15: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/15.jpg)
1
Chapter I
INTRODUCTION
Purpose of the Study
Infectious bursal disease virus (IBDV) is the etiological agent of Gumboro disease
or infectious bursal disease (IBD). IBD is an acute highly contagious viral disease of
young chickens. This virus causes severe immunosuppresion by destroying the B-
lymphocytes precursors found within the bursa of Fabricius, followed by bursal atrophy.
The virus is ubiquitous, highly stable in the environment and has a tendency to persist in
the environment despite thorough cleaning and disinfection, thus IBDV is endemic in
most poultry producing areas of the world. IBD is one of the major economically
important diseases of poultry worldwide despite wide usage of vaccination programs.
Most commercial chickens are exposed to IBDV early in life. In unprotected flocks, the
virus causes mortality and immunosuppression. Although mortality can be quite
significant, the major economic loss is the ability of IBDV to produce
immunosuppression. Immunosuppressed flocks have poor performance which results in
reduced economic return (230)
Controlling infectious bursal disease (IBD) and its associated immune suppression
is critical to the broiler industry. This control is achieved by either vaccinating breeder
hens with conventional live attenuated and/or inactivated IBD vaccines, or by the use of
live IBD vaccines in broiler chicks, layers or young pullets to provide active protection
against IBDV, or a combination of both strategies may be used.
There is significant antigenic, immunogenic, and pathogenic variation between
IBDV strains which determines disease outcome. Some IBDV strains cause an
![Page 16: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/16.jpg)
2
immunosuppressive, subclinical form of disease with less than 5% mortality, while others
can cause a clinical form with up to 100% mortality such as very virulent strains. The
clinical signs and the degree of immunosuppression can also vary significantly.
Vaccination is the primary means for control; and thus most efforts for protection against
IBDV by the commercial poultry industry are focused on developing efficient
vaccination programs. Successful immunization requires reliable IBDV field and vaccine
strain characterization.
The first project was designed to detect of IBDV RNA from formalin fixed
paraffin embedded tissues from field cases that showed signs of IBDV or
immunosuppression. Characterization of extracted RNA allows direct correlation
between viral identity and lesions present in infected tissues. Molecular identification of
the hypervariable region of VP2 allows for strain identification which when aligned with
sequences of vaccine strains will be a tool that can assist veterinarians in choosing which
vaccines to include in their control programs against IBDV. This technology has the
ability to detect newly emerging viruses that have a unique genomic sequence. For
example, one strain of IBDV missing 21 amino acids from the hypervariable region was
able to replicate and produce very severe lesions. Detection of unique viruses that differ
from available vaccine strains can lead to use of these strains for vaccine development in
the future.
Our second goal was to explore optimal RNA extraction from formalin fixed
paraffin embedded tissue as well as refine detection of IBDV by use of
immunohistochemistry. We sought to investigate the effect of various fixing and storage
conditions on RNA extraction and real time RT-PCR identification of IBDV from
![Page 17: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/17.jpg)
3
paraffin embedded tissues as well as the immunohistochemistry (IHC) detection of IBDV
in the infected tissues. Bursa of Fabricius from experimentally exposed chickens with
histopathological lesion scores of +3 or more were always positive for extracted RNA
and identification of IBDV with real time RT-PCR. However, this was not always the
case for bursal tissues that originated from field submissions. Some samples that had
acute +4 lesion scores histologically were negative for IBDV with real time RT-PCR.
This finding occurred more often in samples submitted from outside the United States
than those originating from the United States. The cause of the discordance between
severe histologic lesions and negative RT-PCR results is unknown. We hypothesized that
differences in sample collection and storage methods might be partially responsible. We
assumed that samples are fixed in 10 % buffered formalin and kept at room temperature,
but pH analysis, and microscopic artifacts suggests otherwise as some of the samples
were fixed in 37% formalin with pH 2.4 or were subjected to high temperatures. We
experimentally simulated these field conditions in terms of storage time, storage
temperature, pH of unbuffered formalin, and different concentrations of buffered
formalin to test their effect on RNA extraction from paraffin embedded tissue from a
known positive sample.
Out third aim was to produce a recombinant protein or polypeptide from IBDV
genomic material extracted from formalin fixed paraffin embedded tissue (FFPET)
without actual manipulation of live or killed virus particles. This will allow us to use
archival FFPET as a valuable source of genomic material for production of proteins or
actual viruses using reverse genetics. Our focus is on protein production and not reverse
genetic reproduction of viruses. This method may allow us to produce an efficient subunit
![Page 18: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/18.jpg)
4
vaccine to IBDV in a system that would enable mass production for vaccination of
chickens against IBDV.
We are hopeful our work may lay the foundation for improving current techniques
developed for rapid characterization of IBDV field isolates and determining their
antigenic properties. Production of a subunit vaccine that provides effective protection
against IBDV, will allow differentiation between vaccinated birds and field challenged
birds which may provide another tool to controlling this disease by the commercial
poultry industry.
![Page 19: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/19.jpg)
5
Chapter II
Literature Review
Part 1: Infectious Bursal Disease
Infectious bursal disease virus (IBDV) is the etiological agent of Gumboro disease
or infectious bursal disease (IBD). IBD is an acute and highly contagious viral disease of
young chickens. This virus causes severe immunosuppresion by destroying the B-
lymphocytes precursors found within the bursa of Fabricius, followed by bursal atrophy.
The IBD virus is ubiquitous, highly stable and may persist in the environment despite
thorough cleaning and disinfection, thus IBDV is endemic in most poultry producing
areas of the world. There are two serotypes of IBDV: 1 and 2. All viruses capable of
causing disease in chickens belong to serotype 1, whereas serotype 2 viruses are non-
pathogenic for both chickens and turkeys (112, 157). Chickens are the only avian species
known to be susceptible to clinical disease and lesions produced by IBDV. Turkeys,
ducks and ostriches are susceptible to infection with IBDV but are resistant to its clinical
manifestations (148, 158). IBDV has also been isolated from African black-footed and
Macaroni penguins and have been serologically identified as serotype 2 IBDV (71), and
further confirmed as serotype 2 by molecular identification (115).
IBD is one of the major economically important diseases of poultry worldwide
despite wide usage of vaccination programs. Most commercial chickens get exposed to
IBDV early in life. In unprotected flocks, the virus causes mortality and
immunosuppression. Although mortality can be quite significant, the major economic
![Page 20: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/20.jpg)
6
concern is the ability of IBDV to produce immunosuppression. Immunosuppressed flocks
have poor performance and show reduced economic return (211).
1.1 History:
Infectious bursal disease (IBD) was first reported by Cosgrove in 1957. It was
initially recognized as “avian nephrosis”, and the syndrome became known as “Gumboro
disease” because the first outbreaks occurred in the town of Gumboro, Delaware, USA.
The clinical picture of the syndrome includes white or watery diarrhea, followed by
anorexia, depression, trembling, severe prostration, and death. At necropsy, gross
pathology findings commonly include dehydration, leg and thigh muscles hemorrhages ,
urate deposits in kidneys and enlargement of the bursa of Fabricius (37).
Initially avian nephrosis or Gumboro disease was thought to be caused by the
Gray strain of infectious bronchitis virus (IBV) because of gross changes in the kidney.
This misconception arose because the IBV and IBDV infections were concurrent in many
cases and IBDV was difficult to isolate with the available methods at the time of
discovery (135). In later studies, Winterfield et al (256), succeeded in isolating the
causative agent in embryonating eggs, and later Hitchner proposed the term “infectious
bursal disease” for the disease (85).
In 1972, it was reported that IBDV infections at an early age were
immunosuppressive (1). The recognition of this immunosuppressive capability of IBDV
greatly increased the interest in the control of this disease. The existence of serotype 2
IBDV was reported in 1980 (156).
The Delmarva Peninsula broiler growing area experienced a significant increase
in mortality and higher percentage of condemnations in 1984 and 1985. The clinical
![Page 21: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/21.jpg)
7
syndrome had significant variability, but often was respiratory in nature. Lesions ranged
from moderate to severe, with death usually being attributed to E. coli infection (38).
Rosenberger et al. isolated four isolates designated as A, D, G, and E using vaccinated
sentinel birds (205). These isolates differed from standard strains in that they produced a
very rapid bursal atrophy associated with minimal inflammatory response. The available
killed standard vaccines did not provide complete protection against these four new
Delaware isolates. The Delaware isolates, A, D, G and E were designated as antigenic
variants and killed vaccines were developed, tested and proven effective against them
(205). Currently these and other similar variants are widely distributed in the United
States (220, 221). Snyder et al. first described variant viruses as newly emergent viruses
due to a major antigenic shift within serotype 1 (221, 223). The terminology given to
these newly emergent viruses was “IBDV variants” as they were the result of a major
antigenic shift within serotype 1 (224, 221), while the older serotype 1 viruses discovered
prior to these newly emergent viruses were called standard or classical strains of IBDV.
Acute IBDV outbreaks exhibiting 30% to 60% mortality in broiler and pullet
flocks, respectively, have been commonly reported in Europe since 1987. The first
reports were made by Chettle et al. (32), and van den Berg et al. (243). Some of these
acute outbreaks occurred in broiler flocks where appropriate hygienic and prophylactic
measures had been taken. Although no antigenic drift was detected, these strains of
increased virulence were identified as very virulent IBDV (vvIBDV) strains (242, 243).
The European situation has been dominated for a decade by the emergence of vvIBDV
strains. These strains have now spread all over the world (57). In the Americas, acute
IBD outbreaks due to vvIBDV strains have already been reported in Brazil (46, 93), and
![Page 22: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/22.jpg)
8
the Dominican Republic (5). To date the terminology given to serotype 1 IBDV is
standard or classic, variant, and very virulent IBDV.
1.2 Etiology:
The Birnaviridae family includes three genera: Genus Aquabirnavirus (type
species: infectious pancreatic necrosis virus or IPNV), Genus Avibirnavirus (type
species: Infectious Bursal Disease Virus or IBDV), and Genus Entomobirnavirus (type
species: Drosophilla X virus or DXV) (49). IBDV is a small, non-enveloped virus whose
genome consists of two segmented dsRNA segments (121). These two segments were
designated A and B. Other birnaviruses have been isolated from bivalve mollusks such as
Tellina virus (235), and Oyster Virus (49, 128), and Japanese eels(138). To date, there
has been no report of Birnavirus capable of causing disease in mammals, although dogs
have been found to be carriers for vvIBDV (233).
The virion has a single capsid shell of icosahedral symmetry composed of 32
capsomeres and a diameter of 60 to 70 nm (49, 73, 81, 176). By cryomicroscopy, it was
shown that the IBDV capsid is an icosahedron with a T = 13 lattice composed of trimeric
subunits. The outer face of the particle is composed of 260 trimeric VP2 clusters. Closely
apposed to the inside of this protein layer are 200 Y-shaped trimeric VP3 structures (19,
29).
1.3 Viral genome structure and replication:
The genome of IBDV is formed by two segments of double-stranded RNA
(dsRNA) with the two segments detected by polyacrylamide gel electrophoresis (49,
103). The molecular weight of the double stranded segment A is 2.2 x 106 Da with a
length of approximately 3.2 kb, while the molecular weight of the double stranded
![Page 23: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/23.jpg)
9
segment B is 1.9 x106 Da with a length of approximately 2.8 kb (166, 92).
The larger segment A contains two partially overlapping open reading frames.
The first encodes a nonstructural polypeptide of 17 kDa known as VP5, which is not
essential for replication in vitro but important for virus-induced pathogenicity (171. 172).
The second ORF encodes a 110 kDa polyprotein (NH3-VPX-VP4-VP3-COOH) that is
autoproteolytically cleaved into three polypeptides, VPX or pVP2 (48 kDa), VP3 (32
kDa) and VP4 (28 kDa). pVP2 is further processed to produce a polypeptide known as
VP2 (38 kDa) (4, 91, 119, 163). VPX, VP2, and VP3 are the major structural proteins
that form the virus capsid (19), while VP4 appears to be responsible for the proteolytic
maturation of the polyprotein (116, 119, 139).
Segment B encodes VP1, a 95-kDa protein which is the RNA-dependent RNA
polymerase responsible for the replication of the genome and synthesis of mRNAs (48,
226). VP1 shares a number of primary sequence features with RNA polymerases from
diverse origins (22).
There are direct terminal and inverted repeats at the 5’ and 3’ ends in both genome
segments of IBDV that are likely to contain important signals for replication,
transcription and packaging. It is not known whether virulence variations are due to
mutations in these regions (173). The inverted adjacent repeats at the 3’ terminus on
segments A and 5’ terminus on segment B have the potential to form stem and loop
secondary structures (120), which are involved in the processes of RNA replication,
translation and encapsidation like other RNA viruses such as poliovirus (215).
The synthesis mechanism of both virus-specific ssRNA and dsRNA during
infection with IBDV has not been clearly determined. An RNA-dependent RNA
![Page 24: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/24.jpg)
10
polymerase has been demonstrated in IBDV (225). Genome-linked proteins have been
demonstrated in three different Birnaviruses, (165, 192, 202), indicating that they
replicate their nucleic acid by a strand displacement (semi conservative) mechanism (14,
161,226).
1.4 Viral Proteins:
Four mature viral structural proteins designated VP1, VP2, VP3 and VP4 are
detected in infected cells (9, 47, 176). A non-structural protein designated VP5 has been
identified, the function of this protein is under investigation, and was found to be non-
essential for viral replication in vitro (171, 172). Lombardo et al. reported that VP5 plays
an important role in in vivo virus egression and pathogenesis (146).
During the processing of the polyprotein precursor NH3-pVP2-VP4-VP3-COOH
into pVP2, VP3 and VP4, the existence of two sites, essential for the cleavage of the
VPX-VP4 and VP4-VP3 precursors respectively, has been reported (208). These
sequences are highly conserved among IBDV strains from both serotypes 1 and 2.
VP1, the RNA-dependent RNA polymerase of the virus, is present in small
amounts in the virion, both as a free polypeptide and covalently linked to the two double-
stranded RNA genomic segments as a genome-linked protein (VPg) ( 17, 119, 164). It
plays a key role in the encapsidation of the viral particles (147). Boots et al. reported that
enhanced virulence of vvIBDV is partly determined by its B-segment which encodes VP1
(17), particularly due to the presence of eight conserved amino acid differences (16).
VP2 is the most abundant among IBD viral proteins, accounting for 51% of the
virus proteins of the serotype 1 IBDVs. This protein is the major component of the viral
capsid, and is the host-protective antigen; with most of the neutralizing epitopes
![Page 25: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/25.jpg)
11
occurring in the hypervariable region (amino acids 224–314) of VP2 (17) i.e. VP2
contains the antigenic region responsible for the induction of neutralizing antibodies and
for serotype specificity (60). Rescue of recombinant IBDVs from chimeric A-segments
revealed that amino acids (at positions 253 and 284) within the hypervariable region are
responsible for the cell culture adaptation (18, 20, 140, 169, 247). The transition from the
precursor of VP2 (pVP2) to VP2 involves the cleavage of pVP2 near its C terminus (4).
VP2 has also been identified as an inducer of apoptosis (63).
VP3 which is a structural protein also, accounts for 40% of the virion proteins
(121). VP3 is found only on the inner surfaces of virus-like particles (152). This protein
plays a role in the assembly of viral particles, and packaging of the viral genome (33,
147, 153, 228). Chevalier et al. found out that what actually controls capsid assembly of
Infectious Bursal Disease Virus is the last C-terminal residue of VP3, glutamic acid 257
(33). VP3 is a group-specific antigen that is recognized by non-neutralizing antibodies,
some of which cross-react with both serotypes 1 and 2 (11). It is likely that the outer
subunits in the viral capsid consists of VP2, carrying the dominant neutralizing epitope,
and that the inner trimers consist of protein VP3, as it was shown that the IBDV capsid is
an icosahedron with a T = 13 lattice composed of trimeric subunits. The outer face of the
particle is composed of 260 trimeric VP2 clusters. Closely apposed to the inside of this
protein layer are 200 Y-shaped trimeric VP3 structures (19, 29).
VP4 is the viral protease involved in the processing of the precursor polyprotein
(4). It is a proteolytic enzyme-like protein, which uses a Ser-Lys catalytic dyad to act on
specific substrates and cleavage sites (15). The integrity of VP4 is essential for the
![Page 26: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/26.jpg)
12
proteolytic processing of the polyprotein (51, 116) and either itself, or through proteins
under its control, plays a role in the trans-activation of the synthesis of VP1 (15).
VP5 is a class II membrane protein with a cytoplasmic N-terminus and
extracellular c-terminus domain (146). VP5 was the last IBDV protein identified. This
protein is not essential for IBDV replication in vitro or in vivo (171), however, it plays an
important role in viral pathogenesis as a reverse genetics system with VP5 knockout
mutant did not cause bursal lesions after experimental infections (264). VP5 expression
results in the alteration of cell morphology, the disruption of plasma membrane and
drastic reduction of cell viability. VP5 acts as a death protein, modifying cell membrane
and promoting the release of newly formed IBD virions (146).
1.5 Natural and Experimental Hosts:
For many years, the chicken (Gallus gallus) was considered the only species in
which natural infections occurred (76), where all breeds of chicken are affected. White
Leghorns exhibit the most severe reactions and have the highest mortality rate. Turkeys
(Meleagris gallopavo) may be infected with serotypes 1 and 2 but do not exhibit clinical
signs of the disease (113, 158). There is, however, considerable potential for
immunosuppression or interaction with other diseases under commercial conditions in
turkeys (134). Serotype 2 was originally identified in clinically unaffected adult turkeys
in Ireland (156). Currently chickens and turkeys are considered the natural hosts of the
virus (148). Ducks (Cairina moschata) may develop IBDV infection and antibodies are
detectable by serum virus neutralization, but neither gross nor microscopic lesions have
been observed. Antibodies have been detected in wild birds like weavers (Ploceus
cucullatus), rooks (Corvus frugilegus) and finches (Uraeginthus bengalus) (27, 175) as
![Page 27: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/27.jpg)
13
well as in Antarctic adelaide penguins, but the source of IBDV exposure has not been
defined (65). The IBDV in African black-footed and Macaroni penguins has been
serologically identified as serotype 2 IBDV (71), and was confirmed molecularly as
serotype 2 IBDV by using reverse transcriptase polymerase chain reaction (RT-PCR) and
sequencing (115). Guinea fowl (Numida meleagris) inoculated with the virus did not
develop lesions or antibodies (184, 186). A serotype 1 virus was isolated from two 8-
week-old ostrich chicks (Struthio camelus) that had lymphocyte depletion in the bursa of
Fabricius, spleen, and/or thymus (148). van den Berg experimentally inoculated
pheasants (Phesanus colchicus), partridges, quails, and guinea fowl with vvIBDV and
reported no clinical signs or lesions in these species (240).
1.6 Transmission:
IBDV is highly contagious and the disease may be spread by direct contact
between infected and susceptible flocks. Infected chickens shed IBDV one day after
infection and can transmit the disease for at least 14 days. There are neither experimental
data nor naturally-occurring observations to suggest that IBDV is transmitted vertically
by the transovarian route (148).
Indirect transmission of virus most probably occurs on fomites (feed, clothing and
litter) or through airborne dissemination of virus-laden feathers and poultry house dust
(12); . IBDV is very persistent in the environment of a poultry house. Houses from which
infected birds were removed, were found to harbor infective virus 54 and 122 days later
(12). The lesser mealworms, Alphitobius diaperinus may be reservoir hosts (155, 219).
IBDV has also been isolated from Aedes vexans mosquitoes (89), and antibodies against
IBDV have been detected in rats found on poultry farms (185). No further evidence
![Page 28: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/28.jpg)
14
supports the conclusion that either mosquitoes or rats act as vectors or reservoirs of the
virus. Dogs have been found to be carriers for vvIBDV (233).
1.7 Resistance to chemical and physical agents: Without proper disinfection the
virus can survive on the premises for more than 4 months. The virus is extremely
resistant to disinfection and pH changes between pH 2-12. The virus remains viable
following incubation for 5 hours at 56 °C and 30 min at 60 °C. The infectivity can be
reduced by treatment with 0.5% formalin for 6 hours or 1% formalin for 1 hour (13).
1.8 Clinical forms of IBDV:
The classical form, as described since the early 1960s, is caused by the classic
moderately virulent strains of IBDV. The incubation period of IBD ranges from 2 to 4
days post exposure. One of the earliest signs of the classical infection in a flock is the
tendency for some birds to pick at their own vents. The disease also produces acute onset
of depression, reluctance to move, ruffled feathers, white or watery diarrhea, soiled vent
feathers with urates, trembling, closed eyes and prostration. The feed intake is depressed
but water consumption may be elevated. Severely affected birds become dehydrated and
in terminal stages of the disease have subnormal temperature, after which the bird dies
(37).
The variant form, described initially in the United States, is caused by variant
strains, such as the Delaware variants or GLS strains, which partially resist neutralization
by antibodies against the so-called “classic” or standard strains (220).
The acute and very virulent form, described initially in Europe, and then spread to
Asia, Africa and some countries in Latin America, is caused by hypervirulent strains of
IBDV, and it is characterized by an acute progressive clinical disease, leading to high
![Page 29: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/29.jpg)
15
mortality rates on affected farms. The initial outbreaks in Europe were characterized by
high morbidity usually approaching 100% and mortality reaching 20-30% in broilers and
60% in pullets over a 7-day period (32), (179). Several isolates of vvIBDV caused
mortality rates of 90-100% in 4-week old susceptible leghorn chickens (243)
1.9 Gross lesions:
Chickens which die from IBD infection as a primary cause show dehydration of
the subcutaneous fascia and musculature of the thigh, inguinal and pectoral areas (37,
148). Age-related coagulation disorders coincide with the mortality and lesion severity.
Insignificant changes in birds infected with field IBDV isolates at 17 days were observed
compared to severe effects on birds infected at 42 days (228). Petechial hemorrhages
occur occasionally in the mucosa of the intermediate zone between the proventriculus and
the gizzard, as well as on leg, thigh and breast muscles. There is increased mucus in the
intestine. Kidneys show enlargement and pallor with accumulation of crystalline urate in
tubules (37). Renal lesions were more prominent in early outbreaks in the United States,
perhaps due to co-infection with nephropathogenic strains of avian infectious bronchitis
(Gray strain) (148).
The bursa of Fabricius is the primary target organ following exposure to IBDV
(34). When Cheville studied the bursal weights for 12 days postinfection, he noticed that
by the 2nd or 3rd day the bursa has a gelatinous yellow transudate covering the serosal
surface giving the bursa a creamy color instead of the normal white color. The bursa also
had prominent longitudinal striations on the serosal surface. By the 4th day after the
infection there was a doubling in size and weight of the bursa due to edema and
hyperemia. By the 5th day the bursa returns to normal weight, but it continues to atrophy,
![Page 30: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/30.jpg)
16
and from the 8th day forward it is approximately one-third its original weight (148).
Variant strains isolates have been reported that do not induce an acute inflammatory
response (205, 213). Although one variant strain (IN) was reportedly able to induce such
acute inflammatory response (74). The variant strain’s disease is primarily subclinical
resulting in immunosuppression. Field challenge is likely a result of mild or variant
strains of IBDV, such as Delaware variant E (107, 224).
Spleenomegaly has been documented, with small gray foci uniformly dispersed
through the parenchyma (148, 162). The vvIBDV strains cause greater decrease in thymic
weight index and more severe lesions in cecal tonsils, thymus, spleens, and bone marrow
when compared to moderately pathogenic strains of IBD virus, but the bursal lesions are
similar (148).
1.10 Histopathological lesions:
Histopathological lesions of IBD occur primarily in the lymphoid structures (i.e., cloacal
bursa, spleen, thymus, harderian gland, and cecal tonsil). Infection with standard or
variant serotype 1 IBDV strains can result in death of bursal B lymphocytes.
Degeneration and necrosis of lymphocytes in the medullas of bursal follicles can be
detected within one day of infection, and were soon replaced by heterophils, lymphocytes
associated with karyorrhexis and pyknosis, and hyperplastic stromal histiocytes. By the
third day an inflammatory response with edema, heterophil infiltration, congestion and
hemorrhage were present in infections due to standard strains. At this time the follicles
may be reduced to a necrotic center surrounded by heterophils. From the fourth day after
infection, the acute inflammatory reaction declines, and as necrotic debris were cleared
by phagocytosis, cystic cavities develop in the medullary areas of follicles; necrosis and
![Page 31: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/31.jpg)
17
phagocytosis of heterophils and plasma cells occur; and there may be fibroplasia in
interfollicular connective tissue and the covering epithelium becomes infolded and
irregular (6, 34, 199). Sharma et al (1989) observed that the infection with the variant A
strain did not result in an acute inflammatory response, and follicular lymphoid necrosis
was evident at three days after infection (213). The lack of inflammation associated with
variant infections may be due to the variant viruses killing B-lymphocytes by apoptosis
instead of necrosis (248).
The development of lesions by IBDV in thymus depends on the pathotype of the
virus (94, 231). IBDV-induced cortical thymic lymphocyte depletion is caused by
apoptosis (94). The highly pathogenic vvIBDV strains from Europe and Japan are
associated with severe thymic lymphocyte loss when compared to less pathogenic strains
(231). Although the thymus undergoes marked atrophy and extensive apoptosis of thymic
cells during the acute phase of virus infection, there is no evidence that the virus actually
replicates in T cells (230). Gross and microscopic lesions in the thymus are quickly
resolved and the thymus returns to its normal state within a few days of virus infection
(211).
The spleen may have hyperplasia of stromal histiocytes around the adenoid sheath
arteries in early stages of the infection, and lymphoid necrosis in the germinal follicles
and the periarteriolar lymphoid sheath by the third day (148). The Harderian gland may
also be affected. Normally, this gland is infiltrated and populated with plasma cells as the
chicken ages. Infection with IBDV prevents this infiltration (227). In cecal tonsils, there
may be acute heterophil inflammation, destruction of lymphocytes, and regeneration on
the fifth day after infection (76).
![Page 32: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/32.jpg)
18
Histological lesions in the kidney are nonspecific and probably occur because of
severe dehydration of affected chickens. Lesions observed consisted of large casts of
homogeneous material infiltrated with heterophils, and also glomerular hypercellularity
(76). The liver may have slight perivascular infiltration of monocytes (193).
The vvIBDV strains can cause severe lesions in the cecal tonsils, thymus, and
bone marrow (149). Bursal lesions caused by very virulent strains are even more severe,
and are characterized by cortical lymphocyte necrosis, depletion of medullary
lymphocytes with interstitial inflammation and hyperplasia of epithelial and reticular
cells. The thymus, spleen, liver, and bone marrow are also affected (79). Other very
virulent strains cause severe lysis of heterophil myelocytes with pyknotic nuclei (94).
Thymic cortical lymphocyte necrosis and depletion of lymphocytes are more severe when
caused by vvIBDV strains, than lesions caused by classical virulent strains (95).
1.11 Ultrastructural lesions in the bursa of Fabricius:
Naqi and Millar (174)followed the sequential changes in the surface epithelium of
the bursa of Fabricius of IBDV-infected chicks by scanning electron microscopy. Forty
eight hours post inoculation they observed a reduction in number and size of microvilli
on epithelial cells. There was gradual loss of the button follicles normally seen at the
surface, and by 72 hours, most had involuted. By 96 hours, there were numerous erosions
of the epithelial surface. The surface was intact by day 9 postinoculation, but follicles
were involuted, leaving deep pits.
![Page 33: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/33.jpg)
19
1.12 Diagnosis of IBDV:
1.12.1 Differential diagnosis:
Diagnosis of the clinical forms of IBD is based on typical signs of the disease and
on the histopathological lesions of the bursa of Fabricius. Differential diagnosis should
include velogenic viscerotropic Newcastle disease, chicken infectious anemia, vitamin K
deficiency and mycotoxicosis. In subclinical and immunosuppressive forms of IBD,
Marek’s disease, chicken anemia and mycotoxicosis should be considered (134, 148).
Due to the immunosuppressive nature of IBDV, it may serve as a predisposing factor to
other conditions, such as gangrenous dermatitis, hemorrhagic aplastic anemia syndrome,
inclusion body hepatitis, and respiratory disease. Involvement of IBDV in disease
complexes of these types is usually diagnosed retrospectively by demonstrating persistent
bursal lesions or serologic evidence of previous IBDV infection (206).
1.12.2 Histopathological diagnosis:
Diagnosis by histopathology of the bursa is frequently used, since the lesions
caused by IBDV infection is well characterized in the bursa (34, 199). This approach has
the advantage of giving valuable information about the virulence of the IBDV strain
involved and the possible time when the infection occurred. Virulence of IBDV strain is
measured by a lesion severity score, where a lesion score of 1 represented no lesions, 2
represented mild reduction in overall follicle size, 3 represented moderate reduction in
size of follicles, and 4 represented either necrosis or follicle atrophy. Time of infection is
calculated based on type of inflammatory cells present or type of inflammatory response
seen in tissue.
![Page 34: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/34.jpg)
20
1.12.3 Virus identification:
For virus identification, the agar gel precipitin (AGP) test can be used to detect
IBDV group-specific antigen. The virus-neutralization (VN) test could be used to identify
the virus in embryos or in tissue culture after adaptation to these host systems (206). An
antigen-capture enzyme-linked immunosorbent assay (AC-ELISA) has been described
for detecting and characterizing IBDV isolates (223). Polyclonal antibodies can also be
utilized in the AC-ELISA and may be more effective for general screening of tissue
samples for IBDV (148). Direct and indirect immunofluorescent assays as well as
immunocytochemistry have been shown to be highly reliable for detection of viral
antigens in infected tissues. (206).
Strains of IBDV can be differentiated on the basis of pathotype and antigenic
configuration. There are at least two distinct serotypes and several antigenic subtypes that
can be identified by cross-neutralization and cross challenge tests. Isolates of IBDV may
vary in pathogenicity from being nonpathogenic to virulent (108,122, 148).
1.12.4 Serological diagnosis:
Serologically the AGP test can be used to detect and quantitate antibodies in
convalescent birds. To quantitate the antibodies, usually two fold serum dilutions are
made to obtain an endpoint. The antigen is prepared from bursal homogenates of
experimentally infected birds collected 3-6 days postinfection (206). The virus
neutralization (VN) test is also used for antibody quantitation. The test is routinely
performed in microtiter systems using cell-culture-adapted virus and chicken embryo
fibroblasts. Neutralization titers are expressed as the reciprocal of the highest dilution of
serum that prevents cytopathic effect. The VN test is more sensitive than the AGP test
![Page 35: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/35.jpg)
21
and accordingly should be utilized when antibody titers are low or when quantitation of
antibody is important (206). But for the past decade enzyme-linked immunosorbent assay
(ELISA) has been widely used because it is a sensitive and rapid method. ELISA make it
easy to handle large number of samples and only requires small quantities of serum.
ELISA results do not always correlate with VN test findings. Using serological
techniques it is possible to detect the immunologic response in an outbreak or evaluate
vaccination programs (180).
1.12.5 Molecular diagnosis:
Molecular identification of IBDV has been used to diagnose IBDV. The reverse
transcription-polymerase chain reaction (RT-PCR) allows for the detection of viral RNA
from infected clinical samples (106, 137, 262). Using the RFLP procedure and BstN1 and
Mbo1 restriction enzymes (RE) IBDV were classified into 6 molecular groups (103, 105,
110). IBDV strains that do not match any of the 6 defined molecular groups have been
identified and in the USA 32 new molecular patterns have been found (111). Ikuta et al.
using 6 REs (DraI, SacI, StyI, TaqI and MvaI) classified IBDV into 20 molecular groups.
RT-PCR amplicons were also identified by sequencing (5, 7). Other molecular techniques
include the use of RNA probes (109, 114). Using real-time RT/PCR Sequence homology
or mutations were detected using real-time RT/PCR and four mutation probes. The
melting temperature (Tm) of the mutation probes is an indicator of sequence homology
(102). An in situ RT-PCR was developed to investigate early stages of infection in the
IBDV-infected BF (265). Extraction of fragmented viral genomic RNA from formalin-
fixed paraffin-embedded tissues allowed subsequent sequencing, classification, and when
![Page 36: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/36.jpg)
22
correlated with lesions present in those tissues histologically, allowed identification of
candidate vaccine viruses (188).
1.13 Immunity:
Infectious bursal disease virus is highly infectious and very resistant to
inactivation. Therefore, despite strict hygienic measures, vaccination is unavoidable
under high infection pressure and it is necessary to protect chickens against infection
during the first weeks after hatch. The immunization of breeder flocks is especially
important to confer passive immunity to their progeny (148). Antibodies transmitted from
the hen via the yolk of the egg can protect chicks against early infections with IBDV,
thus protecting against the immunosuppressive effect of the virus (148). Therefore, it is
important to induce high titers of maternally derived antibodies that persist over the
whole laying period in laying breeders, to do so breeder hens are vaccinated two times
once with a live vaccine and once with inactivated oil-emulsified vaccines or vaccinated
twice with inactivated oil-emulsified vaccines (86). After hatching, chickens are
immunized with live vaccines, and because maternal immunity interferes with
vaccination with live vaccines, the major problem with active immunization of young
maternally immune chicks is determining the proper time of vaccination. This
determination is aided by monitoring antibody levels in a breeder flock or its progeny
(242) or by formulas like the one developed by de Wit to determine best time of
vaccination(45). The titers may vary considerably within a flock and revaccinations may
be necessary. It has also to be taken into consideration that vvIBDV will break through
immunity provided by highly attenuated vaccine strains
![Page 37: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/37.jpg)
23
1.14 IBDV Vaccines:
1.14.1 Live vaccines:
It is well known that less attenuated strains may cause lesions in the bursa follicles
and cause immunosuppression even in vaccinated birds. To avoid live vaccine side
effects, a number of alternative vaccines have been produced. Examples include, a
subunit VP2 vaccine produced in yeast and an immune complex vaccine, composed of
the live vaccine virus complexed in vitro with antibodies (167). Satisfactory protection
against IBDV can be achieved by immunization with live or inactivated vaccines.
Classical live vaccines achieve lifelong and broad protection, but posses residual
pathogenicity and a proportional risk of reversion to virulence (241). Many choices of
live vaccines are available that differ in virulence and antigenic diversity. According to
virulence, vaccines are classified as mild, mild intermediate, intermediate, intermediate
plus, or hot. Vaccines that contain Delaware variants are also available (148). Ashraf et al
(3) studied the interactions between two antigenically similar strains of IBDV one being a
mild strain and the other being a pathogenic IBDV strain. They concluded that viral
interference occurs in live chickens, and that the most significant interference occurring
when infection with the mild and field strains occur 24 hr apart. This phenomenon might
be due to competition for host receptor sites or production of cytokine(s), and likely has
practical implications for vaccine usage and protection against IBDV (3).
1.14.2 Inactivated vaccines:
Killed vaccines in oil emulsions stimulate high levels of maternal immunity and
are extensively used in the field (148). Inactivated vaccines and live vaccines made from
variant strains protect chickens from disease caused by either variant or standard strains,
![Page 38: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/38.jpg)
24
whereas inactivated vaccines made from standard strains do not protect, or only partially
protect, against challenge with variant strains (99). To overcome this autogenous killed
vaccines are used by some companies to better prime their breeders (218). Very virulent
strains of IBDV can be controlled adequately under experimental conditions by
vaccination with commercial vaccines prepared from classical attenuated strains (56, 187,
242).
1.14.3 In-ovo vaccines:
In ovo vaccination may provide a way for vaccines to circumvent the effects of
maternal antibody and initiate a primary immune response (64, 69). An “immune
complex” vaccine has been developed, in which the vaccine virus is complexed in vitro
with an optimum amount of antibodies (167). These virus-antibody complex vaccines
seem very promising in protecting against IBDV(72). This new technology utilizes
specific hyperimmune neutralizing antiserum with a vaccine virus under conditions that
are not sufficient to neutralize the vaccine virus but which are sufficient for delaying the
pathological effects of the vaccine alone. This allows chicks to be vaccinated more
effectively in the presence of passive immunity even with a strain that would be too
virulent for use in ovo or at hatching (72, 86, 69).
1.14.4 Molecularly engineered vaccines:
IBDV VP2, expressed in yeast (197, 259), the baculovirus system (52, 151, 196,
217, 238), recombinant NDV vaccines (90) or via transgenic Arabidopsis thaliana plants
(257) have been studied for the use as subunit vaccines. An advantage of this technology
is that a vaccine based on VP2 alone should allow monitoring of the field situation by the
discrimination between antibody induced by vaccine (anti-VP2 only) and that induced by
![Page 39: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/39.jpg)
25
infection (anti-VP2 and VP3) (239). The use of a reverse genetics system could represent
a basis for the genetic attenuation of IBDV strains and for the generation of new
vaccines, although interference of passive immunity would still exist. Therefore,
recombinant viral vaccines expressing the VP2 protein, such as fowl pox virus (8),
herpesvirus of turkey (HVT) (44, 234), or fowl adenovirus (214) might be able to mount
an active immune response, as they are less sensitive to neutralization by anti-IBDV
maternally derived antibodies.
1.15 Antigenic variation of IBDV:
The high mutation rate of RNA viruses and the high selection pressure generated
by intensive vaccination of birds can lead to the emergence of viruses with new
properties allowing them to persist in immune populations. Historically, these mutations
have led to antigenic variation and modifications in virulence of circulating Infectious
Bursal Disease Virus (IBDV) strains. It is therefore essential to identify and characterize
new IBDV isolates as soon as they appear and compare them with previously described
viruses (239, 241). The capsid protein, VP2, is the major host protective immunogen.
Immunization of susceptible chickens with purified VP2 elicits neutralizing antibodies
and confers protection against homologous virulent virus challenge (11, 60). Three panels
of neutralizing monoclonal antibodies (mAbs) have been used in antigen capture enzyme-
linked immunosorbent assays (AC-ELISA) for antigenic characterization of serotype 1
isolates of IBDV (61, 62, 54). Neutralizing mAbs have been shown to bind to VP2 within
a restricted region, called the variable domain, between amino acids 206 and 350, which
is highly hydrophobic but has short hydrophilic regions at each end (7). Since this epitope
was denaturated by SDS, it was determined that is a conformationally-dependent epitope
![Page 40: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/40.jpg)
26
(4). Antigenic epitopes on VP3 protein have also been reported but these antibodies are
not completely neutralizing (4, 59). Antigenic diversity between IBDV serotypes has
been recognized when serotypes 1 and 2 were defined on the basis of their lack of in vitro
cross neutralization (156). Based on studies with monoclonal antibodies, IBDV strains
belonging to serotypes 1 and 2 have been found to not share major neutralizing epitopes
(9, 209). Polyvalent neutralizing antiserotype 1 monoclonal antibodies such as
monoclonal antibodies 1, 6, 7, 8 and 9 (54), monoclonal antibody 8 (222), and
monoclonal antibodies 6F6 and 7C9 (244) have been developed.
Antigenic differences have been shown within serotype 1, and the study of
different strains has led to dividing serotype 1 into six subtypes, differentiation based on
cross neutralization assays using polyclonal sera (108). Studies with monoclonal
antibodies demonstrated the presence of a number of modified neutralizing epitopes
among antigenically variant strains detected in the United States. Based on this evidence,
there may have been an antigenic shift in IBDV viruses in the US (224). There are a
minimum of at least five neutralization epitopes on the standard IBDV strains (e.g. D78
strain) as defined by the monoclonal antibodies 8, 179, B69, R63, and 10. Delaware
viruses have lost the B69 site, GLS viruses lack the B69 and R63 sites but has a
monoclonal 57 reactive site, the DS326 virus lacked the sites for monoclonal antibodies
B69, R63 and 179, the RS593 had the 179, 8 and 67 site only, while the AL2 variant
strain had 8, 57, 67 and 179 sites (222, 223). Thus based on the reactiveness with various
monoclonal antibodies, the IBDV viruses are antigenically grouped as classic or standard,
GLS Variant, RS593 variant, AL2 variant, Y2K Variant DS326 and Delaware type
variants (132, 237)
![Page 41: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/41.jpg)
27
Despite their enhanced pathogenic properties, the vvIBDV strains were
considered to be closely antigenically related to the standard strains such as the Faragher
52/70 strain, based on high cross-neutralization indices (56). Using neutralizing
monoclonal antibodies developed by Snyder to characterize US IBDV variants, van der
Marel studied twelve European isolates of IBDV. He detected no important differences
between the standard strain 52/70 and vvIBDV (246). Similar data was produced by
Oppling et al (187). However, Eterradossi et al. developed nine other monoclonal
antibodies and using these he detected modified binding and neutralizing properties
against French vvIBDV strains (54). All their monoclonal antibodies neutralized most
mild or intermediate vaccines strains, whereas two monoclonal antibodies did not
neutralize a French vvIBDV strain, US variant A, and the European strain Faragher
52/70. Based on their results, they suggested a neutralizing epitope may be altered in the
European vvIBDV strains, causing decreased antibody neutralization. This difference
could be used to differentiate vvIBDV strains (54).
1.16 Molecular basis of IBDV variability:
Sequencing of the VP2 gene of numerous different IBDV strains and escape
mutants confirmed that a hypervariable domain is responsible for antigenic variation
(187, 209, 237) and comparison of this region offers the best option for IBDV typing.
Therefore, the nucleic acid sequencing of genes coding for VP2 and subsequent
deduction of their predicted amino acid sequences is now commonly used for phylogeny.
The amino acid changes between strains are not evenly distributed throughout the open
reading frame but are clustered in certain regions. Most of the changes that occur in VP2
are located between amino acids 239 and 332 (7, 133, 237) whereas van den Berg et al.
![Page 42: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/42.jpg)
28
said this hypervariable region is between amino acids 206 and 350 (245). This highly
variable region falls entirely within those sequences of VP2 identified as the minimum
region required for reaction with virus neutralization monoclonal antibody 5 (60, 261).
Hydrophilicity profiling of this region showed that there are two hydrophilic
peaks at either ends of this region, the larger peak (Major peak A) from amino acids 212
to 224 and the other from amino acids 314 to 324 (Major peak B). These hydrophilic
regions have been shown to be important in binding of neutralizing antibodies and,
hence, are presumed to be a main part of the neutralizing domain (75, 209). It is
interesting that most of amino acid variations in this region fall within these two peaks (7,
133).
Variations in IBDV antigenicity depend on changes in hydrophilic peaks. The
serotype 2 strain 23/82 (209), the North-American antigenic variants A, E, GLS and
DS326 (75, 133, 237), and neutralization resistant escape mutants (209) all exhibit amino
acid changes in these hydrophilic peaks. Only differences in the intervening hydrophobic
domains are found between typical serotype 1 strains (237). A nucleotide sequence
comparison suggested that four amino acid alterations in the VP2 protein of the Delaware
F strain allowed this variant to escape neutralizing antibodies. These amino acids were
located at positions 213, 222, 318, and 323 (75). By restriction enzyme and amino acid
sequence analysis, point mutations have been detected at residues 222, 254 and 323.
Amino acid residues 222 and 254 are consistently mutated in the variant strains (50, 105).
Glycine is present in the standard strains, amino acid residue number 254, whereas the
variants have serine at this position (50, 104).
![Page 43: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/43.jpg)
29
Mundt (2005) showed by reverse genetics systems for IBDV, that amino acid
changes in these hydrophilic peaks was accompanied by loss or acquirement of
monoclonal antibody recognition sites (170). Vakharia et al. used monoclonal antibodies
to correlate antigenic variations with amino acid sequence substitutions in the
hypervariable region of VP2 (237). They found that the amino acid residue glutamine at
position 249 might be involved in the binding of neutralizing antibody B69, which
recognizes epitopes in standard strains. All the variant viruses have lysine instead of
glutamine at this position, and they escape binding with antibody B69. Using a
baculovirus expression system to synthesize all the structural proteins coded for in
segment A of the IBDV genome, Vakharia et al., produced virus like particles (236).
They mapped the antigenic sites by producing chimeric cDNA clones of IBDV using the
variant GLS plasmid as a backbone and inserting fragments from the D78 and Delaware
strains. At least two antigenic reactive sites are present on the surface of IBDV, one falls
between amino acid residues 222 and 249, and the other between 269 and 323.
In highly virulent strains three specific amino acid residues in VP2 have been
reported at position 222 (Ala), 256 (Ile), 294 (Ile) and 299 serine which differ from
classical strains (21). These substitutions are also present in other strains isolated from
other countries such as Bangladesh (98), Brazil (46, 93), China (28), Germany (266),
Israel (195), Japan (142), (262), Malaysia (36, 88), Nigeria (266), Taiwan (144), and
Vietnam (232). Positions 222-223 and 318-324 may be critical for the vvIBDV (55).
These three positions have been identified as “hot spots” for mutations in several escape
mutants resistant to selected neutralizing monoclonal antibodies (209, 244).
The role of VPl in the virulence of IBDV was unknown for a long time, only
![Page 44: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/44.jpg)
30
recently did Liu and Vakharia (2004) by the use of reassortant viruses recovered by use
of reverse genetics system discover the role VP1 plays in the virulence of IBDV in vivo.
They showed virulence was due to the effect of VP1 on viral replication kinetics in vivo
(145). The VP1 sequences of very virulent IBDV strains are genetically distinct from
those of classical virulent or attenuated strains thus, VP1 of vvIBDV constitutes a genetic
lineage distinct from that of classical virulent or attenuated strains and serotype 2 strains
as well (97).
Part 2: IBDV Pathogenesis and Immunosuppression:
2.1 IBDV Pathogenesis:
IBD is characterized by lesions in lymphoid organs, and in chicks older than 3
weeks is characterized by morbidity and in some cases death (213, 251). Chickens that
recover are severely immunosuppressed (1, 25, 84) due to the loss of B cells, especially
the developing B-cell population in the bursa of Fabricius. Only serotype 1 viruses cause
IBD, and pathotypes have been classified in increasing order of virulence as mild,
intermediate, variant virulent (in North America), classical virulent, very virulent (vv) or
hyper-virulent strains (241).
The mature bursa of Fabricius is the main target organ of IBDV as it is the source
for B lymphocytes in avian species. Bursectomized chickens did not develop clinical IBD
despite the presence of infection (79). The severity of the disease is directly related to the
number of susceptible cells present in the bursa of Fabricius; therefore, the highest age
![Page 45: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/45.jpg)
31
susceptibility is between 3 and 6 weeks, when the bursa of Fabricius is at its maximum
development. This age susceptibility is broader in the case of the vvIBDV strains (99,
100, 179).
After oral infection or inhalation, the virus replicates primarily in the lymphocytes
and macrophages of the gut-associated lymphoid tissues. From the gut, the virus is
transported to other tissues by phagocytic cells, most likely resident macrophages (211,
239). By 13 hours post-inoculation (h.p.i.), most bursal follicles are positive for virus and
by 16 h.p.i. a second more pronounced viraemia occurs with secondary replication in
other organs leading to disease and death (168). It is suggested that vvIBDV causes
similar disease signs to those of classical virulent strains with the same incubation time of
4 days but with an exacerbated acute phase (241, 255).
Actively dividing, surface immunoglobulin M-bearing B-cells are lysed by
infection (80, 83, 203), but cells of the monocyte-macrophage lineage can be infected in a
persistent and productive manner, and play a crucial role in dissemination of the virus
(24,96) and in the onset of the disease (127, 131, 212). The exact cause of clinical disease
and death is still unclear but does not seem to be related only to the severity of the lesions
and the bursal damage. Prostration preceding death is very similar to what is observed in
acute coccidiosis, and is reminiscent of a septic shock syndrome (241). The macrophage
could play a specific role in this pathology by exacerbated release of cytokines such as
tumor necrosis factor or interleukin 6 (127). Macrophages are known to be activated by
interferon gamma; increased secretion of interferon as has been demonstrated both in
vitro in chicken embryo cultures and in vivo in chickens after their infection with IBDV
(66, 67).
![Page 46: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/46.jpg)
32
In addition to causing necrosis in the lymphoid cells of the bursa, IBDV also
induces apoptosis (63, 130, 249). Apoptosis is characterized by cell shrinkage and
chromatin condensation and does not generate a local inflammatory response. Induction
of apoptosis in infected cells contributes to the pathogenesis of IBDV in the bursa (118,
183), chicken peripheral blood lymphocytes (248), and in the thymus (94, 230). Virally-
induced apoptosis can occur in cells in the absence of detectable virus (118, 178, 230). A
direct effect of viral proteins like VP2 and VP5 has been implicated in the induction of
apoptosis (63, 263). Apoptotic cells have also been observed in viral antigen-negative
bursal cells, underlining the possible role of immunological mediators in this process
(178, 230). And finally, apoptosis has also been observed in the proventriculus of IBDV
challenged SPF leghorn chickens (189).
2.2 IBDV Immunosuppression:
Most immunosuppression studies have been restricted to vaccine or classical
virulent strains of IBDV (201). Clinical and subclinical infections with IBDV may cause
suppression of both humoral and cellular immune responses (211). The first indication of
damage in the immune system was reported by Helmboldt and Gardner in 1964 (76). In
1970, Cho demonstrated that white leghorn chickens exposed to IBDV at one day of age
were consistently more likely to develop visceral tumors and nerve enlargement by
Marek’s disease virus (35). In 1972 it was reported that IBDV infection at an early age
was immunosuppressive, and severely depressed the antibody response to Newcastle
disease virus (1). IBDV replication in the bursa leads to extensive lymphoid cell
destruction in the follicular medullas and cortices (229). The acute lytic phase of the virus
is associated with a reduction in circulating IgM+ cells (83, 203). IBDV-exposed
![Page 47: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/47.jpg)
33
chickens produce suboptimal levels of antibodies against a number of infectious and
noninfectious antigens (62, 126, 260).
2.2.1 Humoral response to IBDV infection:
Only the primary antibody response is impaired, the secondary responses remain
intact (70, 203,213), and this humoral deficiency may be reversible (211). Although
destruction of Ig-producing B cells may be one of the principal causes of humoral
deficiency, other mechanisms are possible including the adverse effect of IBDV on
antigen-presenting and helper T cell functions (213). A paradox associated with IBDV
infections in chickens is that although there is immunosuppression against many antigens,
the response against IBDV itself is normal, even in 1-day-old susceptible chickens (216).
There appears to be a selective stimulation of the proliferation of B cells committed to
anti-IBDV antibody production (148).
2.2.2 Cellular immune response to IBDV infection:
T-cells are resistant to infection with IBDV (82, 62), and there is no evidence that
the virus actually replicates in thymic lymphocytes (213, 230). However, there is
evidence that in vitro mitogenic proliferation from T cells of IBDV exposed birds is
severely decreased. This mitogenic inhibition is likely mediated by macrophages,
however, how IBDV induces macrophages to exhibit this suppressor effect is not clear
(211). It has been suggested that T cells are induced during an IBDV infection in the
bursa, but phenotypic characterization is still required and (124, 125). Rodenberg et al.
studied changes in the T-cell subsets within the blood, bursa, spleen and thymus after
infection with classical virulent IBDV and suggested that, although the number of
immunoglobulin (Ig)M+ cells in the bursa and spleen decreased significantly, the relative
![Page 48: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/48.jpg)
34
proportions of CD4+ and CD8+ T cells did not change (203). Immunohistochemical
analysis of chicken lymphoid tissues to determine the location of the virus and various
leukocyte subsets showed an influx of T cells into the bursa (177, 251). Bursal CD4+ and
CD8+ αβ1-TCR+ cells increased (251), and some expressed the activation marker CD25
(the interleukin-2 receptor-a) (124). It still remains a matter of contention whether these
cells are a migratory or resident bursal population.
The number of CD4+ and CD8+ T cells increased after infection and were first
detected at the corticomedullary boundary of the bursa, probably reflecting their route of
entry (251). The cortico-medullary boundary is rich in arterioles and venules, which
allow migratory lymphocytes entry into the follicles in response to an appropriate chemo-
attractant(s). Although CD4+ T cells had increased by 7 d.p.i., their location was
restricted to the cortico-medullary boundary and the cortex, even though most IBDV+
cells were present in the medulla. Later, CD8+ T cells were detected throughout the
follicles. The presence of numerous T cells suggests that cell-mediated immunity has a
very important role to play in recovery from an infection with vvIBDV. Poonia and
Charan (198) reported consistently higher titers of IBDV in chickens lacking a fully
functional T-cell-mediated immune system. This increase in bursa T cells appears to be a
consequence of migration and not an artifact due to the loss of B cells or the result of an
expansion of resident T cells (251).
Sharma et al. (211) also detected a dramatic infiltration of T-cells in the bursa
during acute IBDV infection, accompanied by the abrupt drop in the number of IgM+
cells. By the seventh day of infection, the infiltrating cells were predominantly CD8+
lymphocytes. It was suggested that T-cells modulate the infection, limiting viral
![Page 49: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/49.jpg)
35
replication in the bursa in the early phase of the disease. They also promote bursal tissue
damage and delay recovery, possibly through the release of cytokines and cytotoxic
effects (135). Cytotoxic T cells may exacerbate virus-induced cellular destruction by
lysing cells expressing viral antigens. T cells may also promote the production of pro-
inflammatory factors, such as nitric oxide, increasing tissue destruction (211).
2.2.3 Innate immunity
The effect of IBDV on innate immunity is centered in the modulatory effect of
IBDV on macrophage functions. There is evidence that the in vitro phagocytic activity of
these cells is compromised (211).
2.3 Pathogenesis of vvIBDV:
As for vvIBDV, VP2 antigen was most prevalent in the bursa, followed by the
spleen and then the thymus, as reported for classical virus strains (231, 251). However,
the distribution of VP2 antigen within the bursa was different from that with less virulent
IBDV. VP2 antigen was first detected at the cortico-medullary boundary, which probably
corresponds to the site of viral entry. Migratory cells
(e.g. macrophages) probably carry vvIBDV to the bursa from the site of primary
replication (intestine), and once in the medulla, it is able to colonize individual follicles
(101, 255). It is widely accepted that IBDV primarily targets immature B cells located in
the bursal cortex. However, vvIBDV VP2 antigen was mostly present in the medulla, a
site where more mature B cells are found (190, 255); only later was UK661 strain of
IBDV disseminated into the cortex (255).
Rapid depletion of virus from the bursa is associated with distinctive spherical
bodies accumulating in the medulla that resembled highly phagocytosing, activated
![Page 50: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/50.jpg)
36
macrophages (252, 154). Macrophages appear to play a major role in the clearance of
dead (apoptotic and necrotic) cells and cell debris. A large accumulation of cells
expressing the macrophage marker KUL-01 and major histocompatability complex
(MHC) class II invariant chain was present around 3 to 4 d.p.i. (255). The corresponding
decrease in viral load could partly be related to the action of phagocytosing macrophages,
although also to the exhaustion of target cells. Depletion of medullary Bu-1+, IgM+ and
IgG+ cells, prior to their depletion from the cortex, and depletion of IgM+ cells before
IgG+ cells, is consistent with the suggestion that more immature B cells are preferred
targets, although it is important to note that both populations became depleted. This will
have profound consequences both for the immune responses against vvIBDV itself and
the consequent immunosuppression after viral clearance. The extended range of target
lymphocytes could partly explain the increased virulence of vvIBDV isolates (255).
After destruction of the bursal architecture by vvIBDV, Bu-1+ B cells begin to
return to the depleted bursal follicles by 14 d.p.i. However, very few cells with surface
IgM+ or IgG+ are detected with the monoclonal antibodies M1 and G1 (255). There is
also some bursal recovery of the IgM+ cell population at 14 d.p.i. with classical virulent
IBDV (123). The number of IgM+ cells were fewer than the Bu-1+ B cells which could be
due to that IBDV induced conformational changes in the Ig molecules resulting in
alterations in those epitopes recognized by the M1 and G1 monoclonal antibodies. IBDV-
induced changes in chicken IgM giving rise to a monomeric form in the circulation of
convalescent chickens (101). It was recently reported that only B cells expressing a
surface immunoglobulin are able to colonize bursal follicles, whereas those B cells with a
non-productive V-D-J recombination lacking Ig expression are deleted (194). This
![Page 51: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/51.jpg)
37
suggests that the Bu-1+ cells repopulating the bursa are likely to be non-functional and
will be subsequently deleted. The lack of expression of surface Ig on bursal B cells is
consistent with the convalescent chick being severely immunocompromised (101). Lack
of Ig-producing B cells would explain the poor antibody response to secondary antigenic
challenge in chickens recovering from IBDV infection. The situation after vvIBDV
infection seems likely to be far more severe than with less virulent strains ( 25, 77).
An important aspect of the pathogenesis and clinical disease caused by vvIBDV is
the involvement of other lymphoid organs (94). The extensive damage in the thymus
caused by UK661 IBDV strain was far greater than that reported for classical virulent
stains (231). At the height of thymic pathogenesis much of the cortex contained pyknotic
nuclei within large vacuolated spaces, many of which merged. This suggests either that
vvIBDV has a direct apoptotic or necrotic effect on thymocytes (118) or that cell death is
due to bystander activity (254). Lesions in the spleen were less evident and the transient
nature of detectable virus may be related to lymphocyte and macrophage populations
restricting the spread of the IBDV (255). The spleen is the major secondary lymphoid
organ in the chicken where most systemic T-cell and B-cell responses are initiated. The
B-lymphocyte population was most severely affected, suggesting that peripheral B cells
are highly susceptible to vvIBDV. This further supports the notion that immature B cells
are not the only targets for vvIBDV, as both IgM+ and IgG+ B cells decreased. The IgM+
cell population recovered in the spleen, reaching a higher number than before infection,
in association with germinal centers. This is most probably a consequence of expansion
of the peripheral B-cell pool and not due to seeding from the bursa. The IgG+ population
also recovered and was associated with germinal centers, suggesting isotype switching of
![Page 52: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/52.jpg)
38
the IBDV-reactive IgM+ population. The lack of bursal architecture (and probably
function) and the increase in splenic IgM+ and IgG+ cells is consistent with the B-cell
compartment being severely suppressed, while at the same time IBDV-reactive B cells
are present (10, 200). The T-cell compartment within the spleen seemed to be unaffected
after infection (255).
In the thymus, IBDV antigen was only transiently detected at 4 to 7 d.p.i. The
rapid depletion of Bu-1+ medullary B cells probably follows the loss of viral target cells
and restricted viral distribution. Few, if any, Bu-1+, IgM+ or IgG+ cells were detected in
the thymic cortex even though VP2 antigen was detected there. The presence of IBDV
antigen on the surface of numerous, adjacent cortical thymocytes suggests that IBDV is
able to adhere to immature T cells. However, it seems unlikely that IBDV directly infects
and replicates within these cells as Hirai and Calnek were unable to show replication of
IBDV in chicken T cells (80). The proportion of CD4+ and CD8+ T cells in the thymus
altered little following infection.
Part 3: Pichia Pastoris
3.1 Introduction:
Geneticists have learned how to manipulate DNA, to identify, move and place
genes into a variety of organisms that are quite different from the source organism. A
major use for many of these recombinant organisms is to produce proteins. Since many
proteins are of immense commercial value, numerous studies have focused on finding
ways to produce them efficiently and in a functional form. Escherichia coli have been the
choice of researchers for several reasons. It is a single-celled organism that reproduces
![Page 53: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/53.jpg)
39
mainly through asexual reproduction. The organism’s simplicity makes it easy and cheap
to work with. Its food source is simple, and it does not require elaborate facilities for
growth and maintenance. Its rapid growth cycle allows for a quick increase in the
population size of a particular strain, as an Escherichia coli population can double in less
than an hour. In addition to its own circular DNA, Escherichia coli have plasmids that
complement the main segment of DNA. Plasmids are easy to isolate and manipulate. The
plasmid can be removed, a desired gene can be inserted into it, and the plasmid can be
reintroduced into Escherichia coli. The Escherichia coli will then produce the foreign
protein as if the protein were native to the bacteria. In order to express protein, a
promoter from the host needs to be located immediately in front of gene to be expressed.
The promoter regulates when, how much and how often the gene is transcribed. The
simplicity of Escherichia coli makes it a desirable host for production of a foreign
protein; however, it also has its disadvantages as a prokaryote. All prokaryotes do not
have any of the membrane bound organelles found in eukaryotes. In eukaryotes a protein
is often post-translationally modified in different organelles, such as the endoplasmic
reticulum or the Golgi apparatus. Modifications often involve addition of different forms
of glycosylation. Any eukaryotic protein can be mass translated in Escherichia coli , but
many are not quite finished and hence, they are nonfunctional. Escherichia coli will give
the same primary structure, as occurs when that protein is initially produced in its own
cell type. However, the failure to modify that structure often means that the protein will
not form as it would with the presence of certain organelles. Because of the problems
encountered when using a prokaryote to produce eukaryotic products, researchers sought
suitable eukaryotic replacements like mammalian, insect and yeast cells. Of these three
![Page 54: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/54.jpg)
40
eukaryotic expression systems, yeast cells are the most desirable, as they combine the
ease of genetic manipulation and rapid growth characteristics of a prokaryotic organism
with the subcellular machinery for performing post-translational protein modification of
eukaryotic cells (41).
The yeast Saccharomyces cerevisiae has been popular with molecular biologists,
and many proteins have been produced using it as a protein expression system. S.
cerevisiae has several limitations, as its product yields are low, often reaching a
maximum of 1-5 percent of total protein yield. Additionally, the presence of foreign gene
products puts stress on the cells. The production of the protein during the growth phase
hinders growth. Even the use of inducible plasmid promoters to achieve a partial
separation between the growth and protein production phase, has not been effective due
to the instability of the plasmid (23). Besides the difficulties encountered with scaling up
protein production to get better yields, several reports have noted the hyperglycosylation
of secreted glycoproteins which may cause differences in immunogenicity and
diminished activity. Also, many of the secreted proteins of S. cerevisiae are not found
free in the medium, but rather in the periplasmic space. This leads to problems with
purification and further decreases product yield (23).
Pichia pastoris was discovered 30 years ago when Koichi Ogata discovered its
ability to utilize methanol as a sole source of carbon and energy (181). Because methanol
could be inexpensively synthesized from natural gas (methane), there was immediate
interest in exploiting these organisms for the generation of yeast biomass or single-cell
protein (SCP) to be marketed primarily as a high protein animal feed. However, the oil
crisis of the early 1970’s increased the price of methane drastically along with drop of
![Page 55: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/55.jpg)
41
soybean prices rendered this goal unpractical. Use of Pichia pastoris as an alternative
species to S. cerevisiae in molecular biology was appealing, as growth protocols were
similar in both species. Also because P. pastoris has a strong inducible promoter that can
be used for protein production. P. pastoris is capable of generating post-translational
modifications such as proteolytic processing, folding, disulfide bond formation, and
glycosylation that are more similar to human protein modifications than S. cerevisiae was
capable of doing (43). Thus, many proteins that end up as inactive inclusion bodies in
bacterial systems are produced as biologically active molecules in P. pastoris. The P.
pastoris system is also generally regarded as being faster, easier, and less expensive to
use than expression systems derived from higher eukaryotes, such as insect and
mammalian tissue culture cell systems, and usually gives higher expression levels (78).
The production of a functional protein is intimately related to the cellular machinery of
the organism producing the protein. The yeast Pichia pastoris is a useful system for the
expression of milligram-to-gram quantities of proteins for both basic laboratory research
and industrial manufacture. The fermentation can be readily scaled up to meet greater
demands, and parameters influencing protein productivity and activity, such as pH,
aeration and carbon source feed rate, can be controlled (78). Compared with mammalian
cells, Pichia does not require a complex growth medium or culture conditions, is
genetically relatively easy to manipulate, and has a eukaryotic protein synthesis pathway.
Because of these characteristics, some proteins such as G protein-coupled receptors that
cannot be expressed efficiently in bacteria, S. cerevisiae or the insect cell/baculovirus
system, have been successfully produced in functionally active form in P. pastoris (30,
141). Pichia can be grown to very high cell densities using minimal media (250, 253) and
![Page 56: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/56.jpg)
42
integrated vectors help genetic stability of the recombinant elements, even in continuous
and large-scale fermentation processes (204). Simple purification and isolation of a
recombinant protein is facilitated by the fact that P. pastoris does not secrete a lot of its
own proteins (41). Therefore, the powerful genetic techniques available, together with its
economy of use, make P. pastoris a system of choice for heterologous protein expression.
So, what began more than 20 years ago as a program to convert abundant methanol to a
protein source for animal feed has developed into what are today two important
biological tools: a model eukaryote used in cell biology research, and a recombinant
protein production system. Pichia has gained widespread attention as an expression
system because of its ability to express high levels of heterologous proteins. As a result,
recombinant vector construction, methods for transformation, selectable marker
generation, and fermentation methods have been developed to exploit the productive
potential of this system (207).
Research Corporation Technologies (Tucson, AZ, USA) are the current holders of
the patent for the P. pastoris expression system, which they have held since 1993, and the
P. pastoris expression system is available in kit form from Invitrogen Corporation
(Carlsbad, CA, USA).
3.2 Methanol metabolism in Pichia
Methylotrophic yeasts are able to utilize methanol as the sole carbon and energy
source. All such strains identified to date belong to only four genera: Hansenula, Pichia,
Candida and Torulopsis (58). They all share a specific methanol utilization pathway
involving several unique enzymes. The initial reactions take place in specialized
microbodies (the peroxisomes) followed by subsequent metabolic steps in the cytoplasm.
![Page 57: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/57.jpg)
43
Peroxisomes play an indispensable role during growth, as they harbor the three key
enzymes for methanol metabolism, viz. alcohol oxidase, catalase and dihydroxyacetone
synthase. The proliferation of peroxisomes is a reflection of environmental conditions.
When the cells are grown on glucose, very few peroxisomes are present. When grown on
methanol, peroxisomes may take up to 80 percent of the total cell volume. Previous
results clearly show that the alcohol oxidase promoter is both tightly regulated and is a
strong promoter. The production of foreign protein can be repressed until the culture is
saturated with colonies, and then the production of the foreign protein can begin with the
de-repression and induction of the gene. The subsequent reactions of methanol
assimilation and dissimilation are localized in the cytosol. The methanol metabolism is
fully described by Cereghino and Cregg (31, 5, 117), Jahic and Gellissen (68).
3.3 Methanol utilization phenotypes:
There are three phenotypes of P. pastoris host strains with regard to methanol
utilization. The Mut+, or methanol utilization plus phenotype, grow on methanol at the
wild-type rate and require high feeding rates of methanol in large-scale fermentations
(31). The Muts, or methanol utilization slow phenotype, have a disruption in the AOX1
gene. Since the cells must then rely on the weaker AOX2 for methanol metabolism, a
slower growing and slower methanol utilization strain is produced. Muts strains have
been found to be advantageous for production of hepatitis B surface antigen (40). The
Mut-, or methanol utilization minus phenotype, are unable to grow on methanol, since
these strains have both AOX genes deleted. One of the advantages of this phenotype is
that low growth rates may be desirable for production of certain recombinant products
![Page 58: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/58.jpg)
44
(39, 40). Currently, the majority of researchers use the Mut+ phenotype (87, 217),
although some researchers are also using the Muts phenotype (2, 191).
3.4 The Pichia Expression System:
The expression of any foreign gene in P. pastoris comprises three principal steps:
(a) insertion of the gene into an expression vector; (b) introduction of the expression
vector into the P. pastoris host; and (c) examination of potential strains for the expression
of the foreign gene (31, 41, 129)
The majority of heterologous protein production in P. pastoris is based on the fact
that enzymes required for the metabolism of methanol are only present when cells are
grown on methanol (53). This has been the most successful system reported for this
organism (141). The AOX promoters have been the most widely utilized promoters;
however, other promoter options are available for the production of foreign proteins in
Pichia, (31).
3. 4.1 Promoters:
One of the drawbacks with S. cerevisiae was that it did not have a strong
inducible promoter. Pichia pastoris has a strong inducible promoter. This inducible
promoter is related to the fact that P. pastoris is a methylotrophic yeast. The first step in
the utilization of methanol is the oxidation of methanol to formaldehyde and hydrogen
peroxide (136). This step is catalyzed by the enzyme alcohol oxidase. The expression of
this gene is tightly regulated. When the yeast is grown on glucose or ethanol, alcohol
oxidase is not detectable in the cells. However, when the yeast is grown on methanol,
![Page 59: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/59.jpg)
45
alcohol oxidase can make up to thirty-five percent of the total cellular protein. The
control of the amount of alcohol oxidase is largely transcriptional (42).
There are two alcohol oxidase genes: AOX1 and AOX2. The protein coding
regions of the genes are largely homologous, 92 percent and 97 percent at the nucleotide
and amino acid sequence levels respectively (182). The promoters share very little
homology. No mRNA of the two genes is detectable when the yeast is grown in glycerol.
The promoter region for AOX2 has a repressor region that leads to the inhibition of gene
expression, and an activation region that leads to the enhancement of gene expression.
The AOX1 gene promoter probably has a similar mechanism (182).
The AOX1 promoter has been the most widely reported and utilized of all the
available promoters for P. pastoris (141). One of the reasons that the constitutive GAP
(glyceraldehyde 3-phosphate dehydrogenase) promoter has not been widely used is the
belief that constitutive production of foreign proteins in P. pastoris may have cytotoxic
effects (160). However, recent studies have found not only that cytotoxic effects are not
necessarily observed, but also that production levels of a recombinant exo-levanase
(LsdB) using the GAP promoter were similar to those using the AOX1 promoter (160).
Combining the GAP and AOX1 promoters in a strain expressing human granulocyte-
macrophage colony-stimulating factor (hGM-CSF) resulted in a two-fold increase in
production of the recombinant protein (258). By using this combined promoter for
sequential expression of a constitutively produced enzyme required for post-translational
modification, an inducible recombinant protein can be modified to a specified form
within the fermentation process itself (26, 258).
![Page 60: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/60.jpg)
46
The YPT1 [a small GTPase involved in secretion] (210) and PEX8 [a peroxisomal
matrix protein] (143) promoters have not been widely used, probably because of their low
expression levels, since the goal of the majority of researchers using the P. pastoris
expression system is to obtain maximum amounts of expressed foreign proteins (31).
Other promoters include the AOX2 promoter (39), FLD1 promoter (250) and the ICL1
promoter (159).
3.4.2 Selectable markers:
All P. pastoris expression strains are derived from NRRL-Y11 430 (Northern
Regional Research Laboratories, IL, USA), the wild-type strain. One or more auxotrophic
mutants are often present in these strains, allowing for selection during transformation of
strains containing the appropriate selectable marker gene. A number of selectable marker
genes are known for the molecular genetic manipulation of P. pastoris, they include HIS4
(histidinol dehydrogenase gene), ARG4 (argininosuccinate lyase gene), ZeoR (zeocin
resistance gene), Blasticidin S deaminase gene, ADE1-PR-
amidoimidazolesuccinocarboximide synthase, URA3-orotidine 5 -phosphate
decarboxylase and SorR-acetyl-CoA carboxylase (31).
The genetic manipulation of P. pastoris for the production of various
heterologous proteins is simplified by the use of a wide range of selectable markers and
promoters. Choosing the correct markers and promoters is essential for obtaining a high
productivity (150).
3.5 Post-translational modifications:
The post- translational modifications made by P. pastoris are more suitable for
use in humans. The structure of carbohydrate added to secreted proteins is known to be
![Page 61: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/61.jpg)
47
very organism specific. Many proteins secreted from S. cerevisiae have been
demonstrated to be antigenic when introduced into mammals thus; the use of
glycoprotein products synthesized by yeast for therapeutic purposes has been avoided. A
comparison of a S. cerevisiae protein secreted from S. cerevisiae and P. pastoris has
shown distinct differences between N-linked oligosaccharide structures added to proteins
secreted from these yeast. The majority of the N-linked oligosaccharide chains are high
mannose. However, the length of the carbohydrates chains is much shorter in P. pastoris.
Even the longest chains of protein produced in P. pastoris contained only approximately
thirty mannose residues, which is significantly shorter than the 50 to 150 mannose
residue chains typically found on S. cerevisiae glycoproteins. The second major
significant difference between the glycolation by S. cerevisiae and P. pastoris is that
glycans from P. pastoris don't have alpha 1,3-linked mannose residues that are
characteristic of S. cerevisiae (41). The enzyme that makes alpha 1,3 linkages is alpha 1,3
mannosyl transferase and it is undetectable in P. pastoris. It is significant, because the
alpha 1,3 linkages on S. cerevisiae glycans are primarily responsible for the highly
antigenic nature of glycoproteins used for therapeutic products (41)
3.6 Production of heterologous proteins in P. pastoris:
The Pichia expression system has been widely used to produce a variety of
different heterologous proteins (31). P. pastoris grows on a simple mineral media and
does not secrete high amounts of endogenous protein. Therefore the heterologous protein
secreted into the culture is relatively pure and purification is easier to accomplish (58).
Cell growth is particularly important for secreted protein production in bioreactors, since
the concentration of the product in the extracellular medium is roughly proportional to
![Page 62: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/62.jpg)
48
the concentration of cells in the culture in many instances. The yields of proteins
expressed intracellularly in bioreactors are also high, due to the efficiency of the AOX1
promoter(31). Production of large amounts of heterologous proteins in shake-flask
culture is difficult, due to the limitations of volume, oxygen transfer, substrate addition
and an inability to monitor these factors efficiently (150). The use of bioreactors is
preferable, since all of these parameters can be monitored and controlled simultaneously,
allowing more efficient production of the desired heterologous protein. Cereghino et al.
reviewed the use of bioreactors for the production of recombinant proteins from P.
pastoris (30).
Pichia pastoris as a yeast expression system was chosen because it combines the
simplicity of prokaryotic growth requirements, growth potential and ease of manipulation
along with the post-translational modifications of eukaryotes to ensure that the expressed
protein is functional and has the proper conformation.
![Page 63: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/63.jpg)
49
References
1. Allan, W. H., J. T. Faragher, and G. A. Cullen. Immunosuppression by the
infectious bursal agent in chickens immunized against Newcastle disease. Vet
Rec: 511-512. 1972.
2. Aoki, H., M. Nazmul Ahsan, and S. Watabe. Heterologous expression in pichia
pastoris and single-step purification of a cysteine proteinase from northern shrimp.
Protein Expr Purif 31: 213-221. 2003.
3. Ashraf, S., G. Abdel-Alim, M. Q. Al-Natour, and Y. M. Saif. Interference between
mild and pathogenic strains of infectious bursal disease virus in chickens. Avian
Dis. 49: 99-103. 2005.
4. Azad, A. A., M. N. Jagadish, M. A. Brown, and P. J. Hudson. Deletion mapping
and expression in Escherichia coli of the large genomic segment of a Birnavirus.
Virology 161:145-152. 1987.
5. Banda, A., P. Villegas, J. El-Attrache, and C. Estevez. Molecular characterization
of seven field isolates of infectious bursal disease virus obtained from commercial
broiler chickens. Avian Dis 45:620-630. 2001.
6. Barnes, H. J., J. Wheeler, and D. Reed. Serologic evidence of infectious bursal
disease virus infection in Iowa turkeys. Avian Dis 26:560-565. 1982.
7. Bayliss, C. D., U. Spies, K. Shaw, R. W. Peters, A. Papageorgiou, H. Muller, and
M. E. Boursnell. A comparison of the sequences of segment A of four infectious
bursal disease virus strains and identification of a variable region in VP2. J Gen
Virol 71 (Pt 6):1303-1312. 1990.
![Page 64: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/64.jpg)
50
8. Bayliss, C. D., R. W. Peters, J. K. Cook, R. L. Reece, K. Howes, M. M. Binns, and
M. E. Boursnell. A recombinant fowlpox virus that expresses the VP2 antigen of
infectious bursal disease virus induces protection against mortality caused by the
virus. Arch Virol 120:193-205. 1991.
9. Becht, H. Infectious bursal disease virus. Curr Top Microbiol Immunol 90:107-
121. 1980.
10. Becht, H., and H. Muller. Infectious bursal disease-B cell dependent
immunodeficiency syndrome in chickens. Behring Inst Mitt 89: 217-225. 1991.
11. Becht, H., H. Muller, and H. K. Muller. Comparative studies on structural and
antigenic properties of 2 serotypes of infectious bursal disease virus. Journal of
General Virology 69:631-640. 1988.
12. Benton, W., M. S. Cover, and J. K. Rosenberger. Physiochemical properties of the
infectious bursal agent (IBA). Avian Dis 11:438-445. 1967.
13. Benton, W., M. S. Cover, and J. K. Rosenberger. Studies on the transmission of
the infectious bursal agent (IBA) of chickens. Avian Dis:430-438. 1967.
14. Bernard, J. Drosophila X virus RNA polymerase: Tentative model for in vitro
replication of the double-stranded virion RNA. J Virol 33:717-723. 1980.
15. Birghan, C., E. Mundt, and A. Gorbalenya. A non-canonical lon proteinase lacking
the ATPase domain employs the ser-lys catalytic dyad to exercise broad control
over the life cycle of a double-stranded RNA virus. Embo J. 19:114-123. 2000.
16. Boot, H., A. ter Huurne, and B. Peeters. Generation of full-length cDNA of the
two genomic dsRNA segments of infectious bursal disease virus. Journal of
Virological Methods 84:49-58. 2000.
![Page 65: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/65.jpg)
51
17. Boot, H. J., A. J. Hoekman, and A. L. Gielkens. The enhanced virulence of very
virulent infectious bursal disease virus is partly determined by its b-segment. Arch
Virol 150:137-144. 2005.
18. Boot, H. J., A. A. H. M. Ter Huurne, A. J. W. Hoekman, B. P. H. Peeters, and A.
L. J. Gielkens. Rescue of very virulent and mosaic infectious bursal disease virus
from cloned cDNA: VP2 is not the sole determinant of the very virulent
phenotype. J Virol. 74:6701-6711. 2000.
19. Bottcher, B., N. A. Kiselev, V. Y. Stel'Mashchuk, N. A. Perevozchikova, A. V.
Borisov, and R. A. Crowther. Three-dimensional structure of infectious bursal
disease virus determined by electron cryomicroscopy. J Virol 71:325-330. 1997.
20. Brandt, M., K. Yao, M. Liu, R. A. Heckert, and V. N. Vakharia. Molecular
determinants of virulence, cell tropism, and pathogenic phenotype of infectious
bursal disease virus. J Virol 75:11974-11982. 2001.
21. Brown, M. D., P. Green, and M. A. Skinner. VP2 sequences of recent European
very virulent' isolates of infectious bursal disease virus are closely related to each
other but are distinct from those of 'classical' strains. J Gen Virol 75 (Pt 3):675-
680. 1994.
22. Bruenn, J. A. Relationships among the positive strand and double-strand RNA
viruses as viewed through their RNA-dependent RNA polymerases. Nucleic Acids
Res 19:217-226. 1991.
23. Buckholz, R. G., and M. A. Gleeson. Yeast systems for the commercial production
of heterologous proteins. Biotechnology (N Y) 9:1067-1072. 1991.
![Page 66: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/66.jpg)
52
24. Burkhardt, E., and H. Muller. Susceptibility of chicken blood lymphoblasts and
monocytes to infectious bursal disease virus (IBDV). Arch Virol 94:297-303.
1987.
25. Butter, C., T. D. M. Sturman, B. J. G. Baaten, and T. F. Davison. Protection from
infectious bursal disease virus (IBDV)-induced immunosuppression by
immunization with a fowlpox recombinant containing IBDV-VP2. Avian Pathol.
32:597-604. 2003.
26. Callewaert, N., W. Laroy, H. Cadirgi, S. Geysens, X. Saelens, W. Min Jou, and R.
Contreras. Use of hdel-tagged trichoderma reesei mannosyl oligosaccharide 1,2-
alpha-d-mannosidase for n-glycan engineering in pichia pastoris. FEBS Lett
503:173-178. 2001.
27. Campbell, G. Pathogenicity of investigation into evidence of exposure to
infectious bursal disease virus and infectious anaemia virus in wild birds in
Ireland. In: Proceedings II International Symposium on infectious bursal disease
and chicken infectious anaemia. Rauischholzhausen. pp 230 - 235. 2001.
28. Cao, Y. C., W. S. Yeung, M. Law, Y. Z. Bi, F. C. Leung, and B. L. Lim.
Molecular characterization of seven Chinese isolates of infectious bursal disease
virus: Classical, very virulent, and variant strains. Avian Dis 42:340-351. 1998.
29. Caston, J. R., J. L. Martinez-Torrecuadrada, A. Maraver, E. Lombardo, J. F.
Rodriguez, J. I. Casal, and J. L. Carrascosa. C terminus of infectious bursal disease
virus major capsid protein VP2 is involved in definition of the t number for capsid
assembly. J Virol 75:10815-10828. 2001.
![Page 67: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/67.jpg)
53
30. Cereghino, G. P., J. L. Cereghino, C. Ilgen, and J. M. Cregg. Production of
recombinant proteins in fermenter cultures of the yeast pichia pastoris. Curr Opin
Biotechnol 13:329-332. 2002.
31. Cereghino, J. L., and J. M. Cregg. Heterologous protein expression in the
methylotrophic yeast pichia pastoris. FEMS Microbiol Rev 24:45-66. 2000.
32. Chettle, N., J. C. Stuart, and P. J. Wyeth. Outbreak of virulent infectious bursal
disease in East Anglia. Vet Rec 125:271-272. 1989.
33. Chevalier, C., J. Lepault, B. Da Costa, and B. Delmas. The last c-terminal residue
of VP3, glutamic acid 257, controls capsid assembly of infectious bursal disease
virus. J Virol 78:3296-3303. 2004.
34. Cheville, N. F. Studies on the pathogenesis of gumboro disease in the bursa of
fabricius, spleen and thymus of the chicken. Am J Pathol: 527-551. 1967.
35. Cho, B. R. Experimental dual infections of chickens with infectious bursal and
Marek’s disease agents. I. Preliminary observation on the effect of infectious
bursal agent on Marek’s disease. Avian Dis 14:665-675. 1970.
36. Chong, L. K., A. R. Omar, K. Yusoff, M. Hair-Bejo, and I. Aini. Nucleotide
sequence and phylogenetic analysis of a segment of a highly virulent strain of
infectious bursal disease virus. Acta Virol 45:217-226. 2001.
37. Cosgrove, A. An apparently new disease of chickens: Avian nephrosis. Avian Dis:
385-389. 1962.
38. Craig, F. R. Economic impact of respiratory disease. In: 20th National Meeting on
Poultry Health and Condemnations. Ocean City, MD. pp 35-37. 1985.
![Page 68: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/68.jpg)
54
39. Cregg, J., and K. Madden. Development of the methylotrophic yeast, pichia
pastoris, as a host system for the production of foreign proteins. Dev Ind
Microbiol: 23-42. 1988.
40. Cregg, J. M., J. F. Tschopp, and C. Stillman. High-level expression and efficient
assembly of hepatitis b surface antigen in pichia pastoris. BioTechnology: 479-
485. 1987.
41. Cregg, J. M., T. S. Vedvick, and W. C. Raschke. Recent advances in the
expression of foreign genes in pichia pastoris. Biotechnology (N Y) 11:905-910.
1993.
42. Cregg, J. M., K. J. Barringer, A. Y. Hessler, and K. R. Madden. Pichia pastoris as
a host system for transformations. Mol Cell Biol 5:3376-3385. 1985.
43. Cregg, J. M., J. L. Cereghino, J. Shi, and D. R. Higgins. Recombinant protein
expression in pichia pastoris. Mol Biotechnol 16:23-52. 2000.
44. Darteil, R., M. Bublot, E. Laplace, J. F. Bouquet, J. C. Audonnet, and M. Riviere.
Herpesvirus of turkey recombinant viruses expressing infectious bursal disease
virus (IBDV) VP2 immunogen induce protection against an IBDV virulent
challenge in chickens. Virology 211:481-490. 1995.
45. de Jong, L. A., S. Grunewald, J. P. Franke, D. R. Uges, and R. Bischoff.
Purification and characterization of the recombinant human dopamine d2s receptor
from pichia pastoris. Protein Expr Purif 33:176-184. 2004.
46. de Wit, J. J. Gumboro disease - the optimal time for vaccination. International
Poultry Production: 19-23. 2003.
![Page 69: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/69.jpg)
55
47. Di Fabio, J., L. I. Rossini, N. Eterradossi, M. D. Toquin, and Y. Gardin. European-
like pathogenic infectious bursal disease viruses in Brazil. Vet Rec 145:203-204.
1999.
48. Dobos, P. Peptide map comparison of the proteins of infectious bursal disease
virus. J Virol 32:1047-1050. 1979.
49. Dobos, P., and T. E. Roberts. The molecular biology of infectious pancreatic
necrosis virus: A review. Can J Microbiol 29:377-384. 1983.
50. Dobos, P., B. J. Hill, R. Hallett, D. T. Kells, H. Becht, and D. Teninges.
Biophysical and biochemical characterization of five animal viruses with
bisegmented double-stranded RNA genomes. J Virol 32:593-605. 1979.
51. Dormitorio, T. V., J. J. Giambrone, and L. W. Duck. Sequence comparisons of the
variable VP2 region of eight infectious bursal disease virus isolates. Avian Dis
41:36-44. 1997.
52. Duncan, R., E. Nagy, P. Krell, and P. Dobos. Synthesis of the infectious pancreatic
necrosis virus polyprotein, detection of a virus-encoded protease, and fine-
structure mapping of genome segment-a coding regions. J Virol. 61:3655-3664.
1987.
53. Dybing, J. K., and D. J. Jackwood. Antigenic and immunogenic properties of
baculovirus-expressed infectious bursal disease viral proteins. Avian Dis 42:80-91.
1998.
54. Egli, T., J. P. van Dijken, M. Veenuis, W. Harder, and A. Fiechter. Methanol
metabolism in yeasts: Regulation of the synthesis of catabolic enzymes. Arch
Microbiol: 115-121. 1980.
![Page 70: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/70.jpg)
56
55. Eterradossi, N., G. Rivallan, D. Toquin, and M. Guittet. Limited antigenic
variation among recent infectious bursal disease virus isolates from France. Arch
Virol 142:2079-2087. 1997.
56. Eterradossi, N., C. Arnauld, D. Toquin, and G. Rivallan. Critical amino acid
changes in VP2 variable domain are associated with typical and atypical
antigenicity in very virulent infectious bursal disease viruses. Arch Virol
143:1627-1636. 1998.
57. Eterradossi, N., J. P. Picault, P. Drouin, M. Guittet, R. Lhospitalier, and G.
Bennejean. Pathogenicity and preliminary antigenic characterization of 6
infectious bursal disease virus-strains isolated in France from acute outbreaks.
Journal of Veterinary Medicine Series B-Zentralblatt Fur Veterinarmedizin Reihe
B-Infectious Diseases and Veterinary Public Health 39:683-691. 1992.
58. Eterradossi, N., C. Arnauld, F. Tekaia, D. Toquin, H. Le Coq, G. Rivallan, M.
Guittet, J. Domenech, T. van den Berg, and M. Skinner. Antigenic and genetic
relationships between European very virulent infectious bursal disease viruses and
an early West African isolate. Avian Pathol. 28:36-46. 1999.
59. Faber, K. N., W. Harder, G. Ab, and M. Veenhuis. Review: Methylotropic yeasts
as factories for the production of foreign proteins. Yeast:1331-1344. 1995.
60. Fahey, K. J., I. J. Odonnell, and T. J. Bagust. Antibody to the 32k structural
protein of infectious bursal disease virus neutralizes viral infectivity invitro and
confers protection on young chickens. Journal of General Virology 66:2693-2702.
1985.
![Page 71: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/71.jpg)
57
61. Fahey, K. J., K. Erny, and J. Crooks. A conformational immunogen on vp-2 of
infectious bursal disease virus that induces virus-neutralizing antibodies that
passively protect chickens. J Gen Virol 70 (Pt 6):1473-1481. 1989.
62. Fahey, K. J., P. McWaters, M. A. Brown, K. Erny, V. J. Murphy, and D. R.
Hewish. Virus-neutralizing and passively protective monoclonal-antibodies to
infectious bursal disease virus of chickens. Avian Dis. 35:365-373. 1991.
63. Faragher, J. T., W. H. Allan, and G. A. Cullen. Immunosuppressive effect of the
infectious bursal agent in the chicken. Nat New Biol 237:118-119. 1972.
64. Faragher, J. T., W. H. Allan, and P. J. Wyeth. Immunosuppressive effect of
infectious bursal agent on vaccination against Newcastle disease. Vet Rec:385-
388. 1974.
65. FernandezArias, A., S. Martinez, and J. Rodriguez. The major antigenic protein of
infectious bursal disease virus, VP2, is an apoptotic inducer. J Virol. 71:8014-
8018. 1997.
66. Gagic, M., C. A. St Hill, and J. M. Sharma. In-ovo vaccination of specific-
pathogen-free chickens with vaccines containing multiple agents. Avian Dis
43:293-301. 1999.
67. Gardner, H., K. Kerry, M. Riddle, S. Brouwer, and L. Gleeson. Poultry virus
infection in antarctic penguins. Nature 387:245. 1997.
68. Gelb, J., C. S. Eidson, and S. H. Kleven Studies on interferon induction by
infectious bursal disease virus (IBDV).1. Interferon-production in chicken-embryo
cell-cultures infected with IBDV. Avian Dis. 23:485-492. 1979.
![Page 72: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/72.jpg)
58
69. Gelb, J., C. S. Eidson, and S. H. Kleven. Interferon-production in embryonating
chicken eggs following inoculation with infectious bursal disease virus. Avian Dis.
23:534-538. 1979.
70. Gellissen, G. Heterologous protein production in methylotrophic yeasts. Appl
Microbiol Biotechnol 54:741-750. 2000.
71. Giambrone, J., T. Dormitorio, and T. Brown. Safety and efficacy of in ovo
administration of infectious bursal disease viral vaccines. Avian Dis. 45:144-148.
2001.
72. Giambrone, J. J., D. L. Ewert, and C. S. Eidson. Effect of infectious bursal disease
virus on immunological responsiveness of chicken. Poultry Sci. 56:1591-1594.
1977.
73. Gough, R., S. Drury, D. d. B. Welchman, J. R. Chitty, and G. E. S. Summerhays.
Isolation of Birnavirus and reovirus-like agents from penguins in the United
Kingdom. Vet Rec.151:422-424(423). 2002.
74. Haddad, E., C. Whitfill, A. Avakian, C. Ricks, P. Andrews, J. Thomas, and P.
Wakenell. Efficacy of a novel infectious bursal disease virus immune complex
vaccine in broiler chickens. Avian Dis. 41:882-889. 1997.
75. Harkness, J. W., D. J. Alexander, M. Pattison, and A. C. Scott. Infectious bursal
disease agent - morphology by negative stain electron-microscopy. Arch
Virol.48:63-73. 1975.
76. Hassan, M., M. AlNatour, L. Ward, and Y. Saif. Pathogenicity, attenuation, and
immunogenicity of infectious bursal disease virus. Avian Dis. 40:567-571. 1996.
![Page 73: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/73.jpg)
59
77. Heine, H. G., M. Haritou, P. Failla, K. Fahey, and A. Azad Sequence analysis and
expression of the host-protective immunogen VP2 of a variant strain of infectious
bursal disease virus which can circumvent vaccination with standard type I strains.
J Gen Virol 72 (Pt 8):1835-1843. 1991.
78. Hemboldt, C. F., and E. Garner. Experimentally induced gumboro disease (IBA).
Avian Dis:561-575. 1964.
79. Higashihara, M., K. Saijo, Y. Fujisaki, and M. Matumoto. Immunosuppressive
effect of infectious bursal disease virus-strains of variable virulence for chickens.
Veterinary Microbiology 26:241-248. 1991.
80. Higgins, D., and J. Cregg. Methods in molecular biology: Pichia protocols.
Humana, Totowa, NJ. 1998.
81. Hiraga, M., T. Nunoya, Y. Otaki, M. Tajima, T. Saito, and T. Nakamura.
Pathogenesis of highly virulent infectious bursal disease virus-infection in intact
and bursectomized chickens.J Vet Med Sci. 56:1057-1063. 1994.
82. Hirai, K., and B. W. Calnek. Invitro replication of infectious bursal disease virus
in established lymphoid-cell lines and chicken lymphocytes-B. Infect Immun
25:964-970. 1979.
83. Hirai, K., Shimakur.S, and E. Kawamoto, Electron-microscope characterization of
infectious bursal disease virus. Avian Dis. 18:467-471. 1974.
84. Hirai, K., K. Kunihiro, and S. Shimakura, Characterization of immunosuppression
in chickens by infectious bursal disease virus. Avian Dis 23:950-965. 1979.
![Page 74: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/74.jpg)
60
85. Hirai, K., T. Funakoshi, T. Nakai, and S. Shimakura, Sequential-changes in the
number of surface immunoglobulin-bearing lymphocytes-b in infectious bursal
disease virus-infected chickens. Avian Dis. 25:484-496. 1981.
86. Hirai, K., Shimakur.S, E. Kawamoto, F. Taguchi, S. T. Kim, C. N. Chang, and Y.
Iritani. Immunodepressive effect of infectious bursal disease virus in chickens.
Avian Dis. 18:50-57. 1974.
87. Hitchner, S. Infectivity of infectious bursal disease virus for embryonating eggs.
Poultry Sci. 49:511-&. 1970.
88. Hofacre, C. L. Personal communication In. 2005.
89. Hohenblum, H., B. Gasser, M. Maurer, N. Borth, and D. Mattanovich. Effects of
gene dosage, promoters, and substrates on unfolded protein stress of recombinant
Pichia pastoris. Biotechnol Bioeng 85:367-375. 2004.
90. Hoque, M., A. Omar, L. Chong, M. Hair-Bejo, and I. Aini. Pathogenicity of sspI-
positive infectious bursal disease virus and molecular characterization of the VP2
hypervariable region. Avian Pathol. 30:369-380. 2001.
91. Howie, R. I., and J. Thorsen. Identification of a strain of infectious bursal disease
virus isolated from mosquitoes. Can J Comp Med 45:315-320. 1981.
92. Huang, Z., S. Elankumaran, A. S. Yunus, and S. K. Samal. A recombinant
Newcastle disease virus (NDV) expressing VP2 protein of infectious bursal
disease virus (IBDV) protects against NDV and IBDV. J Virol 78:10054-10063.
2004.
![Page 75: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/75.jpg)
61
93. Hudson, P. J., N. M. McKern, K. J. Fahey, and A. A. Azad. Predicted sequence of
the host-protective immunogen of infectious bursal disease virus. FEBS Lett
201:143-146. 1986.
94. Hudson, P. J., N. M. McKern, B. E. Power, and A. A. Azad. Genomic structure of
the large RNA segment of infectious bursal disease virus. Nucleic Acids Res
14:5001-5012. 1986.
95. Ikuta, N., J. El-Attrache, P. Villegas, E. M. Garcia, V. R. Lunge, A. S. Fonseca, C.
Oliveira, and E. K. Marques. Molecular characterization of Brazilian infectious
bursal disease viruses. Avian Dis 45:297-306. 2001.
96. Inoue, M., M. Fukuda, and K. Miyano. Thymic lesions in chicken infected with
infectious bursal disease virus. Avian Dis 38:839-846. 1994.
97. Inoue, M., A. Fujita, and K. Maeda. Lysis of myelocytes in chickens infected with
infectious bursal disease virus. Vet Pathol 36:146-151. 1999.
98. Inoue, M., H. Yamamoto, K. Matuo, and H. Hihara. Susceptibility of chicken
monocytic cell-lines to infectious bursal disease virus.J Vet Med Sci. 54:575-577.
1992.
99. Islam, M., K. Zierenberg, and H. Muller. The genome segment b encoding the
RNA-dependent RNA polymerase protein VP1 of very virulent infectious bursal
disease virus (IBDV) is phylogenetically distinct from that of all other IBDV
strains. Arch Virol 146:2481-2492. 2001.
![Page 76: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/76.jpg)
62
100. Islam, M. R., K. Zierenberg, N. Eterradossi, D. Toquin, G. Rivallan, and H.
Muller. Molecular and antigenic characterization of Bangladeshi isolates of
infectious bursal disease virus demonstrate their similarities with recent European,
Asian and African very virulent strains. J Vet Med B Infect Dis Vet Public Health
48:211-221. 2001.
101. Ismail, N. M., and Y. M. Saif. Immunogenicity of infectious bursal disease viruses
in chickens. Avian Dis 35:460-469. 1991.
102. Ismail, N. M., A. M. Fadly, and T. S. Chang. Effect of bursal cell number on the
pathogenesis of infectious bursal disease in chickens. Avian Dis 31:546-555.
1987.
103. Ivanyi, J., and R. Morris Immunodeficiency in the chicken. Iv. An immunological
study of infectious bursal disease. Clin Exp Immunol.:154-165. 1976.
104. Jackwood, D. Rapid identification of the most appropriate vaccine strain to control
infectious bursal disease. http://www.oardc.ohio-
state.edu/IBDV/IBDVLightCylcer.asp In. 2005.
105. Jackwood, D., and R. Jackwood. Infectious bursal disease viruses - molecular
differentiation of antigenic subtypes among serotype-1 viruses. Avian Dis 38:531-
537. 1994.
106. Jackwood, D., and R. Jackwood. Molecular identification of infectious bursal
disease virus strains. Avian Dis. 41:97-104. 1997.
107. Jackwood, D., and S. Sommer. Restriction fragment length polymorphisms in the
VP2 gene of infectious bursal disease viruses. Avian Dis. 41:627-637. 1997.
![Page 77: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/77.jpg)
63
108. Jackwood, D., G. Hanes, and S. Miller. Infectious bursal disease viral RNA
amplification using RT/PCR from bursa tissue following phenol: Chloroform
inactivation of the virus. Avian Dis 40:457-460. 1996.
109. Jackwood, D., R. Jackwood, and S. Sommer. Identification and comparison of
point mutations associated in classic and variant infectious bursal disease viruses.
Virus Res.49:131-137. 1997.
110. Jackwood, D. H., and Y. M. Saif. Antigenic diversity of infectious bursal disease
viruses. Avian Dis 31:766-770. 1987.
111. Jackwood, D. J. Development and characterization of nucleic-acid probes to
infectious bursal disease viruses. Veterinary Microbiology 24:253-260. 1990.
112. Jackwood, D. J., and S. E. Sommer. Genetic heterogeneity in the VP2 gene of
infectious bursal disease viruses detected in commercially reared chickens. Avian
Dis 42:321-339. 1998.
113. Jackwood, D. J., and S. E. Sommer. Virulent vaccine strains of infectious bursal
disease virus not distinguishable from wild-type viruses with marker the use of a
molecular. Avian Dis 46:1030-1032. 2002.
114. Jackwood, D. J., Y. M. Saif, and J. H. Hughes. Characteristics and serologic
studies of 2 serotypes of infectious bursal disease virus in turkeys. Avian Dis.
26:871-882. 1982.
115. Jackwood, D. J., Y. M. Saif, and P. D. Moorhead. Immunogenicity and
antigenicity of infectious bursal disease virus serotypes I and II in chickens. Avian
Dis 29:1184-1194. 1985.
![Page 78: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/78.jpg)
64
116. Jackwood, D. J., D. E. Swayne, and R. J. Fisk. Detection of infectious bursal
disease viruses using insitu hybridization and nonradioactive probes. Avian Dis.
36:154-157. 1992.
117. Jackwood, D. J., S. E. Sommer, R. E. Gough, S. E. Drury, D. d. B. Welchman, J.
R. Chitty, and G. E. S. Summerhays. Sequence analysis of an infectious bursal
disease virus isolated from penguins in the united kingdom. In.
http://www.oardc.ohio-state.edu/IBDV/Penguin%20Page.asp 2004.
118. Jagadish, M. N., V. J. Staton, P. J. Hudson, and A. A. Azad. Birnavirus precursor
polyprotein is processed in Escherichia coli by its own virus-encoded polypeptide.
J Virol 62:1084-1087. 1988.
119. Jahic, M. Process techniques for production of recombinant proteins with pichia
pastoris. PhD thesis. In: Department of Biotechnology. Royal Institute of
Technology, S-10 691 Stockholm, Sweden. 2003.
120. Jungmann, A., H. Nieper, and H. Muller. Apoptosis is induced by infectious bursal
disease virus replication in productively infected cells as well as in antigen-
negative cells in their vicinity. J Gen Virol 82:1107-1115. 2001.
121. Kibenge, F., and V. Dhama. Evidence that virion-associated VP1 of
Avibirnaviruses contains viral RNA sequences. Arch Virol.142:1227-1236. 1997.
122. Kibenge, F., M. Nagarajan, and B. Qian. Determination of the 5' and 3' terminal
noncoding sequences of the bi-segmented genome of the Avibirnavirus infectious
bursal disease virus. Arch Virol 141:1133-1141. 1996.
123. Kibenge, F. S., A. S. Dhillon, and R. G. Russell. Biochemistry and immunology of
infectious bursal disease virus. J Gen Virol 69 (Pt 8):1757-1775. 1988.
![Page 79: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/79.jpg)
65
124. Kibenge, F. S. B., A. S. Dhillon, and R. G. Russell. Identification of serotype-ii
infectious bursal disease virus proteins. Avian Pathol. 17:679-687. 1988.
125. Kim, I., M. Gagic, and J. Sharma. Recovery of antibody-producing ability and
lymphocyte repopulation of bursal follicles in chickens exposed to infectious
bursal disease virus. Avian Dis. 43:401-413. 1999.
126. Kim, I., S. You, H. Kim, H. Yeh, and J. Sharma. Characteristics of bursal t
lymphocytes induced by infectious bursal disease virus. J Virol. 74:8884-8892.
2000.
127. Kim, I. J., and J. M. Sharma. IBDV-induced bursal t lymphocytes inhibit
mitogenic response of normal splenocytes. Vet Immunol Immunopathol 74:47-57.
2000.
128. Kim, I. J., M. Gagic, and J. M. Sharma. Recovery of antibody-producing ability
and lymphocyte repopulation of bursal follicles in chickens exposed to infectious
bursal disease virus. Avian Dis. 43:401-413. 1999.
129. Kim, I. J., K. Karaca, T. L. Pertile, S. A. Erickson, and J. M. Sharma. Enhanced
expression of cytokine genes in spleen macrophages during acute infection with
infectious bursal disease virus in chickens. Vet Immunol Immunopathol 61:331-
341. 1998.
130. Kitamura, S., S. Jung, and S. Suzuki. Seasonal change of infective state of marine
Birnavirus in Japanese pearl oyster Pinctada fucata. Arch Virol 145:2003-2014.
2000.
![Page 80: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/80.jpg)
66
131. Koutz, P., G. R. Davis, C. Stillman, K. Barringer, J. Cregg, and G. Thill.
Structural comparison of the pichia pastoris alcohol oxidase genes. Yeast 5:167-
177. 1989.
132. Lam, K. Morphological evidence of apoptosis in chickens infected with infectious
bursal disease virus. J Comp Pathol. 116:367-377. 1997.
133. Lam, K. Alteration of chicken heterophil and macrophage functions by the
infectious bursal disease virus. Microb Pathog. 25:147-155. 1998.
134. Lamichhane, C. M., S. A. Mengel-Whereat, J. K. Rosenberger, R. S. Hein, R. S.
Resurreccion, and Lovell. Use and interpretation of monoclonal antibodies for the
characterization of infectious bursal disease viruses. In: International Poultry
Exposition. Atlanta, GA. 2001.
135. Lana, D. P., C. E. Beisel, and R. F. Silva. Genetic mechanisms of antigenic
variation in infectious bursal disease virus - analysis of a naturally-occurring
variant virus. Virus Genes 6:247-259. 1992.
136. Lasher, H., and S. Shane. Infectious bursal disease. Worlds Poult Sci J. 50:133-
166. 1994.
137. Lasher, H., and V. Davis. History of infectious bursal disease in the USA - the first
two decades. Avian Dis. 41:11-19. 1997.
138. Ledeboer, A. M., L. Edens, J. Maat, C. Visser, J. W. Bos, C. T. Verrips, Z.
Janowicz, M. Eckart, R. Roggenkamp, and C. P. Hollenberg. Molecular cloning
and characterization of a gene coding for methanol oxidase in hansenula
polymorpha. Nucleic Acids Res 13:3063-3082. 1985.
![Page 81: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/81.jpg)
67
139. Lee, L. H., S. L. Yu, and H. K. Shieh. Detection of infectious bursal disease virus
infection using the polymerase chain reaction. J Virol Methods 40:243-253. 1992.
140. Lee, N., Y. Nomura, and T. Miyazaki. Gill lamellar pillar cell necrosis, a new
Birnavirus disease in Japanese eels. Dis Aquat Organ. 37:13-21. 1999.
141. Lejal, N., B. Da Costa, J. C. Huet, and B. Delmas. Role of ser-652 and lys-692 in
the protease activity of infectious bursal disease virus VP4 and identification of its
substrate cleavage sites. J Gen Virol 81:983-992. 2000.
142. Lim, B. L., Y. C. Cao, T. Yu, and C. W. Mo. Adaptation of very virulent
infectious bursal disease virus to chicken embryonic fibroblasts by site-directed
mutagenesis of residues 279 and 284 of viral coat protein VP2. J Virol. 73:2854-
2862. 1999.
143. Lin Cereghino, G. P., A. J. Sunga, J. Lin Cereghino, and J. M. Cregg. Expression
of foreign genes in the yeast pichia pastoris. Genet Eng (N Y) 23:157-169. 2001.
144. Lin, Z., A. Kato, Y. Otaki, T. Nakamura, E. Sasmaz, and S. Ueda. Sequence
comparisons of a highly virulent infectious bursal disease virus prevalent in Japan.
Avian Dis 37:315-323. 1993.
145. Liu, H., X. Tan, K. A. Russell, M. Veenhuis, and J. M. Cregg. Per3, a gene
required for peroxisome biogenesis in pichia pastoris, encodes a peroxisomal
membrane protein involved in protein import. J Biol Chem 270:10940-10951.
1995.
146. Liu, H. J., P. H. Huang, Y. H. Wu, M. Y. Lin, and M. H. Liao. Molecular
characterization of very virulent infectious bursal disease viruses in Taiwan. Res
Vet Sci 70:139-147. 2001.
![Page 82: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/82.jpg)
68
147. Liu, M., and V. N. Vakharia. VP1 protein of infectious bursal disease virus
modulates the virulence in vivo. Virology 330:62-73. 2004.
148. Lombardo, E., A. Maraver, I. Espinosa, A. Fernandez-Arias, and J. Rodriguez.
VP5, the nonstructural polypeptide of infectious bursal disease virus, accumulates
within the host plasma membrane and induces cell lysis. Virology 277:345-357.
2000.
149. Lombardo, E., A. Maraver, J. R. Cast n, J. Rivera, A. Fernandez-Arias, A.
Serrano, J. L. Carrascosa, and J. F. Rodriguez. VP1, the putative RNA-dependent
RNA polymerase of infectious bursal disease virus, forms complexes with the
capsid protein VP3, leading to efficient encapsidation into virus-like particles. J
Virol 73:6973-6983. 1999.
150. Lukert, P. D., and Y. M. Saif Infectious bursal disease. In: Diseases of
Poultry, 11th edition ed. Y.M. Saif, H.J. Barnes, J.R. Glisson, A.M. Fadly, L.R.
Mc Dougald, D.E. Swayne. Iowa State University Press, Ames, IA. pp 161-179.
2003.
151. Lukert, P. D., J. Leonard, and R. B. Davis. Infectious bursal disease virus - antigen
production and immunity. Am J Vet Res. 36:539-540. 1975.
152. Macauley-Patrick, S., M. L. Fazenda, B. McNeil, and L. M. Harvey. Heterologous
protein production using the pichia pastoris expression system. Yeast 22:249-270.
2005.
![Page 83: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/83.jpg)
69
153. Macreadie, I. G., P. R. Vaughan, A. J. Chapman, N. M. McKern, M. N. Jagadish,
H. G. Heine, C. W. Ward, K. J. Fahey, and A. A. Azad. Passive protection against
infectious bursal disease virus by viral VP2 expressed in yeast. Vaccine 8:549-
552. 1990.
154. Martinez-Torrecuadrada, J., B. Lazaro, J. Rodriguez, and J. Casal. Antigenic
properties and diagnostic potential of baculovirus-expressed infectious bursal
disease virus proteins VPx and VP3. Clin Diag Lab Immunol.7:645-651. 2000.
155. Martinez-Torrecuadrada, J., N. Saubi, A. Pages-Mante, J. Caston, E. Espuna, and
J. Casal. Structure-dependent efficacy of infectious bursal disease virus (IBDV)
recombinant vaccines. Vaccine 21:3342-3350. 2003.
156. Mast, J., B. M. Goddeeris, K. Peeters, F. Vandesande, and L. R. Berghman.
Characterization of chicken monocytes, macrophages and interdigitating cells by
the monoclonal antibody kul01. Vet Immunol Immunopathol 61:343-357. 1998.
157. McAllister, J. C., C. D. Steelman, L. A. Newberry, and J. K. Skeeles. Isolation of
infectious bursal disease virus from the lesser mealworm, alphitobius-diaperinus
(panzer). Poultry Sci. 74:45-49. 1995.
158. McFerran, J. B., M. S. McNulty, F. R. McKillop, T. J. Connor, R. M. McCracken,
D. S. Collins, and G. M. Allan. Isolation and serological studies with infectious
bursal disease viruses from fowl, turkeys and ducks - demonstration of a 2nd
serotype. Avian Pathol. 9:395-404. 1980.
159. McNulty, M., and Y. Saif. Antigenic relationship of non- serotype turkey
infectious bursal disease viruses from the United States and United Kingdom.
Avian Dis. 32:374-375. 1988.
![Page 84: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/84.jpg)
70
160. McNulty, M. S., G. M. Allan, and J. B. McFerran. Isolation of infectious bursal
disease virus from turkeys. Avian Pathol. 8:205-&. 1979.
161. Menendez, J., I. Valdes, and N. Cabrera. The icl1 gene of pichia pastoris,
transcriptional regulation and use of its promoter. Yeast 20:1097-1108. 2003.
162. Menendez, J., L. Hernandez, A. Banguela, and J. Pais. Functional production and
secretion of the gluconoacetobacter diazatrophicus fructose-releasing exo-
levanase (lsdb) in pichia pastoris. Enz Microb Technol:446-452. 2004.
163. Mertens, P. P., P. B. Jamieson, and P. Dobos. In vitro RNA synthesis by infectious
pancreatic necrosis virus-associated RNA polymerase. J Gen Virol 59:47-56.
1982.
164. Morales, O. E., and W. Boclair. Morphometric relations bursa/spleen in infectious
bursal disease. In: 42 nd, Western Poultry Disease Conference. Sacramento, CA.
pp 91-92. 1993.
165. Muller, H., and H. Becht. Biosynthesis of virus-specific proteins in cells infected
with infectious bursal disease virus and their significance as structural elements
for infectious virus and incomplete particles. J Virol 44:384-392. 1982.
166. Muller, H., and R. Nitschke. Molecular weight determination of the two segments
of double-stranded RNA of infectious bursal disease virus, a member of the
Birnavirus group. Med Microbiol Immunol (Berl) 176:113-121. 1987.
167. Muller, H., and R. Nitschke. Genome of infectious bursal disease virus (IBDV) -
electron-microscopic investigations and demonstration of a genome-linked
protein. Zentralbl Bakteriol 267:156-157. 1987.
![Page 85: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/85.jpg)
71
168. Muller, H., and R. Nitschke. The 2 segments of the infectious bursal disease virus
genome are circularized by a 90,000-da protein. Virology 159:174-177. 1987.
169. Muller, H., M. Islam, and R. Raue. Research on infectious bursal disease - the
past, the present and the future. Vet Microbiol. 97:153-165. 2003.
170. Muller, R., I. Kaufer, M. Reinacher, and E. Weiss. Immunofluorescent studies of
early virus propagation after oral infection with infectious bursal disease virus
(IBDV). Zentralbl Veterinarmed B 26:345-352. 1979.
171. Mundt, E. Tissue culture infectivity of different strains of infectious bursal disease
virus is determined by distinct amino acids in VP2. J Gen Virol 80 (Pt 8):2067-
2076. 1999.
172. Mundt, E. Personal communication In. 2005.
173. Mundt, E., J. Beyer, and H. Muller. Identification of a novel viral protein in
infectious bursal disease virus-infected cells. J Gen Virol 76 (Pt 2):437-443. 1995.
174. Mundt, E., B. Kollner, and D. Kretzschmar. VP5 of infectious bursal disease virus
is not essential for viral replication in cell culture. J Virol 71:5647-5651. 1997.
175. Nagarajan, M. M., and F. S. Kibenge. The 5'-terminal 32 base pairs conserved
between genome segments a and b contain a major promoter element of infectious
bursal disease virus. Arch Virol 142:2499-2514. 1997.
176. Naqi, S. A., and D. L. Millar. Morphologic changes in the bursa of fabricius of
chickens after inoculation with infectious bursal disease virus. Am J Vet Res
40:1134-1139. 1979.
![Page 86: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/86.jpg)
72
177. Nawathe, D. R., O. Onunkwo, and I. M. Smith. Serological evidence of infection
with virus of infectious bursal disease in wild and domestic birds in Nigeria. Vet.
Rec 102:444-444. 1978.
178. Nick, H., D. Cursiefen, and H. Becht. Structural and growth-characteristics of
infectious bursal disease virus. J Virol. 18:227-234. 1976.
179. Nieper, H., and H. Muller. Susceptibility of chicken lymphoid cells to infectious
bursal disease virus does not correlate with the presence of specific binding sites. J
Gen Virol 77 (Pt 6):1229-1237. 1996.
180. Nieper, H., J. P. Teifke, A. Jungmann, C. V. Lohr, and H. Muller. Infected and
apoptotic cells in the IBDV-infected bursa of fabricius, studied by double-labeling
techniques. Avian Pathol. 28:279-285. 1999.
181. Nunoya, T., Y. Otaki, M. Tajima, M. Hiraga, and T. Saito. Occurrence of acute
infectious bursal disease with high mortality in Japan and pathogenicity of field
isolates in specific-pathogen-free chickens. Avian Dis 36:597-609. 1992.
182. Odor, E. Elisa serology: Application to IBD in broiler production. In: International
Poultry Symposium-Summit on Infectious Bursal Disease. Athens, GA, U.S.A. pp
104-105. 1995.
183. Ogata, K., H. Nishikawa, and M. Ohsugi. A yeast capable of utilizing methanol.
Agric. Biol. Chem.:1519-1520. 1969.
184. Ohi, H., M. Miura, R. Hiramatsu, and T. Ohmura. The positive and negative cis-
acting elements for methanol regulation in the pichia pastoris aox2 gene. Mol Gen
Genet 243:489-499. 1994.
![Page 87: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/87.jpg)
73
185. Ojeda, F., I. Skardova, M. Guarda, J. Ulloa, and H. Folch. Proliferation and
apoptosis in infection with infectious bursal disease virus: A flow cytometric
study. Avian Dis. 41:312-316. 1997.
186. Okoye, J. O. A. Susceptibility of laboratory rats and guinea-pigs to infectious
bursal disease virus-infection. Acta Vet Brno. 56:167-171. 1987.
187. Okoye, J. O. A., and U. E. Uche. Serological evidence of infectious bursal disease
virus-infection in wild rats. Acta Vet Brno. 55:207-209. 1986.
188. Okoye, J. O. A., and G. C. Okpe. The pathogenicity of an isolate of infectious
bursal disease virus in guinea fowls. Acta Vet Brno. 58:91-96. 1989.
189. Oppling, V., H. Muller, and H. Becht. Heterogeneity of the antigenic site
responsible for the induction of neutralizing antibodies in infectious bursal disease
virus. Arch Virol 119:211-223. 1991.
190. Pantin-Jackwood, M. J., and T. P. Brown. Infectious bursal disease virus and
proventriculitis in broiler chickens. Avian Dis. 47:681-690. 2003.
191. Pantin-Jackwood, M. J., T. P. Brown, and G. R. Huff. Reproduction of
proventriculitis in commercial and specific-pathogen-free broiler chickens. Avian
Dis 49:352-360. 2005.
192. Paramithiotis, E., and M. J. Ratcliffe. Evidence for phenotypic heterogeneity
among b cells emigrating from the bursa of fabricius: A reflection of functional
diversity? Curr Top Microbiol Immunol 212:29-36. 1996.
193. Peng, L., X. Zhong, J. Ou, S. Zheng, J. Liao, L. Wang, and A. Xu. High-level
secretory production of recombinant bovine enterokinase light chain by pichia
pastoris. J Biotechnol 108:185-192. 2004.
![Page 88: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/88.jpg)
74
194. Persson, R. H., and R. D. Macdonald. Evidence that infectious pancreatic necrosis
virus has a genome-linked protein. J Virol 44:437-443. 1982.
195. Peters, G. Histology of gumboro disease. Berl Munch Tierarztl Wochenschr:394-
396. 1967.
196. Pike, K. A., E. Baig, and M. J. Ratcliffe. The avian B-cell receptor complex:
Distinct roles of Ig alpha and Ig beta in B-cell development. Immunol Rev 197:10-
25. 2004.
197. Pitcovski, J., D. Goldberg, B. Z. Levi, D. Di-Castro, A. Azriel, S. Krispel, T.
Maray, and Y. Shaaltiel. Coding region of segment a sequence of a very virulent
isolate of IBDV--comparison with isolates from different countries and virulence.
Avian Dis 42:497-506. 1998.
198. Pitcovski, J., D. Di-Castro, Y. Shaaltiel, A. Azriel, B. Gutter, E. Yarkoni, A.
Michael, S. Krispel, and B. Z. Levi. Insect cell-derived VP2 of infectious bursal
disease virus confers protection against the disease in chickens. Avian Dis 40:753-
761. 1996.
199. Pitcovski, J., B. Gutter, G. Gallili, M. Goldway, B. Perelman, G. Gross, S. Krispel,
M. Barbakov, and A. Michael. Development and large-scale use of recombinant
VP2 vaccine for the prevention of infectious bursal disease of chickens. Vaccine
21:4736-4743. 2003.
200. Poonia, B., and S. Charan. T-cell suppression by cyclosporin-a enhances
infectious bursal disease virus infection in experimentally infected chickens.
Avian Pathol. 30:311-319. 2001.
![Page 89: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/89.jpg)
75
201. Pope, C. R. Lymhoid system, In Avian Histopathology 2nd edition. Ed.C. Riddle
American Association of Avian Pathologists, Kennet Square, PA. 1996.
202. Ramm, H. C., T. J. Wilson, R. L. Boyd, H. A. Ward, K. Mitrangas, and K. J.
Fahey. The effect of infectious bursal disease virus on b-lymphocytes and bursal
stromal components in specific pathogen-free (SPF) white leghorn chickens. Dev
Comp Immunol.15:369-381. 1991.
203. Rautenschlein, S., H. Y. Yeh, and J. M. Sharma. Comparative
immunopathogenesis of mild, intermediate, and virulent strains of classic
infectious bursal disease virus. Avian Dis 47:66-78. 2003.
204. Revet, B., and E. Delain. The drosophila x virus contains a 1-microm double-
stranded RNA circularized by a 67-kd terminal protein: High-resolution
denaturation mapping of its genome. Virology 123:29-44. 1982.
205. Rodenberg, J., J. M. Sharma, S. W. Belzer, R. M. Nordgren, and S. Naqi. Flow
cytometric analysis of b-cell and t-cell subpopulations in specific-pathogen-free
chickens infected with infectious bursal disease virus. Avian Dis. 38:16-21. 1994.
206. Romanos, M. Advances in the use of pichia pastoris for high-level gene
expression. Curr Opin Biotechnol:527-533. 1995.
207. Rosenberger, J. K., and S. S. Cloud. Isolation and characterization of variant
infectious bursal disease viruses. J Am Vet Med Assoc.189:357. 1986.
208. Rosenberger, J. K., Y. M. Saif, and D. J. Jackwood. Infectious bursal disease, In,
A Laboratory Manual for the Isolation and Identification of Avian Pathogens.4th
editioon. Ed.D.E. Swayne, J.R. Glisson, M.W. Jackwood, J.E. Pearson, W.M.
Reed American Association of Avian Pathologists, Kennet Square, PA. 1998.
![Page 90: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/90.jpg)
76
209. Rosenfeld, S. A., D. Nadeau, J. Tirado, G. F. Hollis, R. M. Knabb, and S. Jia.
Production and purification of recombinant hirudin expressed in the
methylotrophic yeast pichia pastoris. Protein Expr Purif 8:476-482. 1996.
210. Sanchez, A., and J. Rodriguez. Proteolytic processing in infectious bursal disease
virus: Identification of the polyprotein cleavage sites by site-directed mutagenesis.
Virology 262:190-199. 1999.
211. Schnitzler, D., F. Bernstein, H. Muller, and H. Becht. The genetic-basis for the
antigenicity of the VP2-protein of the infectious bursal disease virus. Journal of
General Virology 74:1563-1571. 1993.
212. Segev, N., J. Mulholland, and D. Bostein. The yeast gtp-binding ypt1 protein and
a mammalian counterpart are associated with the secretion machinery. Cell:915-
924. 1988.
213. Sharma, J., I. Kim, S. Rautenschlein, and H. Yeh. Infectious bursal disease virus
of chickens: Pathogenesis and immunosuppression. Dev Comp Immunol.24:223-
235. 2000.
214. Sharma, J. M., and L. F. Lee. Effect of infectious bursal disease on natural-killer
cell-activity and mitogenic response of chicken lymphoid-cells - role of adherent
cells in cellular immune suppression. Infect Immun 42:747-754. 1983.
215. Sharma, J. M., J. E. Dohms, and A. L. Metz. Comparative pathogenesis of
serotype-1 and variant serotype-1 isolates of infectious bursal disease virus and
their effect on humoral and cellular immune competence of specific-pathogen-free
chickens. Avian Dis. 33:112-124. 1989.
![Page 91: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/91.jpg)
77
216. Sheppard, M., W. Werner, E. Tsatas, R. McCoy, S. Prowse, and M. Johnson. Fowl
adenovirus recombinant expressing VP2 of infectious bursal disease virus induces
protective immunity against bursal disease. Arch Virol 143:915-930. 1998.
217. Simoes, E. A., and P. Sarnow. An RNA hairpin at the extreme 5' end of the
poliovirus RNA genome modulates viral translation in human cells. J Virol
65:913-921. 1991.
218. Skeeles, J. K., P. D. Lukert, E. V. Debuysscher, O. J. Fletcher, and J. Brown.
Infectious bursal disease viral-infections.2. Relationship of age, complement
levels, virus-neutralizing antibody, clotting, and lesions. Avian Dis. 23:107-117.
1979.
219. Slibinskas, R., D. Samuel, A. Gedvilaite, J. Staniulis, and K. Sasnauskas.
Synthesis of the measles virus nucleoprotein in yeast pichia pastoris and
Saccharomyces cerevisiae. J Biotechnol 107:115-124. 2004.
220. Smith, J. Personal communication In. 2005.
221. Snedeker, C., F. K. Willis, and I. Moulthorp. Some studies on infectious bursal
agent. Avian Dis:519-528. 1967.
222. Snyder, D. B. Changes in the field status of infectious bursal disease virus. Avian
Pathol. 19:419-423. 1990.
223. Snyder, D. B., V. N. Vakharia, and P. K. Savage. Naturally occurring-neutralizing
monoclonal-antibody escape variants define the epidemiology of infectious bursal
disease viruses in the united-states. Arch Virol.127:89-101. 1992.
![Page 92: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/92.jpg)
78
224. Snyder, D. B., F. S. Yancey, and P. K. Savage. A monoclonal antibody-based
agar-gel precipitin test for antigenic assessment of infectious bursal disease
viruses. Avian Pathol. 21:153-157. 1992.
225. Snyder, D. B., D. P. Lana, B. R. Cho, and W. W. Marquardt. Group and strain-
specific neutralization sites of infectious bursal disease virus defined with
monoclonal-antibodies. Avian Dis. 32:527-534. 1988.
226. Snyder, D. B., D. P. Lana, P. K. Savage, F. S. Yancey, S. A. Mengel, and W. W.
Marquardt. Differentiation of infectious bursal disease viruses directly from
infected-tissues with neutralizing monoclonal-antibodies - evidence of a major
antigenic shift in recent field isolates. Avian Dis. 32:535-539. 1988.
227. Spies, U., H. Muller, and H. Becht. RNA-dependent RNA-polymerase activity in
infectious bursal disease virus (IBDV). Zentralbl Bakteriol 267:156-156. 1987.
228. Spies, U., H. Muller, and H. Becht. Properties of RNA polymerase activity
associated with infectious bursal disease virus and characterization of its reaction
products. Virus Research 8:127-140. 1987.
229. Survashe, B. D., I. D. Aitken, and J. R. Powell. The response of the harderian
gland of the fowl to antigen given by occular route. 1. Histological changes. Avian
Pathol:77-93. 1979.
230. Tacken, M., P. Rottier, A. Gielkens, and B. Peeters. Interactions in vivo between
the proteins of infectious bursal disease virus: Capsid protein VP3 interacts with
the RNA-dependent RNA polymerase, VP1. J Gen Virol. 81:209-218. 2000.
![Page 93: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/93.jpg)
79
231. Tanimura, N., and J. Sharma. Appearance of T cells in the bursa of fabricius and
cecal tonsils during the acute phase of infectious bursal disease virus infection in
chickens. Avian Dis. 41:638-645. 1997.
232. Tanimura, N., and J. Sharma. In-situ apoptosis in chickens infected with infectious
bursal disease virus. J Comp Pathol. 118:15-27. 1998.
233. Tanimura, N., K. Tsukamoto, K. Nakamura, M. Narita, and M. Maeda.
Association between pathogenicity of infectious bursal disease virus and viral
antigen distribution detected by immunohistochemistry. Avian Dis 39:9-20. 1995.
234. To, H., T. Yamaguchi, N. T. Nguyen, O. T. Nguyen, S. V. Nguyen, S. Agus, H. J.
Kim, H. Fukushi, and K. Hirai. Sequence comparison of the VP2 variable region
of infectious bursal disease virus isolates from Vietnam. J Vet Med Sci 61:429-
432. 1999.
235. Torrents, D., J. Maldonado, N. Saubi, and E. A. Pages-Mant. Dogs as potential
carriers of infectious bursal disease virus. Avian Pathol 33:205-209. 2004.
236. Tsukamoto, K., C. Kojima, Y. Komori, N. Tanimura, M. Mase, and S.
Yamaguchi. Protection of chickens against very virulent infectious bursal disease
virus (IBDV) and Marek’s disease virus (MDV) with a recombinant MDV
expressing IBDV VP2. Virology 257:352-362. 1999.
237. Underwood, B. O., C. J. Smale, F. Brown, and B. J. Hill. Relationship of a virus
from tellina teniuis to infectious pancreatic necrosis virus. J Gen Virol:93-109.
1977.
238. Vakharia, V. N. Development of recombinant vaccines against infectious bursal
disease virus. Biotech Ann Rev:15-168. 1997.
![Page 94: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/94.jpg)
80
239. Vakharia, V. N., J. He, B. Ahamed, and D. B. Snyder. Molecular basis of
antigenic variation in infectious bursal disease virus. Virus Res 31:265-273. 1994.
240. Vakharia, V. N., D. B. Snyder, D. Lutticken, S. A. Mengelwhereat, P. K. Savage,
G. H. Edwards, and M. A. Goodwin. Active and passive protection against variant
and classic infectious bursal disease virus-strains induced by baculovirus-
expressed structural proteins. Vaccine 12:452-456. 1994.
241. van den Berg, T. B., N. Eterradossi, D. Toquin, and G. Meulemans. Infectious
bursal disease (gumboro disease). In Diseases of Poultry: World Trade and Public
Health Implications, OIE Scientific and Technical Review:509-543. 2000.
242. van den Berg, T. B., A. Ona, D. Morales, and J. F. Rodriguez.Experimental
inoculation of game/ornamental birds with a very virulent strain of IBDV. In:
Proceedings II International Symposium on infectious bursal disease and chicken
infectious anaemia. Rauischholzhausen. pp 236-246. 2001.
243. van den Berg, T. P. Acute infectious bursal disease in poultry: A review. Avian
Pathol. 29:174-194. 2000.
244. van den Berg, T. P., and G. Meulemans. Acute infectious bursal disease in poultry:
Protection afforded by maternally derived antibodies and interference with live
vaccination. Avian Pathology:409-421. 1991.
245. van den Berg, T. P., M. Gonze, and G. Meulemans. Acute infectious bursal
disease in poultry - isolation and characterization of a highly virulent-strain. Avian
Pathol 20:133-143. 1991.
![Page 95: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/95.jpg)
81
246. van den Berg, T. P., M. Gonze, D. Morales, and G. Meulemans. Acute infectious
bursal disease in poultry: Immunological and molecular basis of antigenicity of a
highly virulent strain. Avian Pathol 25:751-768. 1996.
247. van den Berg, T. P., D. Morales, N. Eterradossi, G. Rivallan, D. Toquin, R. Raue,
K. Zierenberg, M. F. Zhang, Y. P. Zhu, C. Q. Wang, H. J. Zheng, X. Wang, G. C.
Chen, B. L. Lim, and H. Muller. Assessment of genetic, antigenic and pathotypic
criteria for the characterization of IBDV strains. Avian Pathol 33:470-476. 2004.
248. Van der Marel, P., D. Snyder, and D. Lutticken. Antigenic characterization of
IBDV field isolates by their reactivity with a panel of monoclonal antibodies.
Dtsch Tierarztl Wochenschr 97:81-83. 1990.
249. van Loon, A. A. W. M., N. de Haas, I. Zeyda, and E. Mundt. Alteration of amino
acids in vp2 of very virulent infectious bursal disease virus results in tissue culture
adaptation and attenuation in chickens. J Gen Virol 83:121-129. 2002.
250. Vasconcelos, A. C., and K. M. Lam. Apoptosis induced by infectious bursal
disease virus. J Gen Virol 75 (Pt 7):1803-1806. 1994.
251. Vasconcelos, A. C., and K. M. Lam. Apoptosis in chicken embryos induced by the
infectious bursal disease virus. J Comp Pathol 112:327-338. 1995.
252. Veenhuis, M., J. P. van Dijken, and W. Harder. The significance of peroxisomes
in the metabolism of one-carbon compounds in yeast. Adv Microb Physiol:1-82.
1983.
253. Vervelde, L., and T. Davison. Comparison of the in situ changes in lymphoid cells
during infection with infectious bursal disease virus in chickens of different ages.
Avian Pathol26:803-821. 1997.
![Page 96: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/96.jpg)
82
254. von Bulow, V., R. Rudolph, and B. Fuchs. Enhanced pathenogicity of chicken
anemia agent (CAA) in dual infections with marek’s disease virus (MDV),
infectious bursal disease virus (IBDV) or reticuloendotheliosis virus (REV).
Zentralbl Veterinarmed B:93-116. 1986.
255. Wegner, G. H. Emerging applications of the methylotrophic yeasts. FEMS
Microbiol Rev 7:279-283. 1990.
256. Welsh, R. M., J. M. McNally, M. A. Brehm, and L. K. Selin. Consequences of
cross-reactive and bystander ctl responses during viral infections. Virology 270:4-
8. 2000.
257. Williams, A., and T. Davison. Enhanced immunopathology induced by very
virulent infectious bursal disease virus. Avian Pathol34:4-14. 2005.
258. Winterfield, R., S. B. Hitchner, G. S. Appleton, and A. Cosgrove. Avian
nephrosis, nephritis and gumboro disease. L&M News Views:103. 1962.
259. Wu, H., N. K. Singh, R. D. Locy, K. Scissum-Gunn, and J. J. Giambrone.
Immunization of chickens with vp2 protein of infectious bursal disease virus
expressed in arabidopsis thaliana. Avian Dis 48:663-668. 2004.
260. Wu, J., J. Lin, L. Chieng, C. Lee, and T. Hsu. Combined use of gap and aox1
promoter to enhance the expression of human granulocyte-macrophage colony-
stimulating factor in pichia pastoris. Enz Microb Technol:453-459. 2003.
261. Wu, P. C., H. Y. Su, L. H. Lee, D. T. Lin, P. C. Yen, and H. J. Liu. Secreted
expression of the vp2 protein of very virulent infectious bursal disease virus in the
methylotrophic yeast pichia pastoris. J Virol Methods 123:221-225. 2005.
![Page 97: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/97.jpg)
83
262. Wyeth, P. J. Effect of infectious bursal disease on response of chickens to s-
typhimurium and escherichia-coli infections. Vet Rec. 96:238-243. 1975.
263. Yamaguchi, T., K. Iwata, M. Kobayashi, M. Ogawa, H. Fukushi, and K. Hirai.
Epitope mapping of capsid proteins vp2 and vp3 of infectious bursal disease virus.
Arch Virol 141:1493-1507. 1996.
264. Yamaguchi, T., M. Ogawa, M. Miyoshi, Y. Inoshima, H. Fukushi, and K. Hirai.
Sequence and phylogenetic analyses of highly virulent infectious bursal disease
virus. Arch Virol 142:1441-1458. 1997.
265. Yao, K., and V. Vakharia. Induction of apoptosis in vitro by the 17-kda
nonstructural protein of infectious bursal disease virus: Possible role in viral
pathogenesis. Virology 285:50-58. 2001.
266. Yao, K., M. Goodwin, and V. Vakharia. Generation of a mutant infectious bursal
disease virus that does not cause bursal lesions. J Virol. 72:2647-2654. 1998.
267. Zhang, M. F., G. M. Huang, and S. L. Qiao. Early stages of infectious bursal
disease virus infection in chickens detected by in situ reverse transcriptase-
polymerase chain reaction. Avian Pathol31:593-597. 2002.
268. Zierenberg, K., H. Nieper, T. P. van den Berg, C. D. Ezeokoli, M. Voss, and H.
Muller. The VP2 variable region of African and German isolates of infectious
bursal disease virus: Comparison with very virulent, "classical" virulent, and
attenuated tissue culture-adapted strains. Arch Virol 145:113-125. 2000.
![Page 98: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/98.jpg)
84
Chapter III
Identification of infectious bursal disease viruses from RNA extracted from paraffin
embedded tissue1.
______________________
1Mohamed M. Hamoud and Pedro Villegas accepted in Avian Diseases Reprinted here with permission of publisher, 7/3/2006
![Page 99: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/99.jpg)
85
Abstract:
After histopathological screening bursa of Fabricius for the presence of infectious
bursal disease virus (IBDV), the hypervariable region of the VP2 gene for IBDV was
extracted from formalin fixed paraffin embedded tissue blocks. Using real-time RT-PCR
and sequencing, IBDV was identified in 227 different blocks. The ability to identify the
actual virus strain associated with the lesions observed microscopically in the bursa of
Fabricius allowed for direct correlation between viral identity and lesions, which may
help in designing vaccination strategies. Several new emerging viruses that do not group
with other known IBDV in phylogenetic tree analysis were identified, as well as a unique
variant virus that had 63 nucleotides missing from its hypervariable region.
Introduction:
Infectious bursal disease virus (IBDV) is the etiological agent of Gumboro
disease or infectious bursal disease (IBD). IBDV destroys the B lymphocyte precursors
found within the bursa of Fabricius, followed by bursal atrophy in young chickens (32).
In unprotected flocks, the virus may cause mortality and/ or immunosupression (16, 26).
There are two serotypes of IBDV: 1 and 2. All pathogenic viruses belong to serotype 1,
whereas serotype 2 viruses are non-pathogenic for both chickens and turkeys (12, 21).
Very virulent (vv) IBDV strains emerged in Europe in the late eighties, causing up to
60% mortality (4, 30). Strains of vvIBDV have also spread to other continents (1, 7, 28).
The epidemiological origin of vvIBDVs is still unknown (17).
IBDV belongs to the family Birnaviridae (genus Avibirnavirus) which includes
viruses with bisegmented dsRNA genomes (5). Genome segment A has 2 overlapping
open reading frames (ORF) the first encodes a precursor polyprotein in a large ORF, the
![Page 100: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/100.jpg)
86
product of which is cleaved by autoproteolysis to yield mature VP2 (outer capsid), VP4
(protease), andVP3 (inner capsid) (15). The other ORF of segment A encodes a non
structural protein,VP5 and is possibly involved in virus release (18, 33). Genome
segment B encodes the virus polymerase,VP1 (20). VP2 is the major host-protective
antigen of IBDV. It contains at least three independent epitopes responsible for the
induction of neutralizing antibody (2), thus the antigenic characterization of IBDV has
been based mainly on the study of the VP2 gene where some amino acid changes have
been shown to be the basis for antigenic variation (29), or have been proposed as putative
markers for vvIBDV (3, 22, 31).
Controlling infectious bursal disease (IBD) and its associated immune
suppression is critical to the broiler industry. This control is achieved by either
vaccinating breeder hens with conventional live attenuated and/or inactivated IBD
vaccines, or by the use of live IBD vaccines in broiler chicks, layers or young pullets to
provide active protection against IBDV, or a combination of both.
Using a histopathology archive can be very important in molecular research.
Bursal tissue specimens that have been preserved as paraffin blocks for many years
represent a historical collection of IBD. Paraffin embedded tissues have proved to be a
valuable source of DNA or RNA for molecular genetic analysis and the identification of
infectious agents like hepatitis C, and polio viruses (8,10, 24). The use of tissues that are
formalin fixed and embedded in paraffin as a source of genetic material may allow a
direct correlation between the IBDV strain present in the tissue and the pathological
lesions visualized by microscopy. Therefore, the information obtained by this technology
![Page 101: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/101.jpg)
87
may help refine vaccination programs for IBDV, as well as to detect any new emerging
IBDV strains.
The objective of this study was to utilize RNA extraction from formalin fixed paraffin
embedded tissue for rapid identification of nucleic acids from field strains of IBDV that
are causing actual lesions in commercial chickens, and comparing amino acid sequences
and nucleic acid sequences of the hypervariable region of VP2 of these field strains to
known vaccine and common IBDV strains.
Materials and methods
Tissue and Histopathological evaluation. Bursal tissues mainly from commercial
broiler flocks experiencing IBD-related problems from various regions of the world were
formalin fixed and paraffin embedded. Paraffin-embedded tissue samples were sectioned,
mounted, stained using hematoxylin and eosin (HE), and examined using light
microscopy. All sections of bursa of Fabricius were assigned a lesion score, where a
score of 1 represented no lesions, a score of 2 was defined as mild variation in follicle
size, 3 as moderate variation in follicle size, and 4 as either necrosis or follicle atrophy
(23). Tissues came from chickens with an age range from 14 to 84 days; tissues from
older birds were from broiler breeders.
Viruses: IBDV strains Edgar, Lukert, Variant A, Variant E, GLS, STC kept in our
laboratory were used as reference strains. Commercial IBDV vaccines S706™, SVS-
510™, IBD Blen™ and Bursa Blen™ (Merial Select Inc. Gainesville, GA), Clonevac
D78™ (Intervet Inc. Kenilworth, NJ), Univax™ (Schering-Plough Animal Health,
Millsboro, DE) and Bursine 2™ (Fort Dodge Animal Health, Fort Dodge, IA) were
obtained from each company.
![Page 102: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/102.jpg)
88
RNA Extraction. RNA was extracted from formalin-fixed, paraffin-embedded bursas
and examined for IBDV nucleic acid by real-time RT-PCR (23). Sections totaling 50 µm
in thickness were cut from each formalin-fixed, paraffin embedded tissue block,
deparaffinized in HemoDe (Fisher Scientific, Pittsburgh, PA), washed with 100%
ethanol, and digested with 25 ug/ml proteinase K (Sigma Chemical Co., St. Louis, MO)
for 1 hr at 50 C. RNA was extracted using Trizol (Life Technologies, Inc., Gaithersburg,
MD) according to the manufacturer’s recommendations, diluted in 25 µl of 90% dimethyl
sulfoxide, and frozen at -80 C until assayed. RNA from commercial vaccine viruses was
extracted using Trizol (Life Technologies, Inc., Gaithersburg, MD) according to the
manufacture’s recommendations, and then sequenced as mentioned below.
Real-time RT-PCR. Extracted RNA was denatured at 95 C for 5 min and kept on ice.
An RT-PCR was performed using reagents from the Light Cycler RNA Amplification
SYBR Green I Kit (ROCHE Molecular Biochemicals, Indianapolis, IN). The primers
used were designed to amplify a 276-base pair (bp) segment of the IBDV genome shared
by all strains, which represents the hypervariable region of the VP2 gene (primers
synthesized were different from those in cited reference). Amplification and detection of
specific products were also performed using a Light Cycler (ROCHE Molecular
Biochemicals, Indianapolis, IN) according to the manufacturer’s recommendations.
Briefly, RT-PCR was done at 55 C for 30 min., followed by denaturation at 95 C for 30
sec. Fifty five PCR cycles were performed, consisting of denaturation (95 C for 1 sec),
hybridization (55 C for 10 sec), and extension (72 C for 13 sec). A melting curve analysis
was done with an initial denaturation at 95 C. DNA melting was accomplished with an
initial temperature of 65 C for 10 sec and a gradual temperature increase of 0.1 C/sec
![Page 103: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/103.jpg)
89
until 95 C was reached. The melting temperature of the expected 276-bp amplicon was
between 82 C and 84 C. This estimated melting temperature was used to confirm the
identity of IBDV specific products obtained using real-time RT-PCR. Additional
confirmation of specific amplification was done using routine gel electrophoretic
techniques of the PCR products on 2% agarose (Sigma Chemical Co., St. Louis, MO),
followed by ethidium bromide staining (23).
Nucleotide sequence analysis: Extracted genomic material that was positive for IBDV
by real-time RT-PCR melting curve analysis was submitted to Integrated Biotech
Laboratories (IBL) at The University of Georgia (Athens, GA) for sequencing. The
nucleotide sequences were retrieved using Chromas program
(http://www.technelysium.com.au/chromas14x.html) and deduced amino acid sequences
were generated using EditSeq™ (DNASTAR inc. Madison, WI). All nucleic and
amino acid sequences were aligned using the clustal W method using the MegAlign™
program (DNASTAR inc. Madison, WI) and sequence distances calculated. Phylogenetic
analyses were conducted using MEGA version 3.0 software
(http://www.megasoftware.net/) by Neighbor-Joining, 1000 bootstrap replicates and p-
distance. This was used to compare the field IBDV strains to common vaccine strains
either sequenced in our lab or available on GenBank, as indicated by accession numbers
written before the strain name.
Selection of sample for evaluation : Tissues (bursa, spleen and thymus) were collected
globally from problem farms with immunosuppressive and performance issues. The
tissues were then fixed in 10% buffered formalin and shipped to a histology lab where the
tissues were processed and put into paraffin blocks. The blocks were cut with a
![Page 104: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/104.jpg)
90
microtome and slides were prepared for histological evaluation. The tissues were
evaluated by an avian histopathologist and the tissues with severe acute IBDV lesions
were identified and selected for genomic extraction. Real-time RT-PCR was carried out
on extracted genomic material and IBD was identified in samples by melting curve
analysis. The IBDV genomic material was sequenced and the sequences analyzed.
Results
Histopathological examination. There were 452 paraffin embedded blocks from IBDV
cases submitted to our laboratory from the beginning of January 2003 until the end of
June 2005 for IBDV testing. A majority of those blocks were characterized by the
presence of lesion scores of +3 or +4 (characterized by having severe acute bursitis);
while very few had +1 and +2 lesion scores.
Real time RT-PCR. Melting curve analysis detected that IBDV genomic material was
extracted from 227 of these blocks. The other 225 blocks yielded genomic material that
was negative for IBDV on real time RT-PCR testing, in spite of having severe
histological lesions characteristic of IBDV.
Cases from the United States of America totaled 207, of those 181 (87%)
contained IBDV genomic material. There were 245 international samples, of those only
46 (19%) were positive on real time RT-PCR testing. The extracted genomic material
expressed as location [number of positive cases] represented samples from Alabama [16],
Arkansas [10], Colorado [4], Delaware [22], Georgia [22], Iowa [2], Maryland [1],
Michigan [1], Mississippi [45], North Carolina [19], Ohio [4], Pennsylvania [4], South
Carolina [2], Texas [1], Virginia [13], and unknown domestic origin [15]. While
international samples represented Argentina [4], Brazil [4], Dominican Republic [2], El-
![Page 105: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/105.jpg)
91
Salvador [7], Guatemala [4], Mexico [6], Peru [7], Venezuela [12], China [6] and Japan
[1] (Tables 2 and 3).
Some of the submitted samples were autolytic, had chronic lesions, or contained
mild lesions (lesion score ≤ +2) and yielded no detectable genomic material upon
extraction with an exception of one block that had a +2 lesion score and was identified as
a Variant E virus.
Nucleotide and deduced amino acid analysis. The nucleotide sequences of extracted
genomic material from 227 cases were determined across 276 base pairs (bp) of the VP2
hypervariable region. The most dominant viruses present in the U.S.A were the Variant E
viruses while internationally they were the classic strains (Table 1). The geographic
origins of different strains of IBDV are illustrated in Tables 2 and 3. These 227 cases
included 29 classic, 15 Variant A, 160 Variant E, 4 vvIBDV, 7 that could not be
sequenced (Real time melting curve analysis was positive but sequence results - from 2
different independent labs - had too many unknown nucleotides to be properly identified)
and 12 unique viruses that did not fall in any particular group (table 1).
Several virus strains exhibited major differences from other IBDV strains were
identified and therefore are referred here as “unique viruses”. Examples for these unique
viruses included cases identified as 077 and 266. Case 077, in the absence of case 266
falls on a branch of its own (Figure 2), but in the presence of case 266, it clusters with
Nobilis Gumboro 228E™ (Figure 1) with 94.2% similarity in nucleic acid and 94.5% in
deduced amino acid analysis. Case 266 was on a branch of its own on both nucleic and
amino acid phylogenetic trees and did not cluster with any other IBDV strains (figure 1).
Sequence distance data showed that case 266 was closest to Variant E with 96.0%
![Page 106: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/106.jpg)
92
similarity in nucleotide sequence but was closest to STC and AF457106 Univax G603
(Schering Plough has G603 under the trade name Bursavac) with 92.3 % similarity in
deduced amino acid analysis.
Another example for unique viruses was case 087 (figure 1). Extraction and
identification of its genomic material revealed that this IBD virus strain lacked 63
nucleotides from its VP2 hypervariable region. In spite of this, the virus was apparently
still capable of replication in the bursa and caused acute follicle necrosis with no
regeneration (+4 lesion score). Nucleic acid analysis indicated that this was 98.1% similar
to Variant A virus while its deduced amino acid analysis concluded it was 95.7% similar
to both Variant A and Variant E viruses.
One Variant E virus was identified from a block containing tissue with +2 lesion
score, and this was an extremely rare result; as all other +2 blocks from experimentally
infected birds and commercial submissions did not yield genomic material for IBDV.
In multivalent vaccines, all the different strains present could not be identified.
Only the viral strain with the highest viral titer was identified in these multivalent
vaccines.
Discussion:
Controlling infectious bursal disease (IBD) and its associated immune
suppression is critical to the broiler industry. This control is achieved by either
vaccinating breeder hens and/or progeny to provide protection against IBDV. The use of
these vaccines may have caused selection pressure on field viruses that has led to the
emergence of variant strains of IBDV (27). It is also speculated that the very virulent
![Page 107: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/107.jpg)
93
strains of the IBDV (vvIBDV) may have emerged for the very same reasons that caused
the variant strains to emerge (25).
Because IBD is primarily controlled using vaccination, the failure of vaccines to
generate adequate immunity in young chicks is a major concern. One cause of vaccine
failure can be attributed to genetic drift of field viruses, which has lead to antigenically
divergent IBDV strains known as variants (9, 11). Current variant and classic IBDV
vaccines are able to protect against many of the antigenically divergent IBDV strains (9,
14). However, new antigenic variants of the virus have been reported to break through
maternal and active immunity generated using commercially available vaccines (14).
The purpose of this study was to rapidly identify field isolates of IBDV by using
formalin fixed paraffin embedded tissues as a source of genomic material. This is of
importance because it will allow a direct correlation between the virus strain present and
the lesions produced by this virus in a timely fashion. It will also allow analysis of
foreign strains of IBDV with no importation and biosecurity restriction issues because of
the inactivated nature of the antigen. Therefore, the information obtained by this
technology will help refine vaccination programs for IBDV, as well as detect any new
emerging IBDV strains both domestically and internationally.
Analysis of 452 paraffin embedded tissue blocks for presence of IBDV was based
on histopathological lesion scores for IBDV. These 452 samples were not selected at
random. Instead, they were submitted because IBD was suspected in the flock or on the
farm. This study was therefore biased toward IBDV on farms experiencing immune
suppression-related problems. When the viral genomes identified were from viruses
![Page 108: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/108.jpg)
94
associated with disease in commercial poultry operations, they had a greater potential to
be genetic and antigenic mutants (13).
In chickens experimentally infected with IBDV, all paraffin embedded blocks
with bursas having acute +3 or +4 bursitis had extractable genomic material that was
positive for IBDV based on melting curve analysis, indicating high sensitivity of primers
used. Most of the 452 blocks analyzed had +3 or +4 acute lesion scores for IBDV, yet
only 227 were positive for IBDV extractable genomic material. IBDV genomic extraction
rate from samples originating from the U.S.A. was 87%, while that from overseas was
only 19%. A possible explanation is that most of the cases that had acute +3 or +4
histological lesion score for IBDV but were negative on real-time RT-PCR melting curve
analysis for IBDV, were inadequately fixed. This conclusion was based on experimental
simulation of different fixation conditions that could occur in the field, where bursas
positive for extractable IBDV RNA were rendered negative just by changing fixation
conditions. Improving fixation conditions will improve extraction of RNA from paraffin
embedded tissue (6). The seven samples that could not be sequenced were sequenced
repeatedly in 2 different laboratories and yielded similar non specific results. They were
not false positives as they had segments of IBDV sequence, yet they could not be aligned
due to the presence of too many non specific nucleotides (Ns). Also this genomic
material was extracted from bursa’s with specific +4 acute lesions of IBDV.
Nucleic acid and deduced amino acid analysis of extracted IBDV genomic
material has shown that the Variant E strain of IBDV is the predominant strain present in
the U.S.A. as it has also been observed by Jackwood and Sommer-Wagner (13). Classical
strains found in the United States were mainly of vaccine origin. There were no vvIBDV
![Page 109: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/109.jpg)
95
strains found in the U.S.A. Internationally, four vvIBDV strains from both Venezuela and
China were identified. Variant A strains were found in both Peru and Venezuela. Variant
E strains were identified in El Salvador, Guatemala, Mexico, Peru and Venezuela.
Internationally, more classical than variant strains were identified, which is similar to
what Lukert and Saif have reported (19).
Phylogenetic analysis shows that serotype 1 viruses grouped together in several
different groups. These groups were identified as Lukert, Edgar, vvIBDV, STC, 2512,
Websters, various classic, Variant A and Variant E groups. Previous knowledge of strain
origin and identity along with location of viruses on phylogenetic trees was the basis
used for grouping these viruses. The Faragher 52/70 (Gallivac) and the 228E strains fell
on different branches and did not cluster with any other classic IBDV strains (Figure 1
and 2). It was noticed that BursaVac™ fell into two different clusters, the first (GenBank
accession number AF498633) being in the STC cluster and the second (AF148075) was
in the Websters cluster. The same observation was seen for Bursine 2™, where the
Bursine 2 sequenced in our laboratory fell in the Lukert group (similar to the Bursine 2
with GenBank accession number AF498631 - not in figure) while Bursine 2 with
accession number AY332561 fell in the group named various classic (Figure 1 and 2).
The explanation for this may be the use of different strains for production of the same
vaccine, different strains are being given the same trade name by different companies and
researchers, or mislabeling occurred and sequences were posted incorrectly on GenBank.
Therefore, extreme caution has to be made when advising which vaccine to use, because
although two vaccines may have the same trade name, they may contain different IBDV
strains which may not cross protect against the same field isolates of IBDV. To overcome
![Page 110: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/110.jpg)
96
this problem, it is best if the vaccines that are used for comparison to field isolates be
sequenced by the researchers themselves. Variant viruses clustered into Variant A and
Variant E. Variant E had three different branches, with strain 89/03 on one branch,
RS593 on the second branch and Delaware E on the third branch.
Due to the large number of field strains analyzed in this study, only representative
samples are discussed. Several unique virus strains that did not group with the common
IBDV strains and fell on branches of their own were identified; examples for this are
cases 077 and 266. Sequence distance data showed that case 266 had a peculiar property
of being closest to a Variant E strain (96.0% similarity) when analyzing its nucleotide
sequence but its deduced amino acid sequence distance data concluded it was closest to
STC and Bursavac G603 strains (92.3 % similarity). The reason for the shift from variant
to classic strain based upon deduction of amino acid sequence from a nucleotide
sequence is unknown. There may be a need to include these strains (077 and 266) in
future IBDV vaccines depending on how widespread these viruses become among
chicken flocks, as each of these strains was isolated from one farm only.
Genomic material was isolated and identified from a unique IBD virus strain that
was missing 63 nucleotides from its hypervariable region in the VP2 gene, but was
apparently able to replicate in the bursa and cause lymphocytic damage. This unique
virus was given case number 087. Nucleic acid analysis indicated that the virus in case
087 was 98.1% similar to Variant A virus while its deduced amino acid analysis
concluded it was 95.7% similar to both Variant A and Variant E viruses. VP2 is
important for virus attachment to cell receptors and is the viral protein that is recognized
by the chicken’s immune system (2, 29). Missing these 21 amino acids apparently did not
![Page 111: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/111.jpg)
97
affect the virus’s ability to attach and enter the susceptible B-lymphocytes. Constant
vaccination pressure in the past may have contributed to the emergence of variant strains
and vvIBDV (25, 27). Case 087 may have resulted from random mutations by the virus in
an attempt to escape from the immunoglobulins produced in vaccinated chickens; or
maybe this virus was always there in the population of IBDV viruses and constant
vaccination against variant IBD viruses suppressed other viruses, giving this virus a
chance to infect and propagate in the bursas. Also, the equal base pair distances from
both Variant A and Variant E viruses may provide cross protection against both Variant
A and E viruses, however, this needs to be investigated.
The strain identified from the bursa of Fabricius with a lesion score of +2 needs to
be further investigated to see if it is truly apathogenic, and if the virus possesses any
protective abilities against naturally occurring viruses. In the few bursa of Fabricius
encountered with a lesion score of +2, genomic material for IBDV could not be detected
in any of those blocks, this is likely due to low viral load or because these lesions were
due to stressors other than IBDV; with the exception of this case where there was enough
viral load in the block to extract genomic material. It was identified as a Variant E.
From the large number of samples submitted for identification, most of them had
more than 95% similarity to reference strains, example: case 290 was 100% identical in
nucleic acid to STC and Bursavac G603™, case 1042-1 was most similar to Edgar IBDV
strains, cases 340, 366 and 373 were most similar to AL-1 strain of Variant E.
The inability to identify all strains present in multivalent vaccines was attributed
to the nature of the RT-PCR reaction which amplifies the virus with higher logarithmic
concentration than the other viruses that have lower concentration. So when a sequencing
![Page 112: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/112.jpg)
98
reaction is run and analyzed, only the nucleotides that are most abundant are identified.
This was noticed when sequencing a bivalent vaccine, SVS-510™, where only the
predominant variant portion of the vaccine was identified and not the classic portion. To
overcome this, the seeds of that vaccine were isolated and sequenced independently. This
variant portion of this bivalent vaccine was identified in figure 1 and 2 as SVS-510
(Variant portion) while the classical portion was identified as SVS-510 (Standard
portion).
The research potentials of this technology have allowed quick profiling of IBDV
strains that are causing lesions in the field. This is a diagnostic tool that can assist
veterinarians in choosing which vaccines to use based on the nucleic acid sequence of the
hypervariable region of VP2. This in turn may allow the identification of potentially new
vaccine strains.
As with all molecular techniques that are used to predict the relative similarities
and differences between IBDV strains, determining the actual antigenic differences
among viruses requires testing in-vivo (14).
References:
1. Banda, A., and P. Villegas. Genetic characterization of very virulent Infectious Bursal
Disease viruses from Latin America. Avian Dis. 48:540-549. 2004.
2. Becht, H., H. Muller, and H. Muller. Comparative studies on the structural and
antigenic properties of two serotypes of Infectious Bursal Disease virus. J. Gen.
Virol. :631-640. 1998.
![Page 113: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/113.jpg)
99
3. Brandt, M., K. Yao, M. Liu, R. A. Heckert, and V. N. Vakharia. Molecular
determinants of virulence, cell tropism, and pathogenic phenotype of infectious
bursal disease virus. J. Virol. 75:11974-11982. 2001.
4. Chettle, N., J. C. Stuart, and P. J. Wyeth. Outbreak of virulent infectious bursal disease
in East Anglia. Vet. Rec. 125:271-272. 1989.
5. Dobos, P., L. Berthiaume, J. A. Leong, F. S. Kibenge, H. Muller, and B. Nicholson.
Family birnaviridae. In: Virus taxonomy. Classification and Nomenclature of
viruses, Sixth report on the international committee on Taxonomy of Viruses.
Murphy, F.A., Fauquet, C.M., Bishop, D.H.L., Ghabrial, S.A., Jarvis, A.W.,
Martelli, G.P., Mayo, M.A., Summers, M.D. ed. Arch. Virol. [Suppl. 10]
Springer, Wein, New York. 1995.
6. Hamoud, M. H., T. P. Brown, and M. J. Pantin-Jackwood. Molecular characterization
of viral pathogens: Extraction of genomic RNA from paraffin embedded tissues.
In: 141 AVMA annual convention. CD ROM. Philadelphia, PA. 2004.
7. Hassan, M. K. Very virulent infectious bursal disease virus in Egypt: Epidemiology,
isolation and immunogenicity of classic vaccine. Vet. Res. Commun. 28:347-356.
2004.
8. Hofmann, W.P., V. Dries, E. Herrmann, B. Gartner, S. Zeuzem, and C. Sarrazin.
Comparison of transcription mediated amplification (TMA) and reverse
transcription polymerase chain reaction (RT-PCR) for detection of hepatitis C
virus RNA in liver tissue. J. Clin. Virol. Apr;32(4):289-293. 2005
9. Ismail, N. M., and Y. M. Saif. Immunogenicity of infectious bursal disease viruses in
chickens. Avian Dis 35:460-469. 1991.
![Page 114: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/114.jpg)
100
10. Jackson, D., F. Lewis, G. Taylor, A. Boylston, and P. Quirke. Tissue extraction of
DNA and RNA and analysis by the polymerase chain reaction. J. Clin.
Pathol.:499-504. 990.
11. Jackwood, D., and S. Sommer. Genetic heterogeneity in the VP2 gene of infectious
bursal disease viruses detected in commercially reared chickens. Avian Dis.
42:321-339. 1998.
12. Jackwood, D., Y. Saif, and J. Huges. Characteristics and serological studies of 2
serotypes of infectious bursal disease virus in turkeys. Avian Dis. 26:871-882.
1982.
13. Jackwood, D. J., and S. E. Sommer-Wagner. Molecular epidemiology of infectious
bursal disease viruses: Distribution and genetic analysis of newly emerging
viruses in the United States. Avian Dis. 49:220-226. 2005.
14. Jackwood, D. J., S. E. Sommer, and H. V. Knoblich. Amino acid comparison of
infectious bursal disease viruses placed in the same or different molecular groups
by RT/PCR-RFLP. Avian Dis. 45:330-339. 2001.
15. Kibenge, F. S., A. S. Dhillon, and R. G. Russell. Biochemistry and immunology of
infectious bursal disease virus. J. Gen. Virol. 69 (Pt 8):1757-1775. 1988.
16. Lasher, H., and S. Shane. Infectious bursal disease. World Poul. Sci. J. 50:133-166.
1994.
17. Le Nouen, C., G. Rivallan, D. Toquin, and N. Eterradossi. Significance of the genetic
relationships deduced from partial nucleotide sequencing of infectious bursal
disease virus genome segments A or B. Arch. Virol. 150:313-325. 2005.
![Page 115: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/115.jpg)
101
18. Lombardo, E., A. Maraver, I. Espinosa, A. Fernandez-Arias, and J. F. Rodriguez.
VP5, the nonstructural polypeptide of infectious bursal disease virus, accumulates
within the host plasma membrane and induces cell lysis. Virol. 277:345-357.
2000.
19. Lukert, P. D., and Y. M. Saif. Infectious bursal disease. In: Diseases of
Poultry, 11th edition ed. Y.M. Saif, H.J. Barnes, J.R. Glisson, A.M. Fadly, L.R.
Mc Dougald, D.E. Swayne. Iowa State University Press, Ames, IA. pp 161-179.
2003.
20. Macreadie, I. G., and A. A. Azad. Expression and RNA dependent RNA polymerase
activity of birnavirus VP1 protein in bacteria and yeast. Biochem. Mol. Biol. Int.
30:1169-1178. 1993.
21. McNulty, M., and Y. Saif. Antigenic relationship of non- serotype turkey infectious
bursal disease viruses from the United States and United Kingdom. Avian Dis.
32:374-375. 1988.
22. Mundt, E. Tissue culture infectivity of different strains of infectious bursal
disease virus is determined by distinct amino acids in VP2. J. Gen. Virol. 80 (Pt
8):2067-2076. 1999.
23. Pantin-Jackwood, M. J., T. P. Brown, Y. Kim, and G. R. Huff. Proventriculitis in
broiler chickens: Effects of immunosuppression. Avian Dis. 48:300-316. 2004.
24. Rekand, T., R. Male, A.O. Myking, S.J. Nygaard, J.A. Aarli, L. Haarr. and N.
Langeland. Detection of viral sequences in archival spinal cords from fatal cases
of poliomyelitis in 1951-1952. J Virol Methods. Dec;114(1):91-96 2003.
![Page 116: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/116.jpg)
102
25. Rong, J., T. Cheng, X. Liu, T. Jiang, H. Gu, and G. Zou. Development of
recombinant VP2 vaccine for the prevention of infectious bursal disease of
chickens. Vaccine 23:4844-4851. 2005.
26. Sharma, J. M., I. J. Kim, S. Rautenschlein, and H. Y. Yeh. Infectious bursal disease
virus of chickens: Pathogenesis and immunosuppression. Dev. Comp. Immunol.
24:223-235. 2000.
27. Snyder, D. Changes in the field status of infectious bursal disease virus. Avian Pathol.
19:419-423. 1990.
28. Tan, D. Y., M. Hair-Bejo, A. R. Omar, and I. Aini. Pathogenicity and molecular
analysis of an infectious bursal disease virus isolated from Malaysian village
chickens. Avian Dis. 48:410-416. 2004.
29. Vakharia, V. N., J. He, B. Ahamed, and D. B. Snyder. Molecular basis of antigenic
variation in infectious bursal disease virus. Virus Res. 31:265-273. 1994.
30. van den Berg, T. Acute infectious bursal disease in poultry: A review. Avian
Pathol. 29:175-194. 2000.
31. van Loon, A. A., N. de Haas, I. Zeyda, and E. Mundt. Alteration of amino acids in
VP2 of very virulent infectious bursal disease virus results in tissue culture
adaptation and attenuation in chickens. J. Gen. Virol. 83:121-129. 2002.
32. Wyeth, P. J., and G. A. Cullen. Maternally derived antibody-effect on susceptibility
of chicks to infectious bursal disease. Avian Pathol.:253-260. 1976.
33. Yao, K., and V. N. Vakharia. Induction of apoptosis in vitro by the 17-kda
nonstructural protein of infectious bursal disease virus: Possible role in viral
pathogenesis. Virol. 285:50-58. 2001.
![Page 117: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/117.jpg)
103
Acknowledgment:
The authors would like to thank Dr. Stanley Kleven and Dr. John Glisson for
reviewing this manuscript. Histopathological screening for samples submitted after
August 2004 was done by Dr. Frederick Hoerr.
![Page 118: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/118.jpg)
104
Figure Legend
Figure 3.1: Consensus nucleic acid phylogram of common IBDV vaccines and strains, in
addition to some field strains identified from paraffin embedded tissues deduced from
1000 trees by Neighbor-Joining method. Numbers at the forks indicate the number of
times (as a percentage) the groups consisting of the sequences which are to the right of
that fork occurred after the generation of 1000 trees. P-distance bar in bottom of figure.
Arrows indicate field cases identified in our laboratory which are labeled by case number.
Other isolates are identified with GeneBank accession numbers and trade name. Samples
without accession numbers were also extracted and sequenced in our laboratory. Only
213 nucleotides were sequenced in case 087 A.
Figure 3.2: Consensus amino acid phylogram of common IBDV vaccines and strains, in
addition to some field strains identified from paraffin embedded tissues deduced from
1000 trees by Neighbor-Joining method. Numbers at the forks indicate the number of
times (as a percentage) the groups consisting of the sequences which are to the right of
that fork occurred after the generation of 1000 trees. P-distance bar in bottom of figure.
Arrows indicate field cases identified in our laboratory which are labeled by case number.
Other isolates are identified with GeneBank accession numbers and trade name. Samples
without accession numbers were also extracted and sequenced in our laboratory. Only
213 amino acids were deduced in isolate 087 A.
![Page 119: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/119.jpg)
105
Fig 3.1
![Page 120: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/120.jpg)
106
Fig 3.2
![Page 121: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/121.jpg)
107
Table 3.1: Number of IBDV strains isolated and identified from 2003-2005 according to geographical origin of the paraffin
embedded tissues
2003 2004 2005
Strains of IBDV
U.S.A. International U.S.A. International Unknown
origin
U.S.A. International
Classic 3 12 3 2 2 7
Variant A 3 0 5 0 1 3 3
Variant E 24 0 49 7 9 64 7
vvIBDV 0 1 0 0 0 0 3
Unique* 0 1 4 0 0 5 2
Strains that
could not be
sequenced §
0 1 1 0 5 0 0
Total 30 15 62 9 15 74 22
*Unique: Any virus that did not group with common strains of IBDV or possessed different genomic characteristics.
§Strains that could not be sequenced: The sequence data had too many unknown nucleotides (N’s) that when aligned with
other viruses, it was unidentifiable but melting curve analysis as well as histopathological examination confirmed it was an
IBDV
![Page 122: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/122.jpg)
108
Table 3.2: Distribution of IBDV strains in the United States of America from 2003-2005
Location Classical Variant A Variant E Unique*
Alabama 1 15
Arkansas 7 3
Colorado 1 3
Delaware 1 4 15 2
Georgia 1 1 19 1§
Iowa 1 1
Maryland 1
Michigan 1
Mississippi 1 41 3
North
Carolina
1 18
Ohio 4
Pennsylvania 2 2
South
Carolina
2
Texas 1
Virginia 2 11
Unknown
origin
1 9 5§
*Unique: Any virus that did not group with common strains of IBDV or
possessed different genomic characteristics.
![Page 123: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/123.jpg)
109
§ Strains that could not be sequenced: The sequence data had too many unknown
nucleotides (N’s) that when aligned with other viruses, it was unidentifiable but
melting curve analysis as well as histopathological examination confirmed it was an
IBDV
![Page 124: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/124.jpg)
110
Table 3.3: Distribution of IBDV strains in the world during 2003-2005
Location Classical Variant A Variant E Unique
Argentina 4
Brazil 4
Dominican Republic 2
El-Salvador 2 5
Guatemala 1
Mexico 4 2
Peru 4 1 1 1
Venezuela 2* 2 5 3
China 4+2*
Japan 1
* vvIBDV
![Page 125: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/125.jpg)
111
Chapter IV
Detection of infectious bursal disease virus from formalin-fixed paraffin-embedded
tissue by immunohistochemistry and real-time reverse transcription-polymerase
chain reaction1
______________________________
1Mohamed M. Hamoud, Pedro Villegas and Susan M. Williams Submitted to Journal of Veterinary Diagnostic Investigations
![Page 126: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/126.jpg)
112
Abstract
Formalin fixed paraffin embedded tissues blocks are used routinely to diagnose
the economically important immunosuppressive infectious bursal disease virus (IBDV) in
chickens. Immunohistochemical detection of viruses in tissue blocks has been done with
varying results between laboratories. Extraction of IBDV RNA from tissue blocks allows
IBDV strain identification at a molecular level. This allows correlation between virus
identity and histological lesions present in the tissue. Experimentally RT-PCR detectable
IBDV RNA could always be extracted from tissue blocks with acute +3 or higher
histological lesion scores. However, many blocks from diagnostic field cases did not
yield detectable IBDV RNA, in spite of having severe IBDV histological lesion scores.
The reason for this can be the effect different formalin fixation conditions have on RNA
detection from tissue blocks. To study the effect of various fixation parameters on RNA
extraction and immunohistochemical detection of IBDV, bursas with high viral loads and
maximum histological lesion score of 4 for IBDV were fixed in formalin under various
conditions (different pH levels, temperatures, concentrations of formalin, and fixation
duration). Only tissues fixed in formalin with a pH of 7.0, concentration of 5 or 10%
formaldehyde, storage temperature of 25°C or less, and kept for up to 2 weeks in
formalin yielded detectable IBDV RNA upon extraction. No RNA could be detected
from tissues fixed under extreme temperature, pH or formalin concentrations. Optimal
fixation conditions for IHC detection of IBDV were 10% formalin concentration, pH 7.0
and temperature of 4°C, where maximum intensity of immunostaining was observed.
![Page 127: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/127.jpg)
113
Key words: Infectious Bursal Disease, Chicken, Immunohistochemistry, RNA
extraction, Paraffin embedded tissue, formalin fixation.
![Page 128: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/128.jpg)
114
Introduction
Classical infectious bursal disease (IBD), or Gumboro disease, is an acute, highly
contagious viral disease of young birds characterized by severe necrosis, hypoplasia, or
atrophy in the bursa of Fabricius, mainly observed at 3–6 weeks of age.23 IBD has
worldwide distribution, and the effects of the disease are economically significant to the
commercial poultry industry. Highly virulent strains cause increased mortality rates in
chickens. Survivors of classical IBD are immunosuppressed, which is also the outcome of
IBDV infection with antigenic variant strains. Variant IBDV differ from the classical
IBDV strains in that they usually do not cause mortality and can infect chicken younger
than 3 weeks of age. Variant viruses cause immunosuppression by viral induced
apoptosis of lymphocytes in the bursa. Immunocompromised chickens have an increased
susceptibility to other pathogens, such as Newcastle disease virus, infectious bronchitis
virus, infectious laryngotracheitis virus, Salmonella spp, or to other opportunistic agents
such as Escherichia coli. Furthermore, immunosuppressed birds may not respond
properly to vaccination and may suffer severe or persistent postvaccinal reactions.13
Infectious bursal disease virus (IBDV) is a member of the Birnaviridae family
with a genome consisting of two segments of double-stranded RNA. IBDV is a non-
enveloped icosahedral virus with a diameter of 55-60 nm. The smaller segment of RNA
encodes viral protein (VP) 1, which is the RNA polymerase of the virus. The large
segment encodes a polyprotein which is processed into three structural proteins, VP2,
VP3, and VP4.2,10,19 The large segment also encodes the structural protein VP5 in another
reading frame.15 Of these different genes, VP2 gene encodes for the major antigenic
![Page 129: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/129.jpg)
115
protein and its hypervariable region is what confers variability among different IBDV
strains.
The severity of IBDV infection depends on the virulence of the virus, age of
birds, and level of circulating maternal antibodies. Cytotoxic T cells may exacerbate
virus-induced cellular destruction by lysing cells expressing viral antigens. T cells may
also promote the production of pro-inflammatory factors, such as nitric oxide, increasing
tissue destruction18. Outbreaks with high mortality rates caused by very virulent IBDV
(vvIBDV) strains have been reported in Europe, Asia and Latin America.21 Subclinical
and immunosuppressive forms of the disease are prevalent in the United States, where
reduction of body weight and lack of uniformity may be produced in mild outbreaks.13
Real-time RT-PCR (rt-RT-PCR) has been used to previously to detect IBDV in
tissues of infected chickens that were either frozen or stored in phenol.13,14 IBD viral
RNA has also been detected by rt-RT-PCR from formalin-fixed, paraffin-embedded
bursas.17 Using this technique, formalin fixed paraffin embedded bursa of Fabricius from
chickens experimentally infected with IBDV, and with histological lesion scores of +3 or
more always yielded rt-RT-PCR detectable IBDV RNA. However, diagnostic field cases
did not always yield rt-RT-PCR detectable RNA. Some samples (225 blocks over a 3-
year period) that had acute +4 histological lesion scores were negative for IBDV with rt-
RT-PCR. This finding occurred more often in diagnostic samples submitted from outside
the United States than in those originating from the United States (paper to be published
in Avian Diseases). The reason why some infected samples tested negative by rt-RT-PCR
has yet to be determined. It was recommended that these samples should be fixed in 10 %
buffered formalin and kept at room temperature, but pH analysis of formalin and H&E
![Page 130: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/130.jpg)
116
artifacts indicated that some of the samples were fixed in more concentrated formalin,
formalin with variable pH levels or subjected to high temperatures during formalin
fixation. These observations suggested that formalin fixation conditions might have an
effect on rt-RT-PCR detectable RNA from tissue blocks.
Previous research has proved that formalin fixation of tissues is suitable for
immunohistochemistry because formalin is a relatively mild fixative for preservation of
antigenic reactivity. 22 However, formalin fixation can impair or block the antigenic
reactivity of certain proteins.1,4,16 This impairment may be due to extensive cross-linking
of proteins by formaldehyde, where amino groups become blocked and antibodies to
those amino groups do not participate in IHC staining.20
The objective of this study was to experimentally simulate field conditions in
terms of storage time, temperature, pH of unbuffered formalin, and different
concentrations of buffered formalin to test their effect on IBDV RNA extraction from
paraffin embedded tissue for use in rt-RT-PCR and immunohistochemical staining.
Materials and Methods
Birds and experimental design: A total of 95 specific pathogen free (SPF) chickens were
hatched from fertilized eggsa for this experiment. All birds were housed in Horsfall-
Bauer isolation units in 19 groups of five and maintained under positive pressure. Food
and water were provided ad libitum. At 3 weeks of age, the chickens were inoculated
with IBDV Blen vaccineb which contains the 2512 strain. Inoculation routes of intranasal,
oral and intramuscular administration (1x 104.0 EID 50/route) were given simultaneously
to each infected bird to ensure a high viral load in infected tissue. Five uninfected birds
![Page 131: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/131.jpg)
117
were maintained as uninfected controls. Bursal tissue was collected 5 days post
inoculation and subjected to different fixation protocols as described in the experimental
design shown in Table 1.
Histopathology and immunohistochemistry. A 37% formaldehyde solution was diluted in
either neutral phosphate buffered saline (PBS), distilled water or was used undiluted for
formalin fixation. The pH was adjusted with either 10% sodium hydroxide or 5%
hydrochloric acid. Paraffin-embedded tissues were sectioned, mounted, stained with
hematoxylin and eosin (H&E) by using an automated stainerc, and examined for lesions
by light microscopy. All sections were assigned a lesion severity score. For all samples, a
lesion score of 1 represented no lesions; 2 represented mild reduction in overall follicle
size; 3 represented moderate reduction in follicle size; and 4 represented either necrosis
or follicle atrophy.17 All procedures for immunohistochemistry (IHC) were done at room
temperature. Five-micron thick tissue sections were cut from paraffin-embedded samples
and mounted on charged glass slidesd. Paraffin was melted from slides (10 min at 65°C)
and removed by immersion in Hemo-De e three times (5 min each). Slides were then air
dried. Antigen retrieval was done by incubating slides with 10% proteinase Kf for 5 min
at room temperature. IHC staining was performed with an automated stainerg using a
commercial kith according to the manufacturer’s recommendations. The primary antibody
used was a mouse monoclonal antibody specific to and cross-reactive among all IBDV
strains.i The secondary antibodyh was a peroxidase labeled polymer conjugated to anti-
mouse and anti-rabbit immunoglobulins. After IHC staining, sections were
counterstained with hematoxylin, cover slipped, and examined by light microscopy. The
degree of IBDV infection in each section was scored as follows: - = no infection;
![Page 132: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/132.jpg)
118
+ = minimal infection (<10% of cells present); ++ = moderate infection (>10% and <30%
of cells present); and +++ = intense infection (>30% of cells present).17
RNA extraction and quantification. RNA was extracted from formalin-fixed, paraffin-
embedded bursas and examined for IBDV nucleic acid by rt-RT-PCR.17 Sections totaling
50 µm in thickness were cut from each formalin-fixed, paraffin-embedded tissue block,
deparaffinized in Hemo-Dee, washed with 100% ethanol, and digested with 25 ug/ml
proteinase Kf for 1 hr at 50°C. RNA was extracted using Trizolj according to the
manufacturer’s recommendations, resuspended in 25 µl of 90% dimethyl sulfoxide, and
frozen at -80◦C until assayed.17 Extracted RNA was quantified using eppendorf
biophotometerk and 50-2000 µl UVettel.
Real-time RT-PCR. The RNA extracted from tissue blocks was denatured at 95°C for 5
min and kept on ice. A rt-RT-PCR was performed using reagents from the LightCycler
RNA Amplification SYBR Green I Kitm and the LightCycler machinem according to
manufacturer’s recommendations. The primers (B5 5’ TCTTGGGTATGTGAGGCTTG
and B4 3’ GGATGTGATTGGCTGGGTTA)17 were designed to amplify a 400-base pair
(bp) segment of the hypervariable region of the IBDV VP2 gene (GenBank accession
number DQ355819). Briefly, RT was performed at 55°C for 30 min, followed by
denaturation at 95°C for 30 sec. Fifty-five PCR cycles were performed, consisting of
denaturation (95°C for 1 sec), hybridization (55°C for 10 sec), and extension (72°C for
13 sec). A melting curve analysis was done with an initial denaturation at 95°C (for 1
sec.). DNA melting was accomplished with an initial temperature of 65°C for 10 sec and
a gradual temperature increase of 0.1°C/sec until 95°C was reached. After which, there
was a cooling segment and a gradual temperature decrease of 2°C/ sec till the holding
![Page 133: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/133.jpg)
119
temperature 20°C was reached. The melting temperature of the expected 400-bp
amplicon was between 82°C and 84°C. This estimated melting temperature was used to
confirm the presence of IBDV specific products obtained using real-time RT-PCR.17 A
no template control (DEPC-water) and a positive IBDV control was used in each run.
Electrophoresis of real-time RT-PCR products were run on 1.5% agarose gel and
visualized by ethidium bromide staining, to correlate between melting curve peaks and
size of amplified product. This was done initially to verify the specificity of the melting
curve peaks seen in the rt-RT-PCR reaction printouts.
Results
Histology and Immunohistochemistry. Out of 90 infected birds, 89 bursas had
lesion scores of 4, the remaining bursa had a lesion score of 3. All 5 chickens from the
uninfected negative control group had lesion scores of 1. All of the IBDV uninfected
negative control slides were negative using immunohistochemistry. All 5 IBDV infected
positive control slides demonstrated strong immunoreactivity for IBDV. This
demonstrated the specificity of the IHC technique used (Fig. 1, Table 2).
Histological evaluation of 5 bursas from each treatment group demonstrated that
for IBDV infected bursas fixed in different concentrations of formalin, the optimal
formalin concentration for formalin fixed tissues used for IHC staining was 10% formalin
(Table 2). The use of 5% formalin for formalin fixation produced a light nonspecific
background staining of erythrocytes and fibroblasts. IBDV antigen was not detected in
slides that came from paraffin embedded tissues fixed in 20% or 37% formalin (Table 2).
One area in one of the 5 samples fixed in 37% formalin had lymphoid cells with positive
staining. Light staining of apoptotic bodies, epithelial cytoplasm and vacuoles were
![Page 134: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/134.jpg)
120
present and was interpreted as non-specific background staining. Hematoxylin and eosin
staining showed severe lymphoid depletion, atrophy in follicles, and increase in
interfollicular stroma. Artifacts seen in tissues fixed with 20% or 37% formalin
concentrations included granularity of interplical mucin, and mucin in epithelial cysts.
Tissues fixed in 37% formalin had diffuse eosinophilic staining.
Tissues fixed in 10% buffered formalin at different fixation temperatures showed
variable IHC staining. Fixation at 4°C yielded the best staining. The number of IHC
staining positive cells decreased as the fixation temperature increased (Table 2). H&E
artefacts observed in tissues stored at 50°C included streaming and smudging of nuclei,
loss of follicular architecture and very plump fibroblasts in stroma of atrophied plica.
The pH of formalin used for fixation had the most variable effects on IHC
staining. Optimal staining was observed when infected bursal tissue was fixed at pH 7.0.
At pH 2.0 minimal IHC staining of apoptotic bodies within the center of the follicles and
very rare moderate staining of mononuclear cells was observed in all 5 bursas of this
group. At pH 5.0 there was a complete loss of staining. All tissues fixed in formalin at pH
9.0 and 13.0 exhibited non-specific staining of apoptotic bodies and cellular debris. H&E
staining artifacts at pH 2.0 included tinctorial variations of epithelial cells, while at pH
5.0 there was cell shrinkage. At pH 9.0 there was streaming of epithelial nuclei and at pH
13.0 there were epithelial shrinkage and compressed fibroblasts.
IBDV RNA extraction and real time RT-PCR. The amount of extracted RNA
extracted from tissue blocks ranged from 159.92 – 1194.66 µg/ml. Specificity of rt-RT-
PCR melting curve analysis was verified by running amplicons on a 1.5% agarose gel
stained with ethidium bromide (Fig. 2). Detectable IBDV RNA was extracted from all 5
![Page 135: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/135.jpg)
121
bursas stored in pH 7 as well as 1 of the 5 bursas stored in pH 13,0. All tissues fixed pH
2.0, pH 5.0 and pH 9.0 had a histopathological lesion score of 4 but none yielded
detectable IBDV RNA that was identifiable by rt-RT-PCR melting curve. (Table 3).
Real-time RT-PCR melting curve identifiable RNA was extracted from bursas stored at
temperatures 4°C and 25°C but not from 50°C (Table 3). Real time RT-PCR detectable
IBDV RNA was extracted from bursas of Fabricius stored in 5% or 10% buffered
formalin, but not from those tissues stored in 20% buffered formalin or 37% unbuffered
formalin (Table 3). Storage time for up to 2 weeks had no effect on IBDV RNA
extraction and identification, as melting curve peaks specific for IBDV were present at all
fixation times studied. However, storage times longer than 24 hours increased the melting
peak by 1°C; and after 2 weeks it was increased by 2°C. (Fig. 3).
Discussion
Formalin fixation is a common method for tissue preservation in preparation for
histological evaluation of tissues. For immunohistochemistry, small (10 X 10 X 3 mm)
tissue fragments fixed promptly in neutral buffered formalin for 6-24 hours generally had
adequate cytological preservation and immunolocalization, with minimal antigen
masking.9 Variations in fixation times or conditions cause the majority of false negatives
in immunohistochemistry.7 It was reported that lack of consistency in formalin fixation
protocols among laboratories, influences the outcome of staining in
immunohistochemistry.12 Formaldehyde fixes tissue by reacting primarily with basic
amino acids to form cross-linked “methylene bridges”. Formalin fixation conditions have
a direct effect on number of methylene bridges. 7 The number of methylene bridges and
![Page 136: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/136.jpg)
122
which amino groups are cross-linked in the tissue are important variables in the outcome
of immunohistochemical staining, and could also be an important factor in the ability to
extract rt-RT-PCR detectable RNA from tissue blocks.
Tissues fixed in 20% or 37 % formalin undergo shrinkage10 and may suffer from
alteration of epitope conformation. The IBDV epitopes detected by the monoclonal
antibodies used in this study are conformationally dependent;5 thus fixation conditions
such as formaldehyde concentration or pH that may cause changes in epitope
conformation rendering them undetectable by these monoclonal antibodies. Maximum
tissue fixation, i.e. cross-linking, occurs in the pH range of 4 to 5.5 9, therefore, the
presence of too many cross-links or cross-links of certain amino groups may cause
antigen masking.20 This may be the reason why there was minimal or no immunostaining
in tissues fixed in pH ≤5.0. Inconclusive IHC staining at pH ≥9.0 may also be due to
tissue shrinkage or alteration of reactive epitopes.
Immunohistochemical staining was best in tissues fixed at 4°C. Increased
temperature reduced specific IHC staining, but did not eliminate it. The reduction in
staining may be due to tissue shrinkage at temperatures higher than 4°C.8 This result is in
agreement with Key’s findings; however the mechanism for this effect is unknown. 12
Real-time RT-PCR melting curve analysis of infected and non-infected controls
validated the RNA extraction procedure. Real-time RT-PCR on known IBDV genomic
material was performed as a positive rt-RT-PCR control and on DEPC-water as a
negative rt-RT-PCR control. Extracting genomic RNA for identification of IBDV from
bursas of Fabricius stored at acidic pH (pH 5.0 and pH 2.0) was unsuccessful in all 10
tissue blocks. Previous research which found DNA damage in cells at low pH, 11 may
![Page 137: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/137.jpg)
123
explain the lack of extracted genomic RNA in this experiment. Unbuffered formalin
oxidizes to formic acid and an acidic environment causes degradation of nucleic acids
because the β-glycosidic bonds in the purine bases are hydrolyzed at pH 4.4 Loss of some
amino group cross-links occurs at low pH and may result in loss of RNA from the fixed
tissue.3 Extraction of genomic RNA at a basic pH (pH 9.0, and 13.0) was also
unsuccessful and the reason for this is unknown.
The thermodynamic stability of a nucleic acid duplex strongly depends on the
denaturation temperature of the duplex at atmospheric pressure.6 Denaturation of
genomic RNA may have occurred when tissues were formalin fixed at 50°C for 5 days
and might explain the absence of rt-RT-PCR detectable RNA from these blocks.
At formalin concentrations of 20% or 37 %, the extraction of RNA from tissue
blocks yielded no rt-RT-PCR detectable RNA. This may be due to excessive crosslinking
of amino groups resulting from the acidic nature of formalin at higher concentrations;
indeed, maximum tissue fixation, i.e. cross-linking, occurs in the pH range of 4.0 to 5.5,9
thus hindering genomic RNA extraction.
Fixation time had no effect on RNA extraction or subsequent identification
(Fig.3), but longer fixation times are not recommended due to the higher frequency of
non-reproducible sequence alterations. This is demonstrated by the increase in melting
peak temperature over time. Formalin may cause cross-linking of cytosine nucleotides on
either strand. As a result, in PCR the Taq-DNA polymerase fails to recognize the cytosine
and incorporates an adenine in the place of a guanosine, creating an artificial C-T or G-A
mutation.22
![Page 138: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/138.jpg)
124
In summary, for optimal IBDV RNA extraction and sequence identification,
tissues should be fixed in formalin at a pH of 7.0, concentration of 5% or 10% and stored
at 4°C to 25°C for 7 days at most. Extremes in temperature, pH or formalin concentration
have a negative effect on tissues used for RNA extraction. Longer tissue storage times in
formalin may cause inaccuracies in sequencing results. Optimal conditions for fixation of
tissues infected with IBDV that will be used for IHC evaluation are 10% formalin
concentration, pH 7.0 and temperature of 4°C. For practical purposes, fixation
temperature of 4°C is recommended for both procedures. This can be achieved practically
by placing formalin jars or whirlpaks in a cooler with a cardboard separating the ice from
the samples.
Acknowledgments: The authors would like to thank Dr. Stanley Kleven and Linda
Purvis for reviewing this manuscript.
Sources and manufacturers:
a. Sunrise Farms, Catskill NY
b. IBD-Blen™ a vaccine, Merial Select, Gainesville GA, U.S.A.
c. Leica AutoStainer XL, Nussloch, Germany
d. Superfrost/Plus; Fisher Scientific Pittsburgh, PA, U.S.A.
e. HemoDe Fisher Scientific, Pittsburgh, PA, U.S.A.
f. Proteinase K: DAKO, Carpinteria, CA, U.S.A.
g. Leica ST 5050, Nussloch, Germany
h. DAKO Envision System; DAKO Carpinteria, CA, U.S.A.
i. Monoclonal antibody #HB9490, ATCC, Manassas, VA 20108 U.S.A.
![Page 139: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/139.jpg)
125
j. Trizol: Life Technologies, Inc., Gaithersburg, MD, U.S.A.
k. Eppendorf biophotometer, Eppendorf AG, Hamburg, Germany
l. Uvette, Eppendorf AG, Hamburg, Germany
m. ROCHE Molecular Biochemicals, Indianapolis, IN, U.S.A.
References
1 Altmannsberger M, Osborn M, Schauer A, Weber K: 1981, Antibodies to Different Intermediate Filament Proteins - Cell Type-Specific Markers on Paraffin-Embedded Human-Tissues. Lab Invest 45:427-434.
2 Azad AA, Barrett SA, Fahey KJ: 1985, The characterization and molecular cloning of the double-stranded RNA genome of an Australian strain of infectious bursal disease virus. Virology 143:35-44.
3 Basyuk E, Bertrand E, Journot L: 2000, Alkaline fixation drastically improves the signal of in situ hybridization. Nucleic Acids Res 28:E46.
4 Bonin S, Petrera F, Niccolini B, Stanta G: 2003, PCR analysis in archival postmortem tissues. J Clin Pathol 56:184-186.
5 Coulibaly F, Chevalier C, Gutsche I, et al.: 2005, The birnavirus crystal structure reveals structural relationships among icosahedral viruses. Cell 120:761-772.
6 Dubins DN, Lee A, Macgregor RB, Chalikian TV: 2001, On the stability of double stranded nucleic acids. J Am Chem Soc 123:9254-9259.
7 Farmilo AJ, Stead RH, Atwood KN: 2001, Fixation. In: Immunochemical staining methods, ed. Boenisch T, 3rd ed. pp. 18-22. DAKO Corporation, Carpinteria, CA.
8 Fox CH, Johnson FB, Whiting J, Roller PP: 1985, Formaldehyde Fixation. J Histochem Cytochem 33:845-853.
9 Gustavson KH: 1956, Aldehyde tanning, pp. 244-282. Academic Press, New York. 10 Hudson PJ, McKern NM, Power BE, Azad AA: 1986, Genomic structure of the large
RNA segment of infectious bursal disease virus. Nucleic Acids Res 14:5001-5012.
11 Jolly AJ, Wild CP, Hardie LJ: 2004, Acid and bile salts induce DNA damage in human oesophageal cell lines. Mutagenesis 19:319-324.
12 Key M: 2001, Antigen retrieval. In: Immunochemical staining methods, ed. Boenisch T, 3rd ed. pp. 23-25. DAKO Corporation, Carpinteria, CA.
13 Lukert, P. D., and Y. M. Saif: 2003, Infectious bursal disease. In: Diseases of Poultry, ed. Y.M. Saif, H.J. Barnes, J.R. Glisson, A.M. Fadly, L.R. Mc Dougald, D.E. Swayne, 11th ed. pp 161-179. Iowa State University Press, Ames, IA.
14 Moody A, Sellers S, Bumstead N: 2000, Measuring infectious bursal disease virus RNA in blood by multiplex real-time quantitative RT-PCR. J Virol Methods 85:55-64.
15 Mundt E, Beyer J, Muller H: 1995, Identification of a novel viral protein in infectious bursal disease virus-infected cells. J Gen Virol 76 (Pt 2):437-443.
![Page 140: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/140.jpg)
126
16 Nadji M, Morales AR: 1983, Immunoperoxidase: Part 1 The technique and its pitfalls. Lab Med 14:767-771.
17 Pantin-Jackwood MJ, Brown TP: 2003, Infectious bursal disease virus and proventriculitis in broiler chickens. Avian Dis 47:681-690.
18 Sharma J, Kim I, Rautenschlein S, Yeh H: 2000, Infectious bursal disease virus of chickens: pathogenesis and immunosuppression. Dev Comp Immunol 24:223-235.
19 Spies U, Muller H, Becht H: 1987, Properties of RNA polymerase activity associated with infectious bursal disease virus and characterization of its reaction products. Virus Res 8:127-140.
20 Sternberger LA: 1979, Immunocytochemistry, 2nd ed. John Wiley & Sons, New York.
21 Vandenberg TP, Gonze M, Meulemans G: 1991, Acute Infectious Bursal Disease in Poultry - Isolation and Characterization of a Highly Virulent-Strain. Avian Pathology 20:133-143.
22 Williams C, Ponten F, Moberg C, et al.: 1999, A high frequency of sequence alterations is due to formalin fixation of archival specimens. Am J Pathol 155:1467-1471.
23 Wyeth PJ, Cullen GA: 1978, Susceptibility of chicks to infectious bursal disease (IBD) following vaccination of their parents with live IBD vaccine. Vet Rec 103:281-282.
![Page 141: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/141.jpg)
127
Figure Legend Figure 4.1. Photomicrograph of Bursa of Fabricius. (IHC technique specificity control
for IBDV infected and non-infected tissues). 1a: Non infected tissue stained with IHC.
1b: IBDV infected bursa stained with IHC. All tissues were fixed in 10% buffered
formalin at a temperature of 4°C and pH 7.0. IBDV infected controls show brown
positive IHC staining (indicated by arrow) of cortical intrafollicular lymphocytes. (100X)
Figure 4.2: RT-PCR product of amplified VP2 fragment: lane a, molecular size marker;
lane b, amplified VP2 fragment from IBDV control positive; lane c, amplified VP2
fragment from RNA extracted from a tissue block, lane d, negative RT- PCR control
(primers with water); lane e, negative extraction control from RNA extracted from an
uninfected tissue block
Figure 4.3. Real time RT-PCR melting curve analysis for IBDV amplicons extracted
from tissues fixed in 10% buffered formalin at 4°C and submitted to different fixation
durations (hours). Melting curve peak after 24 hours storage was 83°C, but increased to
84°C after 48-120 hours of storage, and after 2 weeks of storage, to 86°C, indicating
changes in nucleotide sequences. RT-control is the reverse transcriptase PCR control for
a known IBDV and extraction control is a known paraffin embedded block with
extractable IBDV genetic material.
![Page 142: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/142.jpg)
128
Figure 4.1:
Figure 4.2:
![Page 143: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/143.jpg)
129
Figure 4.3:
![Page 144: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/144.jpg)
130
Table 4.1: Fixation conditions for bursal tissues from IBDV infected and control chickens.
Variables Storage conditions Fixation treatment a
5 %
10 %
20 %
Formalin
concentration
4°C for
5 days
37 %
4°C b
25°C
Formalin
temperature
10 % Buffered formalin for
5 days 50°C
2.0
5.0
7.0
9.0
pH
of formalin
4°C, in 10% Non buffered
formalin for 5 days
13.0
1 day
2 days
3 days
4 days
Duration in formalin 4°C, 10 % Buffered formalin
14 days
Infected Control c
10% Buffered
formalin at 4°C No variables
![Page 145: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/145.jpg)
131
Non Infected Control c
10% Buffered
formalin at 4°C No variables
a Five individual bursas were tested per treatment.
b. This group was also used to represent 5 days duration in formalin
c Non infected and infected controls were stored in 10% buffered formalin at 4°C to
validate IHC procedure.
![Page 146: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/146.jpg)
132
Table 4.2: Histopathology and IHC mean staining scores of 5 bursas of Fabricius from
chickens infected with IBDV and subjected to different fixation conditions
Variable Treatment Lesion Score a IHC b
5 % 4 ± 0 +
10 % 4 ± 0 +++
20 % 3.2 ± 0.44 -
Formalin
Concentration c
37 % 4 ± 0 -
4°C 4 ± 0 +++
25°C 4 ± 0 ++
Formalin
temperature d 50°C 4 ± 0 +
2 4 ± 0 +
5 4 ± 0 -
7 4 ± 0 +++
9 4 ± 0 +
pH of
formalin e
13 4 ± 0 ±
Non infected
control
10% Buffered
formalin at 4°C 1 ± 0 -
Infected control 10% Buffered
formalin at 4°C 4 ± 0 +++
a Lesion Score: 1= No lesion, 2 = Mild variation in follicle size, 3= Moderate variation in
follicle size, 4 = Either Necrosis or follicle atrophy
b - = No staining; + = Minimal staining, ++ = Moderate Staining, +++ = Severe staining.
![Page 147: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/147.jpg)
133
± = inconclusive.
c Samples fixed at 4°C and pH 7
d Samples fixed at 10 % formalin and pH 7
e Samples fixed at 10% formalin and 4°C
![Page 148: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/148.jpg)
134
Table 4.3: Effect of fixation conditions on extraction of RNA from bursas of Fabricius
from chickens infected with IBDV
Variable Treatment
Number of real-time RT-PCR
Positive / total number tested
5 % 5/5
10 % 5/5
20 % 0/5
Formalin
concentration a
37 % 0/5
4°C e 5/5
25°C 5/5
Fixation
temperature b 50°C 0/5
2 0/5
5 0/5
7 5/5
9 0/5
pH
of formalin c
13 1/5
1d 5/5
2d 5/5
3d 5/5
4d 5/5
Duration in
formalin d
14d 5/5
![Page 149: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/149.jpg)
135
Non infected
control
10% Buffered
formalin at 4°C 0/5
Extraction control 10% Buffered
formalin at 4°C 5/5
a Samples fixed at 4°C and pH 7
b Samples fixed at 10 % formalin and pH 7
c Samples fixed at 10% formalin and 4°C
d Samples fixed at 4°C % formalin and pH 7
e.This group was also used to represent 5 days duration in formalin
![Page 150: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/150.jpg)
136
Chapter V Development of Infectious Bursal Disease (IBD) Viral protein 2 (VP2) and the
hypervariable region of VP2 in Pichia pastoris for the prevention of IBD in chickens. ___________________ Mohamed M. Hamoud , Pedro Villegas 1To be submitted to Vaccine.
![Page 151: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/151.jpg)
137
Abstract Infectious bursal disease virus (IBDV) causes immunosuppression in chickens
and is an infectious disease of global economic importance in poultry. Protection against
IBDV is achieved by vaccination with live or inactivated vaccines. Live viruses cause
some bursal damage while killed vaccines are costly to produce. Therefore, the goal of
this study was to produce a subunit vaccine against IBDV, without actual manipulation of
live or killed viral particles, that protects chicken against IBDV infection. The VP2 gene
from the Edgar strain of IBDV was obtained from frozen bursas, while that for the
hypervariable region of VP2 was obtained from formalin fixed paraffin embedded bursal
tissues. The IBDV VP2 gene and the hypervariable region of VP2 were cloned into
Pichia pastoris and protein production was confirmed by western blot analysis. Specific
pathogen free 1-day old chicks vaccinated with recombinant VP2 protein showed the best
protection against 3 week-old challenge with the Edgar strain of IBDV, as there was no
morbidity or mortality in the VP2 vaccinated birds compared to up to 90% morbidity and
50% mortality in placebo vaccinated birds. However, recombinant vaccines did not
totally protect against viral replication in bursa as confirmed by high histopathological
lesion scores and immunohistochemical detection of IBDV in infected tissue. This was
probably due to the high viral dose and high virulence of the challenge virus used.
![Page 152: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/152.jpg)
138
Introduction:
Infectious bursal disease virus (IBDV) is the etiological agent of Gumboro
disease or infectious bursal disease (IBD). IBDV destroys the B lymphocyte precursors
found within the bursa of Fabricius, resulting in bursal atrophy in young chickens [1]. In
unprotected flocks, the virus may cause mortality and / or immunosuppression [2]. There
are two serotypes of IBDV: 1 and 2. All pathogenic viruses belong to serotype 1, whereas
serotype 2 viruses are non-pathogenic for both chickens and turkeys [3],[4]. Very virulent
(vv) IBDV strains emerged in Europe in the late eighties, causing up to 60% mortality
[5], [30], [6]. Strains of vvIBDV have also spread to other continents [7], [8].
IBDV belongs to the family Birnaviridae (genus Avibirnavirus) which includes
viruses with bisegmented dsRNA genomes [9]. Genome segment A has 2 overlapping
open reading frames (ORF). The first ORF of segment A encodes a non structural
protein,VP5 and is possibly involved in virus release [10], [11]. The other encodes a
precursor polyprotein in a large ORF, the product of which is cleaved by autoproteolysis
to yield mature VP2 (outer capsid), VP4 (protease), andVP3 (inner capsid) [12]. Genome
segment B encodes the virus polymerase,VP1 [13]. VP2 is the major host-protective
antigen of IBDV. It contains at least three independent epitopes responsible for the
induction of neutralizing antibody [14], thus the antigenic characterization of IBDV has
been based mainly on the study of the VP2 gene where some amino acid changes have
been shown to be the basis for antigenic variation [15], or have been proposed as putative
markers for vvIBDV [16], [17],[18].
Controlling infectious bursal disease (IBD) and its associated immune
suppression is critical to the poultry industry. This control is achieved by passive
![Page 153: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/153.jpg)
139
protection of baby chicks through maternal antibodies that come from breeder hens that
have been given conventional live attenuated and/or inactivated IBD vaccines; or by the
use of live IBD vaccines in broiler chicks, layers or young pullets to provide active
protection against IBDV, or by a combination of both.
The IBDV VP2, expressed in yeast [19], [20], the baculovirus system [21]. [22],
[23], [24], recombinant NDV vaccines [25] or via transgenic Arabidopsis thaliana plants
[26] have been studied for the use as subunit vaccines. An advantage of this technology is
that a vaccine based on VP2 alone should allow monitoring of the field situation by the
discrimination between antibody induced by vaccine (anti-VP2 only) and that induced by
infection (anti-VP2 and VP3) [27]. Genetically attenuated viruses generated by the use of
reverse genetics can also be used for the generation of new vaccines, although
interference of maternal antibodies would still exist. Therefore, as recombinant proteins
are less sensitive to neutralization by anti-IBDV maternal antibodies, recombinant viral
vaccines expressing the VP2 protein, such as fowl pox virus [28], herpesvirus of turkey
(HVT) [29], [30], or fowl adenovirus [31] might be able to mount an active immune
response.
Pichia pastoris is a facultative methylotropic yeast which utilizes methanol. The
methanol metabolic pathway of Pichia pastoris involves a unique set of enzymes. In the
first step of this pathway methanol is oxidized to generate formaldehyde and hydrogen
peroxide which is then decomposed to water and molecular oxygen by catalase. The
oxidation is carried out by two alcohol oxidase genes AOX1 and AOX2 [32]. AOX1 is
the more active alcohol oxidase and may reach as much as 30% of the total protein in the
cell when cultured under growth-limiting rates of methanol. This gene’s promoter is
![Page 154: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/154.jpg)
140
utilized for expression of heterologous genes. The expression of heterologous proteins in
Pichia pastoris is fast, simple and inexpensive. Strong aerobic growth allows culturing at
high cell densities. High levels of foreign protein expression have been shown for this
vector [33].
The objective of this study was to produce a recombinant protein or polypeptide from
IBDV genomic material extracted from formalin fixed paraffin embedded tissue blocks
without actual manipulation of live or killed virus particles. Proof of principal of this
technique could provide use of archival tissue as a valuable source of genomic material
for production of proteins or actual viruses using reverse genetics. Here we are aiming for
protein production. Another objective was to produce an efficient recombinant vaccine in
a system that allows mass production.
2. Materials and methods
2.1. Isolation of the virus
The Edgar strain of IBDV was isolated and characterized in our laboratory. The
virus was passed in specific pathogen free chicks several times. The bursa of Fabricius
(bursa) was collected from clinically ill birds then ground and homogenized. The cells
were frozen and thawed three times and centrifuged at 12,000 × g, 4 °C for 10 min. The
supernatant was collected and viral particles were pelleted by centrifugation at 96,400 × g
for 2 h. The pellet was resuspended in Tris- ethylenediaminetetraacetic acid buffer and
kept at -20 °C until use.
2.2. Isolation of IBDV RNA
The Edgar IBD virus was incubated for 3 h in a solution containing 0.01M Tris,
0.01M NaCl, 0.01M EDTA, 0.5% SDS (w/v) and 50 µg/ml proteinase K. IBDV RNA
![Page 155: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/155.jpg)
141
was separated by electrophoresis on a 1.0 % agarose gel. The two RNA fragments of the
virus, with sizes of 3.4 and 2.9 kb, were visualized by ethidium bromide staining. The
large fragment was agarose gel purified and extracted by use of gel extraction kit
(QIAquick, Qiagen Sciences, Valencia, CA). This was the source of genomic material for
VP2.
RNA was extracted from formalin-fixed, paraffin-embedded bursas and examined
for IBDV nucleic acid by real-time RT-PCR [34]. Sections totalling 50 µm in thickness
were cut from each formalin-fixed, paraffin embedded tissue block, deparaffinized in
HemoDe (Fisher Scientific, Pittsburgh, PA), washed with 100% ethanol, and digested
with 25 µg/ml proteinase K (Sigma Chemical Co., St. Louis, MO) for 1 hr at 50 °C. RNA
was extracted using Trizol (Life Technologies, Inc., Gaithersburg, MD) according to the
manufacturer’s recommendations, diluted in 25 µl of 90% dimethyl sulfoxide, and frozen
at -80 °C until assayed by RT-PCR. This was the source of genomic material for the
hypervariable region of VP2 called partial VP2 (pVP2).
2.3. Cloning of VP2 and pVP2 in TOP10 cells and GS-115 Pichia pastoris cells.
Synthetic oligonucleotides (Invitrogen, Carlsbad, CA) corresponding to the 5’ and
3’ conserved ends of VP2 which included restriction sites EcoR1 and Not1, respectively,
as well as an ATG start codon on 3’ end and a factor XA cleavage site on the 5’ end were
used for the production of cDNA by RT-PCR. Template dsRNA (5 µl) was heated at
97 °C for 5 min and immediately transferred to ice. RT-PCR master mix was then
prepared as follows: 1 µl (10 µM) of sense and anti-sense primers, 25 µl of 2X Reaction
Mix (a buffer containing 0.4 mM of each dNTP, 3.2 mM MgSO4), and 2 µl SuperScript®
III/ Platinum® Taq mix were added to 16 µl autoclaved distilled water. The template
![Page 156: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/156.jpg)
142
RNA and RT-PCR mixture were gently mixed to a final volume of 50 µl. The synthesis
of cDNA was done at 55 °C for 30 min. The PCR scheme was 40 cycles of 94 °C for 15
sec, 55 °C for 30 sec and 68 °C for 100 sec followed by a final extension cycle of 68 °C
for 5 min. The amplified segment was separated on a 1.2% agarose gel and the
appropriate band was excised and purified.
The 2 fragments, corresponding to VP2 and pVP2 of the Edgar strain of IBDV
were cleaved by EcoR1 and Not1 restriction enzymes that were introduced by the
oligonucleotides during synthesis. The isolated fragments were mixed with 1 µl pCR 2.1
vector and according to manufacturer’s recommendation were cloned into TOP10
Escherechia coli cells. After 24 hour growth on Luria-Bertani (LB) plates containing
kanamycin (50µg/ml) white colonies were picked up and grown in 5 ml of LB kanamycin
broth (50 µg/ml) at 37 °C in a shaker incubator set at 225 rpm. Minipreps were performed
using Qiaprep® Spin kit (Qiagen Sciences, Valencia, CA), and cloned inserts were double
digested with EcoR1 and Not1 and visualized on an ethidium bromide gel. Inserts were
then ligated to pPICZ A plasmids provided in EasySelect™ Pichia expression kit
(Invitrogen, Carlsbad, CA) which had also been digested with the EcoR1 and Not1
restriction enzymes. The ligated DNA construct was transformed into Escherechia coli
TOP10 cells and white colonies that grew on low salt LB plates containing zeocin 25 µg/
ml were isolated. Plasmid DNA was extracted and analyzed for the presence of VP2 or
pVP2 using restriction enzymes. Several cDNA clones corresponding to VP2 were
isolated and sequenced. DNA sequences were determined by the dideoxy chain
termination method. A plasmid harbouring VP2 or pVP2 with the correct sequence was
cloned into P. pastoris after point mutations were corrected using a site directed
![Page 157: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/157.jpg)
143
mutagenesis kit (Stratagene, La Jolla, CA). Pichia transformation was accomplished by
electroporation of GS115 Pichia pastoris cells pre-treated with 0.1 M lithium acetate and
10mM dithiothreitol [35] using a Gene Pulser Xcell total Electroporation System (Bio-
Rad, Hercules, CA) according manufacturer’s settings for yeast (Saccharomyces
cerevisiae). Briefly, following characterization, the plasmid was linearized to promote
integration into the AOX1 locus, and introduced into GS115 cells; the P. pastoris host
strain, by electroporation transformation.
2.4. Screening for transformed colonies expressing VP2 and pVP2
Putative multi-copy recombinants were selected by plating the transformation mix
on increasing concentrations of Zeocin. Transformed cells were grown on YPDS plates
containing 100, 200, 500, 1000 and 2000 μg/ml Zeocin and incubated at 30 °C for 2 days.
Colonies that grew in presence of higher concentrations of zeocin were selected and then
checked for methanol utilization phenotype by replicate plating of colonies on Minimal
Dextrose with histidine (MDH) agar plates, Minimal Methanol with histidine (MMH)
agar plates. Strains GS115 Albumin (MutS) and GS115/pPICZ/lacZ (Mut+) were also
plated on MMH and MDH plates as controls for MutS and Mut+growth. Further
verification of transformed Mut+ colonies was carried out by PCR analysis of Pichia
integrants (VP2 and pVP2). To do this we developed a simple genomic DNA isolation
protocol, where 5-10 colonies were re-suspended in 50 µl of autoclaved distilled water
and subjected to one freeze thaw cycle by placing the PCR tube containing the colony in
liquid Nitrogen for one minute followed by incubation at 37 °C for 5 min. and then use of
the Qiaprep® Spin miniprep kit according to manufacturer’s recommendation (Qiagen,
Valencia CA).
![Page 158: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/158.jpg)
144
Positive colonies were grown in 100 ml minimal glycerol medium in 500 ml
baffled flacks to an OD of 1.5 (usually 1 day). At this point, VP2 production was induced
by adding 500 µl methanol every day. The optimal period of induction was determined
by collecting samples every day after induction started. Following induction, cells were
broken by vortex with glass beads (500 µm), centrifuged, and the supernatant contained
the soluble VP2.
2.5. Western blot analysis
Protein extraction and Western blot analyses were performed using standard
procedures. The membranes were immunoblotted with primary monoclonal antibodies
against IBDV HB9490 (ATCC, Manassas, VA) at 1:500 dilution and secondary antibody
horseradish peroxidase-conjugated goat anti-mouse IgG at a 1:8000 dilution (Jackson
Lab, West Grove, PA).
2.6. Biofermentation
The fermentor was a New Brunswick Bioflo 3000 fermentor (New Brunswick
Scientific Co., Inc. Edison, NJ) with a working volume of 5.0 L (total volume 7.5 L). The
fermentation process was scaled up from shaker flasks to 5.0 L fermentation in three
stages. The main objectives were: (a) achieving a high mass of active yeast cells at the
end of the glycerol-fed-batch stage, (b) adapting to methanol as an inducer as well as a
metabolic and anabolic carbon source, and (c) efficiently preserving the VP2 protein
accumulated during the final stages of the fermentation. For that purpose 1mM
phenylmethanesulfonyl fluoride (PMSF) (Sigma, St. Louis. MO) was added to breaking
buffer when breaking the yeast cells with acid-washed glass beads (Sigma, St. Louis.
![Page 159: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/159.jpg)
145
MO). This step was done according to EasySelect™ Pichia Expression Kit Version G
122701 25-0172 (Invitrogen, Valencia, CA).
2.7. Vaccine and challenge study:
Studies in isolation units
Two hundred and seventy specific pathogen free (SPF) light breed chicks were
grown in Horsfal-Bauer isolation units from 1 day of age. They were divided into 54
groups of 5 birds each. Each treatment consisted of 2 groups (replicates) of five birds
each. Experimental design is shown in Table 1. Vaccines used were prepared with or
without complete Freund’s adjuvant (Sigma, St. Louis, MO). Vaccines were administered
by injecting 0.1 ml of vaccine per bird intra-muscularly at one day of age with the
exception of the 2512 vaccinated group that was vaccinated orally with 1 X 103.5 EID50 at
one day of age. Maternal antibody level at 1-day of age was determined by ELISA. Birds
were challenged at 3 weeks of age with oral inoculation of either 0.1 ml breaking buffer
(diluent), 0.1 ml containing 103 EID50 Edgar or 0.1 ml containing 1.2 X 104.5 EID50 of
2512 strains of IBDV, or not challenged at all for non-vaccinated non-challenged
controls. Surviving birds were euthanized one week post challenge.
2.8. Evaluation of vaccine protection against challenge
2.8.1 Sample collection and processing
After vaccinating the birds and placing them in isolation units, daily morbidity
and mortality was recorded. One week post challenge birds were examined, weighed,
bled, euthanatized by cervical dislocation, and necropsied. Bursa, spleen, and thymus
were collected from each bird, weighed, and a portion of each was fixed immediately by
immersion in 10% neutral buffered formalin for 24 hr. Tissues were then processed and
![Page 160: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/160.jpg)
146
embedded in paraffin using routine histologic techniques. Relative organ weights were
obtained using the formula [relative organ weight = (organ weight/body weight) × 100]
[36].
2.8.2. ELISA
Blood was collected from the wing vein at 2, and 3 weeks post vaccination and 1
week post challenge. An IBD antibody test kit (IDEXX, FlockChek IBD, Westbrook,
Me) was used to determine antibody titres according to manufacturer’s instruction.
2.8.3 Histopathology.
Paraffin-embedded tissues were sectioned, mounted, stained with hematoxylin
and eosin (H&E) by using an automated stainer (Leica AutoStainer XL, Nussloch,
Germany) , and examined for lesions by light microscopy. All sections were assigned a
lesion severity score. For all tissues, a lesion score of 1 represented no lesions, 2
represented mild variation in follicle size, 3 represented moderate variation in size of
follicles, and 4 represented either necrosis or follicle atrophy [34].
2.8.4 Immunohistochemistry (IHC)
All procedures were done at room temperature. Tissue sections were cut (5 μm)
from paraffin-embedded samples and mounted on charged glass slides (Superfrost/Plus;
Fisher Scientific Pittsburgh, PA, U.S.A.). Paraffin was melted from slides (10 min at
65 °C) and removed by immersion in Hemo-De three times (5 min each). Slides were
then air dried and antigen retrieval performed by digestion with 10% proteinase K
(DAKO, Carpinteria, CA, U.S.A.) for 5 min to expose antigenic target sites. IHC staining
was performed with an automated stainer (Leica ST 5050, Nussloch, Germany) with a
nonbiotin peroxidase kit (DAKO Envision System; DAKO Carpinteria, CA, U.S.A.)
![Page 161: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/161.jpg)
147
according to the manufacturer’s recommendations. The primary antibody used was a
mouse monoclonal antibody specific to and cross-reactive for all IBDVs (ATCC no.
HB9490). The secondary antibody was a peroxidase labelled polymer conjugated to anti-
mouse and anti-rabbit immunoglobulins. After IHC staining, sections were
counterstained with hematoxylin, air dried, cover slipped, and examined by light
microscopy. Intensity of IBDV staining in each section was scored as follows:
- = no staining, + = minimal staining (<10% of cells present), ++ = moderate staining
(>10% and <30% of cells present), and +++ = extensive staining (>30% of cells present)
[34].
2.8.5 IBDV RNA evaluation
2.8.5.1 RNA extraction.
RNA was extracted from formalin-fixed, paraffin-embedded bursas and examined
for IBDV nucleic acid by real-time RT-PCR (Pantin-Jackwood and Brown, 2003).
Sections totalling 50 µm in thickness were cut from each formalin-fixed, paraffin
embedded tissue block, deparaffinized in HemoDe (Fisher Scientific, Pittsburgh, PA,
U.S.A.), washed with 100% ethanol, and digested with 25 µg/ml proteinase K (Sigma
Chemical Co.) for 1 hr at 50 °C. RNA was extracted using Trizol (Life Technologies,
Inc., Gaithersburg, MD, U.S.A.) according to the manufacturer’s recommendations,
diluted in 25 µl of 90% dimethyl sulfoxide, and frozen at -80 °C until assayed [34].
2.8.5.2 Real time RT-PCR.
Extracted RNA was denatured at 95 °C for 5 min and kept on ice. An RT-PCR was
performed using reagents from the Light Cycler RNA Amplification SYBR Green I Kit
(ROCHE Molecular Biochemicals, Indianapolis, IN, U.S.A.). The primers used were
![Page 162: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/162.jpg)
148
designed to amplify a 400-base pair (bp) segment of the IBDV genome shared by all
strains, which flanks a hypervariable region of the VP2 gene. Amplification and detection
of specific products was also performed using a Light Cycler (ROCHE Molecular
Biochemicals, Indianapolis, IN, U.S.A.) according to the manufacturer’s
recommendations. Briefly, RT was done at 55 °C for 30 min, followed by denaturation at
95 °C for 30 sec. Fifty five PCR cycles were performed, consisting of denaturation
(95 °C for 1 sec), hybridization (55 °C for 10 sec), and extension (72 °C for 13 sec). A
melting curve analysis was done with an initial denaturation at 95 °C. DNA melting was
accomplished with an initial temperature of 65 °C for 10 sec and a gradual temperature
increase of 0.1 °C/sec until 95 °C was reached. The melting temperature of the expected
400-bp amplicon was between 82 °C and 84 °C. This estimated melting temperature was
used to confirm the identity of IBDV specific products obtained using real-time RT-PCR
[34].
2.8.6 Lymphoblastogenesis assay
Lymphocytes used for lymphoblastogenesis assay were isolated from peripheral
blood using Histopaque®-1077 (Sigma-Aldrich, St. Louis, MO) and prepared for plating
according to procedure described by Hassan et al. [37] using cold RPMI 1640 medium
and 10% foetal bovine serum (FBS) (Sigma-Aldrich, St. Louis, MO). The viability of the
lymphocytes was determined by staining with a 0.4% solution of trypan blue. The
concentration of viable lymphocytes was adjusted to 1 x 107 cells/ml by adding RPMI
1640 medium with 10% FBS as required. Tests were performed in 96-well flat-bottomed
tissue culture plates. To each of four wells in the first row, 150 µl RPMI containing 10%
FBS was added (media control). To each of four wells in the second row, 50 µl RPMI
containing 10% FBS and 100 µl lymphocyte suspension (1 x 106 cells) was added (cell
![Page 163: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/163.jpg)
149
control). To each of four wells in the third row, 100 µl lymphocyte suspension and 50 µl
of 10 mg/ml Con A (Sigma, St Louis, MI, USA) was added (stimulated cells #1). To each
of four wells in the fourth row, 100 µl lymphocyte suspension and 50 µl of 5 mg/ml
PWM (Sigma) was added (stimulated cells #2). Finally, to each of four wells in the fifth
row, 100 µl lymphocyte suspension and 50 µl of 10 mg/ml IBDV antigen was added. The
plates were covered and incubated at 37 °C in a humidified 5% CO2 atmosphere. The
evaluation of lymphocyte blastogenesis by dye reduction was carried out according to the
method described by Gogal et al. [38]. After 16-18 hr of culture, 20 µl of the Alamar blue
dye was added to each well of one plate and was returned to the incubator. Twenty-four
hours after the dye was added, the absorbance at 570 nm and 600 nm was measured with
a microplate reader. The dye when added is in an oxidized (blue colour) form that is
reduced (red colour) as cells proliferate. The 570 nm absorbance measures the reduced
form and the 600 nm measures the oxidized form. Because there is some degree of
overlap between the two absorbencies, it is necessary to subtract the 600 nm absorbance
from the 570 nm absorbance to obtain the true absorbance (specific absorbance), which
reflects the specific level of proliferation. The specific absorbance of unstimulated cells
(in media alone) was subtracted from the specific absorbance of cells incubated with the
mitogens to yield a ∆-specific absorbance.
The lymphocyte stimulation index was expressed as: Stimulation index (SI) = (C2
– C1) / (C3 – C1), where C1 = concentration of spontaneously reduced Alamar blue in
the medium, C2 = concentration of reduced Alamar blue in the medium of stimulated
cells, and C3 = concentration of reduced Alamar Blue in the medium of unstimulated
control cells [39].
![Page 164: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/164.jpg)
150
2.9 Statistical analysis
The body weight gain, relative bursal, spleen and thymus weights were analysed
using analysis of variance and comparisons with a control using Dunnet’s method by use
of JMP 4.0.2 (SAS Institute, Cary, NC).
3. Results 3.1. Cloning of pVP2 and VP2 in yeast
RNA was isolated from an Edgar strain of IBDV. Oligonucleotides corresponding
to both ends of VP2 were designed and synthesized. The open reading frame of VP2 and
the hypervariable region of VP2 were amplified by RT-PCR followed by PCR (Fig. 1).
The 1452 bp and the 510 bp fragments were cloned in E. coli and following amplification
of the plasmid, transfected into GS 115 Pichia pastoris cells.
3.2. Screening for transformed colonies
Transformation of Pichia pastoris without lithium acetate and dithiothreitol was
very poor. Only after adding these two chemicals to GS-115 cells prior to transformation,
were there enough transformed colonies generated for evaluation of transformation
efficacy. The ability of the transformed yeast to grow in presence of zeocin; along with
growth on both MMH and MDH plates followed by performing PCR on yeast genomic
material for the presence of VP2 and pVP2 inserts allowed selection of which colonies to
choose for expression.
3.3. Expression of pVP2 and VP2
VP2 and pVP2 were produced in yeast cells following induction with methanol.
Cells were disrupted by acid-washed glass beads and centrifuged (10,000 rpm, 10 min,
![Page 165: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/165.jpg)
151
and 4 °C). The protein was found in the supernatant and analyzed by Western blot. A
band with the molecular weight of VP2 and another of the molecular weight pVP2 were
seen when the membrane was immunoblotted with primary monoclonal antibodies
against IBDV HB9490 at 1:500 dilution and secondary antibody horseradish peroxidase-
conjugated goat anti-mouse IgG at a 1:8000 dilution (Fig. 2).
3.4 Immunization studies – efficacy of VP2 and pVP2 to protect against challenge with
Edgar and 2512 strains of IBDV.
3.4.1. Morbidity and mortality:
Birds vaccinated wild type yeast, diluent or the hypervariable region peptide
started showing depression, ruffled feathers, and trembling 2 days post challenge with the
Edgar IBDV. Severe prostration and death of morbid birds started on day 3 post
challenge (Table 2). Birds challenged with diluent or the 2512 strain of IBDV showed no
symptoms of disease and looked apparently healthy. Birds vaccinated with VP2 and
challenged with the Edgar IBDV were also apparently healthy and showed no signs of
sickness and no mortality was observed (Table 2).
3.4.2. Body and organ relative weights and lesions:
No significant body weight differences were seen between control and
experimental groups for body weight gain (Table 3). There was a significant decrease in
relative bursa of Fabricius weights among the Edgar challenged groups compared to the
2512 vaccinated and non vaccinated non infected controls. Among the birds challenged
with the Edgar strain of IBDV, the VP2 vaccinated birds had the highest bursal relative
weights (Table 3). All birds challenged with the Edgar strain of IBDV suffered from +4
severe subacute bursitis with severe lymphocytic depletion with some exceptions in the
![Page 166: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/166.jpg)
152
VP2 and pVP2 vaccinated groups where some birds had acute lesions instead as indicated
by presence of neutrophils in the medulla of the bursal follicles (Table 4). Birds
vaccinated with Pichia control or diluent that died 3-4 days post challenge with Edgar
IBDV had severe bursal haemorrhage (Fig 3). Dead birds in the group vaccinated with
the hypervariable region of VP2 showed oedematous swelling of bursas but had no
haemorrhages. Birds that died on 5th day post challenge with the Edgar IBDV had no
haemorrhages and their bursas appeared to be of normal size. The 2512 strain used for
vaccination and challenge was very mild as the bursas showed very mild or no bursitis
and had relative weights comparable to the non- vaccinated non-infected controls (data
not shown).
The thymus relative weights of birds challenged with the Edgar strain of IBDV,
regardless of vaccine given, were significantly lower in groups not challenged with this
strain of virus, with the exception of the VP2 with no adjuvant vaccinated group. The
VP2 with the adjuvant vaccinated group had significantly higher relative thymus weights
compared to the other Edgar IBDV challenged groups; but was significantly less than
non-vaccinated non infected control group ( Table 3). This was confirmed by the
microscopic observation that some areas of the thymus had moderate to severe depletion
of thymic lymphocytes (Fig. 4).
There was spleenomegaly in birds vaccinated with VP2 or VP2 and challenged
with the Edgar IBD virus (Table 3). In the enlarged spleens, microscopically there were
more lymphocytes and swollen macrophages around the sheathed arteries. There was also
more red blood cells seen in the splenic red pulp that seen in spleens of the non-infected
non-vaccinated control group.
![Page 167: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/167.jpg)
153
3.4.2 ELISA
Some of the extra SPF chicks that were purchased were sacrificed and
serologically tested for IBDV. They were seronegative at 1-day of age for antibodies to
IBDV as determined by ELISA. All birds had no detectable antibody titres at 2 weeks
post vaccination. At 3 weeks post vaccination, no antibody titres were found in the
groups vaccinated with Pichia controls, the hypervariable region of VP2, diluent, or non-
vaccinated. The only groups at 3 weeks post vaccination with detectable antibody titres
were those vaccinated with VP2 and they had antibody levels ranging from 59 to 250 for
birds given the vaccine without adjuvant and 113 to 455 for birds given the vaccine with
adjuvant, while the group vaccinated with the live 2512 virus had titres ranging from 684
to 1013. ELISA GMT antibody titres for 4-week old birds, one week post challenge are
presented in Table 5. The low antibody titres, seen one week post challenge with the
Edgar IBDV strain; in the VP2 vaccinated group compared to the Pichia control and
diluent vaccinated groups, suggest that there were antibodies at time of challenge that
neutralized some of the challenge Edgar IBDV, opposed to the Pichia pastoris and the
diluent control vaccine groups that had higher titres one week post challenge suggesting
that there were no antibodies to neutralize the challenge virus.
3.4.3 Immunohistochemistry and real-time RT-PCR detection of IBDV.
The Edgar IBDV challenged birds were all positive for IBDV when using IHC
with variable degrees of staining as shown in Table 5. The bursas of birds vaccinated
with VP2 mixed with Freund’s adjuvant and challenged with Edgar strain had the least
staining intensities, suggesting low viral load in tissues. This was confirmed by the
![Page 168: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/168.jpg)
154
inability to detect any IBDV RNA in genomic material extracted from formalin fixed
paraffin embedded tissue blocks using real-time RT-PCR (the paraffin blocks used for
extraction were the same ones used in making the slides for IHC). The bursas of birds
vaccinated with VP2 without Freund’s adjuvant and challenged with Edgar IBDV had
slightly more intensity than the previously mentioned group but much less when
compared to the Pichia pastoris control and the diluent control groups. They also had
detectable IBDV RNA in genomic material extracted from the same paraffin embedded
tissue blocks (Table 4). The low intensity of IHC staining along with the absence of
detectable IBDV RNA by real-time PCR in some of the VP2 vaccinated groups,
compared to the very intense staining seen in non-vaccinated Edgar IBDV challenged
groups, suggest that some virus neutralization occurred at time of challenge and hence the
lower antibody responses detected. The birds vaccinated with the hypervariable region of
VP2 and challenged with the Edgar IBDV showed similar IHC staining intensities and
real-time RT-PCR positive for IBDV just like the Pichia pastoris control and diluent
control groups when challenged with a similar virus. This suggests that the hypervariable
region of VP2 subunit vaccine did not provided protection against IBDV challenge.
Pichia pastoris and diluent controls groups that were non-challenged with IBDV viruses
had no IHC staining and were negative for real-time RT-PCR detectable IBDV RNA.
Immunohistochemistry could not detect IBDV in all of the 2512 IBDV vaccinated or
challenged birds with only one exception where mild staining of the bursa was observed
in one of the diluent vaccinated 2512 challenged birds. However, real-time RT-PCR
could detect the 2512 virus in the diluent control and non vaccinated 2512 challenged
groups. The 2512 vaccinated and 2512 challenged group had no real-time RT-PCR
![Page 169: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/169.jpg)
155
detectable RNA, no IBDV IHC staining, and +1 lesion scores suggesting that the
antibodies generated by using the live virus completely neutralized the challenge virus.
The VP2 vaccinated group also had no detectable IBDV RNA suggesting that the virus
was neutralized at time of challenge (data not shown).
3.4.4. Lymphoblastogenesis assay
The stimulation indices of the different treatments are presented in Table 6. Lymphocytes
stimulated with the T-cell specific mitogen (Concanavalin A) were not significantly
different from each other with the exception of one group which was vaccinated with the
Pichia control and challenged with Edgar, that was significantly higher than the rest. The
lymphocytes of birds vaccinated with VP2 and adjuvant as well as those vaccinated with
the Pichia control vaccines had a significantly higher response to the B-cell specific
pokeweed mitogen, while non-vaccinated 2515 IBDV challenged birds had significantly
lower response to the IBDV antigen, when compared to other treatment groups.
Comparing the lymphocyte stimulation indices of birds given the vaccines with or
without adjuvant revealed a very slight increase in stimulation indices of the ones that
had been given the vaccine with adjuvant although the difference was not significant.
4. Discussion
Infectious bursal disease virus is highly infectious and very resistant to
inactivation. Thus, despite strict hygienic measures, vaccination is unavoidable under
high infection pressure and it is necessary to protect chickens against infection during the
first weeks after hatch. After hatching, chickens are immunized with live vaccines, and
because maternal immunity interferes with vaccination with live vaccines, the major
problem with active immunization of young maternally immune chicks is determining the
![Page 170: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/170.jpg)
156
proper time of vaccination. It is well known that less attenuated strains (“hot vaccines”)
may cause lesions in the bursa follicles and, thus, immunosuppression even in vaccinated
birds. To avoid live vaccine side effects [40], a Pichia pastoris expression system
expressing IBDV VP2 or the hypervariable region of VP2 has been developed. Pichia
pastoris as a yeast expression system was chosen because it combines the simplicity of
prokaryotic growth requirements, growth potential and ease of manipulation along with
the post-translational modifications of eukaryotes to ensure that the expressed protein is
functional and has the proper conformation. Using this expression system both VP2 and
the hyper variable region of VP2 were expressed. Ethidium bromide gels of RT-PCR
amplicons showed that the primers succeeded in amplifying VP2 and pVP2 of Edgar
IBDV. Colonies screened for ability to grow in presence of high levels of zeocin,
methanol utilization phenotype and presence of genomic inserts were selected for
biofermentation. Intra-cellular expression of VP2 and pVP2 of Edgar in Pichia pastoris
was confirmed by immunoblotting with primary monoclonal antibodies.
Vaccination with recombinant VP2 in combination with Freund’s adjuvant gave
best results in terms of protection parameters. Birds vaccinated with recombinant VP2
mixed in Freund’s adjuvant showed no morbidity or mortality. This was also observed
the VP2 vaccine without adjuvant, but the difference between the two VP2 vaccinated
groups with or without adjuvant could be observed in the intensity of IHC staining and
ability to detect IBDV RNA from infected tissue. Low intensity of IHC staining of bursas
of Fabricius of the VP2 with adjuvant vaccinated group that was challenged with Edgar
IBDV indicates the presence of IBDV in tissue; however, the absence of real-time RT-
PCR detectable RNA suggests low viral load in tissue. This low viral load was still able
![Page 171: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/171.jpg)
157
to cause severe damage to bursal tissue. This can be attributed to the high virulence of the
challenge dose, as the Edgar IBDV used for challenge was serially passed in chickens
several times prior to use in this experiment. Wild type Pichia pastoris, diluent or the
hypervariable region of VP2 vaccinated birds had 30 to 90 % morbidity and 20 to 60 %
mortality; indicating the virulence of the Edgar IBDV strain used. Also, that the yeast and
breaking buffer used to make the VP2 vaccine did not protect against challenge with
Edgar IBDV. Thus, the protection against morbidity and mortality observed in the VP2
vaccinated group is due to vaccination with VP2. This protection maybe due to T-
lymphocytes, as indicated by increase in relative thymus weight (Table 3), and that
cortical depletion was minimal in the VP2 vaccinated group compared to the other
treatment groups that were Edgar IBDV challenged (Fig 4). The effect of IBDV infection
on cell-mediated immune competence is transient and less obvious than its effect on
humoral responses [41]. Some in vitro cellular functions have been found to be
compromised in IBDV-infected chickens, with lymphoid cells of chickens exposed to
IBDV responding poorly to mitogens [42]. While others reported that maximal
suppression of cell-mediated immune responses occurred at 6 weeks post infection [43],
in our study, mitogen stimulation of peripheral blood lymphocytes of vaccinated and non
vaccinated chickens could not verify the role that T-cells have on IBDV vaccination or
challenge, as there were no significant differences between stimulation indices of
lymphocytes of different treatments when stimulated with T-cell mitogen (Concanavilin
A) with the exception of the Pichia control vaccinated group challenged with the Edgar
IBDV. This may be because the Pichia pastoris homogenate acts like an adjuvant and
stimulated the antigen presenting cells in particularly the macrophages to secrete
![Page 172: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/172.jpg)
158
cytokines that stimulate the T-cell mediated immune system. The lymphocytes of birds
vaccinated with VP2 and adjuvant as well as those vaccinated with the Pichia control
vaccines had significantly higher stimulation indices when stimulated with the B-cell
specific pokeweed mitogen, compared to other treatments indicating the role of B
lymphocytes in protecting against the Edgar IBDV. This could also be due to the
previously mentioned probability of innate immune stimulation and the role that
macrophages have in enhancing the humoral immune system. The use of a lower
infective dose or less virulent virus for challenge in the future might be important to help
identify the role of T-lymphocytes in protecting against IBDV infections.
The low geometric mean titres of antibodies against IBDV at 2 and 3 weeks are
not unusual when recombinant vaccines are used. Previous researchers have reported that
titres of 150 – 400 are common and that these low titres are fully protective against
controlled challenge and exposure to IBDV [19]. The antibody titres against IBDV one
week post challenge (Table 4) are typical of those seen in IBDV challenge studies [44],
as non-vaccinated groups had higher GMT titres, than the vaccinated groups. This may
be due to that the protected birds have antibodies that neutralize some of the challenge
virus thus leaving the bird with less virus particles available for infection opposed to the
unprotected birds that get the whole challenge dose. Generally antibodies of recombinant
protein vaccines have lower GMT than that seen with live virus vaccines [19], as live
virus vaccines produce polyclonal antibodies that react to both VP2 and VP3 that is
present in the IDEXX ELISA plates, whereas the VP2 vaccines produce antibodies only
for VP2 and thus get a lower reaction with the IDEXX ELISA plates. Anti-VP3
antibodies do not confer protection against IBDV infection [45]. The low level of anti-
![Page 173: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/173.jpg)
159
VP2 antibodies or the ability to detect VP3 genomic material by RT-PCR can be used to
differentiate between vaccinated and infected flocks.
In summary, recombinant vaccines expressing VP2 and not just the hypervariable
region of VP2 are needed to protect against IBDV infections. The use of paraffin
embedded tissue as a source of genomic material for protein production in yeast is
feasible. However, it highly recommended for conformationally dependant proteins; to
fully reconstruct the whole genome before expressing it in yeast expression system.
Using these recombinant vaccines will help combat and control this disease in the future,
without the side effects seen with live viruses. Pichia pastoris expressed antigenic
proteins can be mass produced at very high levels; to achieve comparable antigenic levels
in inactivated vaccines, sacrificing a lot of SPF chicken embryos will be required.
Specific pathogen free embryos might not be available in the future for veterinary use; as
shortages of available SPF embryos have been reported. This is due to the high demand
for these embryos for the use in production of human therapeutics. A demand that will
increase drastically with the emerging of new human disease epidemics or pandemics that
threatens the human race.
References:
[1] Wyeth PJ, Cullen GA. Maternally derived antibody-effect on susceptibility of
chicks to infectious bursal disease. Avian Pathol 1976(5):253-60.
[2] Sharma J, Kim I, Rautenschlein S, Yeh H. Infectious bursal disease virus of
chickens: pathogenesis and immunosuppression. Dev Comp Immunol.2000;24(2-3):223-
35.
![Page 174: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/174.jpg)
160
[3] Jackwood D, Saif Y, Huges J. Characteristics and serological studies of 2
serotypes of infectious bursal disease virus in turkeys. Avian Dis 1982;26(4):871-82.
[4] McNulty M, Saif Y. Antigenic relationship of non- serotype turkey infectious
bursal disease viruses from the United States and United Kingdom. Avian Dis.
1988;32(2):374-75.
[5] Chettle N, Stuart JC, Wyeth PJ. Outbreak of virulent infectious bursal disease in
East Anglia. Vet Rec 1989;125(10):271-2.
[6] van den Berg T. Acute infectious bursal disease in poultry: a review. Avian Pathol
2000;29(3):175-94.
[7] Banda A, Villegas P. Genetic characterization of very virulent infectious bursal
disease viruses from Latin America. Avian Dis 2004;48(3):540-9.
[8] Hassan MK. Very virulent infectious bursal disease virus in Egypt: epidemiology,
isolation and immunogenicity of classic vaccine. Vet Res Commun 2004;28(4):347-56.
[9] Dobos P, Berthiaume L, Leong JA, Kibenge FS, Muller H, Nicholson B.L.
Family Birnaviridae. In Murphy, FA, Fauquet, CM, Bishop, DHL, Ghabrial, SA, Jarvis,
AW. Martelli, GP, Mayo, MA, Summers, MD. Editors Virus taxonomy. Classification
and Nomenclature of viruses, Sixth Report on the International Committee on Taxonomy
of Viruses. Arch Virol [Suppl 10] Wein New York: Springer, 1995. pp 240-244
[10] Lombardo E, Maraver A, Espinosa I, Fernandez-Arias A, Rodriguez JF. VP5, the
nonstructural polypeptide of infectious bursal disease virus, accumulates within the host
plasma membrane and induces cell lysis. Virology 2000;277(2):345-57.
![Page 175: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/175.jpg)
161
[11] Yao K, Vakharia VN. Induction of apoptosis in vitro by the 17-kDa nonstructural
protein of infectious bursal disease virus: possible role in viral pathogenesis. Virology
2001;285(1):50-8.
[12] Kibenge FS, Dhillon AS, Russell RG. Biochemistry and immunology of
infectious bursal disease virus. J Gen Virol 1988;69 (Pt 8):1757-75.
[13] Macreadie IG, Azad AA. Expression and RNA dependent RNA polymerase
activity of birnavirus VP1 protein in bacteria and yeast. Biochem Mol Biol Int
1993;30(6):1169-78.
[14] Becht H, Muller H, Muller H. Comparative studies on the structural and antigenic
properties of two serotypes of infectious bursal disease virus. J Gen Virol 1998(69):631-
40.
[15] Vakharia VN, He J, Ahamed B, Snyder DB. Molecular basis of antigenic
variation in infectious bursal disease virus. Virus Res 1994;31(2):265-73.
[16] Brandt M, Yao K, Liu M, Heckert RA, Vakharia VN. Molecular determinants of
virulence, cell tropism, and pathogenic phenotype of infectious bursal disease virus. J
Virol 2001;75(24):11974-82.
[17] Mundt E. Tissue culture infectivity of different strains of infectious bursal disease
virus is determined by distinct amino acids in VP2. J Gen Virol 1999;80 (Pt 8):2067-76.
[18] van Loon AA, de Haas N, Zeyda I, Mundt E. Alteration of amino acids in VP2 of
very virulent infectious bursal disease virus results in tissue culture adaptation and
attenuation in chickens. J Gen Virol 2002;83(Pt 1):121-9.
![Page 176: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/176.jpg)
162
[19] Pitcovski J, Gutter B, Gallili G, Goldway M, Perelman B, Gross G, et al.
Development and large-scale use of recombinant VP2 vaccine for the prevention of
infectious bursal disease of chickens. Vaccine 2003;21(32):4736-43.
[20] Wu PC, Su HY, Lee LH, Lin DT, Yen PC, Liu HJ. Secreted expression of the
VP2 protein of very virulent infectious bursal disease virus in the methylotrophic yeast
Pichia pastoris. J Virol Methods 2005;123(2):221-5.
[21] Pitcovski J, Di-Castro D, Shaaltiel Y, Azriel A, Gutter B, Yarkoni E, et al. Insect
cell-derived VP2 of infectious bursal disease virus confers protection against the disease
in chickens. Avian Dis 1996;40(4):753-61.
[22] Dybing JK, Jackwood DJ. Antigenic and immunogenic properties of baculovirus-
expressed infectious bursal disease viral proteins. Avian Dis 1998;42(1):80-91.
[23] Macreadie IG, Vaughan PR, Chapman AJ, McKern NM, Jagadish MN, Heine
HG, et al. Passive protection against infectious bursal disease virus by viral VP2
expressed in yeast. Vaccine 1990;8(6):549-52.
[24] Vakharia VN, Snyder DB, Lutticken D, Mengelwhereat SA, Savage PK, Edwards
GH, et al. Active and Passive Protection against Variant and Classic Infectious Bursal
Disease Virus-Strains Induced by Baculovirus-Expressed Structural Proteins. Vaccine
1994;12(5):452-56.
[25] Huang Z, Elankumaran S, Yunus AS, Samal SK. A recombinant Newcastle
disease virus (NDV) expressing VP2 protein of infectious bursal disease virus (IBDV)
protects against NDV and IBDV. J Virol 2004;78(18):10054-63.
![Page 177: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/177.jpg)
163
[26] Wu H, Singh NK, Locy RD, Scissum-Gunn K, Giambrone JJ. Immunization of
chickens with VP2 protein of infectious bursal disease virus expressed in Arabidopsis
thaliana. Avian Dis 2004;48(3):663-8.
[27] van den Berg TB, Eterradossi N, Toquin D, Meulemans G. Infectious Bursal
Disease (Gumboro Disease). In Diseases of Poultry: World Trade and Public Health
Implications, OIE Scientific and Technical Review 2000:509-43.
[28] Bayliss CD, Peters RW, Cook JK, Reece RL, Howes K, Binns MM, et al. A
recombinant fowlpox virus that expresses the VP2 antigen of infectious bursal disease
virus induces protection against mortality caused by the virus. Arch Virol 1991;120(3-
4):193-205.
[29] Darteil R, Bublot M, Laplace E, Bouquet JF, Audonnet JC, Riviere M.
Herpesvirus of turkey recombinant viruses expressing infectious bursal disease virus
(IBDV) VP2 immunogen induce protection against an IBDV virulent challenge in
chickens. Virology 1995;211(2):481-90.
[30] Tsukamoto K, Kojima C, Komori Y, Tanimura N, Mase M, Yamaguchi S.
Protection of chickens against very virulent infectious bursal disease virus (IBDV) and
Marek's disease virus (MDV) with a recombinant MDV expressing IBDV VP2. Virology
1999;257(2):352-62.
[31] Sheppard M, Werner W, Tsatas E, McCoy R, Prowse S, Johnson M. Fowl
adenovirus recombinant expressing VP2 of infectious bursal disease virus induces
protective immunity against bursal disease. Arch Virol 1998;143(5):915-30.
[32] Cregg JM, Barringer KJ, Hessler AY, Madden KR. Pichia pastoris as a host
system for transformations. Mol Cell Biol 1985;5(12):3376-85.
![Page 178: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/178.jpg)
164
[33] Clare JJ, Rayment FB, Ballantine SP, Sreekrishna K, Romanos MA. High-level
expression of tetanus toxin fragment C in Pichia pastoris strains containing multiple
tandem integrations of the gene. Biotechnology (N Y) 1991;9(5):455-60.
[34] Pantin-Jackwood MJ, Brown TP. Infectious bursal disease virus and
proventriculitis in broiler chickens. Avian Dis. 2003;47(3):681-90.
[35] Wu S, Letchworth GJ. High efficiency transformation by electroporation of
Pichia pastoris pretreated with lithium acetate and dithiothreitol. Biotechniques
2004;36(1):152-4.
[36] Pantin-Jackwood MJ, Brown TP, Kim Y, Huff GR. Proventriculitis in broiler
chickens: effects of immunosuppression. Avian Dis 2004;48(2):300-16.
[37] Hassan M, Afify M, Aly M. Susceptibility of vaccinated and unvaccinated
Egyptian chickens to very virulent infectious bursal disease virus. Avian Pathol.
2002;31(2):149-56.
[38] Gogal RM, Jr., Ahmed SA, Larsen CT. Analysis of avian lymphocyte
proliferation by a new, simple, nonradioactive assay (lympho-pro). Avian Dis
1997;41(3):714-25.
[39] Carpenter CR, Arnold SR, Bose HR, Jr. Suppression of mitogen-stimulated
blastogenic response during reticuloendotheliosis virus-induced tumorigenesis:
investigation into the mechanism of action of the suppressor. J Immunol 1978
(120):1313-20.
[40] Muller H, Islam M, Raue R. Research on infectious bursal disease - the past, the
present and the future. Vet. Microb. 2003;97(1-2):153-65.
![Page 179: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/179.jpg)
165
[41] Lukert, P. D., and Y. M. Saif Infectious bursal disease. In: Diseases of
Poultry, 11th edition ed. Y.M. Saif, H.J. Barnes, J.R. Glisson, A.M. Fadly, L.R. Mc
Dougald, D.E. Swayne. Iowa State University Press, Ames, IA. pp 161-179. 2003.
[42] Sharma JM, Lee LF. Effect of Infectious Bursal Disease on Natural-Killer Cell-
Activity and Mitogenic Response of Chicken Lymphoid-Cells - Role of Adherent Cells in
Cellular Immune Suppression. Infect Immun. 1983;42(2):747-54.
[43] Sivanandan V, Maheswaran SK. Immune profile of infectious bursal disease. III.
Effect of infectious bursal disease virus on the lymphocyte responses to phytomitogens
and on mixed lymphocyte reaction of chickens. Avian Dis 1981;25(1):112-20.
[44] Haddad E, Whitfill C, Avakian A, Ricks C, Andrews P, Thoma J, et al. Efficacy
of a novel infectious bursal disease virus immune complex vaccine in broiler chickens.
Avian Dis. 1997;41(4):882-89.
[45] Pitcovski J, Levi BZ, Maray T, Di-Castro D, Safadi A, Krispel S, et al. Failure of
viral protein 3 of infectious bursal disease virus produced in prokaryotic and eukaryotic
expression systems to protect chickens against the disease. Avian Dis 1999;43(1):8-15.
![Page 180: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/180.jpg)
166
Figure legends: Fig .5.1. RT-PCR product of amplified VP2 and pVP2: lane 1, molecular size marker; lane 2, 3, 5 and 6 amplified VP2; lane 4, negative control; lane 8 and 9, amplified pVP2 Fig. 5.2. Western blot analysis of recombinant proteins. Lane 1 Molecular weight marker, lanes 2 and 3 two clones of yeast expressing pVP2, Lanes 4 and 5 two clones of yeast expressing VP2 and lanes 6 and 7 negative controls (yeast transformed with wild-type plasmid). The membrane was immunoblotted with primary monoclonal antibodies against IBDV (ATCC HB9490) Fig: 5.3. Photomicrographs of bursas from SPF chickens stained with IHC that were vaccinated and challenged with diluent (A); Vaccinated with diluent and challenged with Edgar IBDV (B); Vaccinated with Pichia pastoris control and challenged with Edgar IBDV (C); non vaccinated non infected control (D); pVP2 vaccinated and Edgar IBDV challenged (E) and VP2 vaccinated and Edgar IBDV challenged (F). X100 Fig: 5.4. Photomicrographs of Thymus from SPF chickens stained with H&E were VP2 vaccinated and Edgar IBDV challenged (A); diluent vaccinated and Edgar IBDV challenged (B); Non-vaccinated , non-challenged control (C). X100 Fig: 5.5. Photomicrographs of bursa from SPF chickens stained with H&E that were non-vaccinated , non-challenged control (A). or diluent vaccinated and Edgar IBDV challenged (B); X100
![Page 181: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/181.jpg)
167
Table 5.1: Experimental design of immunization experiment. Different vaccines were administered at 1-day of age with or without Freund’s adjuvant. Challenge was 3 weeks post vaccination. Experimental replicates had the following treatment groups. Vaccine Pichia control VP2 in pichia pVP2 in pichia Diluent 2512 None none
No
adjuvant
+ + + + + + + + + + + + + + +
Adjuvant
+ + + + + + + + + + + + - - -
Challenge diluent Edgar 2512 diluent Edgar 2512 diluent Edgar 2512 diluent Edgar 2512 2512 2512 none
+: Group contained 5 SPF birds -: Not done ( as live viruses are administered with adjuvants in commercial poultry).
![Page 182: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/182.jpg)
168
Table 5.2: Number of morbid and dead birds per total number in different vaccine and challenge treatments
Vaccine Pichia control VP2 in pichia pVP2 in pichia Diluent 2512 none noneChallenge diluent Edgar 2512 diluent Edgar 2512 diluent Edgar 2512 diluent Edgar 2512 2512 none none
No adjuvant
* 3/10 * * * * * 3/10 * * 9/10 * * * * Morbidity
Adjuvant
* 5/10 * * * * * 3/10 * * 5/10 * n/a n/a n/a
No adjuvant
* 2/10 * * * * * 3/10 * * 6/10 * * * * Mortality
Adjuvant
* 4/10 * * * * * 2/10 * * 3/10 * n/a n/a n/a
* = 0/10 n/a = not applicable
![Page 183: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/183.jpg)
169
Table 5.3: Body weight and relative organ weights of 28 day old SPF chickens vaccinated or non-vaccinated against IBDV, one week post challenge. Values ± standard deviations within a column that are followed by the same superscript letter are not significantly different (P < 0.05).
Vaccine Challenge Body weight Bursa relative weight thymus relative weight Spleen relative weight
VP2 Edgar 273.03 ± 38.32 0.409 ± 0.23b 0.479 ± 0.15a 0.337 ± 0.05c
VP2 + adjuvant Edgar 270.29 ± 22.29 0.282 ± 0.21c 0.396 ± 0.07b 0.303 ± 0.08b
pVP2 Edgar 259.35 ± 29.02 0.197 ± 0.16d 0.227 ± 0.08d 0.325 ± 0.06bc
pVP2 + adjuvant Edgar 259.05 ± 25.24 0.177 ± 0.07d 0.262 ± 0.07d 0.315 ± 0.06b
Pichia Edgar 259.89 ± 51.89 0.162 ± 0.04d 0.271 ± 0.03d 0.242 ± 0.04a
Pichia + adjuvant Edgar 274.70 ± 32.26 0.186 ± 0.11d 0.297 ± 0.05c 0.241 ± 0.08a
Diluent Edgar 241.88 ± 57.27 0.230 ± 0.15c 0.306 ± 0.10c 0.299 ± 0.05a
Diluent + adjuvant Edgar 264.78 ± 20.24 0.114 ± 0.03d 0.250 ± 0.07d 0.234 ± 0.05a
Pichia Diluent 316.60 ± 36.37 0.625 ± 0.22a 0.657 ± 0.15a 0.225 ± 0.06a
Pichia + adjuvant Diluent 309.53 ± 40.77 0.545 ± 0.08a 0.541 ± 0.06a 0.225 ± 0.05a
2512 2512 306.23 ± 41.90 0.423 ± 0.09a 0.595 ± 0.13a 0.180 ± 0.06a
none 2515 271.74 ± 21.60 0.567 ± 0.12a 0.429 ± 0.13a 0.225 ± 0.05a
none none 301.90 ± 21.73 0.616 ± 0.09a 0.553 ± 0.12a 0.229 ± 0.04a
![Page 184: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/184.jpg)
170
Table 5.4: Real-time RT-PCR melting curve detection, histopathological lesion scores and IHC mean staining scores for bursas of birds vaccinated or non vaccinated at 1-day of age and challenged with Edgar or 2512 strains of IBDV at 21 days. Sampling was performed 1 week post challenge. Data for individual bird’s bursa.
Vaccine without Freund’s adjuvant Vaccine with Freund’s adjuvant Vaccine Challenge RT-PCR A Lesion
score B IHC C RT-PCR Lesion
score IHC
VP2 Edgar IBDV
+ + + +
4 4N 4N 4N
+ ++ ++ ++
- - - -
4 4N 4 4
+ + + +
pVP2 Edgar IBDV
- + + +
4 4N 4N 4N
+ +++ +++ +++
- + + +
4 4N 4 4
+ +++ +++ +++
Pichia control
Edgar IBDV
+ + + +
4 4 4 4
++ +++ ++
+++
+ + + +
4 4 4 4
+ +++ +++ +++
Diluent Edgar IBDV
+ + + +
4 4 4 4
+++ +++ +++ +++
+ + + +
4 4 4 4
+ +++ +++ +++
Pichia control
diluent - - - -
1 1 1 1
- - - -
- - - -
1 1 1 1
- - - -
2512 2512 - - - -
1 1 2 1
- - - -
N/A N/A N/A
![Page 185: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/185.jpg)
171
none 2512 + + + +
2 2 2 2
- - - -
N/A N/A N/A
Diluent Diluent - - - -
1 2 1 1
- - - -
N/A N/A N/A
none none - - - -
1 1 1 1
- - - -
N/A N/A N/A
A - = Negative; + = Positive
B Lesion Score: 1= No lesion, 2 = Mild variation in follicle size, 3= Moderate variation in follicle size, 4 = Either Necrosis or follicle atrophy, N = acute necrosis C - = No staining; + = Minimal staining, ++ = Moderate Staining, +++ = Intense staining.
![Page 186: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/186.jpg)
172
Table 5.5: ELISA GMT at 28 days of age to IBDV following vaccination of 1-day-old
SPF chickens
Vaccine without
Freund’s adjuvant
Vaccine with Freund’s
adjuvant
Vaccine
IBDV Challenge
strain A IBDV GM titer IBDV GM titer
VP2 Edgar 436 576
pVP2 Edgar 1825 1884
Pichia control Edgar 2540 2679
Diluent vaccine Edgar 2505 2364
2512 2512 884 N/A
None 2512 57 N/A
Pichia control Diluent 22 1
None None 1 N/A
A Chickens were challenged at 21 days of age with IBDV
N/A = not applicable
![Page 187: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/187.jpg)
173
Table 5.6: Mean lymphocyte transformation indices of vaccinated and non-vaccinated birds challenged or not challenged with 2512 or Edgar IBDV
Vaccine Challenge Con A PWM IBDV
VP2 Edgar 1.13± 0.22 a 0.99.± 0.15 a 0.68 ± 0.21 a
VP2+adj Edgar 1.17± 0.26 a 1.30.± 0.43 b 0.71 ± 0.43 a
pVP2 Edgar 0.99± 0.21 a 1.03.± 0.21 a 0.68 ± 0.38 a
pVP2 +adj Edgar 1.01 ±.0.12 a 1.05.± 0.11 a 0.75 ± 0.31 a
Pichia control Edgar 1.25 ± 0.29 b 1.27.± 0.25 b 0.88 ± 0.17 a
2512 2512 1.03 ± 0.01 a 1.00.± 0.02 a 0.76 ± 0.23 a
None 2512 C 1.19 ± 0.37 a 1.09.± 0.22 a 0.32 ± 0.14 b
None none 1.02 ± 0.01 a 0.98 ± 0.02 a 0.78 ± 0.20 a
Values represent the mean of five chicken per treatment; Con A = Concanavalin A; PWM = pokeweed mitogen. IBDV= Infectious bursal disease virus.Values within a column followed by the same superscript letter are not significantly different (P < 0.05).
![Page 188: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/188.jpg)
174
Fig .5.1. RT-PCR product of amplified VP2 and pVP2: lane 1, molecular size marker;
lane 2, 3, 5 and 6 amplified VP2; lane 4, negative control; lane 8 and 9, amplified pVP2
Fig. 5.2. Western blot analysis of recombinant proteins. Lane 1 Molecular weight marker, two clones of yeast expressing pVP2 lanes 2 and 3, two clones of yeast expressing VP2 and negative control, yeast transformed with wild-type plasmid. The membrane was immunoblotted with primary monoclonal antibodies against IBDV (ATCC HB9490)
![Page 189: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/189.jpg)
175
Fig 5.3
A BA B
Fig: 5.3. Photomicrographs of bursa from SPF chickens stained with H&E that were Non-vaccinated, non-challenged control (A); or diluent vaccinated and Edgar IBDV challenged (B); X100
![Page 190: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/190.jpg)
176
Fig 5.4:
Fig: 5.4. Photomicrographs of Thymus from SPF chickens stained with H&E were VP2 vaccinated and Edgar IBDV challenged (A); diluent vaccinated and Edgar IBDV challenged (B); Non-vaccinated , non-challenged control (C). X100
![Page 191: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/191.jpg)
177
Fig 5.5
Fig 5.5. Photomicrographs of bursas from SPF chickens stained with IHC that were vaccinated and challenged with diluent (A); Vaccinated with diluent and challenged with Edgar IBDV (B); Vaccinated with Pichia pastoris control and challenged with Edgar IBDV (C); non vaccinated non infected control (D); pVP2 vaccinated and Edgar IBDV challenged (E) and VP2 vaccinated and Edgar IBDV challenged (F). X100
![Page 192: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/192.jpg)
178
CHAPTER VI
DISCUSSION AND CONCLUSIONS
Identification of infectious bursal disease viruses from RNA extracted from paraffin
embedded tissue.
Formalin fixed paraffin embedded tissues used as a source of genomic material to
rapidly identify field isolates of IBDV by RT-PCR and sequencing allowed a direct
correlation between the virus strain present and the lesions produced by this virus, in a
timely fashion. This also allowed analysis of foreign strains of IBDV with no importation
and biosecurity restriction issues because of the inactivated nature of the antigen.
Therefore, the information obtained by this technology will help refine vaccination
programs against IBDV, as well as to detect new emerging IBDV strains both
domestically and internationally.
Fixation conditions can have a tremendous impact on the success of RNA
extraction, as properly handled samples generate good results while improperly handled
samples can generate average results at best. In chickens experimentally infected with
IBDV, all paraffin embedded blocks with bursas having acute +3 or +4 bursitis had
extractable genomic material that was positive for IBDV based on melting curve analysis,
indicating high sensitivity of the primers used. Most of the 452 blocks analyzed had +3 or
+4 acute lesion scores for IBDV, yet only 227 were positive for IBDV extractable
genomic material. IBDV genomic extraction rate from samples originating from the
U.S.A. was 87%, while that from overseas was only 19%. The effects of different
fixation conditions on tissues with higher than normal viral load was evaluated. These
![Page 193: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/193.jpg)
179
changes in temperature, pH and concentration of formalin were enough to render a
positive IBDV formalin fixed paraffin embedded tissue block into a negative one.
Nucleic acid and deduced amino acid analysis of extracted IBDV genomic
material has shown that the Variant E strain of IBDV is the predominant strain present in
the U.S.A. The few classical strains found in samples from the United States were
mainly of vaccine origin. There were no vvIBDV strains found in the U.S.A.
Internationally, four vvIBDV strains from both Venezuela and China were identified.
Variant A strains were found in both Peru and Venezuela. Variant E strains were
identified in El Salvador, Guatemala, Mexico, Peru and Venezuela. Internationally, more
classical than variant strains were identified, this is similar to what Lukert and Saif have
reported.
Phylogenetic analysis showed that serotype 1 viruses grouped together in several
different groups. Previous knowledge of strain origin and identity along with location of
viruses on phylogenetic trees was the basis used for grouping these viruses. All variant
viruses sequenced were either Variant A or Variant E. Variant E had three different
branches.
Several unique virus strains that did not group with the common IBDV strains and
fell on branches of their own were identified. Genomic material was isolated and
identified from a unique IBD virus strain that was missing 63 nucleotides from its
hypervariable region in the VP2 gene, yet the virus was apparently able to replicate in the
bursa and cause +4 acute lymphocytic damage. VP2 is important for virus attachment to
cell receptors and is the viral protein that is recognized by the chicken’s immune system.
Missing these 21 amino acids apparently did not affect the virus’s ability to attach and
![Page 194: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/194.jpg)
180
enter the susceptible B-lymphocytes. Constant vaccination pressure in the past may have
contributed to the emergence of variant strains and vvIBDV. This unique case missing
the 21 amino acids may have resulted from random mutations by the virus in an attempt
to escape from the immunoglobulins produced in vaccinated chickens; or maybe this
virus was always there in the population of IBDV viruses, and constant vaccination
against variant IBD viruses suppressed other viruses, giving this virus favorable
propagation conditions.
The inability to identify all strains present in multivalent vaccines was attributed
to the nature of the RT-PCR reaction which amplifies the virus with higher logarithmic
concentration than the other viruses that have lower concentration. So when a sequencing
reaction is run and analyzed, only the nucleotides that are most abundant are identified.
This was noticed when sequencing a bivalent vaccine, SVS-510™, where only the
predominant variant portion of the vaccine was identified and not the classic portion. To
overcome this, the seeds of that vaccine were isolated and sequenced independently. This
variant portion of this bivalent vaccine was identified in figure 1 and 2 as SVS-510
(Variant portion) while the classical portion was identified as SVS-510 (Standard
portion).
To investigate why samples with +4 acute lesion scores of IBDV yielded no
detectable RNA, bursas with high vial loads were subjected to different fixation
conditions. Extracting genomic RNA for identification of IBDV from bursas of Fabricius
stored at acidic pH (pH 5.0 and pH 2.0) was unsuccessful. Previous research which found
DNA damage in cells at low pH, may explain the lack of extracted genomic RNA in this
experiment. Unbuffered formalin oxidizes to formic acid and an acidic environment
![Page 195: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/195.jpg)
181
causes degradation of nucleic acids because the β-glycosidic bonds in the purine bases
are hydrolyzed at pH 4. Loss of some amino group cross-links occurs at low pH and may
result in loss of RNA from the fixed tissue. Extraction of genomic RNA at a basic pH
(pH 9.0, and 13.0) was also unsuccessful and the reason for this is unknown.
The thermodynamic stability of a nucleic acid duplex strongly depends on the
denaturation temperature of the duplex at atmospheric pressure. Denaturation of genomic
RNA may have occurred when tissues were formalin fixed at 50°C for 5 days and maybe
the reason why there were no rt-RT-PCR detectable RNA extracted from these blocks.
At formalin concentrations of 20% or 37 %, the extraction of RNA from FFPET
blocks yielded no rt-RT-PCR detectable RNA. This may be due to excessive crosslinking
of amino groups resulting from the acidic nature of formalin at higher concentrations;
indeed, maximum tissue fixation, i.e. cross-linking, occurs in the pH range of 4.0 to 5.5,
thus hindering genomic RNA extraction.
Fixation time had no effect on RNA extraction or subsequent identification , but
longer fixation times are not recommended due to the higher frequency of non-
reproducible sequence alterations. This is demonstrated by the increase in melting peak
temperature over time. Formalin may cause cross-linking of cytosine nucleotides on
either strand. As a result, in PCR the Taq-DNA polymerase fails to recognize the cytosine
and incorporates an adenine in the place of a guanosine, creating an artificial C-T or G-A
mutation.
Real-time RT-PCR as diagnostic tool for IBDV is not always available, so
another important tool for identifying IBDV is immunohistochemistry. We had the
hypothesis that just as fixation conditions have a negative impact on RNA used for
![Page 196: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/196.jpg)
182
identifying IBDV in formalin fixed paraffin embedded tissues; these same adverse
fixation conditions may also impact IHC identification negatively. Over the years
formalin fixation of tissues has been used for tissue preservation and for histological
evaluation of tissues. Some have shown that small (10 X 10 X 3 mm) tissue fragments
fixed promptly in neutral buffered formalin for 6-24 hours generally had adequate
cytological preservation and immunolocalization, with minimal antigen masking.
Variations in fixation times or conditions cause the majority of false negatives in
immunohistochemistry, as lack of consistency in formalin fixation protocols (formalin
concentration, pH and fixation time) among laboratories influences the outcome of
staining in immunohistochemistry. Formaldehyde fixatives fix tissue by reacting
primarily with basic amino acids to form cross-linked “methylene bridges”. Formalin
fixation conditions have a direct effect on number of methylene brigdes. The number of
methylene bridges and which amino groups are cross-linked in the tissue are important
variables in the outcome of immunohistochemical staining, and could also be an
important factor on the ability to extract rt-RT-PCR detectable RNA from FFPET.
Tissues fixed in 20% or 37 % formalin undergo shrinkage and may suffer from
alteration of epitope conformation. The IBDV epitopes detected by the monoclonal
antibodies used in this study are conformationally dependent; thus fixation conditions
such as formaldehyde concentration or pH that may cause changes in epitope
conformation rendering them undetectable by these monoclonal antibodies. Maximum
tissue fixation, i.e. cross-linking, occurs in the pH range of 4 to 5.5, therefore, the
presence of too many cross-links or cross-links of certain amino groups may cause
antigen masking. This may be the reason why there was minimal or no immunostaining
![Page 197: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/197.jpg)
183
in tissues fixed in a pH <7.0. Inconclusive IHC staining at pH >7.0 may also be due to
tissue shrinkage or alteration of reactive epitopes.
Immunohistochemical staining intensity was highest in tissues fixed at 4 °C.
Increased temperature reduced specific IHC staining, but did not eliminate it. The
reduction in staining intensity may be due to tissue shrinkage at temperatures higher than
4 °C. This result is in agreement with other researchers findings; however the mechanism
for this effect is unknown.
One of the ideas we had when planning for these experiments, was that we could
use the genomic material we extracted from infected bursal tissues for strain
identification, to produce recombinant proteins that provide protection against IBDV in
susceptible flocks. We had the vision of getting field samples from flocks suffering from
immunosuppression; identify IBDV histopathologically and molecularly identify the
strain causing the problem and provide the grower with a tailor made vaccine to control
his IBDV problem. This proof of concept is possible as we were able to identify IBDV
strains by sequencing, and the genomic material extracted from paraffin embedded tissue
was successfully expressed in Pichia pastoris yeast expression system.
Using the information and genomic material gathered from this technology we can
use Pichia pastoris to express various proteins specific for each strain of IBDV
identified; thus, generating a recombinant protein vaccine library that can provide
specific protection against a particular IBDV strains. Once a recombinant IBDV VP2
library is established, very specific vaccines can be provided rapidly to prevent economic
losses caused by IBDV infections. This rapid screening and identification process allows
for processing relatively large number of samples in a very short time. This combined
![Page 198: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/198.jpg)
184
with the easy of processing, allows for extensive epidemiological survey to be carried
out. This helps in finding out what types of virus are present in a certain location at a
certain time. This technology has allowed identification of unique viruses, and newly
emerging viruses. Depending on how wide spread these newly emerging viruses become;
we will be able to determine what vaccines are needed to be produced in order to protect
flocks against particular strains of IBDV. Infectious bursal disease virus is highly
infectious and very resistant to inactivation. Therefore, despite strict hygienic measures,
vaccination is unavoidable under high infection pressure and it is necessary to protect
chickens against infection during the first weeks after hatch. After hatching, chickens are
immunized with live vaccines, and because maternal immunity interferes with
vaccination with live vaccines, the major problem with active immunization of young
maternally immune chicks is determining the proper time of vaccination. It is well known
that less attenuated strains (“hot vaccines”) may cause lesions in the bursa follicles and,
thus, immunosuppression even in vaccinated birds. To avoid live vaccine side effects, a
subunit VP2 vaccine was produced in Pichia pastoris that is a yeast expression system. It
combines the simplicity of prokaryotic growth requirements, growth potential and ease of
manipulation along with the post-translational modifications of eukaryotes to ensure that
the expressed protein is functional and has the proper conformation. Using this
expression system we expressed both VP2 and the hyper variable region of VP2. Using
these recombinant vaccines will help combat and control this disease in the future,
without the side effects seen with live viruses. Pichia pastoris expressed antigenic
proteins can be mass produced at very high levels; to achieve comparable antigenic levels
in inactivated killed vaccines, sacrificing a lot of SPF chicken embryos will be required.
![Page 199: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/199.jpg)
185
Specific pathogen free embryos might not be available in the future for veterinary use; as
shortages of available SPF embryos have been reported. This is due to the high demand
for these embryos for the use in production of human therapeutics. This demand may
increase drastically with the emerging of new human disease epidemics or pandemics that
threatens the human race.
Extracting genomic material from formalin fixed tissue has been done, unlocking
a historical archive. Expressing these extracted genes and using these generated
sequences to look back will help identify viruses, their biology and their evolution.
Researchers have reconstructed the human influenza virus that caused the 1918 epidemic
and found it to be of avian origin. Using this technology to identify IBDV strains can also
be done and may give an insight on how the virus is changing over time. Also rapid
identification of newly emerging viruses and how predominant they are is important for
veterinarians, to allow them more information in controlling a complex disease.
In summary, the research potentials of extracting RNA from formalin fixed
paraffin embedded tissue has allowed rapid accurate profiling of IBDV strains that are
causing lesions in the field. This is a diagnostic tool that has assisted veterinarians in
choosing which vaccines to use based on the nucleic acid sequence of the hypervariable
region of VP2 of IBDV viruses present on their farms. Another potential is the
identification of potentially new vaccine strains. As with all molecular techniques that are
used to predict the relative similarities and differences between IBDV strains,
determining the actual antigenic differences among viruses requires testing in-vivo. For
optimal IBDV RNA extraction and sequence identification, tissues should be fixed in
formalin at a pH of 7.0, concentration of 5% or 10% and stored at 25 °C or lower
![Page 200: STUDIES ON INFECTIOUS BURSAL DISEASE VIRUS (IBDV ......vaccinated with recombinant VP2 showed best protection against 3 week-old challenge with Edgar IBDV. There was no morbidity or](https://reader035.fdocuments.net/reader035/viewer/2022071409/610323dea0264f44585b19f7/html5/thumbnails/200.jpg)
186
temperature. Extremes in temperature, pH or formalin concentration have a negative
effect on tissues used for RNA extraction. Optimal conditions for fixation of tissues
infected with IBDV that will be used for IHC evaluation are 10% formalin, pH 7.0 and
temperature of 4 °C. For practical purposes, fixation temperature of 4 °C is recommended
for both procedures. Also recombinant vaccines expressing VP2 and not just the
hypervariable region of VP2 are needed to protect against IBDV infections. Use of
paraffin embedded tissue as a source of genomic material for protein production in yeast
is feasible. But it is highly recommended for conformationally dependant proteins to fully
construct the whole genome before expressing in yeast expression system.