Structure and Blue-Light-Responsive Transcription of a Chloroplast … · Structure and...

Plant Physiol. (1 997) 11 5: 21 3-222

Structure and Blue-Light-Responsive Transcription of a Chloroplast psbD Promoter from Arabidopsis thaliana’

Paul H. Hoffer and David A. Christopher*

Department of Plant Molecular Physiology, University of Hawaii at Manoa, St. John 503, 3190 Maile Way, Honolulu, Hawaii 96822

~ ~ ~ ~~

We characterized the effects of light on psbD transcription and mRNA levels during chloroplast development in Arabidopsis thaliana. After 6 to 12 hours of illumination of dark-grown seedlings, two psbD mRNAs were detected and their 5’ ends were mapped to positions -550 and -190 bp upstream from the psbD translational start codon. Their kinetics of accumulation resembled the accumulation of chloroplast psbA and rbcL mRNAs but differed from the accumulation of the nuclear-encoded Lhcb and Chs mRNAs. A third psbD mRNA with its 5’ end at position -950 accumulated after illumination of >180 h. The 5‘ ends of this transcript were mapped to a nucleotide sequence that is highly conserved with functional sequences in the barley (Hordeum vulgare) blue-light-responsive promoter (BLRP). Transcription from the Arabidopsis psbD promoter was 3-fold higher in blue relative to red light, whereas red and blue light affected total chloroplast, rbcL, and 16s rDNA transcription similarly. This study shows that transcription of Arabidop- sis psbD i s mediated by a BLRP and suggests that psbD genes in other land plants are regulated by a common blue-light-signaling pathway. lsolating the BLRP from Arabidopsis will allow molecular genetic studies aimed at identifying the pertinent photoreceptor and components of this phototransduction pathway.

The chloroplast genomes of higher plants exist as multiple copies of circular DNA that range in size from 120 to 160 kb (for review, see Palmer, 1990; Sugiura, 1992). The variability in chloroplast DNA size is due to differences in the size of an inverted repeat and small differences in gene content among plant species (Palmer, 1990). In general, chloroplast genomes encode a similar group of approxi- mately 100 protein genes, 30 to 31 tRNA genes, and a complete set of rRNA genes, which function in photosynthesis, transcription, and translation (Shinozaki et al., 1986; Hiratsuka et al., 1989; Wakasugi et al., 1994; Maier et al., 1995). The genes are tightly spaced along the ctDNA, and severa1 are organized into polycistronic operons that resemble those of Escherichia coli and cyanobacteria (Lindahl and Zengel, 1986; Tanaka et al., 1986; Zhou et al., 1989; Bergsland and Haselkorn, 1991). Many of these operons

This study was supported by funds from the University of Hawaii Research Council and U.S. Department of Energy grant no. DE-FG03-97ER20273 to D.A.C. This paper is journal series no. 4279 from the Hawaii Agricultura1 Experiment Station.

* Corresponding author; e-mail [email protected]; fax 1-808- 956-3542.

213

encode different subunits that function in the same multi- subunit protein complex.

The operonal organization of genes encoding related functions allows for unique regulatory mechanisms that control gene expression during chloroplast development. For example, the psbD-psbC genes encode the D2 and CP43 subunits of the PSII reaction center (Vermaas and Ikeuchi, 1991). As chloroplasts mature, psbD-psbC transcription rates and mRNA abundance are maintained at higher levels relative to most other chloroplast genes (Sexton et al., 1990a; Baumgartner et al., 1993; Christopher and Mullet, 1994). The differential expression of psbD-psbC during chloroplast development involves the action of at least four promoters that drive overlapping transcription units (Sex- ton et al., 1990a). As barley (Hordeum vulgare) chloroplasts mature, there is a light-induced switch in the use of the promoters. A BLRP that is differentially activated by high- fluence blue and UV-A light, but not by red or far-red light, becomes the predominant promoter driving transcription (Gamble and Mullet, 1989; Christopher and Mullet, 1994; Christopher, 1996). The blue-light-induced mRNAs make up most of the translatable psbD mRNA in mature chloroplasts (Mullet et al., 1990; Christopher and Mullet, 1994). Blue-light-activated psbD transcription assists in maintaining the synthesis of D2, which is photodamaged in plants and algae exposed to high-intensity light (Schuster et al., 1988; Melis et al., 1992; Christopher and Mullet, 1994).

The nucleotide sequence of the barley BLRP is highly conserved with light-responsive promoters from eight different plant genera (Christopher et al., 1992; Wada et al., 1994). The light-responsive promoter and psbD-psbC genes are linked together in a11 land-plant chloroplast genomes studied to date except the parasite Epifagus virginiana, which lacks these genes (Wolfe et al., 1992), and the liverwort Marchantin polymorpha (Ohyama et al., 1986), which lacks the light-responsive promoter.

Despite the widespread occurrence of the conserved promoter sequences in land plants, it is not known whether the blue-light-responsive transcription observed in barley (Christopher, 1996) is a conserved mechanism of gene activation for psbD in the other plants. In barley the genetic mechanism involves a unique high-fluence blue light/ UV-A phototransduction pathway (Christopher and Mul- let, 1994). This pathway is modulated by phytochrome and leaf development and an extraplastidic Ser / Thr protein

Abbreviation: BLRP, blue-light-responsive promoter.

www.plantphysiol.orgon June 17, 2018 - Published by Downloaded from Copyright © 1997 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org

214 Hoffer and Christopher Plant Physiol. Vol. 11 5, 1997

phosphatase, which affect total chloroplast transcription activity (Christopher, 1996; Christopher et al., 1997). The biochemistry and molecular details of this blue-light signal transduction pathway are poorly understood.

An understanding of the psbD regulation by high-fluence blue light requires a comprehensive study of the relevant photoreceptor, intracellular signaling pathway, and genes for components of the pathway. Arabidopsis thaliana repre- sents a genetically tractable system with which to elucidate the molecular mechanisms regulating psbD expression. However, the psbD gene to our knowledge has not been studied in Arabidopsis. As a prerequisite to using the well-developed genetics of Arabidopsis to study psbD regulation, we cloned the Arabidopsis psbD gene and identified its cognate light-responsive promoter. We mapped the psbD transcripts and studied the effect of light on psbD transcription and mRNA levels in comparison with other light-regulated chloroplast-encoded and nuclear-encoded genes. This study revealed that the Arabidopsis psbD gene is regulated by blue-light-responsive transcription from a conserved BLRP. In addition, we show that the BLRP is differentially regulated relative to other photoresponsive nuclear and chloroplast genes.

MATERIALS A N D METHODS

Plant Material, Crowth Conditions, and Light Treatments

Wild-type seeds of Arabidopsis thaliana ecotype Columbia were purchased from Lehle Seeds (Round Rock, TX). Seeds were surface-sterilized with 25% bleach and 0.2% Tween 20 and plated on 0.8% agar containing Murashige-Skoog me- dium and 2% SUC. Plated seeds were refrigerated (4°C) for 15 h and then exposed to white light (90-100 pmol m-’ s-l) at 21 to 23°C for 24 h to promote uniform germination. The germinating seeds were kept in white light for 9 d (216 h) or blue or red light for 6 d or were placed in the dark in light-tight, controlled environment chambers at 21 to 23°C in a dark room for 3.5 d. After the dark treatments seedlings were exposed to the light sources described below for 6, 12, or 24 h. Tissue was harvested by quick freezing in liquid N,.

To grow plants for chloroplast isolation, seeds were planted in flats containing water-saturated potting mixture (Jiffy, Bentonville, AR). After incubation at 4°C for 15 h, seeds were exposed to a photoperiod of 12 h of darkness and 12 h of white light (fluorescent, 90-100 pmol m - ’ ~ - ~ ) at 21 to 23°C for 26 to 28 d. Seedlings were watered with one-half-strength nutrient solution (Stern, Port Washing- ton, NY). Plants were then placed in complete darkness for 60 h. Following dark adaptation, plants were either maintained in the dark or returned to red, blue, or white light for 7 h before leaves were harvested for subsequent chloroplast isolation.

Fluences (in micromoles per meter per second) for red, blue, and white light were measured using a quantum photometer (LI-1000, Li-Cor, Lincoln, NE). AI1 manipula- tions of dark-grown plants were performed in either complete darkness or a dim green safelight. The sources of

radiation were previously described in detail (Christopher and Mullet, 1994; Christopher, 1996).

RNA Analysis

Total leaf nucleic acid was isolated from frozen leaf tissue by extraction in water-saturated pheno1:chloroform (l:l, v / v ) and buffer (100 mM Tris-HC1, pH 8.5, 100 mM NaC1, 10 mM EDTA, 1.0% SDS). Total cell RNA was obtained by extraction of the total nucleic acid sample with acid phenol, pH 4.5, followed by extraction with chloroform and precipitation in 75% ethanol and 0.3 M sodium acetate (Christopher et al., 1992). RNA was quantitated by measuring the A,,, (1 optical density = 40 mg/mL) and its intactness was analyzed by electrophoresis on 1.0% form- aldehyde/l.2% agarose gels (16 mM Mops, 4 mM sodium acetate, and 1 mM EDTA, pH 7.0).

RNA gel blots containing equal amounts of total cell RNA loaded per lane were prepared as previously described (Christopher et al., 1992). Heterologous probes were derived from linearized recombinant plasmids with DNA inserts specific for the barley chloroplast genes, 16s rRNA, rbcL, and psbA (Rapp et al., 1992). A plasmid specific for the coding region of the nuclear gene Lhcbl*3 (formerly termed cabl) was described previously (Chris- topher, 1996). Gene-specific antisense RNA probes were synthesized and radiolabeled with [cY-~’P]UTP (>800 Ci/ mM, ICN) using T3 and T7 RNA polymerases. A plasmid containing the coding region of the Chs gene from Arabi- dopsis (Feinbaum and Ausubel, 1988) was a generous gift from J. Chory (Salk Institute, San Diego, CA). The 1.75-kb PstI restriction fragment containing part of exon I and a11 of exon I1 of the chs gene was gel-purified and labeled with [a-32P]dATP using a random primer labeling kit (Promega). Radiolabeled RNA and DNA probes were hybridized to RNA gel blots as described previously (Chris- topher and Mullet, 1994).

The deoxyoligonucleotide 5’-GTCATAGTGATCCTC- CTATTC spans the conserved nucleotides -16 to +5 of the psbD mRNA leader in the antisense direction (Christopher et al., 1992). The deoxyoligonucleotide 5’-AGAGATATCG- ACGGATCCCCTA resides 60 nucleotides downstream from the 5’ ends of the light-induced mRNAs of Arabido- psis and is antisense to the mRNA-like strand. The deoxyoligonucleotides were labeled at the 5’ terminus using T4 polynucleotide kinase and [?PIATI’ (ICN).

The first radiolabeled primer was used to assay equal amounts of total cell RNA in primer extension analysis experiments, as described previously (Christopher et al., 1992). To map the 5’ ends of the light-induced mRNAs, a DNA-sequencing reaction was conducted using the second primer and the plasmid pAtEHlOO (described below), and this reaction was electrophoresed in parallel with the primer extension reactions. Radioactivity on the blots and in bands on polyacrylamide gels was quantitated with a liquid scintillation counter (series LS1801, Beckman) or a gel/blot analysis system (model 4000, Ambis, San Diego,



Blue-Light-Responsive Arabidopsis psbD Gene 21 5

CA). Experiments were done in duplicate with at least two assays per sample.

Chloroplast lsolation and Chloroplast Transcription Assays

Leaves were homogenized (Powergen homogenizer, Fisher Scientific) at a dia1 setting between 2 and 3. Plastids were isolated by centrifugation (4100g) of cell lysates on Perco11 gradients (40-80%) essentially as described previously (Christopher et al., 1992), except that chloroplasts were pelleted at 2600g. Intact chloroplasts were counted in a hemacytometer using a phase-contrast microscope. Chlo- roplast transcription activity was assayed using [c~-~'P]UTP and 5 X 107 purified chloroplasts at a final concentration of 4.55 X 10' chloroplasts mL-I, as described previously (Christopher, 1996).

The tagetitoxin experiment utilized 5 X 106 chloroplasts at a final concentration of 9.6 x 107 chloroplasts mL-'. Chloroplast transcription activities from duplicate experiments were expressed as pmol [32P]UMP incorporated (5 X 107 chloroplasts)-' (10 min)-', whereas the units for the tagetitoxin experiment were pmol [32P]UMP incorporated (5 X 106 chlorop1asts)-' (10 min)-'. Radiolabeled run-on transcripts were hybridized as described previously (Chris- topher, 1996) to nonradiolabeled, gene-specific probes rbcL, 16s rRNA, a 350-bp PCR product specific to the psbD promoter, and chloroplast EcoRIl HindIII restriction fragments that were bound to nylon membranes. The levels of radioactivity hybridized to the membranes were determined by liquid scintillation counting of excised bands. Gene and promoter-specific transcription activities were expressed as fmol [32P]UMP incorporated (5 X 107 chloroplasts)-' (10 min)-' kb-'.

lsolation and Molecular Cloning of Arabidopsis ctDNA

Arabidopsis ctDNA was isolated from purified chloroplasts by phenol extraction and ethanol precipitation as described previously (Christopher et al., 1992). DNA quality was assessed by agarose gel electrophoresis of DNA fragments produced by restriction digestion. The deoxyoligonucleotide 5'-TATATCCGCTATTCTGATAT spans the conserved bases 47 to 66 (Christopher et al., 1992) of the barley BLRP. It was used with the deoxyoligonucleotide 5'-GTCATAGTGATCCTCCTATTC (described above) in the PCR to amplify the 950-bp 5' untranslated region of the psbD gene from Arabidopsis ctDNA.

PCR conditions consisted of 4 min at 94°C and then 40 cycles of 1 min at 94"C, 1 min at 42"C, and 1 min at 72°C. The 5' termini of the 950-bp PCR product were labeled using T4 polynucleotide kinase and [y3'P]ATP (ICN). The radiolabeled fragment was used as a probe in Southern hybridization experiments of ctDNA and to screen an Ara- bidopsis chloroplast genomic library. The library was con- structed by ligating ctDNA double-digested with EcoRI/ HindIII into the same sites of pBluescript followed by transformation of E. coli XL-1 Blue (Stratagene). A recombinant plasmid, designated pAtEH100, which contained a 4.1-kb DNA insert, was isolated and purified by alkaline lysis (Sambrook et al., 1989). The nucleotide sequence of

the promoter and the 5' end of the psbD-coding and upstream untranslated regions were determined using dye- terminator cycle sequencing (Applied Biosystems).

A 350-bp DNA fragment that included the Arabidopsis BLRP and the downstream untranslated region was generated using the PCR method (as described above) with the deoxyoligonucleotides 5'-TATATCCGCTATTCTGATAT and 5'-CAAACACCTTGGATCCCATTAAC and pAtEHlOO as a template. DNA sequence data from 12 plants were analyzed using a program from the Genetics Computer Group (University of Wisconsin, Madison). The nucleotide sequences available in the National Center for Biotechnol- ogy Information (Bethesda, MD) were accessed via the In- ternet using the Blast and Entrez programs provided by the National Center for Biotechnology Information.

RESULTS

We used primer extension assays to examine the expression of the Arabidopsis psbD gene and to map the 5' ends of psbD mRNAs during greening of young seedlings. As shown in Figure 1, no psbD mRNAs were detected in dark-grown seedlings. Three major mRNA 5' ends, located 190, 550, and 950 nucleotides upstream from the psbD translational start codon, were detected in illuminated seedlings using a primer specific to the psbD gene (Fig. 1). The 190- and 550-nucleotidc fragments increased in abundance from 6 to 24 h of continuous light and by 216 h of light, these fragments were highly abundant. However, after 216 h of light a third primer extension product of 950 nucleotides was detected. This 950-nucleotide product was detected after 180 to 200 h of light (data not shown), with significant levels being detected by 216 h of light. There- fore, during greening, the accumulation of mRNA corresponding to the 950-nucleotide fragment was different from the accumulation of the mRNAs corresponding to the 190- and 550-nucleotide fragments. The appearance of the 950-nucleotide band was affected by seedling development, with lower levels present in cotyledons compared with leaves of light-grown seedlings (D.A. Christopher and P.H. Hoffer, unpublished data).

We examined as controls the expression of two other chloroplast genes, psbA (encodes the D1 subunit of the PSII reaction center) and rbcL (encodes the large subunit of Rubisco), and two light-regulated nuclear genes, Lhcb (encodes the chlorophyll alb-binding protein) and Chs (encodes chalcone synthase) (Fig. 2). The analysis of the 18s and 16s rRNAs are also presented in Figure 2. Low levels of 16s rRNA and psbA and rbcL mRNAs were detected in 3.5-d-old dark-grown seedlings. The levels of psbA and rbcL increased during the greening process (Fig. 2). Both psbA and rbcL mRNA levels were more abundant after 24 h of continuous light. The increase in abundance of psbA and rbcL mRNAs resembled the increase in the psbD 190- and 550-nucleotide fragments (Figs. 1 and 2). This increase could be due to a general increase in total chloroplast transcription and in the stability of psbA and rbcL mRNAs that accompanies light-induced chloroplast and leaf devel-



216 Hoffer and Christopher Plant Physiol. Vol. 115, 1997

3.5 DP +0 6 12 24 216 HL

550- - -~

The abundance of Chs mRNA increased by 6 h of light,decreased by 24 h of light, and was undetected by 216 h oflight (Fig. 2), which is similar to the previously observedpattern of Chs expression (Kubasek et al., 1992). The psbD950-nucleotide fragment (Figs. 1 and 2B) accumulated laterduring seedling development relative to Chs mRNAs butmoderately resembled Lhcb mRNA accumulation. By ana-lyzing the expression of the four other genes, we show thatthe low level of the psbD 950-nucleotide fragment detectedafter 6 to 24 h of illumination was not an artifact caused byinadequate light treatments, since the light-responsive ex-pression of Chs, Lhcb, and rbcL and the psbD 190- and550-nucleotide mRNAs was detected. Rather, the accumu-lation of the psbD 950-nucleotide fragment followed a dif-

3.5 DD +

190- ~«H

BLRP

-950

psbD

-550-190

Figure 1. Transcript mapping and analysis of psbD expression ingreening Arabidopsis chloroplasts. A, 3.5-d-old dark-grown seed-lings (3.5 DD) were exposed to 0, 6, 12, 24, or 216 h of continuouslight (HL). psbD mRNAs were analyzed by primer extension assays.Three bands corresponding to three different mRNA 5' ends arelabeled by approximate size (in nucleotides) as 190, 550, and 950.The arrow denotes the bands for mRNA 5' ends appearing in thecontinuous light-grown sample (216 h). B, The psbD gene (blackbar), putative light-responsive promoter (LRP, striped box), and po-sition of transcripts (open arrows) are indicated as derived from theexperiments in A. The black half-arrow refers to the location of theprimer used in the primer extension assays.

opment, as has been observed for other plants (Link, 1988;Schrubar et al., 1990; Kim et al., 1993; Dubell and Mullet,1995; for reviews, see Mullet, 1993; Mayfield et al., 1995). Incontrast, during greening of 3.5-d-old seedlings, the accu-mulation of the psbD 950-nucleotide band was delayed intime relative to the 16S rRNA and the rbcL and psbAmRNAs (Figs. 1 and 2B).

The nuclear genes Chs and Lhcb responded to light dif-ferently than the chloroplast genes (Fig. 2). The level ofLhcb mRNA did not increase markedly until after 24 h ofillumination in 3.5-d-old dark-grown seedlings (Fig. 2B).

10 20 30 216Time Illuminated (hr)

Figure 2. Analysis of chloroplast and nuclear gene expression duringArabidopsis chloroplast development. A, Treatments were the sameas described in Figure 1. Transcript levels were analyzed for thechloroplast psbA and rbcL genes and the nuclear Lhcb and Chs genesusing RNA hybridization experiments. The ethidium bromide-stainednuclear 18S and chloroplast 165 rRNAs are included as references. B,The relative transcript levels for Lhcb, Chs, psbA, and the 950-nucleotide psbD band (from Fig. 1) were quantitated. The averages ±so for two experiments done in duplicate are shown. www.plantphysiol.orgon June 17, 2018 - Published by Downloaded from

Copyright © 1997 American Society of Plant Biologists. All rights reserved.


Blue-Light-Responsive Arabidopsis psbD Gene 217

cDNAR G A T C

Figure 3. High-resolution primer extension mapping of the 5' endsof the light-induced psbD mRNAs from Arabidopsis. Lanes labeledcDNA (A, T, C, and C) refer to the dideoxynucleotide sequencingreactions conducted on plasmid pAtEH100 using the same primer asfor primer extension of Arabidopsis RNA (lane R) from light-grownplants. The cDNA sequence read from the lanes is printed to the rightof the panel. The arrows point to the nucleotides mapping to the 5'ends of the light-induced psbD mRNAs that correspond to the 950-nucleotide band in Figure 1. The large and small arrows point to themost and least abundant bands, respectively, as determined in ourreplicated experiments.

ferent time course than the accumulation of mRNAs forChs, psbA, and rbcL.

The location of this third mRNA 5' end at 950 nucleo-tides upstream from the psbD AUG codon (Fig. 1) corre-sponds exactly to the location of the light-responsive pro-

moter in two other dicots, tobacco (Nicotiana tabacum) andspinach (Spinacia oleracea; Yao et al., 1989; Christopher etal., 1992). The nucleotide sequences of the spinach andtobacco light-responsive promoters are highly conservedwith the psbD light-responsive promoters of six otherplants, including the BLRP of barley. By analogy, thissuggests that the 950-nucleotide region in Arabidopsis mayalso encode a light-responsive promoter.

To obtain more information concerning the DNA regionin Arabidopsis from which the psbD mRNA at position—950 arises, we cloned the psbD gene and flanking regionsfrom an Arabidopsis chloroplast genomic library and de-termined the nucleotide sequence of the upstream tran-scribed, untranscribed, and 5' coding regions of the psbDgene. Information about the nucleotide sequence was usedto map the 5' end of the -950-nucleotide mRNA and toanalyze the promoter structure and function. As shown inFigure 3, the 5' ends of the mRNAs were mapped to thenucleotides TTGA in the cDNA sequence 5'-GAATTT-GAATATCAGA. The mRNAs for the psbD light-responsivepromoters from eight other plants also have multiple 5'ends that map to the same T residues in this conservedsequence (Christopher et al., 1992). The 5' ends of the psbDmRNAs reside exactly 949 to 952 bp upstream from thepsbD translational start codon.

As shown in Figure 4, the nucleotide sequence flankingthe Arabidopsis psbD region at position —950 nucleotides ishighly conserved with the barley BLRP and the light-responsive promoters of three dicots, five monocots, andsimilar sequences from two other evolutionarily distantplants, black pine and broad bean. Equally important is thepresence in Arabidopsis of conserved nucleotide sequencescentered at positions 10 (AAGTAAGT), 30 (TTGAAT), and50 (CTAtTCTGaTAT) (numbering as used in Fig. 4). Thetranscription initiation site is also conserved. The CTAt-TCTGaTAT and TTGAAT motifs resemble the -10 and-35 core promoter elements, respectively, of £. coli, and

ArabTobacSpinBeanPeaPine

BarleyRye

MaizeSorgRice

WheatCons

1 * • • • • • • 7 4AGAAAAAGTAAGTGGACCTAACCCATCGAATCATGACTATATCCACTATTCTGATATTCAAATTCGATAGAGAT

TGACAAAGTAAGTGGACTTGGCCTATTGAATCATGAATATACCCGCTATTCTGATATTCAAATTTGATAGAGATAAAAAAAGTAAGTGGACCTAAGCTATTGAATCATAACTATATCCACTATTCTGATATTCAAATTGGATAGAAATAAAAAAAGTAAGTGG. CCTAACCTATTGAATCATAACTATATCCACTATTCTGATATTCAAATTGGATAGAAATAGGAGAAGTAAGTGAACCTGACCCATTGGCTTATGAATATATAAGCTACTCTGGTATTGAAATTTGATGGAGATGCATAAAGTAAGTAGACCTGACTCCTTGAATGATGCCTCTATCCGCTATTCTGATATATAAATTCGATGTAGAT

AGATAAAGTAAGTAGACCTGACCCCTTGAATGATGCCTCTATCCGCTATTCTGATATATAAATTCGATGTGGATAGATAAAGTAAGTGGACCTGACTCCTTGAATGAGGCCTCTATCCGCTATTCTGATATATAAATTCGATGTAGATGCATAAAGTAAGTAGACCTGACTCCTTTAATGATGCCTCTATCCGCTATTCTGATATATAAATTCGATGTAGATagataAAGTAAGTooaCcTqaccc.TtqaaT.Atg.cT.TAtccgCTAtTCTGaTAT.tAAATTcGATq.agAT

AGT "-iS" "-10"—— |

Figure 4. Comparison of the Arabidopsis psbD promoter region with the barley psbD BLRP and homologous regions from10 different plants. Nucleotide sequences of the mRNA-like strand from Arabidopsis (Arab) are aligned with sorghum (Sorg;Christopher etal., 1992), barley (Sexton et al., 1990b), wheat (Howe et al., 1988), spinach (Spin; Holschuh et al., 1984), pea(Rasmussen et al., 1987), rice (Hiratsuka et al., 1989), tobacco (Tobac; Shinozaki et al., 1986), rye (Bukharov et al,, 1989),black pine (Pine; Wakasugi et al., 1994), maize (Maier et al., 1995), and broad bean (Bean; Kuntz et al., 1984). Theconsensus sequence (Cons) for the 74-bp region is given at the bottom. Uppercase letters denote completely conservednucleotides. Lowercase letters refer to a deviation of at least one nucleotide in the alignment. The lowercase, one-letternucleotide abbreviation was selected based on its frequency of occurrence. A period indicates a nucleotide that is notconserved between monocots and dicots, or a deletion, as in the case of pea (position 16). The arrow refers to the majortranscription initiation site (single underline). The double-underlined regions labeled —10, —35, and AGT refer to conservedpromoter elements. The black dots measure every 10 nucleotides between 1 and 74. www.plantphysiol.orgon June 17, 2018 - Published by Downloaded from

Copyright © 1997 American Society of Plant Biologists. All rights reserved.


218 Hoffer and Christopher Plant Physiol. Vol. 115, 1997

B2-,

§1-813 1.6S.1.-H§1-2.£ 1^0.8r>o.6-00.4-0.0.2

0 iD R B WLight Treatment

L D

(•) (+)TAG

Figure 5. Effect of light quality and tagetitoxin on chloroplast tran-scription activity in Arabidopsis plants. A, Chloroplast transcriptionwas quantitated from 26-d-old plants that were dark-adapted for 60 hand then exposed to 7 h of darkness (D), 45 ± 12 ̂ .mol m~2 s~' redlight (R), 45 ± 15 /u.mol m~2 s~' blue light (B), or 100 ± 20 jumolm~2 s"1 white light (W). Transcription activities from duplicateexperiments were expressed as pmol [32PJUMP incorporated (5 x107chloroplasts)~' (10 min)~1. B, Chloroplast transcription activitiesfrom the white-light-treated plants were measured with ( + ) andwithout (-) the addition of the chloroplast transcription inhibitortagetitoxin (TAG; 60 JU.M, final concentration). Chloroplast transcrip-tion activities were expressed as |32P]UMP incorporated (5 x 106

chloroplasts)"1 (10 min)~'. C, Radiolabeled run-on transcripts pro-duced in the chloroplast transcription assays were hybridized toSouthern blots containing ctDNA digested with both EcoRI andH/ndlll restriction enzymes. Radioactive chloroplast transcripts wereused from plants treated with 7 h of white light (L) and darkness (D).The Arabidopsis ctDNA restriction fragments separated by agarosegel electrophoresis and stained with ethidium bromide are shown tothe right.

chloroplast gene promoters that have been shown to benecessary for transcription (Gruissem and Zurawski, 1985;Hanley-Bowdoin and Chua, 1987). The AAGTAAGT motif,which is involved in light responsiveness (Allison andMaliga, 1995; Kim and Mullet, 1995), is also present inArabidopsis. These data strongly indicate that a cognateArabidopsis light-responsive promoter also resides in thisregion.

To confirm that this Arabidopsis DNA region functionsin transcription and to determine whether it is affected by

light, chloroplast transcription assays were conducted us-ing chloroplasts from dark-adapted plants treated withred, blue, or white light. Measurements of the total tran-scription activity of intact Arabidopsis chloroplasts areshown in Figure 5. Transcription rates from 28-d-old dark-adapted plants exposed to red and blue light were similarand were 2-fold higher relative to transcription rates ofplants maintained in darkness (Fig. 5A). Total chloroplasttranscription rates from plants exposed to white light wereon average 4-fold higher than dark-adapted controls.

The addition of tagetitoxin, an inhibitor of chloroplasttranscription (Mathews and Durbin, 1990), reduced tran-scription by 65%. This degree of inhibition falls within thepreviously determined range obtained by titration oftagetitoxin in transcription assays using pea chloroplasts(Mathews and Durbin, 1990). The radiolabeled transcriptssynthesized by the Arabidopsis chloroplasts hybridized toctDNA restriction fragments in a manner proportional totheir transcription rates (Fig. 5C). These data confirm thatchloroplast transcription activities were being measured inour run-on assays.

We measured the transcription activities of the psbDlight-responsive promoter region in comparison with rbcLand 16S rRNA transcription from the same plants. Asshown in Table I, transcription from the psbD promoterwas not detected in the dark-adapted controls. Transcrip-tion increased slightly in red light and was highest in blueand white light (Table I). In contrast, total chloroplasttranscription was similar in red and blue light (Fig. 5), andrbcL transcription did not differ markedly in red, blue, orwhite light. In the dark controls transcription of the 16SRNA was highest among all genes. The transcription of the16S rRNA gene was stimulated 3- and 2-fold in red andblue light, respectively, and more than 20-fold in whitelight. When transcription of the psbD promoter was nor-malized relative to rbcL and 16S rRNA transcription, onlypsbD transcription was significantly higher in blue lightrelative to red light (Table I). This indicates that blue lightspecifically stimulated transcription from the psbD pro-moter relative to other chloroplast genes.

Table I. Quantitation of the effect of light quality on transcriptionactivities of the psbD-light-responsive promoter (LRP) and rbcL and165 rRNA genes

Gene- and promoter-specific transcription activities (mean ± so)were measured on an equal chloroplast basis from dark-adaptedplants exposed to 7 h of additional darkness, red, blue, or white lightas described in "Materials and Methods." In the ratios the tran-scription of the psbD-LRP was normalized to rbcL and 16S rRNAtranscription.

Gene_____Dark_____Red Light Blue Light White Light

fmol UMP incorporated (5 x 107 chloroplasts)'' (10 min)~' ktr'

psfaD-LRPrbcL16S rRNA

LRP: rbcLLRP: 16S

0.00.04 ± 0.010.44 ± 0.05

00

0.38 ± 0.04 1.11 ± 0.160.15 ± 0.04 0.13 ± 0.011.36 ±0.20 0.99 ± 0.04

ratio2.5 8.50.3 1.1

1.98 ± 0.180.13 ± 0.179.34 ± 0.20

15.00.2



Blue-Light-Responsive Arabidopsis psbD Gene 21 9

D I SC U SSI ON

The Arabidopsis psbD Gene 1s Regulaied by a BLRP

Severa1 lines of evidence support the idea that the Ara- bidopsis psbD gene is regulated by a BLRP that is common to most plant ctDNAs. The 5' ends of the light-induced psbD mRNAs arise from a region residing 950 bp upstream from the psbD translational start codon. This -950 position is the same location of the Iight-responsive promoters of the psbD genes from tobacco and spinach chloroplasts (Yao et al., 1989; Christopher et al., 1992). The nucleotide sequences of the light-responsive promoters from dicots are highly conserved with the sequences in the psbD BLRP from the monocot barley and from five other monocots (Christopher et al., 1992). These conserved DNA sequences from barley and tobacco have been identified as functional promoter elements using transcription assays, RNA-capping experiments, transcription inhibitor studies, gel mobility shift experiments, and promoter assays in transgenic chloroplasts (Yao et al., 1989; Sexton et al., 1990a; Christopher et al., 1992; Wada et al., 1994; Allison and Maliga, 1995; Kim and Mullet, 1995; Christopher, 1996).

DNA sequence analysis of the 100-bp region flanking the -950-bp transcription initiation site of Arabidopsis (Fig. 4) indicated that it also contains the conserved promoter elements (-10, -35, AAGTAAGT, and transcription initiation motifs) necessary for transcription (Chris- topher et al., 1992; Wada et al., 1994; Allison and Maliga, 1995; Kim and Mullet, 1995). We demonstrated that transcription from this region is light-dependent and is highest in blue relative to red light. The increase in abundance of transcripts in response to light correlated closely with the increase in psbD transcription. Therefore, we conclude that a conserved BLRP resides 950 to 985 bp upstream from the Arabidopsis psbD gene. In addition, because blue light activates this promoter in the dicot Arabidopsis and the monocot barley, we suggest that the blue light signal transduction pathway is common to other land plants.

In addition to blue light, developmental signals could modulate promoter activity. For example, in young seedlings grown in continuous light, the -950-nucleotide mRNA that arises from the BLRP was detected at significant levels only after extended periods ( > M O h) of illumination, whereas psbD transcription was readily activated in older seedlings exposed to a relatively short (7 h) period of illumination. Recently, we found that the leve1 of the mRNA from the BLRP is higher in primary leaves, whereas low levels were observed in light-grown cotyledons (D.A. Christopher and P.H. Hoffer, unpublished data). Similarly, the expression of the Arabidopsis Lhcb gene is strongly influenced by developmental signals (Brusslan and Tobin, 1992) in addition to light (Kaufman, 1993; Gao and Kauf- man, 1994).

Two other psbD mRNA 5' ends were detected in our experiments (190- and 550-nucleotide bands). Analogous psbD RNAs are also found in a11 other plant species studied (Yao et al., 1989; Sexton et al., 1990a; Christopher et al., 1992; Wada et al., 1994). Multiple 5' ends for psbD tran-

scripts are generated by multiple promoters and 5' RNA- processing events. We suggest that the 190- and 550- nucleotide bands correspond to mRNAs that arise from additional promoters andl or RNA processing within the Arabidopsis psbD operon. Transcription and RNA- processing assays (Sexton et al., 1990a) will further define the origin of the mRNAs arising from the -550 and -190 positions.

The chloroplast psbA and rbcL genes, the other psbD mRNAs (-190 and -550) and the photoresponsive nuclear genes (Lkcb and Cks) differed from the expression of the psbD BLRP. These different genetic responses of nuclear and chloroplast genes during greening could be triggered by the same signaling system that has unique downstream components. Alternatively, the blue light photosensory pathway activating the BLRP could be different from, and could interact with, the signaling pathways regulating the other photoresponsive genes. Along this line, psbD and 16s transcription rates in white light were much greater than the sum of the individual transcription rates in red and blue light (Table I). This suggests a synergistic effect of white light on the transcription of these genes. Pretreat- ment of dark-adapted plants with 30 min of red light followed by 7 h of blue light yielded transcription rates for these genes similar to those for blue light alone (data not shown). This suggests that the synergistic effect requires continuous white light and cannot be mimicked by short exposure to red followed by blue light.

In barley a synergistic effect of continuous blue plus far-red light on psbD transcription was observed, whereas far-red light alone had no effect (Christopher, 1996). Phy- tochrome A has been shown to mediate the high irradiance response to far-red light (Smith, 1995). It was proposed that phytochrome A modulates the activity of the psbD-BLRP by activating total chloroplast transcription, whereas blue light induces a BLRP-specific transcription factor (Christo- pher, 1996). The capacity of the factor to activate transcription could be increased by the higher total plastid transcription levels. Therefore, the synergistic effect of white light is interpreted to be due to these two separate influ- entes of light quality on psbD transcription (Christopher, 1996). Alternatively, the higher fluences of white light used here could have resulted in a greater stimulation of transcription. Further investigation of the effect of phytochrome and fluence rate on the regulation of the psbD BLRP is needed. These investigations will be enhanced by using Arabidopsis because of the ease of generating mutants and

Table II. Nucleotide usage at specific positions in the BLRP in figure 4 differs in monocots relative to dicots anda gymnosperm

Nucleotide Nucleotide Used

Monocot cereals Dicots Black Dine Position

25 32 35 39 58 70

C A A G C T C A A C A A A T T T C C




the large variety of photomorphogenetic mutants already available.

DNA Sequence Similarity 1s Retained among Evolutionarily Related Plants

The sequence comparison of the Arabidopsis psbD BLRP with the promoters from 11 plants (Fig. 4) revealed some interesting differences and similarities among the monocot cereals, dicots, and gymnosperms, which are summarized in Table 11. At positions 25, 32,35,39, 58, and 70, the monocot cereals use a different base than that used by the dicots and the one gymnosperm, black pine. At positions 25, 35, and 39, the monocots use C instead of A, which is used by both dicots and black pine. At positions 32, 58, and 70, the monocots use G, A, and T compared with pyrimidine (C,T), T, and G in dicots and black pine, respectively. Therefore, the DNA sequence in the black pine promoter is more identical to the dicot sequences than to the monocot cereal sequences. The sequence similarity suggests that the gymnosperm promoter is more closely related evolutionarily to the dicots than the monocots. This is interesting because the dicots are hypothe- sized to have originated from gymnosperms, whereas the monocots came later in evolution from the dicots (Doyle et al., 1994). The retainment of these evolutionary similarities in a small, non-protein-coding, functional DNA sequence is noteworthy.

Role of Blue Light in Plant Adaptation to High-Light Environments

The evolutionary conservation of the BLRP in land plants raises an interesting question about its physiological sig- nificance. What is the selection pressure maintaining the linkage of the BLRP with the psbD gene? One view is that the increased turnover of D2 in plants exposed to high light requires that psbD expression be enhanced to maintain PSII function (Christopher and Mullet, 1994). The photochem- istry in plants exposed to high-intensity light and UV radiation, particularly UV-B, leads to damage of the D1 and D2 subunits (Greenberg et al., 1989; Barber and Andersson, 1992; Melis et al., 1992; Aro et al., 1993; Jansen et al., 1993). D1 and D2 form the heterodimeric core of PSII and are essential for photosynthetic activity (Vermaas and Ikeuchi, 1991).

To maintain photosynthesis, the plant uses an efficient repair system that removes the photodamaged proteins and replaces them with newly synthesized subunits (Schuster et al., 1988; Barber and Andersson, 1992; Aro et al., 1993; Christopher and Mullet, 1994). Blue-light- activated psbD expression assists with meeting the demand for increased D2 synthesis under high-light conditions (Mullet et al., 1990; Christopher and Mullet, 1994). The association of the BLRP with the psbD gene is restricted to land plants that are exposed to direct sunlight. Plants that lack the BLRP include the liverwort Marchantia polymorpha (Ohyama et al.), and three nongreen algae: Cyanophora paradoxa, Odentella sinensis, and Porphyra purpurea (Kowal-

lik et al., 1995; Reith and Munholland, 1995; Stirewalt et al., 1995), which grow in the shade or in underwater light environments. One interpretation is that environments of low light and UV-B have reduced damage to PSII and do not select for the BLRP.

The physiological function of blue-light-activated psbD expression can be better studied now that the BLRP has been characterized in the genetically amenable system of Arabidopsis. This work will enable molecular genetic and mutagenesis experiments aimed at identifying the pertinent photoreceptor and components of the intracellularsig- na1 transduction pathway. The small size of the genome of Arabidopsis could facilitate isolation of nuclear genes regulating psbD expression. The effects of known photomorphogenetic mutations (i.e. hy, phy, det, gun, cop), including the blue light photoreceptor (cryptochrome, Cry) , are cur- rently being determined. This will increase our understanding of the molecular mechanisms controlling plastid transcription and PSII biogenesis in response to the chang- ing light environment.

ACKNOWLEDCMENTS

We thank J. Chory and E. López for kindly providing the plasmid DNA containing the Arabidopsis Chs gene.

Received March 24, 1997; accepted June 3, 1997. Copyright Clearance Center: 0032-0889/97/115/0213/ 10.

LITERATURE ClTED

Allison LA, Maliga P (1995) Light-responsive and transcription- enhancing elements regulate the plastid psbD core promoter. EMBO J 14: 3721-3730

Aro E-M, Virgin I, Andersson B (1993) Photoinhibition of photosystem 11. Inactivation, protein damage and turnover. Biochim Biophys Acta 1143: 113-134

Barber J, Andersson B (1992) Too much of a good thing: light can be bad for photosynthesis. Trends Biochem Sci 17: 61-66

Baumgartner BJ, Rapp JC, Mullet JE (1993) Plastid genes encoding the transcription/ translation apparatus are differentially transcribed early in barley (Hordeum uulgare L . ) chloroplast development. Plant Physiol101: 781-789

Bergsland KJ, Haselkorn R (1991) Evolutionary relationships among eubacteria, cyanobacteria and chloroplasts: evidence from the rpoCl gene of Anabaena sp. strain PCC7120. J Bacteriol 173: 3446

Brusslan JA, Tobin EM (1992) Light-independent developmental regulation of Cab gene expression in Arabidopsis thaliana seedlings. Proc Natl Acad Sci USA 89: 7791-7795

Bukharov AA, Kolosov VL, Klezovich ON, Zolotarev AS (1989) Nucleotide sequence of the rye chloroplast DNA fragment comprising psbD, psbC and trnS genes. Nucleic Acids Res 17: 798

Christopher DA (1996) Leaf development and phytochrome modulate the activation of psbD-psbC transcription by high- fluence blue light in barley chloroplasts. Photosynth Res 47:

Christopher DA, Kim MK, Mullet JE (1992) A nove1 light- regulated promoter is conserved in cereal and dicot chloroplasts. Plant Cell 4 785-798

Christopher DA, Mullet JE (1994) Separate photosensory pathways co-regulates blue light/ultraviolet-A-activated psbD-psbC transcription and light-induced D2 and CP43 degradation in barley (Hordeum uulgare) chloroplasts. Plant Physiol 104: 1119- 1129

239-251



Blue-Light-Responsive Arabidopsis psbD Gene 221

Christopher DA, Xinli L, Kim M, Mullet JE (1997) Involvement of protein kinase and extraplastidic serine / threonine protein phos- phatases in signaling pathways regulating plastid transcription and the psbD blue light responsive promoter in barley. Plant Physiol 113: 1273-1282

Doyle JA, Donoghue MJ, Zimmer EA (1994) Integration of mor- phological and ribosomal RNA data on the origin of angio- sperms. Ann MO Bot Gard 81: 419450

Dubell AN, Mullet JE (1995) Differential transcription of pea chloroplast genes during light-induced leaf development. Con- tinuous far-red light activates chloroplast transcription. Plant Physiol 109: 105-112

Feinbaum RL, Ausubel FM (1988) Transcriptional regulation of the Arabidopsis thaliana chalcone synthase gene. Mo1 Cell Biol 8:

Gamble PE, Mullet JE (1989) Blue light regulates the accumulation of two psbD-psbC transcripts in barley chloroplasts. EMBO J 8:

Gao J, Kaufman LS (1994) Blue light-regulation of the Arabidopsis thaliana Cabl gene. Plant Physiol 104: 1251-1257

Greenberg BM, Gaba V, Canaani O, Malkin S, Mattoo AK, Edelman M (1989) Separate photosensitizers mediate degradation of the 32-kDa photosystem I1 reaction center protein in the visible and UV spectral regions. Proc Natl Acad Sci USA 86:

Gruissem W, Zurawski G (1985) Analysis of promoter regions of the spinach chloroplast rbcL, atpB, and psbA genes. EMBO J 4:

Hanley-Bowdoin L, Chua N-H (1987) Chloroplast promoters. Trends Biochem Sci 12 67-70

Hiratsuka J, Shimada H, Whittier RF, Ishibashi T, Sakamoto M, Mori M, Kondo C, Honji Y, Sun CR, Meng BY, and others (1989) The complete nucleotide sequence of the rice (Oryza sa- tiva) chloroplast genome: intermolecular recombination between distinct tRNA genes accounts for a major plastid DNA inversion during the evolution of the cereals. Mol. Gen Genet 217: 185-194

Holschuh K, Bottomley W, Whitfeld PR (1984) Structure of the spinach chloroplast genes for the D2 and 44 kd reaction-centre proteins of photosystem I1 and for tRNASer (UGA). Nucleic Acids Res 12 8819-8834

Howe CJ, Barker RF, Bowman CM, Dyer TA (1988) Common features of three inversions in wheat chloroplast DNA. Curr Genet 13: 343-349

Jansen MAK, Depka B, Trebst A, Edelman M (1993) Engagement of specific sites in the plastoquinone niche regulates degradation of the D1 protein in photosystem 11. J Biol Chem 268: 21246- 21252

Kaufman LS (1993) Transduction of blue-light signals. Plant Physiol102: 333337

Kim MK, Christopher DA, Mullet JE (1993) Direct evidence for selective modulation of psbA, rpoA, rbcL and 16s RNA stability during barley chloroplast development. Plant Mo1 Biol 22 447-463

Kim MK, Mullet JE (1995) Identification of a sequence-specific DNA binding factor required for transcription of the barley chloroplast blue light-responsive psbD-psbC promoter. Plant Cell

Kowallik KV, Stoebe B, Schaffran I, Freier U (1995) The chloroplast genome of a chlorophyll a+c containing alga, Odontella sinensis. Plant Mo1 Biol Rep 13: 336-342

Kubasek WL, Shirley BW, McKillop A, Goodman HM, Briggs W, Ausubel FM (1992) Regulation of flavonoid biosynthetic genes in germinating Arabidopsis seedlings. Plant Cell 4: 1229-1236

Kuntz M, Weil JH, Steinmetz A (1984) Nucleotide sequence of a 2 kbp BamHI fragment of Viciafaba chloroplast DNA containing the genes for threonine, glutamic acid and tyrosine transfer RNAs. Nucleic Acids Res 12: 5037-5047

Lindahl L, Zengel JM (1986) Ribosomal genes in Escherichia coli. Annu Rev Genet 20: 297-326

Link G (1988) Photocontrol of plastid gene expression. Plant Cell Environ 11: 329-338

Maier RM, Neckermann K, Igloi GL, Kossel H (1995) Complete sequence of the maize chloroplast genome: gene content, hot-

1985-1992

2785-2794

6617-6620

3375-3383

7 1445-1457

spots of divergence and fine tuning of genetic information by transcript editing. J Mo1 Biol 251: 614-628

Mathews DE, Durbin RD (1990) Tagetitixon inhibits RNA synthesis directed by RNA polymerases from chloroplasts and Esch- erichia coli. J Biol Chem 265: 493498

Mayfield SP, Yohn CB, Cohen A, Danon A (1995) Regulation of chloroplast gene expression. Annu Rev Plant Physiol Plant Mo1 Biol 46: 147-166

Melis A, Nemson JA, Harrison MA (1992)Damage to functional components and partia1 degradation of photosystem I1 reaction center proteins upon chloroplast exposure to ultraviolet-B radiation. Biochim Biophys Acta 1100 312-320

Mullet JE (1993) Dynamic regulation of chloroplast transcription. Plant Physiol 103: 309-313

Mullet JE, Gamble-Klein PE, Klein RR (1990) Chlorophyll regulates accumulation of the plastid-encoded chlorophyll apopro- teins CP43 and D1 by increasing apoprotein stability. Proc Natl Acad Sci USA 87: 4038-4042

Ohyama K, Fukuzawa H, Kohchi T, Shirai H, Sano T, Sano S , Umesono K, Shiki Y, Takeuchi M, Chang 2, and others (1986) Complete nucleotide sequence of liverwort, Marchantia polymorpha chloroplast DNA. Plan Mo1 Biol Rep 4: 150-175

Palmer JD (1990) Contrasting modes and tempos of genome evolution in land plant organelles. Trends Genet 6: 115-120

Rapp JC, Baumgartner BJ, Mullet JE (1992) Quantitative analysis of transcription and RNA levels of 15 barley chloroplast genes. Transcription rates and mRNA levels vary over 300-fold; pre- dicted mRNA stabilities vary 30-fold. J Biol Chem 267: 21404- 21411

Rasmussen O, Jepsen B, Stummann B, Henningsen KW (1987) Nucleotide sequence of the pea chloroplast tRNA-Thr(GGU) gene and flanking regions. Comparison to the Vicia juba sequence. Nucleic Acids Res 15: 854

Reith M, Munholland J (1995) Complete nucleotide sequence of the Porphyra pupurea chloroplast genome. Plant Mo1 Biol Rep 14: 333-335

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

Schriibar H, Wanner G, Westhoff P (1990) Transcriptional control of plastid gene expression in greening sorghum seedlings. Planta 183: 101-111

Schuster G, Timberg R, Ohad I (1988) Turnover of thylakoid photosystem I1 proteins during photoinhibition of Chlamydomo- nas reinhardtii. Eur J Biochem 177: 403-410

Sexton TB, Christopher DA, Mullet JE (1990a) Light-induced switch in barley psbD-psbC promoter utilization: a nove1 mechanism regulating chloroplast gene expression. EMBO J 9: 4485-4494

Sexton TB, Jones JT, Mullet JE (1990b) Sequence and transcriptional analysis of the barley ctDNA region upstream of psbD- psbC encoding trnK(UUU), rpsl6, trnQ(UUG), psbK, psbl and tmS(GCU). Curr Genet 17: 445454

Shinozaki K, Ohme M, Tanaka M, Wakasugi T, Hayashida N, Matsubayashi T, Zaita N, Chunwongse J, Obokata J, Shi- nozaki KY, and others (1986) The complete nucleotide sequence of the tobacco chloroplast genome: its gene organization and expression. EMBO J 5: 2043-2049

Smith H (1995) Physiological and ecological function within the phytochrome family. Annu Rev Plant Physiol Plant Mo1 Biol46

Stirewalt VL, Michalowski CB, Lofflehardt W, Bohnert HJ, Bry- ant DA (1995) Nucleotide sequence of the cyanelle genome from Cyanophora paradoxa. Plant Mo1 Biol Rep 14: 327-332

Sugiura M (1992) The chloroplast genome. Plant Mo1 Biol 19:

Tanaka M, Wakasugi T, Sugita M, Shinozaki K, Sugiura M (1986) Genes for the eight ribosomal proteins are clustered on the chloroplast genome of tobacco (Nicotiana tabacum): similarity of the S10 and spc operons of Escherichia coli. Proc Natl Acad Sci

289-315

149-168

USA 83: 6030-6034




Vermaas WFJ, Ikeuchi M (1991) Photosystem 11. In L Bogorad, IK Vasil, eds, The Photosynthetic Apparatus: Molecular Biology and Operation. Academic Press, San Diego, CA, pp

Wada T, Tunoyama Y, Shiina T, Toyoshima Y (1994) In vitro analysis of light-induced transcription in the wheat psbD / C gene cluster using plastid extracts from dark-grown and short- term illuminated seedlings. Plant Physiol 104: 1259-1267

Wakasugi T, Tsudzuki J, Ito S, Shibata M, Sugiura M (1994) A physical map and clone bank of the black pine (Pinus thunbergii) chloroplast genome. Plant Mo1 Biol Rep 12: 227-241

25-111

Wolfe KH, Morden CW, Palmer JD (1992) Function and evolution of a minimal plastid genome from a nonphotosynthetic parasitic plant. Proc Natl Acad Sci USA 89: 10648-10652

Yao WB, Meng BY, Tanaka M, Sugiura M (1989) An additional promoter within the protein-coding region of the psbD-psbC gene cluster in tobacco chloroplast DNA. Nucleic Acids Res 17

Zhou DX, Quigley F, Massenet O, Mache M (1989) Cotranscrip- tion of the S10- and spc-like operons in spinach chloroplasts and identification of three of their gene products. Mo1 Gen Genet 216: 439-445

9583-9591



Structure and Blue-Light-Responsive Transcription of a Chloroplast … · Structure and...

Documents

Transcript of Structure and Blue-Light-Responsive Transcription of a Chloroplast … · Structure and...