Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species...

40
Landesamt für Verbraucherschutz Sachsen-Anhalt Fachbereich Lebensmittelsicherheit Workshop Species Identification 14.04.15 Species Identification Dietrich Mäde

Transcript of Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species...

Page 1: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Landesamt für Verbraucherschutz Sachsen-Anhalt

Fachbereich Lebensmittelsicherheit

Workshop Species Identification 14.04.15

Species Identification

Dietrich Mäde

Page 2: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

This is how the press sees us….

superficially

Page 3: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Legal requirements for species identification

• Reg. (EC) No 178/2002 - Art 8 - Protection of consumers' interests -

prevention of:

(a) fraudulent or deceptive practices;

(b) the adulteration of food; and

(c) any other practices which may mislead the consumer.

• Reg. (EU) No. 1196/2011 - Art 7 - Fair information practices

• Reg. (EU) No. 1196/2011 - Art 22 - Quantitative indication of ingredients

• Reg. (EU) No 1379/2013 – Art 35 (1) (a): Indication of commercial

designation of the species and its scientific name

Page 4: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Fraudulent Practices

• Fatstock prices (rounded)

– Pig 1,45 €/kg

– Cattle (Cow) 3,30 €/kg

– Turkey 1,40 €/kg

– Lambs 5,00 €/kg

– Horses 0,50 €/kg

– mechanically deboned meat

(chicken or turkey) ~ 1€/kg

4

Page 5: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Horsemeat scandal

• Quelle: Süddeutsche Zeitung vom 17.202013

Page 6: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Press release

of 07/04/2015

6

“Dutch authorities took 167 samples from his meat supplies in

February 2013 and 35 tested positive for horse DNA, the court

in Den Bosch heard.”

Page 7: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Turkey DNA in salad with sausage

• turkey at ~1 %

level

• not indicated

• technologically not

necessary

• some producers

were striking than

others

Page 8: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Methods for Species Detection

• Immunological methods

– ELISA

– Agargel precipitation (old)

• Electrophoreses

– isoelectric focussing

• molecular methods

– universal PCR and subsequent species determination

by RFLP or Sequencing

– species or “group of species” specific PCR / real-time

PCR with verification by RFLP, probes or sequencing

8

Page 9: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Immunological methods

• ELISA

– detection of muscle specific

glycoproteins

– Sensitivity ~1 %

– false negative results in

some canned foods (F>12 -

(temperature > 134 °C)

– sometimes very helpful

when PCR fails

9

Page 10: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Electrophoresis

• Electrophoresis

– detection of myoglobin

– sensitivity 5% - 10%

– not applicable for highly

processed food

– method of choice for milk,

milk products and cheese

10

po

rk

beef

10892

10895

10898

ho

rse

me

at

mu

tton

10892

10895

10898

ho

rse

me

at

mu

tton

Page 11: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde 11

bovine γ2 casein ovine γ2 casein

bovine γ3 casein ovine γ3 casein

1. cow milk std

2. sample of mislabelled

„feta“ cheese

3. sheep cheese with

cow´s milk added

4. ewe's milk std

5. ewe's milk with 1 %

cow´s milk

6. sheep cheese with

cow´s milk added

7. cow milk std

8. sample of mislabelled

„feta“ cheese

Electrophoresis of milk products

Page 12: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Molecular methods - Qualitative PCR

• Often extremely sensitive

– mitochondrial DNA is present in

hundreds of copies per cell

resp. skeletal muscle fiber

sycytium

– sensitivity drops in highly acidic

and heated food (some canned

soups)

• Interpretation of results

sometimes risky

– traces from other food in artisan

production

• QM is highly demanding

– multiple extraction negative

controls necessary (e.g. every

10 extractions)

12

widely used for

qualitative species

detection

Page 13: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

• conserved universal mitochondrial sequences with

some species specific differences

– differences are made visible by RFLP or DNA sequencing

(sheer products mostly)

• cyt b can be used as amplification control for

subsequent specific assays

– check for inhibition and for DNA degradation

Species detection in the cyt b-gene

13

DNA-extraction

cyt b PCR – diagnostic rxn & amplification ctrl

restriction analysis DNA-sequencing

Page 14: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

cyt b-PCR – detection of pig by RFLP with AluI

conserved conserved

PCR-product is 359 bp long.

bands can be made visible by electrophoresis

AluI recognizes agct at position 114 - 117 and cuts there

ag ct

conserved conserved variable (species specific differences)

ag ct

fragment A 115 bp fragment B 244 bp

Page 15: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Imaging of cyt b-PCR and restriction

fragments on a agarosegel

verification of ampfliability of the

extracted DNA:

all samples result in a 359 bp

PCR product

separation of the restriction

fragments after cutting with AluI

and verification of species specific

gel bands

Sus scrofa f. domestica

Page 16: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Adaptation of the cyt b-primers to species

groups

• Primer mismatches in some

species: Galliformes,

Cervidae, Equidae, Bovidae

compared to humans, mouse

and pig resulting in reduced

sensitivity

– competitive assay

• Adaptations of primers at the

same molecular region to the

taxonomic orders or families

can overcome this

16

primers for Galliformes →

higher sensitivity for turkey

and chicken in mixed products

Page 17: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Conventional species specific PCR

• established for cattle and

sheep

• we use of single copy genes

to allow quantitative

estimations (year 2000)

– GnRH gene

• verification necessary, e.g.

by RFLP

• 1 % w/w as positive control

– 1 % beef in 99 % pork

– 1 % mutton in 99 % beef

17

Page 18: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Analysis of fish by

mitochondrial PCR

and RFLP resp. DNA

sequencing

• Official method in

Germany

• high amount of

fraudulent practices

esp. in restaurants

• amplification of

mitochondrial genes

and comparision with

Genbank or other

databases

18

Solea solea

mislabelledsamples

n=12

Page 19: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Practical cases – special applications

19

068

16

Pa

sta

Pe

nn

e B

olo

gn

ese

068

20

Sp

ag

hetti B

olo

gn

ese

06818 m

inced b

eef

with

hors

e m

eat

068

16

min

ced

bee

f

with

hors

e m

eat

hors

e c

ontro

l

Page 20: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Species detection of teeth

Request for species identification: Pig or Rat?

• cyt b-PCR:

– porcine DNA detected

– rat DNA not detectable

20

Page 21: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Analysis of a finger nail

21

• sample preparation is crucial: All DNA molecules on the surface need

to be removed or destroyed

• sequence analysis of ZFX/ZFY revealed that is was a man

Page 22: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

>gb|DQ309764.1| Canis familiaris cytochrome b (cytb) pseudogene, partial sequence;

nuclear copy of mitochondrial gene

Length=356

Score = 187 bits (101), Expect = 7e-45

Identities = 106/111 (95%), Gaps = 0/111 (0%)

Strand=Plus/Minus

Query 1 CATGGTAGGACGTAACCTATGAATGCTGTGGCTATGGTTGCAAAKAAGAGAATAATTCCA 60

|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||

Sbjct 335 CATGGTAGGACGTAACCTATGAATGCTGTGGCTATGGTTGCAAAGAAGAGAATAATTCCA 276

Query 61 ATATTTCATGTTTCTATGAATACRTAGGRGCCGTAGTATAAYCYTCATCCT 111

||||||||||||||||||||||| |||| |||||||||||| | |||||||

Sbjct 275 ATATTTCATGTTTCTATGAATACGTAGGAGCCGTAGTATAACCTTCATCCT 225

Detection of dog meat in a restaurant

22

Further sequence analysis of ZFX/ZFY revealed that is was a male dog

Page 23: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

further cases

• forensic assays differentiation between animal or

human blood

– criminologists found blood stained trousers

– Ovine blood or human blood?

– 2 methods used to verify the result: cyt b PCR and

species specific PCR

It was ovine blood.

• detection of mouse material in canned tomato

sauce

– The superior sensitivity of the cyt b PCR was very useful

as the DNA was partially degraded

– Verified by RFLP and DNA sequencing

23

Page 24: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Qualitative species detection - summary

Advantages

• cheap

• applicable to all species

• useful for very sensitive

analysis if necessary

• very helpful for food of a

single ingredient

– meat

– fish

– plant

24

Disadvantages

• too sensitive (in general)

– further quantification

required, or ELISA as

alternative method

• target taxon need to be

specified before

– If You do not look for

horsemeat, You won´t see

it if present in minor traces

as adapted cyt b primers or

specific assays are

necessary

Page 25: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Quantitative species detection by real-time PCR

• Quantitative real-time PCR

– detection of species

specific gene sequences

– limited sensitivity 0,1% • depends on amount and

quality of extracted DNA

– quantitative analysis is

most reliable as copy

number quantification

• DNA-content is tissue

specific fat<skeletal

muscle=connecting

tissue<entrails

25

Page 26: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Quantitative digital PCR

• droplet digital PCR (BioRad,

Raindance)

• digital PCR Chip (Fluidigm, Life

Technologies)

• digital PCR on a special microplate

(constellation system by

Formulatrix)

• allows absolute quantification

• no need for standard curves

• resistant to PCR inhibitors

26

Page 27: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

1st trial with the Constellation system from

Formulatrix (01.04.2015, not optimised)

27

species cattle pig sheep chicken turkey horse

525 580 1375 981 623 978

491 570 1442 1236 1128 1073

539 641 1287 897 1090 1031

582 704 1350 992 1000 978

533 545 843 1168 991 1118

552 598 1315 1201 957 1039 mean 537 606 1269 1079 965 1036

copies (by real-time PCR 2013)

500 500 1000 1000 1000 1000

deviation 7 % 21 % 27 % 8 % 4 % 4 %

Page 28: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Is quantification possible?

• single copy genes need to be chosen

• target taxon PCR systems should be as specific

as possible

– cross reactions between different equine species

• generic PCR systems should amplify mammals

and birds

• mass per mass is difficult to establish

– different tissue types contain different DNA amounts

• copy per copy approach overcomes this issue

28

Page 29: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

DNA content of different tissue types

29

Microscopic pictures: Liebich, HG: Funktionelle Histologie der Haussäugetiere. Stuttgart, New York: F.K. Schattauer Verlagsgesellschaft mbH 1999

Page 30: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

DNA content of different tissue types

30

Microscopic pictures: Liebich, HG: Funktionelle Histologie der Haussäugetiere. Stuttgart, New York: F.K. Schattauer Verlagsgesellschaft mbH 1999

tissue type DNA content

(mean and range)

skeletal muscle 100 (70-130) µg/g

connective tissue 100 (50-200) µg/g

fat tissue 40 (10-150) µg/g

liver 700 (600-800) µg/g

spleen 700 (550-850) µg/g

Page 31: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Why copy per copy?

• there is a different DNA content in different tissues

• composition of meat products and sausages is

highly heterogeneous

– different quantities of meat, fat, and entrails

• relatively independent from the quality of standard

material

– standard material need to be made available

Proposal: Laboratories should not determine the

very exact amount of ingredients, the point is that

every laboratory gets the same results.

31

Page 32: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Advantages of the quantitative approach

• no misinterpretation of traces

– cross contamination at retail

– <0,1 % - adventitious traces

– 0,1 % – 1% - on site checks requested to find out where

the species comes from

– >1% legal action

• tool for verification of the quantitative ingredient

declaration

32

European legislation should be harmonized

Page 33: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Limitations of the quantitative real-time PCR

• sampling protocols do not exist

• dynamic range is limited

– reliable quantification between 1 % and 50 %

• cross reactions

– closely related species: Cattle and buffalo, cattle and

Cervidae

• spectral overlap (cross talk) in multiplex assays

– What is crosstalk and what is positive in minor

amounts?

– A cut off value is NOT a scientifically based approach

33

Page 34: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Influence of reduced efficiency on Ct values

34

Relationship between the PCR product to initial template:

Nc = N (1+η)ν

Nc is the number of amplified molecules;

N is the initial number of the target molecules;

η is the efficiency of the system; ν is the number of amplification cycles.

In praxi, reduced

efficiency by minor

inhibitions cannot

be excluded.

This will lead to a

shift of the amplifi-

cation curve with

higher ct-valiues.

Page 35: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

lot size

1000 kg

Are there adventitious traces?

1. Industrial meat products are produced in big lots

2. slaughterhouses are highly specialized – there is not possibility for

adventitious contamination at industrial levels

35

10 kg (true to scale graphic)

• Amounts of <1 % are easily to

be seen in factories

• even small amounts could

have economical effects

Page 36: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Standardisation

36

national:

BS, AFNOR, NMKL, DIN, Ö-Norm, off.

methods collection …

European Standar-dization

CEN

International Standardization

ISO

Page 37: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Official methods available

• German official method collection

– BVL L 11.00-7: Identification of fish species in raw and

cooked foodstuffs (PCR-RFLP)

– BVL L 10.00-12: Fish species identification by sequence

analysis of cytochrome-b-sequences

– BVL L 12.01-3: Crustacean species determination in raw

crustacean and crustacean products by sequence analysis

of 16S rRNA sequences

– BVL L 06.26/27-2: Detection of horse-specific DNA

sequences in tinned meat products and verification by

restriction analysis

37

Page 38: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Further experiences with

method standardisation

• Failed method validation studies:

– Detection of poultry by a adapted cyt b PCR and restriction

analysis

• false positives due to chromosomal pseudogenes in some species

– Quantification of bovine DNA in meat products by real-time

PCR

• to high standard deviation between participants

• Currently under development: Multiplex real-time

PCR method for species identification

– high amount of cross reactions observed

Reliable species identification is highly demanding

38

Page 39: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Standardisation projects

within ISO TC 34 SC 16

• Iranian proposals for qualitative methods based on

conventional PCR:

– Species Identification of Meat and meat products by

Multiplex PCR

– Methods of analysis for the detection of Buffalo meat in

meat products

• no proper control for the amount and the quality of extracted DNA

• no molecular verification of results

• Chinese proposal

– Detection of animal derived materials in foodstuffs and

feedstuffs by real-time PCR

• mixture of mitochondrial or nuclear genome sequences – no reliable

quantification possible

39

Page 40: Species Identification - Landesamt für Verbraucherschutz · 2015-05-04 · Workshop Species Identification 14.04.15 Dietrich Mäde 11 bovine γ2 casein ovine γ2 casein bovine γ3

Workshop Species Identification 14.04.15 Dietrich Mäde

Conclusion

• Urgent need for harmonization of methods for

species identification

• Methodologies are applied for nearly 20 years in

routine diagnostics, however, due to the lack of

standardized principles a comparison of analytical

results is not always guaranteed

• Start of with simple standards and not with complex

multiplex protocols

• Methods should comprise both, sensitive qualitative

protocols and reliable quantitative protocols (the

latter based on the DNA content)

40