Society, Biology and ComputersSociety, Biology and Computers

Views from a Black Woman ScientistViews from a Black Woman Scientist

By Raquell HolmesBy Raquell Holmes

Research Asst. ProfessorCenter for Computational ScienceBoston University

Financial DirectorInstitute for African-American E-Culture

OverviewOverview Biology and SocietyBiology and Society

– Interests of a studentInterests of a student

Biology and ComputersBiology and Computers– A changing professionA changing profession

Computers and SocietyComputers and Society– Creating community and technologyCreating community and technology

Starting OutStarting Out High School Interests: High School Interests:

– Society, Math and BiologySociety, Math and Biology (Social arguments (Social arguments are often based on biology/science)are often based on biology/science)

College thinking: College thinking: – Jobs: Jobs: Biology, Math and Sociology Biology, Math and Sociology – Skills: Skills: Biology, SociologyBiology, Sociology– Money: Money: BiologyBiology

Biology in college: Biology in college: – Little math required, few societal discussionsLittle math required, few societal discussions

Starting OutStarting OutGraduate SchoolGraduate School: Cell Biology: Cell BiologyMammalian Ovary: Cell Signaling and AdhesionMammalian Ovary: Cell Signaling and Adhesion

Skills:Skills:General- inquiry, reading and General- inquiry, reading and

interpretationinterpretation

Math- basic calculations, some statistics Math- basic calculations, some statistics

Computation-use of commercial tools.Computation-use of commercial tools.

Needing MoreNeeding MorePersonal:Personal:

Create learning environmentsCreate learning environmentsIncrease role of technologyIncrease role of technologyIncrease social concernsIncrease social concerns

Job Market for Biologists-Job Market for Biologists-Fewer academic positions for Fewer academic positions for

experimentalistsexperimentalistsIncreased need for computationIncreased need for computation

Biology and ComputersBiology and Computers

New ways of approaching life sciences.

A New Way of Doing Science

Experiment

Theory

Computation

The “New Biology” Era

Biology is an increasingly interdisciplinary science.

The biggest revolutions in biology are emerging from engineering, technology & computer science.

Genomics & Bioinformatics

…………………...GGAAGAACAGGTATAAGCAATTCAATAATTATTGATGGACCATCTCCGTATGTGACAATTATACATAAAGACCCAAATGGAACTGTTCTAGATGATACACTAGCATTAAGAGAAAAATTCGAAGAATCAGTCGATAAATACAAACTTCATTTTACTGGATTAATCGCTGACAAAATTGCAAAAGAAAAACTGAATACTTACGTCCTCACTTATAAAAAAGCAGACGAAGCTATGCCTGCAGACGAAGCTATGCCAACTGATGTACCTAGTACTTCTGTTACTGGATCAACAATGGCAAACGAGCAACCAGAAACTCGTCCTGCAAAAATCGCTCAACCCGCGATGGAAGAGACAGATACTGCTCACATATCGGGATCTGAACCACAGGCTGATACAACACAAGCTGATACTTCAAATTCAGAAAGTGTTCCATCAGAGACAACTAAAACAGTGGCTGAAAATAATCCGCAAGAAAGTGCAACAGCAGAGAAAAACGAGCAAGAAGTCGCCGAGACAACACCTCAAAATGGAGAAGTTGCAAAAGAAGCTCAACCAACTGTAGAAGCTAGCACTCAAACAAATGAAGTCGCCCAAAATGGAAGCGAAAAAGA……. ……. ……. ……. …….

A genome can be viewed as a computer program….

Cell (Machine) DNA(Program)

Organism(Computer)

Bioinformatics premise: from codes to life

The conversionThe conversion Cell Biology--> BioinformaticsCell Biology--> Bioinformatics

– Biological data placed in databases.Biological data placed in databases.

– Computer Science, Computational Science and Computer Science, Computational Science and Biology in one.Biology in one.

Experimental--> Computational SkillsExperimental--> Computational Skills– modeling, database, programming, algorithmsmodeling, database, programming, algorithms

Training RequiredTraining RequiredModelingModeling

Mathematics Mathematics

statistics, linear algebra, differential equations.statistics, linear algebra, differential equations.

Computer Science Computer Science

programming languages- Pearl, Java, C+, C++programming languages- Pearl, Java, C+, C++

Biology Biology

ecology, genomics, genetics, biochemistry, cell ecology, genomics, genetics, biochemistry, cell and developmentaland developmental

Computers and SocietyComputers and Society

Who gets to play?

Full Participation in IT means…Full Participation in IT means…

CreationCreation DesignDesign DevelopmentDevelopment

Decision MakingDecision Making OwnershipOwnership

To research, develop, and deploy To research, develop, and deploy advanced information technologies in advanced information technologies in

concert with and in support of concert with and in support of African-American communitiesAfrican-American communities..

Institute for African American E-Culture

iAAEC is an IT Research CommunityiAAEC is an IT Research Community

Computer ScientistsComputer Scientists Educators and Education ResearchersEducators and Education Researchers Cognitive ScientistsCognitive Scientists Social ScientistsSocial Scientists EntrepreneursEntrepreneurs Youth and StudentsYouth and Students Community ActivistsCommunity Activists

Culture Specific ApproachesCulture Specific Approaches Research: creating culturally dependent IT Research: creating culturally dependent IT

that works to bridge Digital Divide.that works to bridge Digital Divide. Development: creating communities across Development: creating communities across

the Digital Divide that design, use and the Digital Divide that design, use and create technology.create technology.

iAAEC iAAEC IT Development Zones IT Development Zones

Create social and collaborative Create social and collaborative environments that support the development environments that support the development of communities that design, create, and of communities that design, create, and assess culture-specific IT.assess culture-specific IT.

One example is the High Performance One example is the High Performance Computing Lab Restoration Project. Computing Lab Restoration Project. http://family.bu.edu/hpcl/http://family.bu.edu/hpcl/