MUTANT SCREEN REPORT

Sleeping Beauty Transposon Mutagenesis as a Toolfor Gene Discovery in the NOD Mouse Model ofType 1 DiabetesColleen M. Elso,*,1 Edward P. F. Chu,*,†,1 May A. Alsayb,*,†,1 Leanne Mackin,* Sean T. Ivory,*Michelle P. Ashton,*,†,2 Stefan Bröer,‡ Pablo A. Silveira,§ and Thomas C. Brodnicki*,†,3

*Immunology and Diabetes Unit, St. Vincent’s Institute, Fitzroy, Victoria 3065, Australia, †Department of Medicine, Universityof Melbourne, Parkville, Victoria 3010, Australia, ‡Research School of Biology, The Australian National University, Canberra,ACT 2601, Australia, and §Dendritic Cell Research, ANZAC Research Institute, Concord, New South Wales 2139, Australia

ABSTRACT A number of different strategies have been used to identify genes for which genetic variationcontributes to type 1 diabetes (T1D) pathogenesis. Genetic studies in humans have identified.40 loci that affectthe risk for developing T1D, but the underlying causative alleles are often difficult to pinpoint or have subtlebiological effects. A complementary strategy to identifying “natural” alleles in the human population is to engi-neer “artificial” alleles within inbred mouse strains and determine their effect on T1D incidence. We describe theuse of the Sleeping Beauty (SB) transposon mutagenesis system in the nonobese diabetic (NOD) mouse strain,which harbors a genetic background predisposed to developing T1D. Mutagenesis in this system is random, but agreen fluorescent protein (GFP)-polyA gene trap within the SB transposon enables early detection of miceharboring transposon-disrupted genes. The SB transposon also acts as a molecular tag to, without additionalbreeding, efficiently identify mutated genes and prioritize mutant mice for further characterization. We show herethat the SB transposon is functional in NOD mice and can produce a null allele in a novel candidate gene thatincreases diabetes incidence. We propose that SB transposon mutagenesis could be used as a complementarystrategy to traditional methods to help identify genes that, when disrupted, affect T1D pathogenesis.

KEYWORDS

forward geneticsreverse geneticsSlc16a10Serinc1amino acidtransporter

Type 1 diabetes (T1D) is an autoimmune disease in which lympho-cytes mediate the specific destruction of insulin-producing pancre-atic b cells (Bluestone et al. 2010). Genetic studies in humanpopulations have detected .40 genomic intervals that harborT1D-associated alleles (Polychronakos and Li 2011; Pociot et al.2010). However, identification of the underlying genes for theseT1D loci and the biological effects of putative causative alleles isoften difficult due to genetic heterogeneity and limited tissue avail-ability (Polychronakos and Li 2011; Pociot et al. 2010). Instead, it

has proven useful to complement human genetic studies with strat-egies that not only aim to discover “naturally” occurring alleles butalso engineer “artificial” null alleles in putative and novel candidategenes to determine their effect on disease pathogenesis in inbredanimal models (Ermann and Glimcher 2012).

The nonobese diabetic (NOD) mouse strain, in particular, hasbeen widely used to investigate T1D pathogenesis (Driver et al. 2011;Jayasimhan et al. 2014). NOD mice spontaneously develop T1D, andgenetic studies have identified .40 murine T1D susceptibility loci[termed insulin-dependent diabetes (Idd) loci], several of which over-lap human T1D susceptibility loci (Burren et al. 2011). Although con-genic NOD mouse strains have confirmed the majority of these Iddloci, relatively few of the underlying genes and their causative alleleshave been definitively identified (Araki et al. 2009; Hamilton-Williamset al. 2001; Hung et al. 2006; Kissler et al. 2006; Laloraya et al. 2006;McGuire et al. 2009; Razavi et al. 2006; Tan et al. 2010; Yamanouchiet al. 2007). It has become apparent, however, that the NOD mousestrain has a combination of rare alleles (e.g., H2-Abg7) and commonalleles (e.g., H2-Enull and B2ma) for different genes that interact andincrease the risk for T1D (Driver et al. 2011; Ridgway et al. 2008).Intriguingly, some nondiabetic mouse strains harbor a more

Copyright © 2015 Elso et al.doi: 10.1534/g3.115.021709Manuscript received August 25, 2015; accepted for publication September 24,2015; published Early Online September 30, 2015.This is an open-access article distributed under the terms of the Creative CommonsAttribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/),which permits unrestricted use, distribution, and reproduction in any medium,provided the original work is properly cited.1These authors contributed equally to the work.2Present address: DFG Center for Regenerative Therapies, TechnischeUniversität Dresden, Dresden 01307, Germany.

3Corresponding author: Thomas C. Brodnicki, St. Vincent’s Institute, 41 VictoriaParade, Fitzroy, Victoria 3065, Australia. E-mail: tbrodnicki@svi.edu.au

Volume 5 | December 2015 | 2903

diabetogenic allele than NOD mice for a given Idd locus (Brodnickiet al. 2003; Wang et al. 2014; Ghosh et al. 1993; McAleer et al. 1995).This complex genetic architecture for T1D susceptibility in the Musspecies is similar to that described in humans and further complicatesthe identification of “natural” causative alleles within genes under-lying Idd loci using traditional outcross and congenic mouse studies(Driver et al. 2011; Ridgway et al. 2008).

Here, we propose an alternative approach for disease gene discoveryusing the Sleeping Beauty (SB) transposon mutagenesis system to gen-erate “artificial” alleles on the NOD genetic background. The SB trans-poson can insert within genes and disrupt transcript expression (Horieet al. 2003; Carlson et al. 2003; Ivics et al. 1997). Its unique sequencealso serves as a molecular tag to rapidly identify the site of insertionwithout additional breeding. Transposition (i.e., transposon “jump-ing”) is catalyzed by the SB transposase, which can be expressed intrans and controlled by tissue-specific promoters to restrict transposi-tion and subsequent gene mutation to germline or somatic cells. Onceactivated, transposition is relatively random, requiring only a target TAdinucleotide integration site and exhibiting some bias toward “jump-ing” in cis, i.e., within the same chromosome (Keng et al. 2005; Carlsonet al. 2003; Horie et al. 2003). A major advantage of the SB transposonis its ability to carry gene-trap elements and reporter genes, whichincrease gene disruption efficiency and accelerate identification of micewith a disrupted gene (Izsvak and Ivics 2004; Horie et al. 2003). Due tothese unique characteristics, this system has been successfully used tomutate and characterize both putative and novel genes in differentmouse models of cancer (Moriarity and Largaespada 2015; Dupuyet al. 2009). We show here that a relatively small-scale mutagenesisscreen using the SB transposon, combined with disease-specific prior-itization criteria, is able to identify a novel candidate gene that contrib-utes to T1D susceptibility in NOD mice.

MATERIALS AND METHODS

Constructs and production of transgenic and SBtransposon mutant miceThe transposase construct pRP1345 (Figure 1A) was obtained fromProf. R. Plasterk (Hubrecht Laboratory, TheNetherlands) and has beenpreviously described (Fischer et al. 2001). The transposon construct,

pTrans-SA-IRESLacZ-CAG-GFP_SD:Neo (Figure 1A), was obtainedfrom Prof. J. Takeda (Osaka University, Japan) and has been previouslydescribed (Horie et al. 2003). SB transposon and SB transposase trans-genic mice were produced by pronuclear injection of linearized con-structs into fertilized NOD/Lt (NOD) oocytes at The Walter and ElizaHall Institute Central Microinjection Service using a previously de-scribed protocol (Marshall et al. 2004). Transposon transgenic mouselines are NOD-TgTn(sb-Trans-SA-IRESLacZ-CAG-GFP-SD:Neo)1Tcband NOD-TgTn(sb-Trans-SA-IRESLacZ-CAG-GFP-SD:Neo)2Tcb, buthave been termed NOD-SBtson L1 and L2 in the text. Transposasetransgenic mouse lines are NOD-Tg(Prm-sb10)1Tcb and NOD-Tg(Prm-sb10)2Tcb, but have been termed NOD-PrmSB L1 and L2 inthe text. NOD-SBtson mice were mated to NOD-PrmSB mice anddouble-positive hemizygous male offspring (NOD-SBtson+/PrmSB+)were identified by PCR genotyping. NOD-SBtson+/PrmSB+males werebackcrossed to wild-type NOD females to produce G1 mice, carryingpotential transposon insertions. Mice carrying transposon insertions,which activated the polyA trap, were noninvasively identified by visu-alizing GFP expression in newborn mice under UV light with confir-mation by the presence of GFP fluorescence in ear biopsies using afluorescent stereomicroscope equipped with a UV filter. Experimentsinvolving mice were approved by the St. Vincent’s Institute AnimalEthics Committee.

Transposon copy number analysisSouthern blots were performed using standard protocols. An 898-bpprobe specific for GFP labeled witha-32P-dCTP using theDECAprimeII Random Priming DNA labeling kit (Ambion) was used to detect thepresence of the SB transposon. Copy number was calculated by com-parison with standards of known copy number.

Transposon insertion site identificationLigation-mediated PCR (LM-PCR) was performed based on previouslydescribed protocols (Largaespada and Collier 2008; Takeda et al. 2008;Horie et al. 2003; Devon et al. 1995). Briefly, 1 mg genomic DNA wasdigested with HaeIII, AluI, BfaI, or NlaIII (New England Biolabs),and splinkerettes (Table 1) compatible with appropriate blunt or co-hesive ends were ligated to the digested genomic DNA fragments usingT4 DNA ligase (New England Biolabs). The two oligonucleotides to

Figure 1 Sleeping Beauty transposon mutagenesisstrategy. (A) Constructs used for production of NOD-PrmSB and NOD-SBtson lines. The transposon con-struct, pTrans-SA-IRESLacZ-CAG-GFP_SD:Neo, hasbeen described (Horie et al. 2003). The transposaseconstruct pRP1345 comprising SB10 transposase drivenby the mouse proximal protamine 1 promoter has alsobeen described (Fischer et al. 2001). IR/DR: inverse re-peat/direct repeat transposase recognition motifs. (B)Breeding scheme for SB transposon mutagenesis.NOD-SBtson mice (lines 1 and 2) were mated toNOD-PrmSB mice (lines 1 and 2). Double positivemale offspring (seed mice) were backcrossed towild-type NOD females to produce G1 mice carryingpotential transposon insertions. (C) Mice carryingtransposon insertions that activated the polyA trapwere detected by fluorescence under UV light priorto weaning.

2904 | C. M. Elso et al.

produce the double-stranded splinkerette were annealed at a concen-tration of 50mM in the presence of 100 mMNaCl by incubating at 95�for 5min and then allowing themixture to cool to room temperature ina heat block before ligation. A second digest, with XhoI or KpnI, wasused to remove ligated splinkerettes from transposon concatemer frag-ments. DNA was purified after each step using QiaQuick PCR Purifi-cation kit (Qiagen). Two rounds of PCR were performed using nestedprimers within the linker and transposon (Table 1) with the subsequentPCR product sequenced. Restriction enzymes, splinkerettes, and pri-mers were used in the following six combinations (first digest; splin-kerette; second digest; primer set 1; primer set 2): (i) and (ii) AluI orHaeIII; SplB-BLT; XhoI; T/JBA · Spl-P1; TJBI · Spl-P2; (iii) and (iv)AluI or HaeIII; SplB-BLT; KpnI; TDR2 · Spl-P1; T/BAL · Spl-P2; (v)BfaI; Bfa linker; KpnI; LongIRDR(L2) · Linker primer; NewL1 · linkerprimer nested; and (vi)NlaIII; Nla linker;XhoI; LongIRDR(R) · Linkerprimer; KJC1 · Linker primer nested. The resulting sequence wasaligned to mouse genome build GRCm38 to identify the transposon-flanking genomic sequence (i.e., insertion site) and determine whichgene was disrupted based on current annotation for build GRCm38.The different combinations give a number of chances to identify ge-nomic DNA adjacent to both the 39 and 59 ends of the transposonafter transposition. Additional primers were designed for geno-typing the transposon insertion site in establishedmutant mouse lines(Table 2).

Gene expression analysisRNA was extracted from tissues using Trizol (Invitrogen) and cDNAwas synthesized using Superscript III (Invitrogen), both accordingto manufacturer’s instructions. For SB4 mice, RT-PCR was performedwith oligos specific for Slc16a10: Exon 1 forward: 59-GTGGTGCAACGGGTCGGTGT; Exon 2 reverse: 59-GACACTCACGATGGGGCAGCA; Exon 6 reverse: 59-ACAGAGCACAACACCCCCAACG;and Actb (forward: 59-CGGTTCCGATGCCCTGAG; reverse: 59-TGATCCACATCTGCTGGAAGG). For SB7 mice, RT-PCR was performed withprimers in GFP (59-CCCTGAGCAAAGACCCCAACGAGAAGC) andSerinc1 exon 1 (reverse: 59-TCGTCCTTTTTCTGGGCTTA) or exon 2(reverse: 59-ACTCCGACGAGCAAGAAAAG), followed by Sanger se-quencing of products. Transposase expression was determined usingquantitative real-time PCR using LightCycler Probe Master Reagent

(Roche Diagnostics) and the following primer/UPL probe combi-nation for SB transposase (SB10): Fwd: 59-ACCACGCAGCCGTCATAC; Rev: 59-CACCAAAGTACGTTCATCTCTAGG; UPLprobe #12: GGAAGGAG; and Hprt: Fwd: 59- TCCTCCTCAGACCGCTTTT; Rev: 59- CCTGGTTCATCATCGCTAATC; UPLprobe #95: AGTCCCAG. Data were normalized to Hprt expression.For SB7, Serinc1 expression was determined by quantitative real-time PCR (LightCycler480, Roche) with the following primer/probecombination for Serinc1: (Fwd: 59-GACGCGGCGGCGAT; Rev:59-GCATCGGCACAGCAAACAC; Taqman Probe: 59-GCTGGATTCCGTGTTT) and normalization was performed using Hprt(Taqman assay: Mm01545399_m1). Data were normalized to Hprtexpression.

Diabetes monitoringMice were tested once per week for elevated urinary glucose usingDiastix reagent strips (Bayer Diagnostics). Mice with a positive glycos-uria reading (.110 mmol/L) and confirmed by a positive glucosereading (.15 mmol/L), using Advantage II Glucose Strips (Roche),were diagnosed as diabetic.

Data availabilityMouse lines are available upon request.

RESULTS

Generation of transposition events in NOD mice usingSB transgenic NOD linesTo perform germline mutagenesis of the NODmouse, we used two SBconstructs previously used inmice (Figure 1A). The pRP1345 constructcontains the transposase gene under the control of the proximal prot-amine 1 (Prm1) promoter, which restricts expression to spermatogen-esis and limits transposon mutations to the germline, thus preventingsomatic mutations (Fischer et al. 2001). The SB transposon construct(sb-pTrans-SA-IRESLacZ-CAG-GFP-SD:Neo) contains splice acceptorand donor sequence motifs encompassing a promoter trap comprisingthe lacZ gene, and a polyA trap with the gene encoding enhanced greenfluorescent protein (GFP) driven by the CAG promoter (Horie et al.2003). This construct enables efficient identification of mutant mice in

n Table 1 Oligonucleotides used as splinkerettes and primers for LM-PCR

Namea Sequence Purposea

SplB-BLT CGAATCGTAACCGTTCGTACGAGAATCGCTGTCCTCTCCAACGAGCCAAGG SplinkeretteSpl-top CCTTGGCTCGTTTTTTTTGCAAAAA SplinkeretteNla linker+ GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG SplinkeretteNla linker- 59P-GTCCCTTAAGCGGAGCC-amino SplinkeretteBfa linker+ GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC SplinkeretteBfa linker- 59P-TAGTCCCTTAAGCGGAG-amino SplinkeretteSpl-P1 CGAATCGTAACCGTTCGTACGAGAA LM-PCRSpl-P2 TCGTACGAGAATCGCTGTCCTCTCC Nested LM-PCRT/JBA TAACTGACCTTAAGACAGGGAATCTTTAC LM-PCR (left)TJB1 TTTACTCGGATTAAATGTCAGGAATG Nested LM-PCR (left)TDR2 CTGGAATTGTGATACAGTGAATTATAAGTG LM-PCR (right)T/BAL CTTGTGTCATGCACAAAGTAGATGTCC Nested LM-PCR (right)LongIRDR(L2) CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC LM-PCR (left)NewL1 GACTTGTGTCATGCACAAAGTAGATGTCC Nested LM-PCR (left)LongIRDR(R) GCTTGTGGAAGGCTACTCGAAATGTTTGACCC LM-PCR (right)KJC1 CCACTGGGAATGTGATGAAAGAAATAAAAGC Nested LM-PCR (right)Linker primer GTAATACGACTCACTATAGGGC LM-PCRLinker primer nested AGGGCTCCGCTTAAGGGAC Nested LM-PCRa

Primer names and purpose are based on the previously described LM-PCR protocols (Keng et al. 2005; Largaespada and Collier 2008).

Volume 5 December 2015 | Transposon Mutagenesis in NOD Mice | 2905

which the transposon has inserted in a gene, as activation of the polyAtrap results in ubiquitous GFP expression, i.e., mutant mice fluoresce.

The transposase and transposon were introduced separately intoNOD mice to establish independent transgenic NOD lines for each SBcomponent. Briefly, SB transposon and SB transposase transgenic micewere produced by pronuclear injection of linearized constructs intofertilized NOD/Lt (NOD) oocytes. NOD-Tg(Prm-sb10) mice (calledNOD-PrmSB hereafter) harbor the transposase; and NOD-TgTn(sb-pTrans-SA-IRESLacZ-CAG-GFP-SD:Neo) mice (called NOD-SBtsonhereafter) harbor the transposon. The breeding scheme to generatemutant NOD mice is outlined in Figure 1B: mice from the two trans-genic lines are mated, bringing together the two components of the SBsystem, and transposition occurs within the sperm cells of the double-positive hemizygous “seed”males. These NOD seedmales are mated towild-type NOD females to generate G1 litters. G1 pups with potentialtransposon-disrupted genes are efficiently identified before weaning byvisualization of bodily GFP expression underUV light (Figure 1C). Thisearly detection allows cage space to beminimized; only those litters thatcontain fluorescent pups are weaned and kept for additional analysis.

To assess the feasibility of the SB mutagenesis system in the NODmouse strain, two NOD-SBtson lines were established for which thenumber of copies of the transposon within the transgene concatemerwas determined by Southern Blot analysis (Figure 2A) and the site oftransgene integration was determined by ligation-mediated PCR (LM-PCR) (Figure 2B). These lines were bred with two established NOD-PrmSB lines, in which expression of SB transposase in testes had beenconfirmed by quantitative RT-PCR (data not shown), to produce seedmales. NOD seed males (i.e., double-positive, hemizygous for both SBconstructs) were backcrossed to NOD females to produce G1 mice.Three different breeding combinations of transposon/transposasetransgenic strains gave rise to GFP-positive offspring at the rate of2.0%, 2.3%, and 2.7% respectively (Figure 2B). A fourth combinationdid not produce any mutant pups (0%), but breeding of this fourthcombination was stopped before reaching a similar total of G1 mice tothe other combinations (Figure 2B). Eleven GFP-positive G1 micewere sired, confirming that these transgenic lines can facilitate SBtransposition events on the NOD genetic background and resultantGFP-positive mice can be detected.

Identification and prioritization of transposition sites inGFP-positive G1 NOD miceLM-PCR followed by sequencing and genome alignment was used toidentify the transposition sites for nine of the 11 GFP-positive mice(Table 3). Of the two GFP-positive mice that were not determined, onedied before characterization. It was not clear why the second GFP-positive mouse was refractory to site identification by LM-PCR despiteusing six different restriction digest/PCR combinations. Consistentwith the published .30% rate of local chromosomal hopping (Kenget al. 2005), seven of the nine identified transposition sites fell on thesame chromosome as the transposon donor concatemer. Of the seveninsertion sites derived from the NOD-SBTsonL1 concatemer on chro-mosome (Chr) 10, five were on Chr10, with the other two identifiedon Chr1 and Chr4. The two insertion sites arising from the

NOD-SBTsonL2 concatemer on Chr1 were both mapped to Chr1.LM-PCR also indicated that each GFP-positive mouse contained asingle, rather than multiple, transposon insertion site.

Once GFP-positive NOD mice and their transposon mutations areidentified, there are two options. One option is to generate andmonitordiabetes onset in cohorts of mice from every GFP-positive G1 mouse.Although such a full-scale phenotype-driven approach is aimed atidentifying novel genes not suspected to play a role in diabetes, as wellas known and putative candidate genes, this option requires substantialanimal housing capacity andmonitoring numerous cohorts for diabetesover a .200-d time course. Like many investigators, we have limitedresources and this option was not feasible. However, the SB transposonmutagenesis strategy allows for a second option: prioritizing mutantmice based on the genes that are disrupted and establishing homozy-gousmutant lines for expression and diabetesmonitoring.We thereforeprioritized transposon-disrupted genes based on the following criteria:

1) The transposon insertion site is predicted to disrupt the gene insome way. Has the transposon inserted within an exon, an intron,or in a regulatory region? Is the mutation predicted to disrupt geneexpression? An insertion that is predicted to completely abrogateexpression of the normal gene product would be of high priority;however, in some instances a predicted hypomorphic allele mayalso be of value.

2) The gene is a known or putative candidate for a described mouseand/or human T1D susceptibility locus. T1D loci and candidategenes are curated in a searchable form at T1Dbase (https://t1dbase.org/) (Burren et al. 2011).

3) The gene, not previously considered as a putative T1D suscepti-bility gene, encodes a known protein involved in an immune-related molecular pathway that could affect T1D pathogenesis(e.g., cytokine or chemokine signaling/regulation, pattern recog-nition pathways, costimulatory molecules, apoptosis, regulation ofimmune tolerance), but is not likely required for general immunecell development.

4) The gene, not previously considered as a putative T1D suscepti-bility gene, is expressed in relevant cells (e.g., immune cell subsets,b cells) as determined in the first instance using gene expressiondatabases [e.g., Immunological Genome Project (https://www.immgen.org/)] (Heng et al. 2008) followed by additional expres-sion analyses if needed.

Of the nine transposon insertion sites identified (Table 3), only fourwere located within or nearby (within 5 kb) annotated genes orexpressed sequence tags (ESTs): SB4 in intron 1 of Slc16a10; SB7,4.6 kb 59 of Serinc1; SB8, 5 kb 59 of AK018981; and SB9 in intron 2 ofPard3b. In particular, the transposon within Pard3b inserted in theopposite orientation to the direction of transcription of the gene, so itseems unlikely that it would disrupt expression of Pard3b, which en-codes a cell polarity protein most highly expressed in the kidney(Kohjima et al. 2002). There is, however, an antisense gene, Pard3bos1,that overlaps Pard3b approximately 102 kb downstream of the trans-poson insertion site. Thus, it is more likely that the polyA gene-trap has

n Table 2 Oligonucleotides used as primers for genotyping SB4 and SB7 mice

Line Fwd Rev Size Allele

SB4 AGCCCAGAAGACAACCCTCTTGT AAAGGGGCGTGCGCTAAACA 123 bp WTSB4 CTTGTGTCATGCACAAAGTAGATGTCC AAAGGGGCGTGCGCTAAACA 224 bp SBSB7 ATTCCACCAGTGATGTGCTGGTAAC CCTTGAAATCATCCCGTGAGAGA 647 bp WTSB7 ATTCCACCAGTGATGTGCTGGTAAC CTTGTGTCATGCACAAAGTAGATGTCC 632 bp SB

2906 | C. M. Elso et al.

been activated by splicing into this antisense gene. The remaining fivetransposons inserted in regions currently without any annotated genes,suggesting either the presence of unannotated genes or the presence ofcryptic polyA sequence motifs as the GFP polyA trap was activated.

The followingobservationsweremade regarding theprioritizationofthe nine identified transposon insertion sites.Only one fell within aT1Dsusceptibility locus (Pard3bos1 in Idd5.1) (Burren et al. 2011), but un-fortunately this mouse (SB9) died before it could be bred. AK018981has no publicly available information except that it was sequenced fromRNA isolated from adult mouse testes. Both Serinc1 and Slc16a10 havebeen previously disrupted in mice: Serinc1 on a mixed C57BL/6 · 129genetic background (Tang et al. 2010) and Slc16a10 on a C57BL/6background (Mariotta et al. 2012). Neither knockout mouse strain

was reported to develop spontaneous disease. The strains either havenot been analyzed for immunological phenotypes (Slc16a10) or haveonly been analyzed in small cohorts (n # 4) with no differences ob-served (Serinc1). Despite this, Serinc1 and Slc16a10, although not di-rectly attributed in the literature with immune-related roles, havefunctions that could be postulated to affect immune cell responsesand/or b-cell activity, which could be revealed in the context of the“sensitized” NOD genetic background (i.e., the NOD mouse strainenables detection of mutated genes that increase or decrease diabetesincidence). Notably, both genes according to expression databases (TheImmunological Genome Project and BioGPS) (Heng et al. 2008; Wuet al. 2009) were highly expressed in macrophages, an immune cellpopulation with a key role in T1D pathogenesis (Driver et al. 2011;Jayasimhan et al. 2014). SB4 and SB7, which were both male G1 mice,did not carry the transposase construct; consequently, secondary jump-ing of the transposonwas not possible in their offspring. SB4 and SB7G1

mice were thus prioritized for establishment of new lines, bred to ho-mozygosity, and investigated for the effect of their transposon insertions.

Characterization of transposon effects in twoprioritized GFP-positive G1 NOD miceThe transposon insertion site in the SB7 mouse (NOD.Serinc1Tn(sb-Trans-SA-IRESLacZ-CAG-GFP-SD:Neo)1.7Tcb) localized 4.6 kb up-stream of Serinc1 (Table 3, Figure 3A). SERINC1 facilitates the syn-thesis of serine-derived lipids, including the essential membranelipids phosphatidylserine and sphingolipid (Inuzuka et al. 2005).These are important components of membrane structures knownas “ordered membrane domains” or “lipid rafts,” which are requiredfor appropriate signaling in immune cells (Szoor et al. 2010; Yabaset al. 2011). Due to the position of the transposon insertion, wepostulated that, rather than completely disrupting expression of Serinc1,the mutation may affect gene regulation. RT-PCR analysis of homozy-gous SB7 splenic RNA using primers within GFP and Serinc1 identifiedtwo fusion transcripts in addition to the normal transcript. The firstcontains GFP spliced to sequence upstream of exon 1 with normalsplicing of the entire gene. The second contains GFP spliced directlyto exon 2 of Serinc1 (Figure 3A). The skipped exon 1 encodes the first13 amino acids of the Serinc1 coding sequence. The production of anySERINC1 protein from these fusion transcripts is unlikely becausethere is a stop codon following the GFP sequence and no obviousinternal ribosomal entry site prior to the Serinc1 sequence, but thisstill remains to be tested. In either case, the presence of the transposon

Figure 2 Characterization of NOD-SBtson lines and frequency of GFP-positive G1 pups. (A) Transgene copy number in NOD-SBtson lineswas determined by Southern blot analysis using standard techniquesand an 898-bp probe specific for GFP that detected a 13.4-kb bandcontaining the transposon. Known amounts of transposon DNA wereused to generate a standard curve for determining copy number. (B)Site of transgene integration was determined by LM-PCR (coordinatesare based on genome build GRCm38). Number and percentage ofGFP+ offspring for each breeding combination is shown. aNumber ofcopies of the transposon in the donor concatemer, determined bySouthern blot as shown in (A). bOffspring generated from seed malesproduced by breeding NOD-SBtson lines with NOD-PrmSBL1. cOff-spring generated from seed males produced by breeding NOD-SBtson line with NOD-PrmSBL2.

n Table 3 Sleeping Beauty transposon insertion sites in GFP-positive G1 NOD mice

MutantMouse

NOD-SBtsonLine

NOD-PrmSBLine

Site of TranspositionInsertion (STI)a

Closest Gene inCorrect Orientation Gene Coordinatesa

Position of STI withRespect to Gene

SB1 L1 L1 chr4:19,247,537 Cnbd1 chr4:18,860,454-19,122,526 125 kb 59 of geneSB2 L1 L1 chr10:30,040,682 Rspo3 chr10:29,453,107-29,535,867 505 kb 59 of geneSB3 L1 L1 chr10:54,845,255 Msl3l2 chr10:56,106,917-56,116,880 1.2 Mb 59 of geneSB4 L1 L1 chr10:40,122,645 Slc16a10 chr10:40,033,535-40,142,254 Intron 1SB5c L1 L2 n.d. n.d. n.d. n.d.SB6 L1 L2 n.d. n.d. n.d. n.d.SB7 L1 L2 chr10:57,537,126 Serinc1 chr10:57,515,775-57,532,529 4.6 kb 59 of geneSB8c L1 L2 chr10:56,499,234 AK018981 chr10:56,504,501-56,505,287 5 kb 59 of geneSB9c L1 L2 chr1:61,954,348 Pard3bos1 chr1:61,767,415-61,851,462 102 kb 59 of geneb

SB10 L2 L2 chr1:49,094,718 C230029F24Rik chr1:49,244,616-49,340,431 150 kb 59SB11 L2 L2 chr1:48,800,150 Slc39a10 chr1:46,807,544-46,853,509 1.9 Mb 59 of genea

Coordinates are based on genome build GRCm38.b

The SB9 transposon site of integration falls within intron 2 of Pard3b in the opposite orientation.c

SB5, SB8, and SB9 mice died of unknown causes before homozygous lines could be established.n.d., not determined.

Volume 5 December 2015 | Transposon Mutagenesis in NOD Mice | 2907

insertion results in a relatively small, but significant, decrease inexpression of Serinc1 as measured by quantitative RT-PCR using aTaqman probe spanning the exon 1/2 splice junction (Figure 3B).This splice junction is used in both the “normal” Serinc1 and thefusion transcript that includes exon 1; therefore, the reduction in“normal” Serinc1 expression is greater than measured by this assay.These analyses suggest that, rather than completely disrupting expres-sion of Serinc1, this mutation modulates expression and represents ahypomorphic allele. Nonetheless, homozygous mutant SB7 miceexhibited a similar diabetes incidence compared to wild-type littermatefemales (Figure 3C), indicating that a minor reduction in Serinc1expression does not affect T1D pathogenesis.

The transposon insertion identified in the SB4 mouse (NOD.Slc16a10Tn(sb-Trans-SA-IRESLacZ-CAG-GFP-SD:Neo)1.4Tcb) localizes to intron 1of Slc16a10 (Table 3, Figure 4A), which encodes the aromatic aminoacid transporter SLC16A10 (also known as TAT1) (Mariotta et al.2012; Ramadan et al. 2006). It is becoming increasingly evident thatregulation of amino acid transport is crucial for the proper regulation ofimmune cell activation and function (Nakaya et al. 2014; Sinclair et al.2013; Thompson et al. 2008), and also impacts glycemic control (Jianget al. 2015).We predicted that the strong splice acceptor encoded by thetransposon would result in splicing from exon 1 of Slc16a10 into thetransposon sequence, thus truncating the Slc16a10 transcript. Expres-sion analysis of homozygous mutant SB4 mice showed that the

Slc16a10 transcript was not detected (Figure 4B), which was associatedwith a significant increase in diabetes incidence compared to wild-typelittermate females (Figure 4C). This result demonstrates that SB trans-poson mutagenesis can be used to identify novel genes that affect T1Dpathogenesis. Moreover, SB4 is a promising mutant mouse line forinvestigating the role of Slc16a10 and aromatic amino acid transportin macrophage function and the development of T1D in NOD mice.

DISCUSSIONWe demonstrate here that SB transposon mutagenesis can successfullygenerate both null and hypomorphic mutations in the NOD mouse. Asignificant advantage of this strategy is the use of the GFP reporter toscreen out, before weaning, those mice unlikely to be carrying a func-tional mutation, thereby significantly reducing mouse handling andhousing. Mutation sites can then be determined in individual GFP-positive mice and prioritized for further analysis based on the require-ments of the investigator. We used our prioritization criteria to selecttwo mutant NOD mice (SB4 and SB7) for further characterization andsubsequently found that disruption of Slc16a10 expression in NODmice resulted in an increased T1D incidence. Although further studiesare required to determine how Slc16a10 and amino acid transportcontributes to diabetes pathogenesis, this result indicates that SB trans-poson mutagenesis can be used as a complementary approach to otherT1D gene discovery strategies.

Figure 3 Analysis of Serinc1 expression and diabetes incidence in SB7 mutant mice. (A) Schematic diagrams of Serinc1 gene and transcripts withtransposon insertion. Serinc1 consists of nine exons and gives rise to a 2889-bp spliced transcript (top diagram). The transposon insertion occurs4.6 kb 59 of Serinc1. RT-PCR led to the identification of two fusion transcripts: one that splices from GFP (green) to sequence upstream of exon 1resulting in otherwise normal splicing of Serinc1 (middle diagram), and another that skips exon 1 (bottom diagram). (B) Expression analysis wasperformed using RNA isolated from tissues of wild-type (wt/wt) and homozygous mutant (sb/sb) littermates (n = 4). Expression was determined byquantitative real-time PCR. Exon locations of Serinc1 primers are indicated by arrows in (A). Error bars represent 6 SEM. Statistical significance forthe difference in expression was obtained using pairwise t-tests. (C) The cumulative diabetes incidence was determined for age-matched femalecohorts monitored concurrently. Pairwise comparisons of diabetes incidence curves were performed using the log-rank test.

2908 | C. M. Elso et al.

We observed 2–3% fluorescent G1 offspring, which is lower thanthat reported for a similar mutagenesis scheme using the same trans-poson construct (�7%) (Horie et al. 2003). If one aims for a singletransposition event per G1 offspring, it would be expected that�20% ofthe G1 offspring should fluoresce [i.e., �40% of the mouse genomecontains exons/introns (Sakharkar et al. 2005), with a 50% chance ofthe transposon landing in the correct orientation to trap the polyAsequence motif]. There are a number of possibilities that could explaina lower rate of fluorescent G1 offspring, pointing to improvements thatcan be made to our screen. The NOD-SBtson “mutator” transgeniclines we generated harbored few copies of the transposon. A highercopy number in the donor transposon concatemer may increase mu-tation efficiency due to more “jumping” transposons in the sperm ofNOD seed males (Geurts et al. 2006). Use of a more efficient trans-posase could also increase transposition efficiency. As the first de-scribed transposon for use in vertebrates, the SB system has been themost widely used and developed. Improvements from the first-generation SB transposases, such as that used in our study, have seen100-fold increases in transposition efficiency (Mates et al. 2009).

Trying to obtain too high of a mutation rate, however, is notnecessarily favorable. For example, increasing transposon copy numberby using transgenic mice with large transposon concatemers (.30copies) may lead to local chromosomal rearrangements in subsequentoffspring and complicate characterization of causative transposon mu-tations (Geurts et al. 2006). Increasing transposon number and/ortransposase efficiency will also lead to GFP-positive offspring withmultiple gene mutations. It would then require additional work toidentify and confirm all the gene mutations in a given mouse, as wellas additional breeding to segregate mutations and test mutant micewith only one gene mutation, all of which increases breeding times

and cage costs. Thus, an advantage of a lower efficiency is that it leadstomice with only one genemutation, eliminating the need for extensivesegregation analysis and facilitating more efficient gene identificationand prioritization. Although we did not establish and characterize allof our mutantmouse lines due to limited resources, cryopreservation ofsperm from mutant male mice could be used to allow archiving ofmutants for future investigation. Empirically, it will be up to an individuallaboratory to determine how many offspring they can efficiently screenand how they will prioritize mutant mice for subsequent analysis basedon the mutation rate of their transgenic lines and available resources.

Interestingly, several of our transposon insertion sites mapped toregions at some distance from annotated genes. Although it is possiblethat the GFP could be activated by splicing into a cryptic polyA site,polyA gene trap strategies have been successfully used to identify novelunannotated genes (Zambrowicz et al. 1998). However, it may be dif-ficult to predict a priori if an unannotated gene will be of interest,especially if it has little to no sequence homology with known genes.In this regard, the SB mutagenesis approach enables a phenotype-driven (i.e., forward genetics) approach to test novel genes that mightnot otherwise be targeted using a candidate gene approach (i.e., reversegenetics). SB mutagenesis may also benefit characterization of regions(e.g., Idd loci) that are known to contain putative susceptibility genes,but for which the “natural” causative alleles have not yet been identified.Saturation mutagenesis could effectively be performed in these regionsby generating a transgenic NOD mouse line containing a transposonconcatemer near the region of interest and taking advantage of thepropensity of SB transposons to reintegrate close to the donor trans-poson concatemer (Keng et al. 2005). Nonetheless, investigating un-annotated genes is riskier (i.e., the disrupted gene may not affect T1D)or more costly in the case of saturation mutagenesis (i.e., more mutant

Figure 4 Analysis of Slc16a10 expres-sion and diabetes incidence in SB4mutant mice. (A) Schematic diagramsof Slc16a10 gene and transcript withtransposon insertion. Slc16a10 con-sists of six exons and gives rise to a5394-bp spliced transcript (top dia-gram). The transposon insertion oc-curs within intron 1 and is predictedto prevent splicing between exons 1and 2, instead generating a truncatedtranscript [exon 1 - transposon (graybox)] and a transcript initiated by theCAG promoter and GFP gene [trans-poson (green box) - exon 2] (bottomdiagram). (B) Detection of transcriptexpression was performed by RT-PCR using RNA isolated from tissuesof wild-type (wt/wt) and homozygousmutant (sb/sb) littermates. Splicedproducts for exon 1/exon 2 or exon1/exon 6 were not detected in anytissues tested from homozygous mu-tant mice. Expression analysis is rep-resentative of three mice per genotype.(C) The cumulative diabetes incidencewas determined for age-matched fe-male cohorts monitored concurrently.Pairwise comparisons of diabetes in-cidence curves were performed usingthe log-rank test.

Volume 5 December 2015 | Transposon Mutagenesis in NOD Mice | 2909

lines need to be generated and characterized). Hence, prioritizing genesbased on function postulated to contribute to T1D pathogenesis may bemore favorable to most labs.

Transposon mutagenesis is one of a range of techniques that can beused to identify gene variants that affect development of T1D. Con-ventionally, “artificial” null alleles for candidate genes have been gen-erated in other strains and bred onto the NOD background by serialbackcrossing. This approach, however, results in the null allele beingencompassed by a “hitchhiking” congenic interval from the otherstrain, which may also affect T1D susceptibility (Simpfendorfer et al.2015; Armstrong et al. 2006; Leiter 2002; Kanagawa et al. 2000). Al-thoughNODES cell lines are available (Hanna et al. 2009; Nichols et al.2009; Ohta et al. 2009), there are relatively few reports of their use intargeting genes (Kamanaka et al. 2009; Morgan et al. 2013). Alterna-tively, random mutagenesis using N-ethyl-N-nitrosourea (ENU) doesnot require ES cells or prior knowledge about candidate genes. ENUmutagenesis, however, creates tens to hundreds of mutations permouse. Substantial breeding and sequencing, more than for SB trans-poson mutagenesis, would be required to segregate and test individualENU mutations for their effect on T1D susceptibility (Hoyne andGoodnow 2006). Finally, emerging gene-editing techniques using theCRISPR-Cas9 system (Ran et al. 2013) can facilitate hypothesis-driveninvestigation of known and putative candidate genes in NOD mice(Ran et al. 2013; Li et al. 2014). Modifications of the CRISPR-Cas9system also allow a range of strategies to be used, including the pro-duction of conditional alleles, insertion of reporters, activation or re-pression of alleles, and specific gene editing allowing the recreation ofparticular variants affecting immune function (Pelletier et al. 2015).Nonetheless, this approach requires genes to be specifically targeted,whereas SB transposon mutagenesis is random and may identify genesnot otherwise considered. Thus, a combination of different approachesfor gene discovery and characterization of allelic effects is available andwill likely prove useful for understanding the genetic architecture of T1D.

The increasing number of causative “natural” alleles identified inhuman populations and inbred mouse strains will undoubtedly aid ourunderstanding and prediction of genetic risk for T1D, as well as aidfuture clinical trials in selecting appropriate patient treatment groupsbased on their genetic profile (Bluestone et al. 2010; Polychronakos andLi 2011). Nonetheless, many of the identified T1D loci and underlyingcausative alleles have subtle biological effects that are not therapeuti-cally amenable or are difficult to investigate due to tissue availability.Generating random “artificial” null alleles in the NODmouse providesan alternative strategy to test and identify both putative and novel genesthat: (i) have larger diabetes effects when more grossly disrupted; (ii)represent potential drug targets; and (iii) are less likely to be identifiedin population-based studies of natural variation. The NOD mouseexhibits a number of immunological abnormalities that are associatedwith T1D pathogenesis and provides a “sensitized” background to in-vestigate the effect of artificial mutations upon the development of T1D(Driver et al. 2011; Ridgway et al. 2008; Jayasimhan et al. 2014). Ourstudy indicates that SB transposon mutagenesis in NOD mice is feasibleand provides a new strategy that combines the advantage of both forwardgenetics (randommutagenesis) and reverse genetics (gene prioritization)for the potential discovery of new genes that affect T1D pathogenesis.

ACKNOWLEDGMENTSWe thank J. Takeda and R. Plasterk for providing the transposon andtransposase constructs used in this study, S. Foote for advice, andH. Dashnow for technical assistance. Transgenic NOD mice weregenerated by The Walter & Eliza Hall Institute animal services facility.C.M.E was supported by Peter Doherty Fellowship 403037 from the

Australian National Health and Medical Research Council. E.P.F.C.was supported by a Melbourne International Research Scholarshipand St. Vincent’s Institute Research Scholarship. M.P.A. was sup-ported by an Australian Postgraduate Award. M.A.A. was supportedby the Ministry of Higher Education Scholarship, Saudi Arabia. Thiswork was funded by Innovative Grant 5-2007-620 from the JuvenileDiabetes Research Foundation International (T.C.B.), Project Grant1030865 from the Australian National Health and Medical ResearchCouncil (T.C.B., P.S., C.M.E.), and the Victorian Government’s Op-erational Infrastructure Support Program.

LITERATURE CITEDAraki, M., D. Chung, S. Liu, D. B. Rainbow, G. Chamberlain et al.,

2009 Genetic evidence that the differential expression of the ligand-independent isoform of CTLA-4 is the molecular basis of the Idd5.1 type 1diabetes region in nonobese diabetic mice. J. Immunol. 183: 5146–5157.

Armstrong, N. J., T. C. Brodnicki, and T. P. Speed, 2006 Mind the gap:analysis of marker-assisted breeding strategies for inbred mouse strains.Mamm. Genome 17: 273–287.

Bluestone, J. A., K. Herold, and G. Eisenbarth, 2010 Genetics, pathogenesisand clinical interventions in type 1 diabetes. Nature 464: 1293–1300.

Brodnicki, T. C., F. Quirk, and G. Morahan, 2003 A susceptibility allelefrom a non-diabetes-prone mouse strain accelerates diabetes in NODcongenic mice. Diabetes 52: 218–222.

Burren, O. S., E. C. Adlem, P. Achuthan, M. Christensen, R. M. Coulsonet al., 2011 T1DBase: update 2011, organization and presentation oflarge-scale data sets for type 1 diabetes research. Nucleic Acids Res. 39(Database issue): D997–D1001.

Carlson, C. M., A. J. Dupuy, S. Fritz, K. J. Roberg-Perez, C. F. Fletcher et al.,2003 Transposon mutagenesis of the mouse germline. Genetics 165: 243–256.

Devon, R. S., D. J. Porteous, and A. J. Brookes, 1995 Splinkerettes–improved vectorettes for greater efficiency in PCR walking. Nucleic AcidsRes. 23: 1644–1645.

Driver, J. P., D. V. Serreze, and Y. G. Chen, 2011 Mouse models for thestudy of autoimmune type 1 diabetes: a NOD to similarities and differ-ences to human disease. Semin. Immunopathol. 33: 67–87.

Dupuy, A. J., L. M. Rogers, J. Kim, K. Nannapaneni, T. K. Starr et al., 2009 Amodified Sleeping Beauty transposon system that can be used to model awide variety of human cancers in mice. Cancer Res. 69: 8150–8156.

Ermann, J., and L. H. Glimcher, 2012 After GWAS: mice to the rescue?Curr. Opin. Immunol. 24: 564–570.

Fischer, S. E., E. Wienholds, and R. H. Plasterk, 2001 Regulated transpo-sition of a fish transposon in the mouse germ line. Proc. Natl. Acad. Sci.USA 98: 6759–6764.

Geurts, A. M., L. S. Collier, J. L. Geurts, L. L. Oseth, M. L. Bell et al., 2006 Genemutations and genomic rearrangements in the mouse as a result of trans-poson mobilization from chromosomal concatemers. PLoS Genet. 2: e156.

Ghosh, S., S. M. Palmer, N. R. Rodrigues, H. J. Cordell, C. M. Hearne et al.,1993 Polygenic control of autoimmune diabetes in nonobese diabeticmice. Nat. Genet. 4: 404–409.

Hamilton-Williams, E. E., D. V. Serreze, B. Charlton, E. A. Johnson, M. P.Marron et al., 2001 Transgenic rescue implicates b2-microglobulin asa diabetes susceptibility gene in nonobese diabetic (NOD) mice.Proc. Natl. Acad. Sci. USA 98: 11533–11538.

Hanna, J., S. Markoulaki, M. Mitalipova, A. W. Cheng, J. P. Cassady et al.,2009 Metastable pluripotent states in NOD-mouse-derived ESCs. CellStem Cell 4: 513–524.

Heng, T.S., and M.W. Painter, and Immunological Genome ProjectConsortium, 2008 The Immunological Genome Project: networks ofgene expression in immune cells. Nat. Immunol. 9: 1091–1094.

Horie, K., K. Yusa, K. Yae, J. Odajima, S. E. Fischer et al.,2003 Characterization of Sleeping Beauty transposition and itsapplication to genetic screening in mice. Mol. Cell. Biol. 23: 9189–9207.

Hoyne, G. F., and C. C. Goodnow, 2006 The use of genomewide ENU muta-genesis screens to unravel complex mammalian traits: identifying genes thatregulate organ-specific and systemic autoimmunity. Immunol. Rev. 210: 27–39.

2910 | C. M. Elso et al.

Hung, M. S., P. Avner, and U. C. Rogner, 2006 Identification of the tran-scription factor Arntl2 as a candidate gene for the type 1 diabetes locusIdd6. Hum. Mol. Genet. 15: 2732–2742.

Inuzuka, M., M. Hayakawa, and T. Ingi, 2005 Serinc, an activity-regulatedprotein family, incorporates serine into membrane lipid synthesis. J. Biol.Chem. 280: 35776–35783.

Ivics, Z., P. B. Hackett, R. H. Plasterk, and Z. Izsvak, 1997 Molecularreconstruction of Sleeping Beauty, a Tc1-like transposon from fish, and itstransposition in human cells. Cell 91: 501–510.

Izsvak, Z., and Z. Ivics, 2004 Sleeping Beauty transposition: biology andapplications for molecular therapy. Mol. Ther. 9: 147–156.

Jayasimhan, A., K. P. Mansour, and R. M. Slattery, 2014 Advances in ourunderstanding of the pathophysiology of type 1 diabetes: lessons from theNOD mouse. Clin. Sci. (Lond.) 126: 1–18.

Jiang, Y., A. J. Rose, T. P. Sijmonsma, A. Broer, A. Pfenninger et al.,2015 Mice lacking neutral amino acid transporter B0AT1 (Slc6a19) haveelevated levels of FGF21 and GLP-1 and improved glycaemic control.Mol. Metab. 4: 406–417.

Kamanaka, M., D. Rainbow, K. Schuster-Gossler, E. E. Eynon, A. V.Chervonsky et al., 2009 Amino acid polymorphisms altering theglycosylation of IL-2 do not protect from type 1 diabetes in the NODmouse. Proc. Natl. Acad. Sci. USA 106: 11236–11240.

Kanagawa, O., G. Xu, A. Tevaarwerk, and B. A. Vaupel, 2000 Protection ofnonobese diabetic mice from diabetes by gene(s) closely linked to IFN-greceptor loci. J. Immunol. 164: 3919–3923.

Keng, V. W., K. Yae, T. Hayakawa, S. Mizuno, Y. Uno et al., 2005 Region-specific saturation germline mutagenesis in mice using the SleepingBeauty transposon system. Nat. Methods 2: 763–769.

Kissler, S., P. Stern, K. Takahashi, K. Hunter, L. B. Peterson et al., 2006 Invivo RNA interference demonstrates a role for Nramp1 in modifyingsusceptibility to type 1 diabetes. Nat. Genet. 38: 479–483.

Kohjima, M., Y. Noda, R. Takeya, N. Saito, K. Takeuchi et al.,2002 PAR3beta, a novel homologue of the cell polarity protein PAR3,localizes to tight junctions. Biochem. Biophys. Res. Commun. 299: 641–646.

Laloraya, M., A. Davoodi-Semiromi, G. P. Kumar, M. McDuffie, and J. X.She, 2006 Impaired Crkl expression contributes to the defective DNAbinding of Stat5b in nonobese diabetic mice. Diabetes 55: 734–741.

Largaespada, D. A., and L. S. Collier, 2008 Transposon-mediated muta-genesis in somatic cells: identification of transposon-genomic DNAjunctions. Methods Mol. Biol. 435: 95–108.

Leiter, E. H., 2002 Mice with targeted gene disruptions or gene insertionsfor diabetes research: problems, pitfalls, and potential solutions.Diabetologia 45: 296–308.

Li, F., D. O. Cowley, D. Banner, E. Holle, L. Zhang et al., 2014 Efficient geneticmanipulation of the NOD-Rag12/2IL2RgammaC-null mouse by combiningin vitro fertilization and CRISPR/Cas9 technology. Sci. Rep. 4: 5290.

Mariotta, L., T. Ramadan, D. Singer, A. Guetg, B. Herzog et al., 2012 T-typeamino acid transporter TAT1 (Slc16a10) is essential for extracellular aro-matic amino acid homeostasis control. J. Physiol. 590(Pt 24): 6413–6424.

Marshall, V. M., J. Allison, T. Templeton, and S. J. Foote, 2004 Generationof BAC transgenic mice. Methods Mol. Biol. 256: 159–182.

Mates, L., M. K. Chuah, E. Belay, B. Jerchow, N. Manoj et al., 2009 Molecularevolution of a novel hyperactive Sleeping Beauty transposase enables robuststable gene transfer in vertebrates. Nat. Genet. 41: 753–761.

McAleer, M. A., P. Reifsnyder, S. M. Palmer, M. Prochazka, J. M. Love et al.,1995 Crosses of NOD mice with the related NON strain. A polygenicmodel for IDDM. Diabetes 44: 1186–1195.

McGuire, H. M., A. Vogelzang, N. Hill, M. Flodstrom-Tullberg, J. Sprentet al., 2009 Loss of parity between IL-2 and IL-21 in the NOD Idd3locus. Proc. Natl. Acad. Sci. USA 106: 19438–19443.

Morgan, M. A., P. S. Muller, A. Mould, S. A. Newland, J. Nichols et al.,2013 The nonconventional MHC class II molecule DM governsdiabetes susceptibility in NOD mice. PLoS One 8: e56738.

Moriarity, B. S., and D. A. Largaespada, 2015 Sleeping Beauty transposoninsertional mutagenesis based mouse models for cancer gene discovery.Curr. Opin. Genet. Dev. 30: 66–72.

Nakaya, M., Y. Xiao, X. Zhou, J. H. Chang, M. Chang et al., 2014 InflammatoryT cell responses rely on amino acid transporter ASCT2 facilitation of glu-tamine uptake and mTORC1 kinase activation. Immunity 40: 692–705.

Nichols, J., K. Jones, J. M. Phillips, S. A. Newland, M. Roode et al.,2009 Validated germline-competent embryonic stem cell lines fromnonobese diabetic mice. Nat. Med. 15: 814–818.

Ohta, H., Y. Ohinata, M. Ikawa, Y. Morioka, Y. Sakaide et al., 2009 Male germlineand embryonic stem cell lines from NOD mice: efficient derivation of GS cellsfrom a nonpermissive strain for ES cell derivation. Biol. Reprod. 81: 1147–1153.

Pelletier, S., S. Gingras, and D. R. Green, 2015 Mouse genome engineeringvia CRISPR-Cas9 for study of immune function. Immunity 42: 18–27.

Pociot, F., B. Akolkar, P. Concannon, H. A. Erlich, C. Julier et al.,2010 Genetics of type 1 diabetes: what’s next? Diabetes 59: 1561–1571.

Polychronakos, C., and Q. Li, 2011 Understanding type 1 diabetes throughgenetics: advances and prospects. Nat. Rev. Genet. 12: 781–792.

Ramadan, T., S. M. Camargo, V. Summa, P. Hunziker, S. Chesnov et al.,2006 Basolateral aromatic amino acid transporter TAT1 (Slc16a10)functions as an efflux pathway. J. Cell. Physiol. 206: 771–779.

Ran, F. A., P. D. Hsu, J. Wright, V. Agarwala, D. A. Scott et al., 2013 Genomeengineering using the CRISPR-Cas9 system. Nat. Protoc. 8: 2281–2308.

Razavi, R., Y. Chan, F. N. Afifiyan, X. J. Liu, X. Wan et al., 2006 TRPV1+sensory neurons control b cell stress and islet inflammation in autoim-mune disease. Cell 127: 1123–1135.

Ridgway, W. M., L. B. Peterson, J. A. Todd, D. B. Rainbow, B. Healy et al.,2008 Gene-gene interactions in the NOD mouse model of type 1diabetes. Adv. Immunol. 100: 151–175.

Sakharkar, M. K., B. S. Perumal, K. R. Sakharkar, and P. Kangueane,2005 An analysis on gene architecture in human and mouse genomes.In Silico Biol. 5: 347–365.

Simpfendorfer, K. R., R. A. Strugnell, T. C. Brodnicki, and O. L. Wijburg,2015 Increased autoimmune diabetes in pIgR-deficient NOD miceis due to a “Hitchhiking” interval that refines the genetic effect of Idd5.4.PLoS One 10: e0121979.

Sinclair, L. V., J. Rolf, E. Emslie, Y. B. Shi, P. M. Taylor et al., 2013 Control ofamino-acid transport by antigen receptors coordinates the metabolic re-programming essential for T cell differentiation. Nat. Immunol. 14: 500–508.

Szoor, A., J. Szollosi, and G. Vereb, 2010 Rafts and the battleships ofdefense: the multifaceted microdomains for positive and negative signalsin immune cells. Immunol. Lett. 130: 2–12.

Takeda, J., Z. Izsvak, and Z. Ivics, 2008 Insertional mutagenesis of the mousegermline with Sleeping Beauty transposition. Methods Mol. Biol. 435: 109–125.

Tan, I. K., L. Mackin, N. Wang, A. T. Papenfuss, C. M. Elso et al., 2010 Arecombination hotspot leads to sequence variability within a novel gene(AK005651) and contributes to type 1 diabetes susceptibility. GenomeRes. 20: 1629–1638.

Tang, T., L. Li, J. Tang, Y. Li, W. Y. Lin et al., 2010 A mouse knockout libraryfor secreted and transmembrane proteins. Nat. Biotechnol. 28: 749–755.

Thompson, R. W., J. T. Pesce, T. Ramalingam, M. S. Wilson, S. White et al.,2008 Cationic amino acid transporter-2 regulates immunity by modu-lating arginase activity. PLoS Pathog. 4: e1000023.

Wang, N., C. M. Elso, L. Mackin, S. I. Mannering, R. A. Strugnell et al.,2014 Congenic mice reveal genetic epistasis and overlapping disease locifor autoimmune diabetes and listeriosis. Immunogenetics 66: 501–506.

Wu, C., C. Orozco, J. Boyer, M. Leglise, J. Goodale et al., 2009 BioGPS: anextensible and customizable portal for querying and organizing geneannotation resources. Genome Biol. 10: R130.

Yabas, M., C. E. Teh, S. Frankenreiter, D. Lal, C. M. Roots et al.,2011 ATP11C is critical for the internalization of phosphatidylserineand differentiation of B lymphocytes. Nat. Immunol. 12: 441–449.

Yamanouchi, J., D. Rainbow, P. Serra, S. Howlett, K. Hunter et al.,2007 Interleukin-2 gene variation impairs regulatory T cell functionand causes autoimmunity. Nat. Genet. 39: 329–337.

Zambrowicz, B. P., G. A. Friedrich, E. C. Buxton, S. L. Lilleberg, C. Personet al., 1998 Disruption and sequence identification of 2,000 genes inmouse embryonic stem cells. Nature 392: 608–611.

Communicating editor: I. M. Hall

Volume 5 December 2015 | Transposon Mutagenesis in NOD Mice | 2911