Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop...
-
Upload
quentin-ethelbert-blair -
Category
Documents
-
view
215 -
download
0
Transcript of Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop...
![Page 1: Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series.](https://reader031.fdocuments.net/reader031/viewer/2022032723/56649d175503460f949ecece/html5/thumbnails/1.jpg)
Single Nucleotide Polymorphisms
Jennifer Lyon
Eskind Biomedical Library
May 1, 2009
CRC Workshop Series
![Page 2: Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series.](https://reader031.fdocuments.net/reader031/viewer/2022032723/56649d175503460f949ecece/html5/thumbnails/2.jpg)
Types of Genetic Variations
• Single Nucleotide Polymorphisms (SNP)
– Single base pair changes
GTCATTCGATT
GTCAGTCGATT
• Indels
– Small insertion/deletions
CTT------GATC
CTTACGGATC
• Small variable repeats – microsatellites
– ACGACGACGACGACGACG (6 copies)
– ACGACGACGACGACGACGACG (7 copies)
• Variable Long tandem repeats (can be dozens to hundreds to thousands)
• Chromosomal Aberrations: Translocations, Inversions, etc.
![Page 3: Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series.](https://reader031.fdocuments.net/reader031/viewer/2022032723/56649d175503460f949ecece/html5/thumbnails/3.jpg)
Focusing on SNPs
• Types of SNPs• SNP nomenclature• Resources for SNPs• Examples and Challenges in Finding SNPs
http://learn.genetics.utah.edu/content/health/pharma/snips/
![Page 4: Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series.](https://reader031.fdocuments.net/reader031/viewer/2022032723/56649d175503460f949ecece/html5/thumbnails/4.jpg)
SNPs Types
• SNPs can be categorized in a number of ways, the most common are by location and function (relative to a gene)
• Intragenic SNPs are often categorized by function – are they in a coding region, an intron, part of the mRNA, outside the mRNA but still in the gene locus (i.e., in the promoter)
• Extragenic SNPs may be considered simply ‘genomic’ or might be labeled relative to the nearest gene, ie. 5’ or 3’ to a gene
An ‘extragenic’ SNP may affect regulatory regions important in gene expression or other DNA functions such as DNA replication.
![Page 5: Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series.](https://reader031.fdocuments.net/reader031/viewer/2022032723/56649d175503460f949ecece/html5/thumbnails/5.jpg)
SNP Functional Categories
• coding nonsynonymous– Missense, nonsense, frame shift
• coding synonymous• Intronic
– splice site
• mRNA utr– 5' utr or 3' utr
• (gene) locus region (5’ or 3’ to the gene)– ‘near gene’ usually means within ~2000bp of gene
• genomic/extragenic (distant from any gene)
![Page 6: Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series.](https://reader031.fdocuments.net/reader031/viewer/2022032723/56649d175503460f949ecece/html5/thumbnails/6.jpg)
Coding Nonsynonymous SNPs
Missense – change an aa
http://www.ncbi.nlm.nih.gov/Class/NAWBIS/Modules/Variation/powerpoint/variation_files/frame.html
![Page 7: Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series.](https://reader031.fdocuments.net/reader031/viewer/2022032723/56649d175503460f949ecece/html5/thumbnails/7.jpg)
Coding Non-Synonymous SNPs
• Nonsense– Change an aa to a stop codon– Results in a shortened protein
• Frame Shift– Are really single-base indels– Drop or add one base and the triplet reading frame is
thrown out of shift, altering all downstream aa’s and usually resulting in an earlier stop codon
![Page 8: Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series.](https://reader031.fdocuments.net/reader031/viewer/2022032723/56649d175503460f949ecece/html5/thumbnails/8.jpg)
SNP Nomenclature
• The Human Genome Variation Society (http://www.hgvs.org/mutnomen/recs.html) has proposed some guidelines for SNP nomenclature, but at the moment, there is minimal consistency.
• Different sources will refer to the same SNP in different ways
• While dbSNP identifiers (rs#12345678) are becoming common, they are not required of publishing authors and not used in all cases.
![Page 9: Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series.](https://reader031.fdocuments.net/reader031/viewer/2022032723/56649d175503460f949ecece/html5/thumbnails/9.jpg)
SNPs at Base-Pair Level
• The base-pair change is given in various forms:
A/C T→G C>T 432G>C T73C
The HGVS nomenclature recommendations:
"c." for a coding DNA sequence (like c.76A>T) "g." for a genomic sequence (like g.476A>T) "m." for a mitochondrial sequence (like m.8993T>C
"r." for an RNA sequence (like r.76a>u)
![Page 10: Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series.](https://reader031.fdocuments.net/reader031/viewer/2022032723/56649d175503460f949ecece/html5/thumbnails/10.jpg)
Position, position, position!
• The big issue with SNPs is identifying their location (numerically).
• Position can be specified:– Number location within a specific sequence– Relative to another genetic landmark
• Start site for a coding region of a gene• Start or end of an exon or intron• Relative to a marker
• Published articles are not always clear on this!!!• Different resources may use different
landmarks/numbering• Numbering is always relative to the chosen
sequence
![Page 11: Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series.](https://reader031.fdocuments.net/reader031/viewer/2022032723/56649d175503460f949ecece/html5/thumbnails/11.jpg)
Coding SNPs
• These are easier because they can be identified by the amino acid position rather than the base-pair position
• Most common nomenclature uses either 3-letter or single amino acid codes:
Asn332Asp OR A95V• The HGVS recommendation is similar:
"p." for a protein sequence (like p.Lys76Asn)• Amino Acid (protein) coding sequence positions
becoming more consistent, but are not always consistent
![Page 12: Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series.](https://reader031.fdocuments.net/reader031/viewer/2022032723/56649d175503460f949ecece/html5/thumbnails/12.jpg)
Database of SNPs (dbSNP)
dbSNP • is the international central repository for both
single base nucleotide substitutions and short deletion and insertion polymorphisms
• accepts data submissions from scientists • is integrated with the NCBI’s Entrez system
![Page 13: Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series.](https://reader031.fdocuments.net/reader031/viewer/2022032723/56649d175503460f949ecece/html5/thumbnails/13.jpg)
dbSNP Content
The SNP database has two major classes of content:
• Submitted data, i.e., original observations of sequence variation: Submitted SNPs (SS) with ss# (ss 5586300)
• Computed/curated data: Reference SNP Clusters (Ref SNP) with rs# (rs 4986582)
![Page 14: Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series.](https://reader031.fdocuments.net/reader031/viewer/2022032723/56649d175503460f949ecece/html5/thumbnails/14.jpg)
Reference SNP Clusters
• Ref SNP clusters are computer-generated and curated by NCBI staff
• Ref SNP Clusters define a non-redundant set of SNPs
• All individual SNPs submitted by a researcher are given a submitter SNP number (ss#) and then redundant (repetitive) submitter SNPs are combined into a RefSNP cluster record, with a unique rs#
• Ref SNP clusters may contain multiple submitted SNPs
![Page 15: Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series.](https://reader031.fdocuments.net/reader031/viewer/2022032723/56649d175503460f949ecece/html5/thumbnails/15.jpg)
Searching dbSNP
• dbSNP is searched like any other Entrez db• Specialized fields include:Field Tag Notes
Allele [Allele] Uses IUPAC codes for bases
Chromosomal Location [CHRPOS] Uses chromosomal base-pair locations
Contig Position [ctpos] Uses contig base-pair locations
Function Class [Func] Includes coding synonymous, missense, nonsense, intron, utr, etc.
SNP Class [SNP_Class] Includes snp, indel, mixed
![Page 16: Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series.](https://reader031.fdocuments.net/reader031/viewer/2022032723/56649d175503460f949ecece/html5/thumbnails/16.jpg)
SNP Limits Page
![Page 17: Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series.](https://reader031.fdocuments.net/reader031/viewer/2022032723/56649d175503460f949ecece/html5/thumbnails/17.jpg)
Creating a Complex Search
Retrieve all synonymous coding reference SNPs for the human norepinephrine transporter gene (Slc6a2) from dbSNP
Search Strategy:
human[orgn] AND Slc6a2[gene] AND “coding synonymous” [FUNC]
Note: To use the [gene] (gene name) field, it is necessary to have the official gene name or gene symbol as per the Human Gene Nomenclature Committee. Entrez Gene can be used to find these.
![Page 18: Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series.](https://reader031.fdocuments.net/reader031/viewer/2022032723/56649d175503460f949ecece/html5/thumbnails/18.jpg)
dbSNP Output – Graphical Display
![Page 19: Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series.](https://reader031.fdocuments.net/reader031/viewer/2022032723/56649d175503460f949ecece/html5/thumbnails/19.jpg)
dbSNP - Live
• Let’s look at a dbSNP reference SNP page:
• http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?rs=3743788
![Page 20: Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series.](https://reader031.fdocuments.net/reader031/viewer/2022032723/56649d175503460f949ecece/html5/thumbnails/20.jpg)
Finding SNPs - Challenges
• If rs# is available – start with it• Not all rs#s have information in all databases• Another database of interest is the Online
Mendelian Inheritance in Man (OMIM)• OMIM doesn’t always provide rs#s even when
there is one• dbSNP records may link to OMIM or may not,
even if the SNP is in an OMIM record
![Page 21: Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series.](https://reader031.fdocuments.net/reader031/viewer/2022032723/56649d175503460f949ecece/html5/thumbnails/21.jpg)
Example 1
• rs1800888• (C>T) → Ile164Thr in ADRB2 gene• HGVS nomenclature
– NP_000015.1:p.T164I
To Find in OMIM• Search with rs1800888 – yield nothing• Search with ADRB2[gene] – find record• Look at allelic variants: .0003 BETA-2-
ADRENORECEPTOR AGONIST, REDUCED RESPONSE TO [ADRB2, THR164ILE ]
• It is a match
![Page 22: Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series.](https://reader031.fdocuments.net/reader031/viewer/2022032723/56649d175503460f949ecece/html5/thumbnails/22.jpg)
Example 2
• rs2740574• A/G SNP located 5’ to CYP3A4• HGVS nomenclature:
– NT_007933.14:g.24616372C>T
To find in OMIM• Search with rs2740574 yields nothing• Search with gene name CYP3A4 – find record• Find list of allelic variants - .0001 CYP3A4
PROMOTER POLYMORPHISM [CYP3A4, a-g PROMOTER]
• Compare info in dbSNP to info in OMIM (look at sequence)
![Page 23: Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series.](https://reader031.fdocuments.net/reader031/viewer/2022032723/56649d175503460f949ecece/html5/thumbnails/23.jpg)
Other Databases
• OMIM – NCBI• HapMap - International HapMap Project• ALFRED – Allele Frequence Databases• HGVbaseG2P - Human Genome Variation
database of Genotype-to-Phenotype information
• PharmGKB – Pharmacogenomics Knowledgebase
• F-SNP – Functional SNPs