Simultaneously typing nine serotypes of enteroviruses associated ...
Transcript of Simultaneously typing nine serotypes of enteroviruses associated ...
1
Simultaneously typing nine serotypes of enteroviruses 1
associated with hand, foot and mouth disease by a GeXP 2
anaylizer-based multiplex RT-PCR assay 3
4
Xiumei Hu,1, 2† Yong Zhang,1† Xiaomian Zhou,2† Banglao Xu,2 Mengjie Yang,1 5
Miao Wang,1 Chen Zhang,1 Jin Li,1 Ruyin Bai,1 Wenbo Xu,1* and Xuejun Ma1* 6
State Key Laboratory for Genetic Engineering and Molecular Virology, National 7
Institute for Viral Disease Control and Prevention, Chinese Center for Disease 8
Control and Prevention, No.155, Changbai Road, Changping district, Beijing, 102206, 9
People’s Republic of China1; Clinical Laboratory of Guangzhou First Municipal 10
People's Hospital, Affiliated Hospital of Guangzhou Medical College, No. 1, Panfu 11
Road, Yuexiu district, Guangzhou, 510180, People’s Republic of China2 12
13
Running Title: Typing enteroviruses by GeXP anaylizer 14
15
* Corresponding authors. Mailing address for X. Ma: Department of Core Facility, 16
National Institute for Viral Disease Control and Prevention, Chinese Center for 17
Disease Control and Prevention, No. 155, Changbai Road, Changping district, Beijing, 18
102206, People’s Republic of China. Phone: 86-10-58900810. Fax: 86-10-58900810. 19
E-mail to X. Ma: [email protected]; 20
E-mail to W. Xu: [email protected]. 21
† Xiumei Hu, Yong Zhang and Xiaomian Zhou contributed equally to the study 22
Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Clin. Microbiol. doi:10.1128/JCM.05828-11 JCM Accepts, published online ahead of print on 23 November 2011
on March 13, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
2
ABSTRACT 23
Hand, foot and mouth disease (HFMD) is a contagious enteroviral disease 24
occurring primarily in young children caused by enterovirus 71 (EV71), 25
coxsackievirus A16 (CVA16) and other serotypes of coxsackievirus and echovirus. In 26
this study, a GeXP analyzer-based multiplex RT-PCR assay (GeXP assay) consisting 27
of chimeric primer-based fluorescently labeled PCR amplification and capillary 28
electrophoresis separation was developed to simultaneously identify nine serotypes of 29
enteroviruses associated with HFMD in China, including EV71, CVA16, CVA4, 5, 9, 30
10, CVB1, 3 and 5. The RNAs extracted from cell cultures of viral isolates and 31
synthetic RNAs via in vitro transcription were used to analyze the specificity and 32
sensitivity of the assay. The GeXP assay detected as few as 0.03 TCID50 of EV71 and 33
CVA16, 10 copies of pan-enterovirus, EV71, CVA16, CVB1, CVB5, and 100 copies 34
of ten (including pan-enterovirus) pre-mixed RNAs templates. A total of 180 stool 35
specimens collected from HFMD patients and suspects were adopted to evaluate the 36
clinical performance. In comparison with the results of conventional methods, the 37
sensitivities of the GeXP assay for detection of pan-enterovirus, EV71 and CVA16 38
were 98.79% (163/165), 91.67% (44/48) and 91.67% (33/36), respectively, and the 39
specificities were 80.00% (12/15), 98.48% (130/132) and 100% (144/144), 40
respectively. The accordance of typing other 7 serotypes of enteroviruses with the 41
results of conventional methods was 92.59% (25/27). In conclusion, the GeXP assay is 42
a rapid, cost-effective and high throughput method for typing nine serotypes of 43
HFMD associated enteroviruses. 44
INTRODUCTION 45
Hand, foot and mouth disease (HFMD) is a common acute enteroviral infectious 46
disease, which usually affects infants and young children below 10 years old, 47
on March 13, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
3
characterized by a brief febrile illness and vesicular rash and cutaneous vesicles on the 48
hands, feet, mouth and buttocks. Some complications such as myocarditis, aseptic 49
meningitis, encephalitis, pulmonary edema, circulatory disturbance and even death 50
have appeared in minority patients (3, 8, 22). HFMD is caused by enteroviruses, 51
members of the Picornavirus family (single stranded RNA, non-enveloped) and is most 52
commonly associated with coxsackievirus A16 (CVA16) and human enterovirus 71 53
(EV71) (12). Other members including CVA2, CVA4 to CVA6, CVA9, CVA10, 54
CVB1 to CVB3, CVB5 (1, 3, 5-6, 10, 14, 23) and partial echovirus (ECHO) (2, 9, 22, 55
32) have also been associated with outbreaks or sporadic cases of HFMD. 56
The identification and serotyping of enteroviruses have been based on the 57
time-consuming and labor-intensive procedures of viral isolation in cell culture and 58
neutralization with mixed hyperimmune equine serum pools and specific monovalent 59
polyclonal antisera for confirmation (4, 13, 21). Recently, a series of molecular typing 60
methods largely were developed for rapid identification of the enteroviral serotypes, 61
including RT-PCR combined amplicon sequencing (17-18), real-time RT-PCR 62
(26-27), nested and seminested PCR (16), PCR-RFLP for typing of enteroviruses 63
causing aseptic meningitis in Korea (11),microwell oligonucleotide arrays (24) and 64
RT-PCR-based reverse line blot (RLB) hybridization assay (31). These molecular 65
methods could sensitively identify different serotypes of enteroviruses, however, the 66
real-time RT-PCR and nested and seminested PCR were used for detecting only 67
limited serotypes. The PCR-RFLP, microwell oligonucleotide arrays and RLB 68
hybridization assay could simultaneously detect several viral serotypes, however, the 69
costly, time-consuming and labor-intensive hand procedures were needed. Therefore, 70
a rapid, cost-effective and high throughput method for typing the HFMD associated 71
enteroviruses was needed. 72
on March 13, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
4
The GeXP analyzer is a multiplex gene-expression profiling analysis platform 73
developed by Beckman Coulter Company (USA), which has previously been used in 74
rapidly identifying gene expression prostate cancer biomarker signatures in biological 75
samples, rapid and sensitive detection of 68 unique varicella zoster virus gene 76
transcripts (15), and detection of pandemic influenza A H1N1 virus (19). The 77
principle of GeXP multiplex amplification assay is based on the amplification of two 78
sets of primers: the universal primers and the gene-specific chimeric primers 79
(gene-specific primers linked to the universal primer sequences at the 3’ end). During 80
the first few cycles of PCR, amplification is carried out by chimeric forward and 81
reverse primers. In later stages of PCR, amplification is predominantly carried out by 82
universal forward and reverse primers. All gene targets in the multiplex panel are 83
amplified by universal primers. The forward universal primer is fluorescently 84
dye-labeled enabling subsequent fluorescence detection of amplicons by capillary 85
electrophoresis. 86
In this study, a GeXP analyzer-based multiplex RT-PCR assay (GeXP assay) was 87
developed to simultaneously detect nine common serotypes of enteroviruses 88
associated with HFMD in China, including EV71, CVA16, CVA4, CVA5, CVA9, 89
CVA10, CVB1, CVB3 and CVB5. It is a methodology that can be implemented 90
effectively in routine testing environments by allowing users to process higher 91
numbers of sample in less time than existing assays and platforms. 92
MATERIALS AND METHODS 93
Viral isolates and RNA extraction. Twenty eight serotypes of cell cultured 94
on March 13, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
5
enterovirus isolates used for evaluating the sensitivity and specificity of the GeXP 95
assay were obtained from National Laboratory for Poliomyelitis, National Institute for 96
Viral Disease Control and Prevention, Chinese Center for Disease Control and 97
Prevention. These isolates were used as control viruses and were identified previously 98
by sequencing or neutralization tests. These control viruses included EV71, CVA16, 99
CV2, CVA4, CVA5, CVA6, CVA9, CVA10, CVA12, CVA14, CVA24v, CVB1 to 100
CVB6, ECHO1 to ECHO 7, ECHO11, ECHO13, ECHO19 and ECHO30. Among 101
them, the EV71 isolate (Strain FY17.08/AN/CHN/2008, GenBank accession no. 102
EU703812) and CVA16 isolate (Strain FY18/AN/CHN/2008, GenBank accession no. 103
EU812514) were used as reference viruses in this study, both reference viruses had an 104
infectivity titer of 106.5 50% tissue culture infective doses (TCID50)/ml on human 105
rhabdomyosarcoma (RD) cells. The Viral RNAs were extracted from 140 μl of cell 106
culture of various reference virus stocks using QIAamp Viral RNA Mini kit 107
(QIAGEN) according to the manual and eluted in 50 μl of nuclease -free water. The 108
eluted RNA was aliquoted and stored at -80°C until needed (7). 109
Primers. The GeXP multiplex assay consisted of 11 pairs of chimeric primers 110
(including one pair of pan-enterovirus primers and ten pairs of human enterovirus 111
serotype-specific primers) and one pair of universal primers (Tag-F/Tag-R) (TABLE 112
1.). Each of these chimeric primers consisted of a gene-specific sequence for each 113
virus fused at the 5’ end to the universal sequence. Both the forward and reverse 114
universal sequences were quasi-T7 sequences and selected by default using the GeXP 115
eXpress Profiler software. Tag-F/Tag-R was the same as the forward or reverse 116
on March 13, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
6
universal sequence. This strategy was first developed by Beckman Coulter Company 117
(USA) and was reported in our previous study (19). The pan-enterovirus primers 118
(PE-F and PE-R) were designed in highly conserved region of 5’UTR of the 119
enterovirus genomes as Yang, C. F. reported (28). Ten pairs of human enterovirus 120
serotype-specific primers for the nine serotypes of enteroviruses were designed in 121
relatively conserved VP1 regions of each serotype. Serotype-specific primers 122
sequences were evaluated using the NCBI Primer-Blast, Primer Premier 5.0 and Oligo 123
6.0 softwares. Degenerated bases were introduced to cover different strains. The 5’ 124
end of forward universal primer (Tag-F) was labeled with fluorescent dye Cy5 and 125
purified with high pressure liquid chromatography. All chimeric primers and the 126
reverse universal primer (Tag-R) were synthesized and purified by polyacrylamide gel 127
electrophoresis in Invitrogen (Shanghai, China). 128
Evaluation of the specificity of the GeXP assay. Firstly the mono RT-PCR assay 129
was developed individually with extracted RNA from 28 cell cultured serotypes of 130
enterovirus strains to evaluate the specificity of each pair of gene-specific primers 131
(including PE-F and PE-R) and ascertain the actual amplicon size of each target 132
region. Both the mono RT-PCR assay and the multiplex RT-PCR were performed 133
with QIAGEN One Step RT-PCR kit in a 25 μl volume, containing 5 μl of 5× 134
QIAGEN One Step RT-PCR Buffer, 1 μl of RT-PCR Enzyme Mix, 1 μl of 135
deoxynucleotide triphosphate (10 mM each) mix, 5 units of RNase inhibitor, and 1μl 136
of extracted viral RNA from each serotype. The mono RT-PCR assay contained 50 137
nM of each pair of gene-specific chimeric primers individually while the GeXP assay 138
on March 13, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
7
contained 50 nM of 11 pairs of gene-specific chimeric primers and 500 nM of the 139
universal Tag primers as the final concentrations, Nuclease-free water was added to 140
25 μl volume. The RT-PCR was performed under the following conditions: 50°C for 141
30 min (the RT reaction), 95°C for 15 min, followed by three steps of amplification 142
procedures reaction according to the temperature switch PCR (TSP) strategy(25): step 143
1, 10 cycles of 95°C for 30 s, 55°C for30 s, and 72°C for 30 s; step 2, 10 cycles of 144
95°C for 30 s, 65°C for 30 s, and 72°C for 30 s; step 3, 20 cycles of 95°C for 30 s, 145
48°C for 30 s, and 72°C for 30 s. 146
Separation by capillary electrophoresis (CE) and fragment analysis. PCR 147
product separation and detection were performed on a GenomeLabTM GeXP Genetic 148
Analysis System (Beckman Coulter, USA) by capillary electrophoresis, following the 149
protocols described previously (20). After amplified fragments were separated, the 150
peaks were initially analyzed using the Fragment Analysis module of the GeXP 151
system software and matched to the appropriate gene. The peaks height for each gene 152
was reported in the electropherogram, respectively. 153
Evaluation of the sensitivity of the GeXP assay. Sensitivity was tested following 154
the method described previously (16) by using titrated reference viruses (EV71 and 155
CVA16) obtained from infected human RD cells. Serial 10-fold dilutions of the EV71 156
and CVA16 stock were made in Hank’s balanced salt solution, and RNA from 140 μl 157
of each dilution was extracted with the QIAamp Viral RNA mini kit (QIAGEN). The 158
RNAs preparation ranging from 105.5 TCID50 to 10-1.5 TCID50 (0.03 TCID50) per 159
microliter were tested with the GeXP assay. The assay at each template concentration 160
on March 13, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
8
was repeated three times. 161
Absolute sensitivity was measured by using in vitro transcribed synthetic RNAs 162
derived from ten recombinant plasmids containing the VP1 sequences of the nine 163
serotypes of enteroviruses or the 5’UTR region, respectively. The in vitro synthesized 164
RNA products were purified with RNeasy MinElute Cleanup Kit (QIAGEN) and 165
quantitated by spectrophotometry (NanoDrop ND-1000). The concentration for each 166
serotype was diluted ranging from 105 copies to 1 copy per microliter, and then 167
individually subjected to the GeXP assay, respectively. The concentrations of specific 168
primers were optimized according to the amplification efficiency of the GeXP assay 169
using single template. The sensitivity of the optimized GeXP assay was re-evaluated 170
using ten pre-mixed RNAs templates ranging from 105 copies to 10 copies for each 171
serotype per microliter for three times on three different days. 172
Application to clinical specimens. RNAs were extracted from 180 original clinical 173
stool specimens obtained from HFMD patients and suspects to illustrate the 174
application of the optimized GeXP assay. All the clinical stool specimens were 175
detected in parallel by conventional methods including isolation of the viruses 176
followed by neutralization testing and conventional RT-PCR followed by amplicons 177
sequencing (21, 29-30). 178
RESULTS 179
Evaluation of the specificity of the GeXP assay The RNAs of 28 cell cultured 180
serotypes of enterovirus isolates were individually used as template to evaluate the 181
specificity of each pair of gene-specific primers. In mono-RT-PCR assays, the 182
on March 13, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
9
pan-enterovirus universal primers could amplify the target genes of all the 28 183
serotypes of enteroviruses, but each pair of serotype-specific primers only generated 184
corresponding VP1 gene of the targeted serotype without cross-amplification. The 185
amplicon size for each serotype was as follows, pan-enterovirus: 150-153 bp, EV71: 186
264-267 bp, CVA16: 246-248 bp, CVA4: 270-272 bp, CVA5: 180-181 bp, CVA9: 187
251-254 bp, CVA10: 274-276 bp, CVB1: 224-225 bp, CVB3: 281-284 bp, CVB5: 188
193-196 bp (electropherograms not shown). The nine serotypes of enteroviruses 189
associated with HFMD were detected via the GeXP assay. Two specific amplification 190
peaks were observed presenting the pan-enterovirus target amplicon and the 191
serotype-specific target amplicon, respectively (FIG. 1.). 192
Evaluation of the sensitivity of the GeXP assay. The sensitivity of the GeXP 193
assay was measured using titrated reference viruses (EV71 and CVA16 stocks) or in 194
vitro transcribed RNAs of 9 serotypes of enteroviruses and pan-enterovirus. The 195
GeXP assay detected as few as 0.03 TCID50 of EV71 and CVA16, 10 copies of 196
pan-enterovirus, EV71, CVA16, CVB1, CVB5, more than 100 copies of CVA4, CVA5, 197
CVA9, CVA10 and CVB3 with single RNA template. 198
Based on all the sensitivity results of GeXP assay with single RNA template, the 199
concentration of each chimeric primer in the new GeXP assay was adjusted as the 200
following: PE (F/R) 20 nM, EV71 (F/R) 50 nM, CVA16 (F/R) 40 nM, CVA4 (F2, 201
F3/R2) 80 nM, CVA5 (F4/R4) 50 nM, CVA9 (F2/R2) 70 nM, CVA10 (F2/R2, R3) 202
100 nM, CVB1 (F1/R1, F2/R2) 30 nM, CVB3 (F2/R2) 100 nM, CVB5 (F1/R1) 40 203
nM. The optimized GeXP assay achieved a sensitivity of 100 copies with ten 204
on March 13, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
10
pre-mixed RNAs templates in three independent experiments on three different days 205
(FIG. 2.), and the CV was less than 10.15% (not shown). 206
Application to clinical specimens. A total of 180 specimens collected from HFMD 207
patients and suspects were detected simultaneously by both the GeXP assay and the 208
conventional methods including viral isolation in cell culture, neutralization and 209
conventional RT-PCR followed by amplicons sequencing (21, 29-30). In comparison 210
with the results of conventional methods, the sensitivities of the GeXP assay for 211
detection of pan-enterovirus, EV71 and CVA16 were 98.79% (163/165), 91.67% 212
(44/48) and 91.67% (33/36), respectively, and the specificities were 80.00% (12/15), 213
98.48% (130/132) and 100% (144/144), respectively, as showed in TABLE 2. The 214
accordance between the detection results of GeXP assay and the results of 215
conventional methods for typing other 7 serotypes of enteroviruses was 92.59% 216
(25/27) as shown in TABLE 3. 217
DISCUSSION 218
In our study, ten pairs of serotype-specific primers and one pair of pan-enterovirus 219
universal primers were designed to develop a GeXP assay for simultaneous 220
identification of nine serotypes of enteroviruses including EV71, CVA16, CVA4, 221
CVA5, CVA9, CVA10, CVB1, CVB3 and CVB5. The selection of enterovirus 222
associated with HFMD was based on the research data from the National Notifiable 223
Disease Reporting System (NNDRSe) in China and the previous study (10, 23). The 224
serotype-specific primers were designed to target relatively conserved VP1 regions of 225
each enterovirus serotype and the pan-enterovirus universal primers were designed 226
on March 13, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
11
from 5’UTR (28). Due to the high degree diversities of VP1 sequences, some 227
degenerated bases were introduced and more than two primers for some enterovirus 228
serotypes were designed to cover the majority of the viral sequences, such as the 229
primers for CVA4, CVA10 and CVB1. 230
The original standard workflow of GeXP was performed in two separated tubes 231
with a RT reaction and a subsequent PCR amplification as the previous reports (15, 232
19-20), which was a costly, time-consuming, tedious-process and apt to bring carry 233
over. In order to obviate these troubles, a One Step RT-PCR Kit (QIAGEN) was 234
adopted and replaced the GeXP start kit (Beckman Coulter Company). The 235
amplification procedure of the GeXP assay was improved via temperature switch 236
PCR (TSP) strategy (25) including three steps with different annealing temperatures 237
(FIG. 3.): the step 1 was carried out by gene specific sequences of chimeric forward 238
and reverse primers, step 2 was mainly carried out by chimeric forward and reverse 239
primers and step 3 predominantly by universal forward and reverse Tag primers. The 240
chimeric primers and fluorescent dye labeled universal Tag primers-based GeXP 241
assay using the TSP strategy offered high sensitive and specific amplifications of 242
different genes in one multiplex RT-PCR assay, avoided preferred and inferior 243
amplification and minimized non-specific reactions. The resolution of GeXP 244
analyzer-based capillary electrophoresis is superior to that of conventional capillary 245
electrophoresis. The forward universal primer was fluorescently labeled in the GeXP 246
assay. The resulting dye-labeled PCR products were separated and detected via the 247
Beckman Coulter GenomeLabTM GeXP Genetic Analysis System using capillary 248
on March 13, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
12
electrophoresis. After amplified fragments were separated, the data was initially 249
analyzed using the Fragment Analysis module of the GeXP system software. Then 250
each amplified fragments would be present as a sole peak with accurate size on the 251
electropherogram. One can clearly differentiate two peaks between 3 or more 252
nucleotides difference in a practical way. The minimal nucleotides difference among 253
the PCR products in this study is 3bp as shown in TABLE 1. and FIG. 2. (for CVA4 254
and CVA10). 255
The improved GeXP assay was further optimized by adjusting the concentration of 256
each chimeric primer in the reaction based on individual sensitivity result of GeXP 257
assay with single RNA template to overcome the potential interference due to the 258
preferred amplification in mixed infections. In this study, the relative and absolute 259
sensitivity were analyzed to evaluate the detection limit of the GeXP assay. The 260
optimal GeXP assay detected as few as 0.03 TCID50 of EV71 and EVA16, which is 261
comparable to the detection sensitivity of the real-time RT-PCR assay published 262
recently (26), and slightly less sensitive than seminested RT-PCR (16). The absolute 263
sensitivity of the optimal GeXP assay was 100 copies for simultaneously detecting ten 264
target genes without cross or non-specific amplification. In the clinical performance 265
of 180 samples, the sensitivities of the GeXP assay for detection of pan-enterovirus, 266
EV71 and CVA16 were 98.79% (163/165), 91.67% (44/48) and 91.67% (33/36), 267
respectively, and the specificities were 80.00% (12/15), 98.48% (130/132) and 100% 268
(144/144), respectively, compared with conventional methods, revealing high 269
sensitivity and specificity in detection of pan-enterovirus, EV71 and CVA16. Twelve 270
on March 13, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
13
negative specimens were detected by both the GeXP assay and the conventional 271
methods. Two specimens that were negative by the GeXP assay were enterovirus 272
positive by the conventional methods. The false negatives of GeXP assay might due 273
to the RNA degradation or occurrence of PCR inhibition with the samples. Three 274
specimens that were negative by the conventional methods were enterovirus positive 275
by the GeXP assay, which were confirmed later by independent RT-PCR and 276
sequencing to be true positives. Because of the limited positive samples for other 7 277
serotypes of enteroviruses (CVA4, CVA5, CVA9, CVA10, CVB1, CVB3 and CVB5), 278
the validation of GeXP assay with a larger number of clinical samples for these 279
viruses is necessary. 280
One distinct advantage of the GeXP assay is the time-saving and cost-effectiveness. 281
The cost of GeXP assay for simultaneous detection of 9 serotypes of enteroviruses is 282
approximately $8 per test, versus $8 per test for each virus using a commercial 283
real-time RT-PCR kit. The whole reaction was completed in one tube in a one-step 284
multiplex RT-PCR within 2.5 hours, followed by capillary electrophoresis separation. 285
In addition, two 96-well plates can be placed in parallel in a GeXP machine at the 286
same time to further increase the throughput of the samples. 287
CONCLUSION 288
This study has demonstrated that the GeXP assay is a rapid, cost-effective and high 289
throughput method with high sensitivity and specificity for typing most of HFMD 290
associated enteroviruses, which might be generalized to department of Viral Disease 291
Control and Prevention for molecular epidemiologic survey of enteroviruses. 292
on March 13, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
14
CONFLICT OF INTERESTS 293
A Chinese patent (application number: 201110089404.9) has been filed for the 294
combination of all the listed primers specific to 10 HFMD associated enteroviruses 295
and experimental parameters. The authors Xuejun Ma and Wenbo Xu are inventors on 296
the patent application. The technology is available for research-only purposes. 297
ACKNOWLEDGMENTS 298
This work was supported by the China Mega-Project for Infectious Disease 299
(2009ZX10004-101, 202, 2008ZX10004-002, 001, 004). 300
301
REFERENCES 302
1. Abubakar, S., H. Y. Chee, N. Shafee, K. B. Chua, and S. K. Lam. 1999. 303
Molecular detection of enteroviruses from an outbreak of hand, foot and 304
mouth disease in Malaysia in 1997. Scand J Infect Dis 31:331-335. 305
2. Apisarnthanarak, A., R. Kitphati, Y. Pongsuwann, R. Tacharoenmueng, 306
and L. M. Mundy. 2005. Echovirus type 11: outbreak of 307
hand-foot-and-mouth disease in a Thai hospital nursery. Clin Infect Dis 308
41:1361-1362. 309
3. Barriere, H., M. Berger, and S. Billaudel. 1976. Hand, foot and mouth 310
disease. Sem Hop 52:2215-2220. 311
4. Bell, E. J., R. A. McCartney, D. Basquill, and A. K. Chaudhuri. 1986. 312
Mu-antibody capture ELISA for the rapid diagnosis of enterovirus infections 313
in patients with aseptic meningitis. J Med Virol 19:213-217. 314
on March 13, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
15
5. Blomqvist, S., P. Klemola, S. Kaijalainen, A. Paananen, M. L. Simonen, T. 315
Vuorinen, and M. Roivainen. Co-circulation of coxsackieviruses A6 and A10 316
in hand, foot and mouth disease outbreak in Finland. J Clin Virol 48:49-54. 317
6. Chen, S. P., Y. C. Huang, W. C. Li, C. H. Chiu, C. G. Huang, K. C. Tsao, 318
and T. Y. Lin. 2010. Comparison of clinical features between coxsackievirus 319
A2 and enterovirus 71 during the enterovirus outbreak in Taiwan, 2008: a 320
children's hospital experience. J Microbiol Immunol Infect 43:99-104. 321
7. Chen, T. C., G. W. Chen, C. A. Hsiung, J. Y. Yang, S. R. Shih, Y. K. Lai, 322
and J. L. Juang. 2006. Combining multiplex reverse transcription-PCR and a 323
diagnostic microarray to detect and differentiate enterovirus 71 and 324
coxsackievirus A16. J Clin Microbiol 44:2212-2219. 325
8. Frydenberg, A., and M. Starr. 2003. Hand, foot and mouth disease. Aust 326
Fam Physician 32:594-595. 327
9. Han, J. F., R. Y. Cao, T. Jiang, M. Yu, W. Liu, X. Tian, E. D. Qin, W. C. 328
Cao, and C. F. Qin. Echovirus 30 in EV71-associated hand, foot and mouth 329
disease outbreak, Guangxi, China. J Clin Virol 50:348-349. 330
10. Hu, Y. F., F. Yang, J. Du, J. Dong, T. Zhang, Z. Q. Wu, Y. Xue, and Q. Jin. 331
2011. Complete genome analysis of coxsackievirus A2, A4, A5, and A10 332
strains isolated from hand, foot, and mouth disease patients in China revealing 333
frequent recombination of human enterovirus A. J Clin Microbiol 334
49:2426-2434. 335
11. Lee, Y. S., K. S. Kim, Y. S. Chung, D. S. Cheon, S. K. Jung, K. S. Park, B. 336
on March 13, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
16
K. Na, Y. M. Jee, D. S. Kim, J. D. Yoon, C. Y. Song, and K. H. Lee. 2002. 337
PCR-RFLP based molecular typing of enteroviruses isolated from patients 338
with aseptic meningitis in Korea. Arch Virol 147:1711-1720. 339
12. Li, L., Y. He, H. Yang, J. Zhu, X. Xu, J. Dong, Y. Zhu, and Q. Jin. 2005. 340
Genetic characteristics of human enterovirus 71 and coxsackievirus A16 341
circulating from 1999 to 2004 in Shenzhen, People's Republic of China. J Clin 342
Microbiol 43:3835-3839. 343
13. Lin, T. L., Y. S. Li, C. W. Huang, C. C. Hsu, H. S. Wu, T. C. Tseng, and C. 344
F. Yang. 2008. Rapid and highly sensitive coxsackievirus a indirect 345
immunofluorescence assay typing kit for enterovirus serotyping. J Clin 346
Microbiol 46:785-788. 347
14. Lindenbaum, J. E., P. C. Van Dyck, and R. G. Allen. 1975. Hand, foot and 348
mouth disease associated with coxsackievirus group B. Scand J Infect Dis 349
7:161-163. 350
15. Nagel, M. A., D. Gilden, T. Shade, B. Gao, and R. J. Cohrs. 2009. Rapid 351
and sensitive detection of 68 unique varicella zoster virus gene transcripts in 352
five multiplex reverse transcription-polymerase chain reactions. J Virol 353
Methods 157:62-68. 354
16. Nix, W. A., M. S. Oberste, and M. A. Pallansch. 2006. Sensitive, seminested 355
PCR amplification of VP1 sequences for direct identification of all enterovirus 356
serotypes from original clinical specimens. J Clin Microbiol 44:2698-2704. 357
17. Oberste, M. S., K. Maher, D. R. Kilpatrick, and M. A. Pallansch. 1999. 358
on March 13, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
17
Molecular evolution of the human enteroviruses: correlation of serotype with 359
VP1 sequence and application to picornavirus classification. J Virol 360
73:1941-1948. 361
18. Oberste, M. S., W. A. Nix, K. Maher, and M. A. Pallansch. 2003. Improved 362
molecular identification of enteroviruses by RT-PCR and amplicon sequencing. 363
J Clin Virol 26:375-377. 364
19. Qin, M., D. Y. Wang, F. Huang, K. Nie, M. Qu, M. Wang, Y. L. Shu, and X. 365
J. Ma. 2009. Detection of pandemic influenza A H1N1 virus by multiplex 366
reverse transcription-PCR with a GeXP analyzer. J Virol Methods 367
168:255-258. 368
20. Rai, A. J., R. M. Kamath, W. Gerald, and M. Fleisher. 2009. Analytical 369
validation of the GeXP analyzer and design of a workflow for 370
cancer-biomarker discovery using multiplexed gene-expression profiling. Anal 371
Bioanal Chem 393:1505-1511. 372
21. Rigonan, A. S., L. Mann, and T. Chonmaitree. 1998. Use of monoclonal 373
antibodies to identify serotypes of enterovirus isolates. J Clin Microbiol 374
36:1877-1881. 375
22. Russo, D. H., A. Luchs, B. C. Machado, C. Carmona Rde, and C. 376
Timenetsky Mdo. 2006. Echovirus 4 associated to hand, foot and mouth 377
disease. Rev Inst Med Trop Sao Paulo 48:197-199. 378
23. Shi, H. J., J. S. Liu, L. C. Wang, X. M. Zhang, L. D. Liu, Y. Liao, R. X. Na, 379
and Q. H. Li. 2010. Biological characters of a coxsackievirus B3 variant 380
on March 13, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
18
strain isolated from a hand-foot-mouth disease patient with severe clinical 381
symptoms. Zhonghua Yi Xue Za Zhi 90:1141-1144. 382
24. Susi, P., L. Hattara, M. Waris, T. Luoma-Aho, H. Siitari, T. Hyypia, and P. 383
Saviranta. 2009. Typing of enteroviruses by use of microwell oligonucleotide 384
arrays. J Clin Microbiol 47:1863-1870. 385
25. Tabone, T., D. E. Mather, and M. J. Hayden. 2009. Temperature switch 386
PCR (TSP): Robust assay design for reliable amplification and genotyping of 387
SNPs. BMC Genomics 10:580. 388
26. Xiao, X. L., Y. Q. He, Y. G. Yu, H. Yang, G. Chen, H. F. Li, J. W. Zhang, D. 389
M. Liu, X. F. Li, X. Q. Yang, and H. Wu. 2009. Simultaneous detection of 390
human enterovirus 71 and coxsackievirus A16 in clinical specimens by 391
multiplex real-time PCR with an internal amplification control. Arch Virol 392
154:121-125. 393
27. Xiao, X. L., H. Wu, Y. J. Li, H. F. Li, Y. Q. He, G. Chen, J. W. Zhang, H. 394
Yang, X. F. Li, X. Q. Yang, and Y. G. Yu. 2009. Simultaneous detection of 395
enterovirus 70 and coxsackievirus A24 variant by multiplex real-time RT-PCR 396
using an internal control. J Virol Methods 159:23-28. 397
28. Yang, C. F., L. De, S. J. Yang, J. Ruiz Gomez, J. R. Cruz, B. P. Holloway, 398
M. A. Pallansch, and O. M. Kew. 1992. Genotype-specific in vitro 399
amplification of sequences of the wild type 3 polioviruses from Mexico and 400
Guatemala. Virus Res 24:277-296. 401
29. Zhang, Y., X. J. Tan, H. Y. Wang, D. M. Yan, S. L. Zhu, D. Y. Wang, F. Ji, 402
on March 13, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
19
X. J. Wang, Y. J. Gao, L. Chen, H. Q. An, D. X. Li, S. W. Wang, A. Q. Xu, 403
Z. J. Wang, and W. B. Xu. 2009. An outbreak of hand, foot, and mouth 404
disease associated with subgenotype C4 of human enterovirus 71 in Shandong, 405
China. J Clin Virol 44:262-267. 406
30. Zhang, Y., D. Wang, D. Yan, S. Zhu, J. Liu, H. Wang, S. Zhao, D. Yu, L. 407
Nan, J. An, L. Chen, H. An, A. Xu, and W. Xu. Molecular evidence of 408
persistent epidemic and evolution of subgenotype B1 coxsackievirus 409
A16-associated hand, foot, and mouth disease in China. J Clin Microbiol 410
48:619-622. 411
31. Zhou, F., F. Kong, K. McPhie, M. Ratnamohan, L. Donovan, F. Zeng, G. L. 412
Gilbert, and D. E. Dwyer. 2009. Identification of 20 common human 413
enterovirus serotypes by use of a reverse transcription-PCR-based reverse line 414
blot hybridization assay. J Clin Microbiol 47:2737-2743. 415
32. Zhu, Z., W. B. Xu, A. Q. Xu, H. Y. Wang, Y. Zhang, L. Z. Song, H. L. Yang, 416
Y. Li, and F. Ji. 2007. Molecular epidemiological analysis of echovirus 19 417
isolated from an outbreak associated with hand, foot, and mouth disease 418
(HFMD) in Shandong Province of China. Biomed Environ Sci 20:321-328. 419
420
421
422
on March 13, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
20
423
FIG. 1. The specificity results of multiplex RT-PCR assay. Cy5-labled PCR 424
products were separated via GeXP capillary electrophoresis and detected by 425
fluorescence spectrophotometry given as dye signal in arbitrary unites on the Y-axis, 426
each peak was identified by comparing expected to actual PCR product size on the 427
X-axis. Figure A~I showed amplified results of EV71, CVA16, CVA4, CVA5, CVA9, 428
CVA10, CVB1, CVB3 and CVB5, respectively, using enterovirus RNAs extracted 429
from various cell cultured strains. Nuclease-free water was used as negative control 430
(J). 431
432
433
434
FIG. 2. The sensitivity analysis of GeXP detection of 10 pre-mixed RNA templates 435
with multiplex primers. All 10 target genes could be detected at 103 copies/μL (A) and 436
102 copies/μL levels (B), only CVA16 and CVA9 could be detected at 10 copies/μL 437
levels (C), Nuclease-free water was used as negative control (D). 438
439
440
441
FIG. 3. The workflow of GeXP amplification using Temperature Switch PCR 442
strategy 443
444
445
446
on March 13, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
TABLE 1. Oligonucleotide primers for the GeXP assay 1
primer name sequence(5'->3')a GenBank
accession no. position size
PE-F AGGTGACACTATAGAATATCCGGCCCCTGAATGCGGCTAATCC
FJ713137.1
450-474
151 bp PE-R GTACGACTCACTATAGGGAACACGGACACCCAAAGTAGTCGGTCC 563-538
EV71-F AGGTGACACTATAGAATAGCAGCCCAAAAGAACTTCAC
FJ713137.1
2368-2387
263 bp EV71-R GTACGACTCACTATAGGGAATTTCAGCAGCTTGGAGTGC 2594-2575
CVA16-F AGGTGACACTATAGAATAATTGGTGCTCCCACTACAGC
GQ279371.1
2519-2539
245 bp CVA16-R GTACGACTCACTATAGGGATCAGTGTTGGCAGCTGTAGG 2349-2330
CVA4-F2 AGGTGACACTATAGAATACCTAARCCTGATGCYCGAGA
EU908135.1
1-20
271 bp
CVA4-F3 AGGTGACACTATAGAATACCTAAGCCTGATGCCCGAGA 1-20
CVA4-R2 GTACGACTCACTATAGGGACAACTCTAGCTGRGAATGTYCCT 210-233
CVA5-F4 AGGTGACACTATAGAATAATGAGCCCAGCYAGYACYTA
AY421763.1
3013-3032
181 bp CVA5-R4 GTACGACTCACTATAGGGAGATACHCCTGASACCATGCG 3036-3157
CVA9-F2 AGGTGACACTATAGAATATTTGATCAGAAGGGCTCATACGGGT
GQ294574.1
604-628
251 bp CVA9-R2 GTACGACTCACTATAGGGATCTGTGATGGGTGTTGGTGTAAA 796-818
CVA10-F2 AGGTGACACTATAGAATACGBTGTGTGGTTAAYAGRAATGG GU947783.1 198-221 274 bp
on March 13, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
1
a The degenerate sites in each primer are represebped by characters in boldface type, degenerate primer abbreviations are as follows: M=A/C, 2
R=A/G, W=A/T, S=G/C, Y=C/T, K=G/T, V=A/G/C, H=A/C/T, D=A/G/T, B=G/C/T. 3
Universal Tag sequences are underlined. 4
5
CVA10-R2 GTACGACTCACTATAGGGAGCCTCTCCATTYTTAGTCGTTGT 412-434
CVA10-R3 GTACGACTCACTATAGGGAGCTTCYCCAYCTTCAGTHGTTGT 412-434
CVB1-F1 AGGTGACACTATAGAATAGAAAATTTCCTGTGCCGGT
GU949568.1
193-221
223 bp CVB1-R1 GTACGACTCACTATAGGGAGGGTTGTTGTGCACTCGTTA 359-378
CVB1-F2 AGGTGACACTATAGAATAGAGAATTTCCTGTGCCGGTC
AY373099.1
83-102
223 bp CVB1-R2 GTACGACTCACTATAGGGATAGGTTGTTGGGCGCTTGTTA 249-269
CVB3-F2 AGGTGACACTATAGAATAATGTCCATACCTTTCCTGAGTATTGG
GQ141875.1
2985-3010
282 bp CVB3-R2 GTACGACTCACTATAGGGATTTGCCTTCTCATACTGGCA 3210-3229
CVB5-F1 AGGTGACACTATAGAATAGCTCACGCATCAAATCATGT
GQ246507.1
414-433
193 bp CVB5-R1 GTACGACTCACTATAGGGAGCATTGCCTATGCTGATGAA 550-569 Cy5-labeled Tag-F AGGTGACACTATAGAATA
Tag -R GTACGACTCACTATAGGGA
on March 13, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
TABLE 2. Comparison of GeXP assay and the conventional methods for detecting 1
pan-enterovirus, EV71 and CVA16 2
3
a All of 180 stool specimens were identified previously by cell culture and classical 4
PCR followed by sequencing. Neutralization test was performed for those positive 5
samples for EV71 (n=48) and CVA16 (n=36). 6
b Twelve negative specimens were detected by both the GeXP assay and the 7
conventional methods. Two specimens that were negative by the GeXP assay were 8
enterovirus positive by the conventional methods. The false negatives of GeXP assay 9
might due to the RNA degradation or occurrence of PCR inhibition with the samples. 10
Three specimens that were negative by the conventional methods were enterovirus 11
positive by the GeXP assay, which were confirmed later by independent RT-PCR and 12
sequencing to be true positives. 13
c Measure of Agreement: Kappa for pan-enterovirus (P=0.000), EV71 (P=0.000) and 14
CVA16 (P=0.000) were 0.813, 0.914 and 0.946, respectively (using SPSS13.0) 15
16
Results of the GeXP assay
Results of the conventional
methods Total
(+) (-)
(+)
pan-enterovirus 163 3 166
EV71 44 2 46
CVA16 33 0 33
(-)
pan-enterovirus 2 12 14
EV71 4 130 134
CVA16 3 144 147
Total
pan-enterovirus 165 15 180
EV71 48 132 180
CVA16 36 144 180
on March 13, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
TABLE 3. Comparison of the GeXP assay and the conventional methods for detecting 1
other 7 serotypes of enteroviruses 2
3
Serotype Results of the GeXP assay Results of the conventional methods
CVA4 7 7
CVA5 3 3
CVA9 2 3
CVA10 3 3
CVB1 2 2
CVB3 4 4
CVB5 4 5
on March 13, 2018 by guest
http://jcm.asm
.org/D
ownloaded from