Shumaila Naz1, Farhana Riaz Chaudhry2, Dilawar Abbas ... · Shumaila Naz1, Farhana Riaz Chaudhry2,...
5
ORIGINALARTICLE ABSTRACT Objective: The coding of astigmatid mites based on their morphological and developmental characteristics often leads to uncertainty in the results. The ribosomal internal transcribed spacer (ITS-2) region, being highly conserved in eukaryotes is commonly employed as a barcode for identification of mite species. The present study was an attempt to characterize the gene sequences of astigmatid mites i.e. Sarcoptes scabiei (S. scabiei), Dermatophagoides farinae (D. farinae) using ITS-2 as a genetic marker. Place and Duration of Study: The study was conducted at Department of Dermatology, Military Hospital (MH), Rawalpindi from September 2012 to October 2013. Materials and Methods: In order to characterize relationship of astigmatid mites, the ITS-2 marker was successfully amplified and sequenced. The resulting ITS-2 gene sequences were aligned using Clustal W. MEGA 7 was used to construct phylogenetic tree of the aligned sequence. Results: The phylogenetic tree showed an overall genetic distance of 0.53 indicating close genetic relationship among astigmatid mite species. Pairwise distance was calculated for the ITS-2 gene and low genetic diversity values were observed within S. scabiei and D. farinae that range from 0.003-0.008 and 0.006-0.038 respectively. Conclusion: The study supports the view that the ITS-2 region can be used to identify morphologically difficult astigmatid mites but is not useful in characterization of different species based on the geographical distribution. This study has important implication in our understanding of the epidemiology of S. scabiei and D. farinae and development of control strategies in human transmission. Key Words: Dermatophagoides Farina (Derf), House Dust Mite (HDM), ITS-2 region, Pakistan, Sarcoptes scabiei var. hominis. How to cite this: Naz S, Chaudhry FR, Rizvi DA, Ismail M. Phylogenetic Analysis of Astigmatid Mites Sarcoptes scabiei and Dermatophagoides farinae using ITS-2 as a Genetic Marker. Life and Science. 2020; 1(2): 55-59. doi: http://doi.org/10.37185/LnS.1.1.75 morphological identification of different developmental stages of mites often leads to uncertainty in the results. In the adult stage, mites are difficult to identify with high level of accuracy; complexity and similarity in taxonomy and morphology has made it challenging to differentiate 4,5,6 between them with great precision. The limited availability of genomic data of astigmatid mites has implications related to genetic structure, epidemiology and monitoring protocols of the 7,8 mites. Advances in molecular studies have allowed the exploration of the whole genomic sequence of 9 mites which has enabled the recognition of taxonomically complex species and to comprehend 10,11 associations between mite taxa. Phylogenetic relationships among different mite families are based on their morphological characteristics, allergen characterization, geographical distribution and physiological Introduction Due to the ubiquitous nature of parasitic mites, they are known to infect invertebrates, vertebrates and plants. The parasitic infections are responsible for massive disease burden to humans and animals which in turn leads to higher levels of morbidity 1,2,3 and mortality than any other infection. The Phylogenetic Analysis of Astigmatid Mites Sarcoptes scabiei and Dermatophagoides farinae using ITS-2 as a Genetic Marker 1 2 3 4 Shumaila Naz , Farhana Riaz Chaudhry , Dilawar Abbas Rizvi , Muhammad Ismail Correspondence: Dr. Shumaila Naz Assistant Professor, Biological Sciences National University of Medical Sciences, Rawalpindi E-mail: [email protected] 1,2 Department of Zoology Pir Mehr Ali Shah Arid Agriculture University, Rawalpindi Current Address: National University of Medical Sciences Rawalpindi 3 Department of Dermatology Military Hospital, Rawalpindi 4 Instituteof Biomedical and Genetic Engineering, Islamabad Life & Science 2020 Vol. 1, No. 2 Phylogenetic Analysis of Astigmatid Mites using ITS-2 Funding Source: HEC; Conflict of Interest: NIL Received: Sept 26, 2019; Revised: Jan 21, 2020 Accepted: Feb 26, 2020 55
Transcript of Shumaila Naz1, Farhana Riaz Chaudhry2, Dilawar Abbas ... · Shumaila Naz1, Farhana Riaz Chaudhry2,...
ORIGINAL�ARTICLE
ABSTRACTObjective:Thecodingofastigmatidmitesbasedontheirmorphologicalanddevelopmentalcharacteristicsoftenleadstouncertaintyintheresults.Theribosomalinternaltranscribedspacer(ITS-2)region,beinghighlyconservedineukaryotesiscommonlyemployedasabarcodeforidentificationofmitespecies.Thepresentstudywasanattempttocharacterizethegenesequencesofastigmatidmitesi.e.Sarcoptes scabiei (S. scabiei), Dermatophagoides farinae(D. farinae)usingITS-2asageneticmarker.PlaceandDurationofStudy:ThestudywasconductedatDepartmentofDermatology,MilitaryHospital(MH),RawalpindifromSeptember2012toOctober2013.Materials andMethods: In order to characterize relationship of astigmatidmites, the ITS-2markerwassuccessfullyamplifiedandsequenced.TheresultingITS-2genesequenceswerealignedusingClustalW.MEGA7wasusedtoconstructphylogenetictreeofthealignedsequence.Results:Thephylogenetictreeshowedanoverallgeneticdistanceof0.53indicatingclosegeneticrelationshipamongastigmatidmitespecies.PairwisedistancewascalculatedfortheITS-2geneandlowgeneticdiversityvalues were observed within S. scabiei and D. farinae that range from 0.003-0.008 and 0.006-0.038respectively.Conclusion:ThestudysupportstheviewthattheITS-2regioncanbeusedtoidentifymorphologicallydifficultastigmatid mites but is not useful in characterization of different species based on the geographicaldistribution.ThisstudyhasimportantimplicationinourunderstandingoftheepidemiologyofS. scabiei and D. farinae anddevelopmentofcontrolstrategiesinhumantransmission.
KeyWords: Dermatophagoides Farina (Derf),House Dust Mite (HDM), ITS-2 region, Pakistan, Sarcoptes scabiei var. hominis.
How to cite this: Naz S, Chaudhry FR, Rizvi DA, Ismail M. Phylogenetic Analysis of Astigmatid Mites Sarcoptes scabiei and Dermatophagoides farinae using ITS-2 as a Genetic Marker. Life and Science. 2020; 1(2): 55-59. doi: http://doi.org/10.37185/LnS.1.1.75
morphological identif icat ion of differentdevelopmental stages of mites often leads touncertaintyintheresults.Intheadultstage,mitesaredifficultto identifywithhigh levelofaccuracy;complexity and similarity in taxonomy andmorphologyhasmadeitchallengingtodifferentiate
4,5,6betweenthemwithgreatprecision.Thelimitedavailabilityofgenomicdataofastigmatidmiteshasimplicationsrelatedtogeneticstructure,epidemiology and monitoring protocols of the
7,8mites. Advancesinmolecularstudieshaveallowedtheexplorationofthewholegenomicsequenceof
9mites which has enabled the recognition oftaxonomicallycomplexspeciesandtocomprehend
10,11associationsbetweenmitetaxa.Phylogenetic relationships among different mitefamilies are based on their morphologicalcharacterist ics, al lergen characterization,geographical distribution and physiological
IntroductionDuetotheubiquitousnatureofparasiticmites,theyareknownto infect invertebrates,vertebratesandplants. The parasitic infections are responsible formassive disease burden to humans and animalswhich in turn leads to higher levels of morbidity
1,2,3and mortality than any other infection. The
PhylogeneticAnalysisofAstigmatidMitesSarcoptes scabieiandDermatophagoides farinae usingITS-2asaGeneticMarker
1 2 3 4ShumailaNaz ,FarhanaRiazChaudhry ,DilawarAbbasRizvi ,MuhammadIsmail
Correspondence:Dr. Shumaila NazAssistant Professor, Biological SciencesNational University of Medical Sciences, RawalpindiE-mail: [email protected]
1,2Department of ZoologyPir Mehr Ali Shah Arid Agriculture University, RawalpindiCurrent Address: National University of Medical SciencesRawalpindi3Department of DermatologyMilitary Hospital, Rawalpindi4Instituteof Biomedical and Genetic Engineering, Islamabad
Life&Science2020Vol.1,No.2 PhylogeneticAnalysisofAstigmatidMitesusingITS-2
Funding Source: HEC; Conflict of Interest: NILReceived: Sept 26, 2019; Revised: Jan 21, 2020Accepted: Feb 26, 2020
55
responses of mites to the environment and12,13associationwiththeirhosts. Currently,molecular
tools used to evaluate genetic diversification ofspecies and to study phylogenetic interaction andrelatednessamongindividualspeciesareemployingmitochondrialgenes,ribosomalgenesandinternal
14,15transcribedspacers.In acarological research, the internal transcribedspacer ITS-2 gene has been used to studyorganization and kinship of a population, and to
16identify taxonomically challenging species. PreviousliteratureshowedthattheITS-2regionhasbeenusedasageneticmarker forscrutinizingthediversity and exploring phylogenetic relationships
17among astigmatid mites. ITS-2 marker has beenusedtosuccessfullyverifythetaxonomyofcloselyrelated species and to differentiate and identify
18,19differentspeciesofastigmatidmites. Inthisstudy,we used ITS-2 region to characterize astigmatidmitesi.e. S. scabiei andhousedustmites(HDMs)andthenapplyitasaphylogeneticmarkertoinferthegenetic relationships among these two group ofspecies.
MaterialsandMethodsSampleCollectionTheethicalapprovalforthecollectionofmiteswasgrantedbytheInstitutionalReviewBoard(IRB)ofPirMehr Ali Shah Arid Agriculture UniversityRawalpindi,Pakistan (letterNo.PMAS-AAUR/ZOOL362 approved on 22-3-2012). The S. scabiei miteswereisolatedfromscabiesinfestedpatientsvisitingMilitary Hospital (MH), Rawalpindi after obtainingwritten informedconsent from20 individualswithordinary scabies between September 2012 andOctober2013. The casesof ordinary scabieswereconfirmed through clinical presentation, positiveidentification of mites and mite parts under themicroscope.For the collection of HDM, dust samples werecollectedfrommattressesofbedsandcouchesintherandomly selected houses and other places of
20human dwelling using vacuum cleaner. Thesaturated sodium chloride floatation method wasused to isolate collected HDM from dust with
21supernatantfilteredthrough45µmfilterpaper. Theastigmatid mites were then identified under themicroscope. Both S. scabiei and HDMmites werethen fixed in 70% ethanol and stored at 4°C until
furtherprocessing.ExtractionofGenomicDNAThegenomicDNAof20individualastigmatidmitesi.e. 10 of each Sarcoptes and HDM mites wereextractedindividuallyusingthehotshotplusthermal
22shocktechnique. Accordingtothismethod,25μlofalkalinelysisbuffer(25mMNaOH,0.2mMdisodiumEDTA)wasaddedinthermal-cyclertubesfollowedbythree cycles of thermal shocks. Then 25 μlneutralizingreagent(40mMTris-HCl)wasaddedtodisrupt theexoskeletonand toadjust thepH.TheconcentrationofDNAwasdeterminedbynanodrop2000Spectrometer(ThermoScientific,USA)at260and280nmwavelength.PCRAmplificationandSequencingThe DNA of mites was amplified by using ITS-2forward and reverse primers of sequence 5'C G A C T T TCGAACG C ATAT TG C 3 ' a n d 5 '
23,24GCTTAAATTCAGGGGGTAATCTGC3' respectively. PCRwascarriedoutinafinalvolumeof20μlwiththefollowingsteps:pre-denaturationfor2minat95°C,followedby30cyclesofthe30sat94°C,30secat56°C,50secat72 °C.8µlPCRproductofHDMwasdigestedindividuallywithrestrictionenzymesHinfI(10U)andTaqI(20U).HinfIwasincubatedat37°Cand Taq I at 65°C overnight. The amplicons werevisualizedon3%agarosegel,stainedwithethidiumbromide. The Big Dye® Terminator v3.1 cyclesequencing kit was used to directly sequence 10purifiedPCRproductsinbothdirectionsbyABI310genetic analyzer (Applied Biosystems, Foster City,USA).SequenceAnalysisC h r om a s P r o ( v e r s i o n 1 . 5 ) s o f t w a r e (https://chromaspro.software.informer.com/1.5/)was used to edit and assemble the sequences. Toverify results of sequenced samples, BLAST(https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome) was performed. The resulting top hitnucleotide sequences of ITS-2 were aligned usingC lusta lW (http : / /www.genome. jp / too l s -bin/clustalw). The aligned sequenceswere furtherusedtostudyandconstructphylogenetictreeusingMolecularEvolutionaryGeneticsAnalysis(MEGA7)
25basedonKimura-2-parameter(K2P)distance.
ResultsGenomicDNAs ofS. scabiei andHDMmiteswere
Life&Science2020Vol.1,No.2 PhylogeneticAnalysisofAstigmatidMitesusingITS-2
56
isolated from a total of twenty specimens anddigested PCR products with both Hinf I and Taq IconfirmedthemorphologicallyidentifiedD. farinae and no unexpected bands of PCR products orrestrictionfragmentswereobserved.ThesequencesofITS-2genefromS. scabiei andD. farinae showed 99% similarity respectively withwhole genome of astigmatid mite (Accession no.AB778919.1 and GQ205600.1). The sequencesobtainedasaresultofthisstudyweresubmittedinGenBank under accession numbers KR010367,KJ409446,KT724354andKT724355fortwoS. scabiei samples(Sspak1,Sspak2)andtwoD. farinaesamples(DerfPak1 and DerfPak2) respectively as shown inTable1.
evolutionarypercentageandforcertaingenealogicaltests.PhylogeneticAnalysis
The phylogram constructed by using MEGA 7
softwarerevealedtwodistinctclustersdenotedby
cluster I and cluster II (Fig 1) separatingS. scabiei
fromtheHDMS.
The length of the ITS-2 sequences was between335bpand376bpforS. scabieivar.hominisandD. farinae respectively. ITS-2sequencesofastigmatidmites showed differences in terms of their lengthbecauseof insertionsanddeletionatseveralsites. Three variable sites were determined for bothastigmatidmitesi.e.at68,235and272positionsinITS-2 sequence of S. scabiei and 97, 174 and 281nucleotide positions in the ITS-2 sequences of D. farinae when comparedwith reported ITS-2 genesequencesinNCBInucleotidedatabase.
Tandem repeats of nucleotides (AAA) , (TTT) andn n
(GATT) were observed in the ITS-2 gene of bothn
astigmatid mites are useful in determining
Fig1:PhylogeneticrelationshipofS. scabiei andHDM mitesbasedonITS-2sequences
Thephylogenetic treeCluster I includesD. farinae
samples indicating close genetic similarity with
bootstrap value of 100. The Pakistani D. farinae
(DerfPak1andDerfPak2)liewithintheHDMcluster,
showing closer genetic relationship to each other
than to the other HDMs included in the study
(bootstrap value = 73). Cluster II includes the
PakistaniS. scabieisamples(SsPak1andSsPak2)and
otherS. scabieisequenceswithbootstrapvalueof
93. The phylogram showed an overall genetic
Life&Science2020Vol.1,No.2 PhylogeneticAnalysisofAstigmatidMitesusingITS-2
57
distance of 0.1 indicating close genetic distance
betweenHDMandSarcoptesmites,indicatingclose
geneticcorrelation.PairwiseDistanceCalculationPairwisedistancewascalculatedonthebasisofITS-2gene sequences ofD farinae and S. scabiei mites(Table2andTable3).ThevaluesforgeneticdiversitywerecalculatedwithinspeciesforbothS. scabieiandD. farinaeseparately.Thevaluesofgeneticdiversityfor D. farinae range from 0.006-0.038 with anaverage of 0.022. Similarly, the values of geneticdiversityforS. scabieirangefrom0.003-0.008withanaverageof0.004.Thesevaluesindicatethatgenesweregeneticallyrelatedwitheachotherandtherewaslittlegeneticdiversityamongthem.Theoverallgeneticdistancebetween S. scabieiandD. farinaewascalculatedtobe0.53.
DiscussionInthepresentstudywecharacterizedS. scabiei var. hominissequencesandcomparedthemwithotherreportedITS-2(mostlyanimalsasahost)aspreviousstudiesonastigmatidmitesdidnotincludeSarcoptes
23,26mite from human host. Results of the studiescarriedoutinPakistanshowedthatITS-2sequencesofD. farinaeischaracterizedby3transitionsi.e.Y,RandWandofS. scabiei var. hominis sequences ischaracterized by two transitions and onetransversion.The comparison of ITS-2 sequences of astigmatidmites with sequences obtained from GenBankrevealed that the sequences couldnotbeused todifferentiategeographicalpopulationsimplyingthattheITS-2regionwashighlyconservedinmitesfrom
26,27different areas. The lower level of intraspecificvariation and the relatively higher level ofinterspecific variation in ITS-2 region show thatthese genes may be suitable for studying thephylogeny of astigmatid mites. These species ofmites were positioned in the phylogenetic trees
28accordingtotheirmorphologicalcharacteristics.
27As reported by Yang et al the genetic distancesbetween the specieswere higher as compared to
26distances within the species. The study revealedthatITS-2regionissuitableforphylogeneticstudiesof astigmatidmites as this region shows relativelylower variation within the species and highervariation between the different species of mites.These astigmatid mites were placed in the
phylogenetic tree based on their geneticcharacteristics.Our study with ITS-2 region is also supported bySuarez-Martinez et al. in which it has beenestablished that ITS-2 region is not able to
discriminate geographically isolated mite species.Themitochondrial12SrDNAisalsonotabletoreflectdifferences between the families Pyroglyphidae
29and Acaridae because of sequence conservation theuseofthismarkerislimited.Incomparison,ITS-2region is advantageous in studying populationstructureofastigmatidmitesandcanhelpusstudylow-level phylogenetic relationships between
23,26astigmatidmites.
ConclusionThepresentstudy is the first report fromPakistanusingITS-2markerforthephylogeneticanalysisofastigmatid mites. Although it is challenging todistinguishing theastigmatidmitesbasedon theirmorphological characteristics, the ITS-2 regioncanbe for this purpose. However, ITS-2 region is notconvenient for geographical discrimination of
30differentspecies but itcanbeusedtostudy low-levelphylogeneticrelationshipsbetweenastigmatidmites.
AcknowledgementsThe authors are thankful to Higher EducationCommission, Islamabad, Pakistan for financialsupportunder5000IndigenousFellowshipProgram.
REFERENCES1. Buczek A, Pabis B, Bartosik K, Stanislawek IM, SalataM,
Pabis A. Epidemiological study of scabies in differentenvironmental conditions in central Poland. Annals ofepidemiology.2006;16:423-8.
2. HeQ,MaZ,DangX,XuJ,ZhouZ.Identification,diversityandevolution of MITEs in the genomes of microsporidianNosemaparasites.PloSone.2015;10:e0123170.
3. Lozano-Fernandez J, Tanner AR, GiacomelliM, Carton R,VintherJ,EdgecombeGD,etal.Increasingspeciessamplinginchelicerategenomic-scaledatasetsprovidessupportformonophy ly o f Aca r i and Arachn ida . Natu re communications.2019;10:2295.
4. ColloffMJ,StewartGA.Housedustmites.Asthma.1997;2:1089-103.
5. PepatoAR,daRochaCE,DunlopJA.Phylogeneticpositionofthe acariformmites: sensitivity to homology assessmentundertotalevidence.BMCEvolutionaryBiology.2010;10:235.
6. WongSF,ChongAL,MakJW,TanJ,LingSJ,HoTM.Molecularidentification of house dust mites and storage mites.
Life&Science2020Vol.1,No.2 PhylogeneticAnalysisofAstigmatidMitesusingITS-2
58
Experimentalandappliedacarology.2011;55:123.7. Dong X, Armstrong SD, Xia D,Makepeace BL, Darby AC,
KadowakiT.Draftgenomeofthehoneybeeectoparasiticmite,Tropilaelaps mercedesae, isshapedbytheparasiticlifehistory.Gigascience.2017;6:gix008.
8. Carroll EL,BrufordMW,DeWoody JA, LeroyG, StrandA,Waits L, et al. Genetic and genomic monitoring withminimally invasive sampling methods. Evolutionaryapplications.2018;11:1094-119.
9. Mounsey KE, Willis C, Burgess ST, Holt DC, McCarthy J,FischerK.QuantitativePCR-basedgenomesizeestimationof the astigmatidmitesSarcoptes scabiei,Psoroptes ovisandDermatophagoides pteronyssinus.Parasites&vectors.2012;5:3.
10. NavajasM,FentonB.Theapplicationofmolecularmarkersinthestudyofdiversityinacarology:areview.Experimentalandappliedacarology.2000;24:751-74.
11. SkorackaA,MagalhaesS,RectorBG,Kuczyński L.CrypticspeciationintheAcari:afunctionofspecieslifestylesorourability to separate species?. Experimental and AppliedAcarology.2015;67:165-82.
12. BeroizB,Couso-FerrerF,OrtegoF,ChamorroMJ,ArteagaC,Lombardero M, et al. Mite species identification in theproduction of allergenic extracts for clinical use and inenvironmental samples by ribosomal DNA amplification.Medicalandveterinaryentomology.2014;28:287-96.
13. ArlianLG,MorganMS.AreviewofSarcoptes scabiei:past,presentandfuture.Parasites&vectors.2017;10:297.
14. CruickshankRH.Molecularmarkersforthephylogeneticsofmitesandticks.SystematicandAppliedAcarology.2002;7:3-15.
15. KaneNC, KingMG, BarkerMS, Raduski A, Karrenberg S,Yatabe Y, et al. Comparative genomic and populationgeneticanalysesindicatehighlyporousgenomesandhighlevelsofgeneflowbetweendivergentHelianthusspecies.Evolution:InternationalJournalofOrganicEvolution.2009;63:2061-75.
16. FukuyamaS,NishimuraT,YotsumotoH,GushiA,TsujiM,Kanekura T, et al. Diagnostic usefulness of a nestedpolymerase chain reaction assay for detecting Sarcoptes scabiei DNA in skin scrapings from clinically suspectedscabies.BritishJournalofDermatology.2010;163:892-4.
17. FengS,JiangM,ShiY,JiaoK,ShenC,LuJ,etal.Applicationofthe ribosomal DNA ITS2 region of Physalis (Solanaceae):DNAbarcodingandphylogeneticstudy.Frontiers inplantscience.2016;7:1047.
18. Zhao LL, Feng SJ, Tian JY, Wei AZ, Yang TX. Internaltranscribed spacer 2 (ITS 2) barcodes: A useful tool for
identifying Chinese Zanthoxylum. Applications in plantsciences.2018;6:e01157.
19. WeeksAR,OpijnenTV,BreeuwerJAJ.AFLPfingerprintingforassessingintraspecificvariationandgenomemappinginmites.ExperimentalandAppliedAcarology.2000;24:775-93.
20. Dautartiene A. Seasonal changes in house dust mites.Ekologija.2001;2:3-7.
21. ArlianLG,WoodfordPJ,BernsteinIL,GallagherJS.Seasonalpopu l a t i on s t ru c tu re o f house du s t m i te s , Dermatophagoides spp.(Acari:Pyroglyphidae).JournalofMedicalEntomology.1983;20:99-102.
22. AlasaadS,RossiL,MaioneS,SartoreS,SoriguerRC,PérezJM,etal.HotSHOTPlusThermalSHOCK,anewandefficienttechnique for preparation of PCR-quality mite genomicDNA.Parasitologyresearch.2008;103:1455.
23. NogeK,MoriN,TanakaC,NishidaR,TsudaM,KuwaharaY.Identificationofastigmatidmitesusingthesecondinternaltranscribed spacer (ITS2) region and its application forphylogenetic study. Experimental & applied acarology.2005;35:29-46.
24. WongSF,ChongAL,MakJW,TanJ,LingSJ,HoTM.Molecularidentification of house dust mites and storage mites.Experimentalandappliedacarology.2011;55:123.
25. Kumar S, Stecher G, Tamura K. MEGA7: molecularevolutionary genetics analysis version 7.0 for biggerdatasets.Molecularbiologyandevolution.2016;33:1870-4.
26. Song Z,Wang X, Liang G. Species identification of somecommon necrophagous flies in Guangdong province, Southern China based on the rDNA internal transcribedspacer2(ITS2).ForensicScienceInternational.2008;175:17-22.
27. YangB,Cai J, ChengX. Identificationof astigmatidmitesusing ITS2 and COI regions. Parasitology research. 2011;108:497-503.
28. Fain A. Adaptation, specificity and host-parasitecoevolution in mites (Acari). International journal forparasitology.1994;24:1273-83.
29. Suarez-Martinez EB, Montealegre F, Sierra-Montes JM,Herrera RJ.Molecular identification of pathogenic housedust mites using 12S rRNA sequences. Electrophoresis.2005;26:2927-34.
30. AlasaadS,SogliaD,SpalenzaV,MaioneS,SoriguerRC,PérezJM, et al. Is ITS-2 rDNA suitable marker for geneticcharacterization of Sarcoptes mites from different wildanimals in different geographic areas? Veterinaryparasitology.2009;159:181-5.
Life&Science2020Vol.1,No.2 PhylogeneticAnalysisofAstigmatidMitesusingITS-2
59
