Folia Biologica (Praha) 67, 82-89 (2021)

Short Communications

A Preliminary Characterization of a Novel Recombinant Clostridial Collagenase Blend(collagenase / recombinant / Escherichia coli)

I. LEONTOVYC1, T. KOBLAS1, Z. BERKOVA1, K. BITTENGLOVA2,3, A. LEONTOVYC4, M. BENESIK5, F. SAUDEK2

1Laboratory for the Islets of Langerhans, Department of Experimental Medicine, Institute for Clinical and Experimental Medicine, Prague, Czech Republic2Department of Diabetes, Institute for Clinical and Experimental Medicine, Prague, Czech Republic3Department of Biomedicine – Cell Biology and Pathology, First Faculty of Medicine, Charles University, Prague, Czech Republic4Institute of Organic Chemistry and Biochemistry, Czech Academy of Sciences, Prague, Czech Republic5Department of Experimental Biology, Faculty of Science, Masaryk University, Brno, Czech Republic

Received December 7, 2020. Accepted April 20, 2021.

The research was supported by a grant from the Ministry of In-dustry and Trade, Czech Republic, Project FV20139.

Corresponding author: Ivan Leontovyč, Department of Experi-mental Medicine, Institute for Clinical and Experimental Medi-cine, Vídeňská 1958/9, 140 21 Prague 4, Czech Republic. E-mail: ivan.leontovyc@ikem.cz

Abbreviations: ColG – collagenase G, ColH – collagenase H, FALGPA – N-[3-(2-furyl)acryloyl]-Leu-Gly-Pro-Ala, HBSS – Hanks’ balanced salt solution, PVDF – polyvinylidene fluoride, SDS-PAGE – sodium dodecyl-sulphate polyacrylamide gel elec-trophoresis, rColGH – recombinant collagenase G + H blend.

Biocompatibility of the blend was validated by a standardized viability assay on the isolated islets. Two batches of rColGH were produced and compared to a commercially available collagenase. Based on our results, we conclude that rColGH is a functional and non-toxic novel recombinant collagenase worth fur-ther characterization and blend optimization in or-der to make it a competitive commercial product.

IntroductionThe enzymatic tissue dissociation techniques contin-

ue to be developed for study or further utilisation of cells or cell clusters liberated from the surrounding ex-tracellular matrix. Collagens represent a major compo-nent of the matrix (Gelse et al., 2003). These fibrillar molecules comprise a triple helix structure, which in its native state is resistant to most proteolytic enzymes, in-cluding pepsin, trypsin or chymotrypsin (Gelse et al., 2003). However, the collagen triple helix can be specifi-cally cleaved by mammalian matrix metalloproteinases and cysteine proteinases (Zhang et al., 2015) involved in tissue remodelling. In addition, several bacterial strains produce bacterial collagenases serving as a virulence factor (Duarte et al., 2016). Since the first isolation of collagenase (Mandl et al., 1953), Clostridium histolyti­cum, re-classified as Hathewaya histolytica in 2016 (Lawson, 2016), became an important biotechnological source of tissue dissociation enzymes for research and for therapeutic usage, including relief from Dupuytren’s contracture, enzymatic debridement of wounds or burns (Alipour et al., 2016), and isolation of pancreatic islets for diabetes treatment (Johnson et al., 1996).

The structure and function of bacterial collagenases were recently reviewed (Zhang et al., 2015; Duarte et al., 2016). Clostridial collagenases are multidomain me-

Abstract. Clostridial collagenases are essential bio-technological tissue dissociation agents owing to their ability to cleave different types of collagen. Standardization of collagenase-based protocols has been hampered by impurities in products manufac-tured from Clostridium histolyticum. To enhance the purification process, we produced recombinant col-lagenase classes G and H, taking advantage of the Escherichia coli expression system. The respective gene sequences were derived from C. histolyticum and modified by addition of a C-terminal polyhisti-dine tag. Harvested bacteria were lysed and the col-lagenase protein was affinity purified using a His-tag column. The purity, identity, integrity of the eluted collagenases G and H were determined by SDS elec-trophoresis and Western blot. The proteolytic activi-ty of the collagenase G and H blend (rColGH) was determined by the standard FALGPA assay. The tis-sue dissociation activity was verified using a stand-ardized method for isolation of rat pancreatic islets.

Vol. 67 83

talloproteins that have a single catalytic (collagenase) domain, linked by one or more polycystic kidney dis-ease-like domains to one or more collagen-binding do-mains. A total of six distinct collagenase enzymes were identified in commercial crude collagenase preparations from C. histiolyticum (Van Wart et al., 1985). They were functionally classified into two classes, C1 (collagenas-es α, β, γ) and C2 (collagenases δ, ε, ζ), on the basis of differential enzymatic activity towards the substrates of native collagen and N-[3-(2-furyl)acryloyl]-Leu-Gly-Pro-Ala (FALGPA) peptide (Van Wart et al., 1985). Two collagenase genes were cloned from C. histiolyticum, colG for collagenase G (Matsushita et al., 1999) and colH for collagenase H (Yoshihara et al., 1994). All six collagenases appear to be encoded in C. histiolyticum by only the two genes colG and colH, which correspond to the class 1 and class 2 collagenases, respectively (Mat-sushita et al., 2001). Within each class, the collagenases possess an identical N-terminus encoding the catalytic

domain and various truncations of the C-terminus, which is responsible for the size differences.

colG encodes a polypeptide comprising 1118 amino acids with predicted molecular weight of 126 kDa, which subsequently matures into a 114 kDa enzyme, comprising one collagenase domain, one linking do-main, and two collagen-binding domains (Matsushita et al., 2001; Breite et al., 2011). colH encodes a polypep-tide consisting of 1021 amino acids with predicted mo-lecular weight of 116 kDa, which subsequently matures into a 112 kDa enzyme, which contains, besides the catalytic domain, two linking domains and one colla-gen-binding domain (Matsushita et al., 2001; Breite et al. 2011). The predicted sizes correspond well with the size determination by SDS electrophoresis (Bond et al., 1984). The domain organization of the immature colla-genases is depicted in Fig. 1.

Collagenases of both classes are necessary for suc-cessful isolation of pancreatic islets (Wolters et al., 1995;

Recombinant Collagenase for Islet Isolation

Fig. 1. Domain organization of collagenases class G (114 kDa) and H (112 kDa), with C-terminal modification for affin-ity purification. PKD – polycystic kidney disease-like domain; CBD – collagen-binding domain. Signal peptide and propeptide were not used in our DNA inserts. Position – position in the natural sequence; His-Tag – polyhistidine tag (A) and collagenase gene insertion into the appropriate plasmid (B).

84 Vol. 67

Fujio et al., 2014). The crude collagenase from C. histo­lyticum is a complex mixture of different collagenases, neutral protease and other enzymes with tryptic-like ac-tivity. Seven types of preparations of the crude collage-nase have been developed and optimized for particular tissues, differing in the relative content of non-colla-genase enzymes. Because the tryptic-like activity con-tributes to pancreatic islet isolation, a standardized com-position of the collagenase blend is crucial for obtaining reproducible results in terms of the yield and quality of the islets. Degradation of native collagenases was de-scribed during fermentation and purification steps (Ba-lamurugan et al., 2010; Brandhorst et al., 2017; Berkova et al., 2018). The inconsistent presence of other proteo-lytic activities of clostripain (Loganathan et al., 2018) also contribute to the batch-to-batch variation. The batch variability was reduced but not completely eliminated by refinement of the manufacturing process (Loganathan et al., 2020), and by detailed quality testing of the en-zyme blends (Jahr et al., 1999; Brandhorst et al., 2010).

Development of recombinant collagenases may theo-retically overcome the above-mentioned problems. The bacterial strains tested so far for the enzyme production include Grimontia hollisae (Tanaka et al., 2020) or Escherichia coli (Ducka et al., 2009). The separate ex-pression of ColG and ColH polypetides in E. coli facili-tated the blend optimization (ratio between class I and II collagenases, addition of neutral proteases), thus im-proving the product performance in comparison to the crude collagenase from C. histolyticum (Balamurugan et al., 2016). It was possible to manufacture milligram amounts of high-grade protein free of contaminants (Ducka et al., 2009). A recombinant collagenase was also suitable for isolation of human islets (Brandhorst et al., 2003).

Our aim is to produce a blend of recombinant clostrid-ial collagenases optimized for isolation of pancreatic islets. The purpose of this study was to achieve separate expression and basic biochemical and functional char-acterization of the protein.

Material and Methods

Preparation of DNA sequences

Each collagenase gene was subcloned into pMAL-c5x plasmid (New England Biolabs, Ipswich, MA) with added His-tag. See Supporting information for DNA se-quences of PCR primers and collagenase inserts. The genomic DNA of C. histolyticum CCM 8656 was iso-lated by a NucleoSpin Microbial DNA kit (Macherey-Nagel, Düren, Germany). The genes for collagenases G (3357 bp) (Matsushita et al., 1999) and H (3066 bp) (Yoshihara et al., 1994) without signal peptide and pro-peptide and with His-tag (with predicted molecular weight of ColG 115 kDa and ColH 113 kDa) were am-plified by PCR amplification using gene-specific prim-ers and Q5 High-Fidelity DNA Polymerase, Q5 Reaction Buffer and Deoxynucleotide solution mix, all from New

England Biolabs, and PCR thermal cycler (Veriti 96-Well Thermal Cycler, Applied Biosystems, Foster City, CA), while introducing the restriction sites for KpnI and PstI. The PCR products KpnI-ColG-PstI and KpnI-ColH-PstI were purified using a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). pMAL-c5x plasmid was modified between the restriction sites NdeI and SbfI by subcloning the His-tag together with the restriction sites KpnI and PstI using an In-Fusion HD Cloning Kit (Clontech, Mountain View, CA), resulting in the pMAL-c5X_HisTag-KpnI-PstI construct. The individual colla-genase PCR products KpnI-ColG-PstI and KpnI-ColH-PstI were cloned using the In-Fusion enzyme into pMAL-c5X_HisTag-KpnI-PstI, resulting in pMAL-c5X_HisTag_ColG and pMAL-c5X_HisTag_ColH plas-mids. NEB Express competent E. coli cells (Clontech) were transformed with the respective plasmids. Four positive clones (ColGa-d and ColHa-d) were verified for each construct by full insert length sequencing. The clones ColGa and ColHa were used for the protein ex-pression.

Protein expression and purificationBacterial clones ColGa and ColHa were cultured in

LB medium (Carl Roth, Karlsruhe, Germany) with 2% glucose (Sigma-Aldrich, St. Louis, MO) and 50 µg/ml ampicillin (Serva, Heidelberg, Germany) at 37 °C, and agitated at 260 rpm. Protein expression was induced at absorbance A = 0.8 by addition of 0.5 or 0.25 mM IPTG (Sigma-Aldrich) for 4 h at 30 °C or 25 °C, respectively. Bacterial cells were sonicated in a His-Tag-binding buffer containing 50 µg/ml DNase (Roche, Rotkreuz, Switzerland) and 1 mg/ml lysozyme (Serva). The super-natant was purified on a His-Tag Purification Resin, cOmplete (Merck, Munich, Germany). The collagenase in the eluent was quantified using the BCA protein assay (Thermo Fisher Scientific, Waltham, MA). Transfer of the purified protein into Hanks’ balanced salt solution (HBSS) was performed using a 50 kDa Amicon filter (Merck, Darmstadt, Germany). The protein solutions of ColG and ColH were stored in aliquots at −20 °C for one month.

SDS PAGE and Western blotSamples were mixed with 4x Laemmli loading buffer

containing 8% SDS, 40% glycerol, 0.02% bromophenol blue, 250 mM Tris, and 20% 2-mercaptoethanol (all from Sigma-Aldrich), pH 6.8, heated at 95 °C for 3 min, and run in 15% polyacrylamide gel and transferred to PVDF membranes (Merck Millipore, Burlington, MA) using a Pierce G2 electroblotter (Thermo Fisher Scien-tific). The membranes were blocked with 3% BSA (Sigma-Aldrich). Primary polyclonal antibody rabbit anti-collagenase ab182916 (Abcam, Cambridge, UK) was used at 1 : 10,000 dilution. The secondary antibody goat anti-rabbit IgG-HRP (Merck Millipore) diluted to 1 : 50,000 was used. Chemiluminescent SuperSignal West Pico Plus chemiluminescent substrate (Thermo Fisher Scientific) was used for detection. The signals

I. Leontovyc et al.

Vol. 67 85

were acquired using G:BOX Chemi XR5 (Syngene, Cambridge, UK).

Assessment of collagenase activity in vitroThe collagenase activity was measured using the

FALGPA substrate reaction. One hundred µl of 2mM FALGPA substrate was mixed with 90 µl of reaction buf-fer (50 mM Tricine, 10 mM CaCl2, 400 mM, pH = 7.5) and 10 µl of collagenase sample at the following concen-tration (rColGH-1, 0.42 mg/ml; rColGH-2, 0.44 mg/ml; Control 1 mg/ml). Reaction kinetics was measured us-ing an Epoch ELISA reader (Biotech, Prague, CZ) for 30 min under the following conditions: in 20 s intervals at 345 nm and 37 °C, according to the manufacturer’s protocol. Factor 3.9 was used to convert FALGPA units into PZ units (Wünsch) according to Lockhart et al. (2015). The measurements of collagenase concentration and FALGPA activity were carried out in three repli-cates (N = 3).

Isolation of rat pancreatic islets All experimental protocols were approved by the

Experimental Animal Welfare Committee of the Institute for Clinical and Experimental Medicine and the Ministry of Health of the Czech Republic in accordance with the European Union Council Directive 86/609/EEC. Male outbred rats (Wistar or Sprague-Dawley) 5–6 months old were used in this study. Rat islet isolation was per-formed using the method standardized in our laboratory at the Institute for Clinical and Experimental Medicine (Kriz et al., 2011; Girman et al., 2015). Briefly, the pan-creas was distended with intraductal injection of 15 ml collagenase in HBSS. A commercial collagenase (C9263, Sigma-Aldrich) was used as a standard at the concentra-tion 1.0 mg/ml. Digestion was carried out at 37 °C and the digestion time was measured as the one of the end-points to evaluate the efficiency of collagenase. Determi-nation of digestion end was defined as the time when the distended pancreas disintegrates to very small pieces homogenously dispersed throughout the whole volume.

After purification on a discontinuous gradient of Ficoll (Sigma-Aldrich), the purity and the number of isolated islets was assessed. Purity of isolated islets was assessed under the microscope before counting the islet yield as the ratio of exocrine tissue and pancreatic islets expressed as a percentage. Viability was determined using dead and live cell staining with acridine orange (2.5 μg/ml) and propidium iodide (50 μg/ml), respectively, in three replicates (N = 3).

Results and Discussion The recombinant collagenases, classes G and H, were

affinity purified and blended (1 : 1 ratio mg/mg). Two different batches were produced and tested. Each batch was characterized and compared to a commercially avail-able product, as described below.

Identity and integrity of purified recombinant clostridial collagenases G and H

The collagenases classes G and H were each pro-duced by separately transformed bacteria and subse-quently affinity purified. For each class, the SDS PAGE revealed only a single strong band of the expected mo-lecular size for ColG (115 kDa) and ColH (113 kDa), as depicted in Fig. 2A. The identity of the collagenase was further verified by a specific polyclonal anti-collagenase antibody on Western blot, where the correct sizes were found, as shown in Fig. 2B. No proteolytic degradation products were observed, demonstrating the integrity of the respective purified proteins.

Enzymatic activity of blended collagenase rColGH in vitro

Both affinity purified recombinant collagenases clas-ses G and H were produced and purified separately and then blended (1 : 1 ratio mg/mg) with a final concentra-tion to serve as two different batches. Both batches were

Recombinant Collagenase for Islet Isolation

Fig. 2. Characterization of the His-tag column eluents of the lysates from the clones ColG (115 kDa), ColH (113 kDa) and control crude collagenase by SDS-electrophoresis (A) and Western blot (B).

86 Vol. 67

produced, characterized, and compared to commercially available products, as described below. Final concentra-tions for isolation of rat pancreatic islets was rColGH-1 0.42 mg/ml; rColGH-2 0.44 mg/ml; Control 1 mg/ml. In the first experiments, we used a Collagenase Activity Co-lorimetric Assay Kit (Biovision, Milpitas, CA) at 37 °C according to the manufacturer’s protocol. The tempera-ture for pancreas digestion in the islet isolation protocol was also 37 °C. The specific activities of the blends rColGH-1 and -2 were 2.5 and 4.3 FALGPA U/mg pro-tein, respectively (i.e., 0.28 and 0.46 U PZ, Wünsch)/mg protein, respectively).

Application of rColGH to isolation of pancreatic islets

A standard procedure for isolation of rat pancreatic islets was selected to demonstrate the tissue dissociation capacity of the blended recombinant collagenase. Two subsequent collagenase blends rColGH-1 and rColGH-2 were compared to a commercially available standard, which is routinely used for islet isolation in our lab. The final concentrations for isolation of rat pancreatic islets were 0.42 mg/ml (rColGH-1), 0.44 mg/ml (rColGH-2), and 1 mg/ml (Control). Four criteria were assessed, in-cluding the time necessary for the pancreas tissue diges-tion, the total yield of islets, the islet purity, and the islet viability. The results are summarized in Table 1. In com-parison to the standard 12 min digestion time, a slower release of islets (17 and 20 min) was observed with the respective blends rColGH-1 and rColGH-2. Similarly, a lower islet yield per rat body weight of islets per rat was obtained using rColGH-1 and rColGH-2 (400 and 550 islets) as compared to the standard (750 islets). Also, the viability of the islets was lower with rColGH-1 and rColGH-2 (83 and 93 %) compared to the standard col-lagenase (98 %). On the other hand, semi-quantitatively assessed purity of the islets isolated by the recombinant collagenases was higher (+++) in comparison to the control (++) (Table 1).

I. Leontovyc et al.

Table 1. Functional comparison of rColGH to a commercial collagenase

Collagenase Control rColGH-1 rColGH-2Specific activity [(FALGPA U)/mg protein] 2.0* 2.6 4.1Activity in final solution [FALGPA U/ml] 2.0* 1.1 1.8Concentration of final solution [mg/ml] 1 0.42 0.44Digestion time [min] 12 17 20Number of islets per rat 750 400 550Islet purity ++ +++ +++Viability [%] 98 83 93

*datasheet information

These results were obtained for two subsequent batches that were blended at the same ratio (1 : 1), which, how-ever, may not be optimal for the purpose of islet isola-tion (Loganathan et al., 2019). Moreover, the prepared collagenase blends contained no other proteolytic en-zymes such as clostripain and neutral protease, which are present in commercial collagenases from C. histo­lyticum. Specification of the control collagenase was 2 FALGPA U/mg; 175 caseinase U/mg; 1.2 clostripain U/mg; 0.28 tryptic activity U/mg (datasheet informa-tion). Addition of other proteolytic enzymes to the col-lagenase blend significantly improves the islet yield and quality (Stahle et al., 2015; Balamurugan et al., 2016). It may therefore be expected that optimization of the en-zyme blend can produce better results in the future.

Conclusion Here, we present our first biochemical and functional

characterization of two batches of new recombinant, af-finity purified collagenases G and H. Our preliminary data demonstrate the basic integrity of the two constitu-ent collagenase proteins and their effectiveness in isola-tion of pancreatic islets. We conclude that these novel recombinant collagenases are worth further characteri-zation and blend optimization, which are under way.

Author contributions Conceived project and designed experiments: TK, ZB,

FS. Performed experiments: IL, KB, ZB, AL. Analysed the data: TK, ZB, DH, IL. Wrote the manuscript: DH, IL, TK, ZB. Contributed chemical reagents: MB.

Acknowledgement Clostridium histolyticum CCM 8656 (Patent No.

CZ2017537A3) at the Industrial Property Office, Czech Republic, related to C. histolyticum DSM 2158 (Leibniz Institute, DSMZ – German Collection of Micro orga-nisms and Cell Cultures, GmbH, Braunschweig, Ger-many), was obtained from MB Pharma, Prague, Czech Republic.

Vol. 67 87

Supplemental information

Primers:Collagenase1FUS_F1 – CAGGGTTCGGCATCGATAGCGAATACTAATTCTGAGACollagenase1FUS_R1 – ATGGTGACCAGAACCTTTATTTACCCTTAACTCATAGCollagenase2FUS_F1 – CAGGGTTCGGCATCGGTACAAAATGAAAGTAAGAGCollagenase2FUS_R1 -ATGGTGACCAGAACCTCTTCCTACTGAACCTTCTATATTAATTCTATATGG

Collagenase G: ATAGCGAATACTAATTCTGAGAAATATGATTTTGAGTATTTAAATGGTTTGAGCTATACTGAACTTACAAATTTAATTAAAAATATAAAGTGGAATCAAATTAATGGTTTATTTAATTATAGTACAGGTTCTCAAAAGTTCTTTGGAGATAAAAATCGTGTACAAGCTATAATTAATGCTTTACAAGAAAGTGGAAGAACTTACACTGCAAATGATATGAAGGGTATAGAAACTTTCACTGAGGTTTTAAGAGCTGGTTTTTATTTAGGGTACTATAATGATGGTTTATCTTATTTAAATGATAGAAACTTCCAAGATAAATGTATACCTGCAATGATTGCAATTCAAAAAAATCCTAACTTTAAGCTAGGAACTGCAGTTCAAGATGAAGTTATAACTTCTTTAGGAAAACTAATAGGAAATGCTTCTGCTAATGCTGAAGTAGTTAATAATTGTGTACCAGTTCTAAAACAATTTAGAGAAAACTTAAATCAATATGCTCCTGATTACGTTAAAGGAACAGCTGTAAATGAATTAATTAAAGGTATTGAATTCGATTTTTCTGGTGCTGCATATGAAAAAGATGTTAAGACAATGCCTTGGTATGGAAAAATTGATCCATTTATAAATGAACTTAAGGCCTTAGGTCTATATGGAAATATAACAAGTGCAACTGAGTGGGCATCTGATGTTGGAATATACTATTTAAGTAAATTCGGTCTTTACTCAACTAACCGAAATGACATAGTACAGTCACTTGAAAAGGCTGTAGATATGTATAAGTATGGTAAAATAGCCTTTGTAGCAATGGAGAGAATAACTTGGGATTATGATGGGATTGGTTCTAATGGTAAAAAGGTGGATCACGATAAGTTCTTAGATGATGCTGAAAAACATTATCTGCCAAAGACATATACTTTTGATAATGGAACCTTTATTATAAGAGCAGGGGATAAGGTATCCGAAGAAAAAATAAAAAGGCTATATTGGGCATCAAGAGAAGTGAAGTCTCAATTCCATAGAGTAGTTGGCAATGATAAAGCTTTAGAGGTGGGAAATGCCGATGATGTTTTAACTATGAAAATATTTAATAGCCCAGAAGAATATAAATTTAATACCAATATAAATGGTGTAAGCACTGATAATGGTGGTCTATATATAGAACCAAGAGGGACTTTCTACACTTATGAGAGAACACCTCAACAAAGTATATTTAGTCTTGAAGAATTGTTTAGACATGAATATACTCACTATTTACAAGCGAGATATCTTGTAGATGGTTTATGGGGGCAAGGTCCATTTTATGAAAAAAATAGATTAACTTGGTTTGATGAAGGTACAGCTGAATTCTTTGCAGGATCTACCCGTACATCTGGTGTTTTACCAAGAAAATCAATATTAGGATATTTGGCTAAGGATAAAGTAGATCATAGATACTCATTAAAGAAGACTCTTAATTCAGGGTATGATGACAGTGATTGGATGTTCTATAATTATGGATTTGCAGTTGCACATTACCTATATGAAAAAGATATGCCTACATTTATTAAGATGAATAAAGCTATATTGAATACAGATGTGAAATCTTATGATGAAATAATAAAAAAATTAAGTGATGATGCAAATAAAAATACAGAATATCAAAACCATATTCAAGAGTTAGCAGATAAATATCAAGGAGCAGGCATACCTCTAGTATCAGATGATTACTTAAAAGATCATGGATATAAGAAAGCATCTGAAGTATATTCTGAAATTTCAAAAGCTGCTTCTCTTACAAACACTAGTGTAACAGCAGAAAAATCTCAATATTTTAACACATTCACTTTAAGAGGAACTTATACAGGTGAAACTTCTAAAGGTGAATTTAAAGATTGGGATGAAATGAGTAAAAAATTAGATGGAACTTTGGAGTCCCTTGCTAAAAATTCTTGGAGTGGATACAAAACTTTAACAGCATACTTTACGAATTATAGAGTTACAAGCGATAATAAAGTTCAATATGATGTAGTTTTCCATGGGGTTTTAACAGATAATGCGGATATTAGTAACAATAAGGCTCCAATAGCAAAGGTAACTGGACCAAGCACTGGTGCTGTAGGAAGAAATATTGAATTTAGTGGAAAAGATAGTAAAGATGAAGATGGTAAAATAGTATCATATGATTGGGATTTTGGCGATGGTGCAACTAGTAGAGGCAAAAATTCAGTACATGCTTACAAAAAAGCAGGAACATATAATGTTACATTAAAAGTAACTGACGATAAGGGTGCAACAGCTACAGAAAGCTTTACTATAGAAATAAAGAACGAAGATACAACAACACCTATAACTAAAGAAATGGAACCTAATGATGATATAAAAGAGGCTAATGGTCCAATAGTTGAAGGTGTTACTGTAAAAGGTGATTTAAATGGTTCTGATGATGCTGATACCTTCTATTTTGATGTAAAAGAAGATGGTGATGTTACAATTGAACTTCCTTATTCAGGGTCATCTAATTTCACATGGTTAGTTTATAAAGAGGGAGACGATCAAAACCATATTGCAAGTGGTATAGATAAGAATAACTCAAAAGTTGGAACATTTAAATCTACAAAAGGAAGACATTATGTGTTTATATATAAACACGATTCTGCTTCAAATATATCCTATTCTTTAAACATAAAAGGATTAGGTAACGAGAAATTGAAGGAAAAAGAAAATAATGATTCTTCTGATAAAGCTACAGTTATACCAAATTTCAATACCACTATGCAAGGTTCACTTTTAGGTGATGATTCAAGAGATTATTATTCTTTTGAGGTTAAGGAAGAAGGCGAAGTTAATATAGAACTAGATAAAAAGGATGAATTTGGTGTAACATGGACACTACATCCAGAGTCAAATATTAATGACAGAATAACTTACGGACAAGTTGATGGTAATAAGGTATCTAATAAAGTTAAATTAAGACCAGGAAAATATTATCTACTTGTTTATAAATACTCAGGATCAGGAAACTATGAGTTAAGGGTAAATAAA

Recombinant Collagenase for Islet Isolation

88 Vol. 67

Collagenase H:GTACAAAATGAAAGTAAGAGGTATACAGTATCATATTTAAAGACTTTAAATTATTATGACTTAGTAGATTTGCTTGTTAAGACTGAAATTGAGAATTTACCAGACCTTTTTCAGTATAGTTCAGATGCAAAAGAGTTCTATGGAAATAAAACTCGTATGAGCTTTATCATGGATGAAATTGGTAGAAGGGCACCTCAGTATACAGAGATAGATCATAAAGGTATTCCTACTTTAGTAGAAGTTGTAAGAGCTGGATTTTACTTAGGATTCCATAACAAGGAATTGAATGAAATAAACAAGAGGTCTTTTAAAGAAAGGGTAATACCTTCTATATTAGCAATTCAAAAAAATCCTAATTTTAAACTAGGTACTGAAGTTCAAGATAAAATAGTATCTGCAACAGGACTTTTAGCTGGTAATGAAACAGCGCCTCCAGAAGTTGTAAATAATTTTACACCAATACTTCAAGACTGTATAAAGAATATAGACAGATACGCTCTTGATGATTTAAAGTCAAAAGCATTATTTAATGTTTTAGCTGCACCTACCTATGATATAACTGAGTATTTAAGAGCTACTAAAGAAAAACCAGAAAACACTCCTTGGTATGGTAAAATAGATGGGTTTATAAATGAACTTAAAAAGTTAGCTCTTTATGGAAAAATAAATGATAATAACTCTTGGATAATAGATAACGGTATATATCATATAGCACCTTTAGGGAAGTTACATAGCAATAATAAAATAGGAATAGAAACTTTAACAGAGGTTATGAAAGTTTATCCTTATTTAAGTATGCAACATTTACAATCAGCAGATCAAATTAAGCGTCATTATGATTCAAAAGATGCTGAAGGAAACAAAATACCTTTAGATAAGTTTAAAAAGGAAGGAAAAGAAAAATACTGTCCAAAAACTTATACATTTGATGATGGAAAAGTAATAATAAAAGCTGGTGCTAGAGTAGAAGAAGAAAAAGTTAAAAGACTATACTGGGCATCAAAGGAAGTTAACTCTCAATTCTTTAGAGTATACGGAATAGACAAACCATTAGAAGAAGGTAATCCAGATGATATATTAACAATGGTTATCTACAACAGTCCCGAAGAATATAAACTCAATAGTGTTCTATACGGATATGATACTAATAATGGTGGTATGTATATAGAGCCAGAAGGAACTTTCTTCACCTATGAAAGAGAAGCTCAAGAAAGCACATACACATTAGAAGAATTATTTAGACATGAATATACACATTATTTGCAAGGAAGATATGCAGTTCCAGGACAATGGGGAAGAACAAAACTTTATGACAATGATAGATTAACTTGGTATGAAGAAGGTGGAGCAGAATTATTTGCAGGTTCTACTAGAACTTCTGGAATATTACCAAGAAAGAGTATAGTATCAAATATTCATAATACAACAAGAAATAATAGATATAAGCTTTCAGACACTGTACATTCTAAATATGGTGCTAGTTTTGAATTCTATAATTATGCATGTATGTTTATGGATTATATGTATAATAAAGATATGGGTATATTAAATAAACTAAATGATCTTGCAAAAAATAATGATGTTGATGGATATGATAATTATATTAGAGATTTAAGTTCTAATTATGCTTTAAATGATAAATATCAAGATCATATGCAGGAGCGCATAGATAATTATGAAAATTTAACAGTGCCTTTTGTAGCTGATGATTATTTAGTAAGGCATGCTTATAAGAACCCTAATGAAATTTATTCTGAAATATCTGAAGTAGCAAAATTAAAGGATGCTAAGAGTGAAGTTAAGAAATCACAATATTTTAGTACCTTTACTTTGAGAGGTAGTTACACAGGTGGAGCATCTAAGGGGAAATTAGAAGATCAAAAAGCAATGAATAAGTTTATAGATGATTCACTTAAGAAATTAGATACGTATTCTTGGAGTGGGTATAAAACTTTAACTGCTTATTTCACTAATTATAAAGTTGACTCTTCAAATAGAGTTACTTATGATGTAGTATTCCACGGATATTTACCAAACGAAGGTGATTCCAAAAATTCATTACCTTATGGCAAGATCAATGGAACTTACAAGGGAACAGAGAAAGAAAAAATCAAATTCTCTAGTGAAGGCTCTTTCGATCCAGATGGTAAAATAGTTTCTTATGAATGGGATTTCGGAGATGGTAATAAGAGTAATGAGGAAAATCCAGAGCATTCATATGACAAGGTAGGAACTTATACAGTGAAATTAAAAGTTACTGATGACAAGGGAGAATCTTCAGTATCTACTACTACTGCAGAAATAAAGGATCTTTCAGAAAATAAACTTCCAGTTATATATATGCATGTACCTAAATCCGGAGCCTTAAATCAAAAAGTTGTTTTCTATGGAAAAGGAACATATGACCCAGATGGATCTATCGCAGGATATCAATGGGACTTTGGTGATGGAAGTGATTTTAGCAGTGAACAAAACCCAAGCCATGTATATACTAAAAAAGGTGAATATACTGTAACATTAAGAGTAATGGATAGTAGTGGACAAATGAGTGAAAAAACTATGAAGATTAAGATTACAGATCCGGTATATCCAATAGGCACTGAAAAAGAACCAAATAACAGTAAAGAAACTGCAAGTGGTCCAATAGTACCAGGTATACCTGTTAGTGGAACCATAGAAAATACAAGTGATCAAGATTATTTCTATTTTGATGTTATAACACCAGGAGAAGTAAAAATAGATATAAATAAATTAGGGTACGGAGGAGCTACTTGGGTAGTATATGATGAAAATAATAATGCAGTATCTTATGCCACTGATGATGGGCAAAATTTAAGTGGAAAGTTTAAGGCAGATAAACCAGGTAGATATTACATCCATCTTTACATGTTTAATGGTAGTTATATGCCATATAGAATTAATATAGAAGGTTCAGTAGGAAGA

I. Leontovyc et al.

References:Alipour, H., Raz, A., Zakeri, S., Djadid, N. D. (2016) Thera-

peutic applications of collagenase (metalloproteases): A re-view. Asian Pac. J. Trop. Biomed. 6, 975-981.

Balamurugan, A. N., Breite, A. G., Anazawa, T., Loganathan, G., Wilhelm, J. J., Papas, K. K., Dwulet, F. E., McCarthy, R. C., Hering, B. J. (2010) Successful human islet isolation and transplantation indicating the importance of class 1 col-

lagenase and collagen degradation activity assay. Trans­plantation 89, 954-961.

Balamurugan, A. N., Green, M, L., Breite, A. G., Loganathan, G., Wilhelm, J. J., Tweed, B., Vargova, L., Lockridge, A., Kuriti, M., Hughes, M. G., Williams, S. K., Hering, B. J., Dwulet, F. E., McCarthy, R. C. (2016) Identifying effective enzyme activity targets for recombinant class I and class II collagenase for successful human islet isolation. Tranplant. Direct. 2, 1-10.

Vol. 67 89

Berkova, Z., Saudek, F., Leontovyc, I., Benesik, M., Stverak-ova, D. (2018) Testing of a new collagenase blend for pan-creatic islet isolation produced by Clostridium histolyti-cum. Adv. Biosci. Biotechnol. 9, 26-35.

Brandhorst, H., Brandhorst, D., Hesse, F., Ambrosius, D., Brendel, M., Kawakami, Y., Bretzel, R. G. (2003) Success-ful human islet isolation utilizing recombinant collagenase. Diabetes 52, 1143-1146.

Brandhorst, H., Friberg, A., Nilsson, B., Andersson, H. H., Felldin, M., Foss, A., Salmela, K., Tibell, A., Tufveson, G., Kosgren, O., Brandhorst, D. (2010) Large-scale compari-son of liberase HI and collagenase NB1 utilized for human islet isolation. Cell Transplant. 19, 3-8.

Brandhorst, B., Brandhorst, H., Johnson, P. R. V. (2017) En-zyme development for human islet isolation: five decades of progress or stagnation? Rev. Diabet. Stud. 14, 22-38.

Breite, A. G., McCarthy, R. C., Dwulet F. E. (2011) Charac-terization and functional assessment of Clostridium histol-yticum class I (C1) collagenases and the synergistic degra-dation of native collagen in enzyme mixtures containing class II (C2) collagenase. Transplant. Proc. 43, 3171-3175.

Bond, M. D., Van Wart, H. E. (1984) Characterization of the individual collagenases from Clostridium histolyticum. Biochemistry 32, 3085-3091.

Duarte, A. S., Correia, A., Esteves, A. C. (2016) Bacterial col-lagenases – a review. Crit. Rev. Microbiol. 42, 106-126.

Ducka, P., Eckhard, U., Schönauer, E., Kofler, S., Gottschalk, G., Brandstetter, H., Nüss, D. (2009) A universal strategy for high-yield production of soluble and functional clostrid-ial collagenases in E. coli. Appl. Microbiol. Biotechnol. 83, 1055-1065.

Fujio, A., Murayama, K., Yamagata, Y., Watanabe, K., Imura, T., Inagaki, A., Ohbayashi, N., Shima, H., Sekiguchi, S., Fujimori, K., Igarashi, K., Ohuchi, N., Satomi, S., Goto, M. (2014) Collagenase H is crucial for isolation of rat pancre-atic islets. Cell Transplant. 23, 1187-1198.

Gelse, K., Poschl, E., Aigner, T. (2003) Collagens – structure, function, and biosynthesis. Adv. Drug Deliv. Rev. 55, 1531-46.

Girman, P., Kriz, J., Balaz, P. (2015) Rat Experimental Trans­plantation Surgery: A Practical Guide. Springer, Switzer-land.

Jahr, H., Pfeiffer, G., Hering, B. J., Federlin, K., Bretzel, R. G. (1999) Endotoxin-mediated activation of cytokine produc-tion in human PBMCs by collagenase and Ficoll. J. Mol. Med. 77, 118–120.

Johnson, P. R. V., White, S. A., London, N. J. M. (1996) Col-lagenase and human islet isolation. Cell Transplant. 5, 437-452.

Kriz, J., Jirak, D., Berkova, Z., Herynek, V., Lodererova, A., Girman, P., Habart, D., Hajek, M., Saudek, F. (2011) De-tection of pancreatic islet allograft impairment in advance of functional failure using magnetic resonance imaging. Transpl. Int. 25, 250-260.

Lawson, P. (2016) The taxonomy of the genus Clostridium: Current status and future perspectives. Microbiology China 43, 1070-1074.

Lockhart, R. A., Hakakian, C. S., Aronowitz, J. A. (2015) Tis-sue dissociation enzymes for adipose stromal vascular frac-tion cell isolation: A review. J. Stem Cells Res. Ther. 5, 1-8.

Loganathan, G., Subhashree, V., Breite, A. G., Tucker, W. W., Narayanan, S., Dhanasekaran, M., Mokshagundam, S., Green, M. L., Hughes, M. G., Williams S. K., Dwulet, F. E., McCarthy, R. C., Balamurugan A. N. (2018) Beneficial effect of recombinant RC1rC2 collagenases on human islet function: Efficacy of low-dose enzymes on pancreas diges-tion and yield. Am. J. Transplant. 18, 478-485.

Loganathan, G., Hughes, M. G., Szot, G. L., Smith, K. E., Hussain, A., Collins, D. R., Green, M. L., Dwulet, F. E., Williams, S. K., Papas, K. K., McCarthy, R. C., Balamuru-gan, A. N. (2019) Low cost, enriched collagenase-purified protease enzyme mixtures successfully used for human is-let isolation. OBM Transplant. 3, 1-14.

Loganathan, G., Balamurugan, A. N., Venugopal, S. (2020) Human pancreatic tissue dissociation enzymes for islet iso-lation: Advances and clinical perspectives. Diabetes Me­tab. Syndr. 14, 159-166.

Matsushita, O., Jung, C. M., Katayama, S., Minami, J., Taka-hashi, Y., Okabe, A. (1999) Gene duplication and multi-plicity of collagenase in Clostridium histolyticum. J. Bac­teriol. 181, 923-933.

Matsushita, O., Okabe, A. (2001) Clostridial hydrolytic en-zymes degrading extracellutar components. Toxicon 39, 1769-1780.

Mandl, I., MacLennan, J. D., Howes, E. L. (1953) Isolation and characterization of proteinase and collagenase from Cl. histolyticum. J. Clin. Invest. 32, 1323-1329.

Stahle, M., Foss, A., Gustafsson, B., Lempinen, M., Lund-gren, T., Rafael, E., Tufveson, G., Kosgren, O., Friberg, A. (2015) Clostripain, the missing link in the enzyme blend for efficient human islet isolation. Transplant. Direct. 1, 1-6.

Tanaka, K., Okitsu, T., Teramura, N., Lijima, K., Hayashida, O., Teramae, H., Hattori, S. (2020) Recombinant colla-genase from Grimontia hollisae as a tissue dissociation enzyme for isolating primary cells. Sci. Rep. 10, 1-14.

Van Wart, H. E., Steinbrink, D. R. (1985) Complementary substrate specificities of class I and class II collagenase from Clostridium histolyticum. Biochemistry 24, 6520-6526.

Wolters, G. H. J., Vos-Scheperkeuter, G. H., Lin, H. C., Van Schilfgaarde, R. (1995) Different roles of class I and class II Clostridium histolyticum collagenase in rat pancreatic islet isolation. Diabetes 44, 227-233.

Yoshihara, K., Matsushita, O., Minami, J., Okabe, A. (1994) Cloning and nucleotide sequence analysis of the colH gene from Clostridium histolyticum encoding a collagenase and a gelatinase. J. Bacteriol. 176, 6489-6496.

Zhang, Y., Ran, L., Li, Ch., Chen, X. (2015) Diversity, struc-tures, and collagen-degrading mechanism of bacterial col-lagenolytic proteases. Appl. Environ. Microbiol. 81, 6098-6107.

Recombinant Collagenase for Islet Isolation