Seri Indian traditional knowledge and molecular biology ...labs.eeb.utoronto.ca/murphy/PDFs of...

ORIGINALARTICLE

Seri Indian traditional knowledge andmolecular biology agree: no express trainfor island-hopping spiny-tailed iguanasin the Sea of Cortes

Christina M. Davy1,2*, Fausto R. Mendez de la Cruz3, Amy Lathrop2 and

Robert W. Murphy1,2,4

1Department of Ecology and Evolutionary

Biology, University of Toronto, 25 Wilcocks

Street, Toronto, ON M5S 3B2, Canada,2Department of Natural History, Royal

Ontario Museum, 100 Queen’s Park, Toronto,

ON M5S 2C6, Canada, 3Laboratorio de

Herpetologıa, Instituto de Biologıa,

Universidad Nacional Autonoma de Mexico,

AP 70-153, CP 04510, Mexico, DF, Mexico,4State Key Laboratory of Genetic Resources and

Evolution, Kunming Institute of Zoology, The

Chinese Academy of Sciences, Kunming

650223, China

*Correspondence: Christina M. Davy,

c/o Department of Natural History, Royal

Ontario Museum, 100 Queens Park, Toronto,

ON M5S 2C6, Canada.

E-mail: [email protected]

ABSTRACT

Aim The role of human activities in species biogeography can be difficult to

identify, but in some cases molecular techniques can be used to test hypotheses of

human-mediated dispersal. A currently accepted hypothesis states that humans

mediated the divergence of two species of spiny-tailed iguanas in the Ctenosaura

hemilopha species complex, namely C. conspicuosa and C. nolascensis, which

occupy islands in the Sea of Cortes between the peninsula of Baja California and

mainland Mexico. We test an alternative hypothesis that follows the traditional

knowledge of the Seri Indians and states that the divergence of these species was

not mediated by humans.

Location Mexico, including Baja California, Sonoran and Sinaloan coastal

regions, and Isla San Esteban and Isla San Pedro Nolasco in the Sea of Cortes.

Methods We analysed mitochondrial (cytochrome b and cytochrome c oxidase

subunit III) DNA sequences from four species in the C. hemilopha species

complex. Maximum parsimony and Bayesian inference were used to infer

matriarchal genealogical relationships between the species and several outgroup

taxa. Bayesian methods were used to estimate divergence times for the major

nodes on the trees based on previously published, fossil-calibrated priors.

Results Our analysis indicated that lineages within the C. hemilopha species

complex diverged long before human colonization of the Americas. The

divergence of C. nolascensis and C. conspicuosa could not be attributed to Seri

translocations. The matriarchal genealogy of the species complex currently defies

a simple biogeographical interpretation.

Main conclusions We conclude that humans did not mediate the divergence of

C. nolascensis and C. conspicuosa. This conclusion is consistent with the

traditional knowledge of the Seri people. These results demonstrate the utility

of molecular techniques in investigating potential cases of human-mediated

dispersal of plants and animals, and reinforce the importance of considering

traditional knowledge in the formation of scientific hypotheses and the

interpretation of results.

Keywords

Baja California, Ctenosaura conspicuosa, Ctenosaura hemilopha, Ctenosaura

nolascensis, genealogy, human-mediated dispersal, Iguanidae, island biogeo-

graphy, molecular clock, reptiles.

Journal of Biogeography (J. Biogeogr.) (2011) 38, 272–284

272 www.blackwellpublishing.com/jbi ª 2010 Blackwell Publishing Ltddoi:10.1111/j.1365-2699.2010.02422.x

INTRODUCTION

Untangling the historical causes of the geographic distributions

of species or species complexes is central to the study of

biogeography. However, the factors that are responsible for

current species distributions cannot always be directly inferred

from available data. For example, historical climatic conditions

are often difficult to determine, although these may explain

current species ranges and distributions. Likewise, the geolog-

ical history of many areas is not completely understood; it may

not be ‘written in stone’ (e.g. Murphy & Aguirre-Leon, 2002;

Riddle et al., 2008). Human impacts on species distributions

must also be considered, because humans have both deliber-

ately and accidentally mediated the dispersal of many plants

and animals (e.g. Austin, 1999; Nabhan, 2002; Carlton, 2003).

In this study we use molecular techniques to investigate

whether or not human-mediated translocations played a role

in the evolutionary history of an iguanid species complex in

the Sea of Cortes.

The Cape spiny-tailed iguana (Ctenosaura hemilopha Cope,

1863) species complex (Squamata, Iguanidae) is found in the

southern part of the Baja Californian peninsula, on mainland

Mexico (Sonora and Sinaloa), and on several islands in the Sea

of Cortes (Smith, 1935; Lowe & Norris, 1955; Fig. 1). Colour

pattern variability and other morphological attributes among

individuals from these isolated locations led Smith (1972) to

recognize five geographically isolated subspecies, four of which

Grismer (1999) elevated to full species level. Ctenosaura

hemilopha occurs on the southern half of the peninsula of

Baja California, and C. h. insulana is found on Isla Cerralvo,

c. 8.73 km from the peninsula (Murphy et al., 2002). Cten-

osaura macrolopha (Grismer, 1999) is found on the Mexican

mainland, from Hermosillo, Sonora, southwards to mid-

Sinaloa. Ctenosaura nolascensis (Grismer, 1999) is restricted to

Isla San Pedro Nolasco, a small island c. 14.61 km off the coast

near Guaymas, Sonora (Murphy et al., 2002). Finally, Cten-

osaura conspicuosa (Grismer, 1999) occurs only on Isla San

Esteban and the neighbouring Isla Cholludo (also referred to as

Isla Lobos, e.g. Smith, 1972). Isla Cholludo is located near the

southernmost point of Isla Tiburon (Fig. 1), and it was

connected to this island and mainland Mexico at times of

maximum glaciation in the Pleistocene. The oceanic islands in

the Sea of Cortes are estimated to have uplifted between 5 and

2 Ma (Carreno & Helenes, 2002). Some of these islands have

never been connected to the mainland, and Isla San Esteban

may be one of these (Carreno & Helenes, 2002). Thus, the

occurrence of C. conspicuosa on Isla San Esteban, and the

distribution of this species complex in general, is a biogeo-

graphical conundrum.

Bailey (1928) suggested that C. conspicuosa on Isla San

Esteban ‘were in all probability carried there by man’. When

Smith (1972) later described the taxon, he suggested that the

insular populations were founded by individuals from the

peninsula of Baja California, as ‘a few waif populations in a

24o

28o

32o

30o

26o

117o 113o 111o 107o109o115o

0 100 200

km

N

2, 34

18, 19

5

29-36

112.6o 112.5o

29.6o

29.7o

112.4o112.3o

Isla Datil

Isla Tiburon

Isla Cholludo

Isla San Esteban

0 5 10

km

13,1420-24

1

7

6

25-28

see inset

Figure 1 Distribution of the Ctenosaura

hemilopha species complex, with arrows

indicating Isla San Esteban and Isla San

Pedro Nolasco. The location of Isla Cholludo

is indicated in the inset. Numbers indicate

samples included in the analysis (see Table 1

for sample details). Shaded areas indicate the

ranges of C. hemilopha (dotted line) and

C. macrolopha (dashed line). Samples 1–6,

C. hemilopha; 13, 14, 20–24, C. conspicuosa; 7,

18, 19, 25–28, C. macrolopha; 29–36,

C. nolascensis.

Human translocation is not responsible for Ctenosaura hemilopha dispersal

Journal of Biogeography 38, 272–284 273ª 2010 Blackwell Publishing Ltd

sweepstake pattern reached a number of the Gulf Islands’.

Grismer (1994, 2002) further considered the hypothesis that

the indigenous culture in and around the Sea of Cortes

mediated the dispersal of Ctenosaura sp. (presumably

C. nolascensis) from Isla San Pedro Nolasco to Isla San Esteban.

Nabhan (2003) documented in detail the complex cultural

relationship between the Seri (Comcaac) people indigenous to

the Sea of Cortes and the native reptiles of the region. Many

Seri recognize snakes, lizards, tortoises and marine turtles by

species, and some species have more than one common name

in the Comcaac language. Each species has a cultural signif-

icance to the Seri. Some may be included in feasts at important

celebrations; for example, marine turtles are served during

coming-of-age ceremonies. Some are avoided; for example, the

Seri believe that looking at certain lizards can cause a pregnant

woman to miscarry (Nabhan, 2003).

Along with the cultural importance of the Seri’s relationship

with reptiles, Seri oral history contains information about

historical translocations of reptiles. Nabhan (2002, 2003)

documented Seri accounts of the deliberate translocation of

chuckwallas (Sauromalus) between islands in the Sea of Cortes.

Chuckwallas are an important source of food for the Seri

(Nabhan, 2003). Both molecular evidence and Seri traditional

knowledge suggest that the Seri were responsible for trans-

locating Sauromalus hispidus from Isla Angel de la Guarda

southwards to Isla San Lorenzo Sur, and probably also to Isla

San Lorenzo Norte and Islote Granito (Petren & Case, 1997,

2002; Murphy & Aguirre-Leon, 2002). Seri involvement is also

implicated in the dispersal of several other reptilian species

throughout the Gulf islands, including side-blotched lizards,

which probably dispersed as hitchhikers (Uta; Upton &

Murphy, 1997), and giant chuckwallas (Sauromalus varius;

Murphy & Aguirre-Leon, 2002), which were probably trans-

located deliberately (Nabhan, 2003). Human translocations

have also mediated the dispersal and subsequent divergence of

lizards in other parts of the world. For example, molecular data

demonstrate how Lipinia noctua ‘took the express train’ to

distant Polynesian islands by hitchhiking with humans

dispersing out of Melanesia (Austin, 1999).

Could translocations by the Seri explain the peculiar

occurrence of C. conspicuosa on the islands of San Esteban

and Cholludo, which are so far north of the other insular

Ctenosaura and surrounded by islands on which Ctenosaura

are not found? The Seri people hunt spiny-tailed iguanas

(Nabhan, 2003), so it would have benefited them to move

Ctenosaura species to islands on which they lived or hunted.

They have successfully translocated and established new

populations of other iguanid lizards, as evidenced by their

translocations of Sauromalus and other reptiles, and they have

an oral history of the translocation of C. conspicuosa from Isla

San Esteban to nearby Isla Cholludo. However, Isla San

Esteban itself is located far to the north of the other insular

species of Ctenosaura (Fig. 1) and is isolated from other

populations of Ctenosaura. The occurrence of C. conspicuosa

on Isla San Esteban is, therefore, more difficult to explain.

When Nabhan (2003) directly asked a Seri elder if his people

had translocated Ctenosaura from Isla San Pedro Nolasco to

Isla San Esteban, the response was that, although it was

certainly possible, they had no history of such a translocation.

When translocating animals for live food, the Seri have a

practice of breaking the legs of lizards in order to prevent

escape (Nabhan, 2003), which makes accidental introductions

unlikely (although not impossible).

Recent translocations are unlikely to be detectable mor-

phologically. For example, translocated populations of chuc-

kwallas cannot be morphologically distinguished based on

their place of origin. In contrast, phenotypic distinctions

between C. conspicuosa on Isla San Esteban and C. nolascensis

on Isla San Pedro Nolasco have been listed by Grismer

(1999). These include the presence of small black spots on

the ventral surface of the hind limbs of adult C. nolascensis,

while C. conspicuosa, C. macrolopha and C. hemilopha have

large circular blotches. In C. nolascensis, the dorsal hind limb

pattern is mottled, while in C. conspicuosa it is banded.

Hatchling coloration tends to differ between the populations

as well, although less consistently than adult coloration

(Grismer, 1999). Consistent differences in coloration between

these two populations (Smith, 1972; Grismer, 1999) imply

prolonged reproductive isolation, which is inconsistent with

ongoing human translocation of individuals between recently

diverged populations. Overall, the evidence for human-

mediated dispersal of Ctenosaura to Isla San Esteban is

currently equivocal. In the case of Sauromalus, molecular

evidence helped to confirm Seri translocations, but such

evidence is lacking for the C. hemilopha complex.

To date, the sole genetic analysis of the C. hemilopha species

complex, an MSc thesis (Cryder, 1999), suggested a genealogy

based on 22 cytochrome b (cyt b) and cytochrome c oxidase

subunit III (COIII) sequences (Fig. 2). Grismer (2002) cited

Cryder’s genealogy and the morphological variation between

species (Grismer, 1999) as evidence that the Seri people had

‘created’ C. conspicuosa by moving C. nolascensis from Isla San

Pedro Nolasco to Isla San Esteban. Grismer (2002) also cited

Nabhan’s (2003) ethno-herpetological study of the Seri culture

as evidence for Seri translocation of Ctenosaura from Isla San

Pedro Nolasco to Isla San Esteban.

The question of Seri involvement has not yet been

adequately addressed. The Seri elders cited by Grismer

(2002) did not, in fact, claim an oral history of Ctenosaura

translocations between those two islands (Nabhan, 2003). The

practice of breaking the legs of lizards being transported for

food makes accidental translocations unlikely. Equally prob-

lematic, Cryder’s (1999) phylogenetic results (Fig. 2) do not

show the topology expected under the hypothesis of the

translocation of Ctenosaura from Isla San Pedro Nolasco to Isla

San Esteban. Recent divergence between young species or

diverging populations typically manifests in genealogies as

incomplete lineage sorting (e.g. Murphy & Aguirre-Leon, 2002;

Morando et al., 2004; Heckman et al., 2007). In contrast to

this prediction, Cryder’s (1999) genealogy showed that the

four species and the one subspecies form distinct lineages. The

exception was C. nolascensis, which had two independent

C. M. Davy et al.

274 Journal of Biogeography 38, 272–284ª 2010 Blackwell Publishing Ltd

maternal lineages, both of which were resolved and neither of

which nested within another species.

We used mtDNA sequences to test the hypothesis suggested

by Bailey (1928) and Grismer (2002) that the Seri people

founded the population of C. conspicuosa on Isla San Esteban

by translocating C. nolascensis from Isla San Pedro Nolasco.

Acceptance of this hypothesis requires that the divergence of

the separate species lineages occurred after the first known

human colonization of the Americas (c. 16,500 years ago;

Goebel et al., 2008). We inferred the relationships between

maternal lineages of the C. hemilopha species complex using

standard phylogenetic methods, and used Bayesian inference

(BI) to estimate divergence times between the species. Rejec-

tion of the hypothesis requires that estimated divergence times

between the species occurred before human colonization of the

Americas, and that there is no evidence of incomplete lineage

sorting between matrilines sampled within the ranges of

C. conspicuosa and C. nolascensis.

MATERIALS AND METHODS

Because the sequences obtained by Cryder (1999) were not

available in GenBank, we resampled the four species. Phyloge-

netic analysis of mtDNA was assumed to produce a genealogy

of maternal lineages that closely reflects the evolutionary

history of the species in question (e.g. Upton & Murphy, 1997).

To produce a mtDNA genealogy for the C. hemilopha complex,

we examined mitochondrial cyt b and COIII sequences from 31

individual Ctenosaura representing the four recognized species

in the C. hemilopha complex. Where possible, we attempted to

sample from a number of locations within the range of each

species in order to avoid a geographic sampling bias. The

subspecies C. h. insulana was not included owing to sampling

restrictions. We also collected tissues from the Mexican spiny-

tailed iguana (C. pectinata Wiegmann) in Sinaloa (near

Chametla, Culiacan and Mazatlan) as an outgroup taxon.

Previously, this iguanid was shown to be closely related to the

C. hemilopha complex (Kohler et al., 2000). As more distant

outgroups we included sequences from Petrosaurus thalassinus

Cope collected in Baja California, Iguana iguana Linnaeus taken

from GenBank, and Sauromalus ater Dumeril collected from

Sonora (near Sonoyta and Caborca). Petrosaurus thalassinus

was specified as the most distant outgroup whenever required.

GenBank accession numbers and voucher specimen informa-

tion for all individuals are listed in Table 1.

DNA extraction, amplification and sequencing

We isolated total genomic DNA from frozen or 95% ethanol-

preserved tissues using standard proteinase K digestion

followed by phenol-chloroform extraction (Sambrook et al.,

1989). Cyt b and COIII were amplified using polymerase chain

reaction (PCR) (Saiki et al., 1988). DNA amplification and

purification followed the methods of Blair et al. (2009), using

the primers and primer-specific annealing temperatures listed

in Table 2. Sequencing reactions were performed on a Gene-

Amp 9700 thermal cycler (Applied Biosystems, Foster City, CA,

USA), using the BigDye Terminator v 3.1 Cycle Sequencing kit

(Applied Biosystems). Sequences were visualized on an ABI 377

automated sequencer (Applied Biosystems).

C. nolascensis Isla San Pedro Nolasco

C. conspicuosa

C. conspicuosa

Isla San Esteban

C. macrolopha

Isla Cholludo

C. nolascensis

C. hemilopha

C. hemilopha

Sonora

Isla San Pedro Nolasco

Baja California

Isla Cerralvo

Figure 2 Genealogy of the matrilines of the

Ctenosaura hemilopha species complex

inferred by Cryder (1999) from cytochrome b

and cytochrome c oxidase subunit III

sequences using maximum parsimony

methods (redrawn from Grismer, 2002).



Alignment and sequence analysis

We sequenced 1632 base pairs combined from COIII and

cyt b for 49 individuals. Sequences were aligned with

ClustalW (Larkin et al., 2007) and subsequently checked

by eye. Conversion to amino acids confirmed the align-

ment. We calculated the percentage sequence divergence

(uncorrected p-distances) for all ingroup taxa based on

Table 1 Sample details for iguanid lizards

included in this study. Sample ID numbers

correspond to the ID numbers on the trees

and in Fig. 1. Where vouchers were taken,

ROM accession numbers are designated (i.e.

‘ROM xxxx’). If vouchers were not taken, the

field number corresponding to the tissue

sample is indicated.

Species Sample ID

Voucher

number/Field

number

GenBank

accession no.

(cyt b)

GenBank

accession no.

(COIII)

Ctenosaura hemilopha CH1 ROM 26795 HQ141246 HQ141198

CH2 RWM 2280 HQ141251 HQ141203

CH3 RWM 2282 HQ141247 HQ141199

CH4 RWM 623 HQ141248 HQ141200

CH5 RWM 631 HQ141249 HQ141201

CH6 RWM 879 HQ141250 HQ141202

C. macrolopha CH7 JRO 645 HQ141235 HQ141187

CH18 ROM 38003 HQ141268 HQ141220

CH19 ROM 38004 HQ141267 HQ141219

CH25 ROM 38021 HQ141236 HQ141188

CH26 ROM 38022 HQ141237 HQ141189

CH27 ROM 38023 HQ141238 HQ141190

CH28 ROM 38024 HQ141239 HQ141191

CH37 ROM 38037 HQ141231 HQ141183

CH38 ROM 38038 HQ141232 HQ141184

CH39 ROM 38039 HQ141233 HQ141185

C. conspicuosa CH13 KP-EC102 HQ141252 HQ141204

CH14 KP-EC103 HQ141253 HQ141205

CH 20 ROM 38011 HQ141254 HQ141206

CH21 ROM 38012 HQ141255 HQ141207

CH22 ROM 38013 HQ141256 HQ141208

CH23 ROM 38014 HQ141257 HQ141209

CH24 ROM 38015 HQ141258 HQ141210

C. nolascensis CH29 ROM 38028 HQ141240 HQ141192

CH30 ROM 38029 HQ141271 HQ141223

CH31 ROM 38030 HQ141272 HQ141224

CH32 ROM 38031 HQ141273 HQ141225

CH33 ROM 38032 HQ141274 HQ141226

CH34 ROM 38033 HQ141275 HQ141227

CH35 ROM 38034 HQ141276 HQ141228

CH36 ROM 38035 HQ141277 HQ141229

Petrosaurus thalassinus Petrosaurus RWM 2263 HQ141230 HQ141182

Iguana iguana Iguana GenBank AJ278511.2 AJ278511.2

Sauromalus ater S1 KP-20 HQ141242 HQ141194

S2 KP-22a HQ141243 HQ141195

S3 KP-22b HQ141244 HQ141196

S4 KP-19 HQ141241 HQ141193

S5 KP-21 HQ141245 HQ141197

C. pectinata CP1 ROM 38001 HQ141269 HQ141221

CP2 ROM 38002 HQ141270 HQ141222

CP3 ROM 38040 HQ141234 HQ141186

CP4 ROM 38041 HQ141259 HQ141211

CP5 ROM 38042 HQ141260 HQ141212

CP6 ROM 38043 HQ141261 HQ141213

CP7 ROM 38044 HQ141262 HQ141214

CP8 ROM 38045 HQ141263 HQ141215

CP9 ROM 38046 HQ141264 HQ141216

CP10 ROM 38047 HQ141265 HQ141217

CP11 ROM 38050 HQ141266 HQ141218

Cyt b, cytochrome b; COIII, cytochrome c oxidase subunit III.

C. M. Davy et al.


uncorrected p-distances as implemented in mega 4 (Tamura

et al., 2007).

Because direct comparison of our sampled sequences with

those of Cryder (1999) was not possible, we initially followed

his methods in order to determine if any inherent differences

between the two data sets might have caused our genealogy to

differ in topology from his (Fig. 2). Thus, maximum parsi-

mony (MP) analysis was implemented in paup* 4.0b10

(Swofford, 2002), employing a heuristic search with 50

random addition sequences (RAS) and tree bisection–recon-

nection branch swapping. We then assessed nodal confidence

for the MP strict consensus tree by nonparametric bootstrap-

ping (Felsenstein, 1985) using a heuristic search with 1000

pseudoreplicates, 50 RAS per pseudoreplicate, and nearest-

neighbour interchange branch swapping (Nei & Kumar, 2000).

We considered bootstrap values > 70 to indicate strong nodal

support (Hillis & Bull, 1993).

We used MrBayes 3.1.2 (Huelsenbeck & Ronquist, 2001;

Ronquist & Huelsenbeck, 2003) to determine the most

probable evolutionary history for the matrilines based on the

available sequences. MrModeltest 2.3 (Nylander, 2004)

indicated that the best-fit evolutionary model for our data

was (GTR+I+C), which was selected for each gene using the

Akaike information criterion (Akaike, 1974, 1979). To

account for potential rate variation and differing rates of

substitution between the two genes (Nylander, 2004; Brandley

et al., 2005), we partitioned our data set by gene, and set the

analysis to account for variable rates between partitions using

the command prset applyto = (all) ratepr = variable in

MrBayes.

The Bayesian analysis was run for 1 · 105 generations, with

two simultaneous runs of six chains sampled at 100-generation

intervals. The first 2500 trees (25%) were discarded as burn-in,

and the inferred genealogy was based on 7500 data points.

Examination of the raw trace, the log-likelihood plot and the

standard deviations of the split frequencies all indicated that

convergence had occurred, and that the burn-in period was

sufficient. We considered lineages to have significant support if

they had posterior probability values ‡ 0.95 (Felsenstein,

2004).

Estimates of divergence time

It is not advisable to estimate divergence times for nodes in a

tree without at least one point of geological or palaeonto-

logical reference, and preferably several (Benton & Ayala,

2003; Reisz & Muller, 2004). Robust estimations of diver-

gence dates require several points of reference, preferably

from fossil evidence. Unfortunately, the fossil record for

iguanid lizards in western Mexico is scarce, and it is therefore

not possible to date the evolution of the C. hemilopha species

complex by dating fossils of these species. Therefore, we base

our estimates of divergence time within the C. hemilopha

complex on the divergence time (most recent common

ancestor, MRCA) of C. pectinata and C. hemilopha estimated

by Zarza et al. (2008). Using a Bayesian approach and

calibration points based on fossil evidence, they estimate that

the divergence of C. pectinata and C. hemilopha occurred

9.24 Ma (SD = 2.9), and that divergence within C. pectinata

began between 2.3 and 6.5 Ma (Zarza et al., 2008). We use

these priors in our analysis.

We used the program beast 1.4.2 (Drummond et al., 2007)

to infer divergence times for species of the C. hemilopha

complex under an uncorrelated lognormal relaxed molecular

clock model (Drummond et al., 2006). Input files were created

with BEAUti 1.4.2 (Drummond et al., 2007), and manually

edited to partition the data by gene and to specify substitution

rates, gamma shape parameters and proportion of invariable

sites for each partition based on the estimates made in

MrModeltest. We specified monophyly of the lineages

identified by our BI analysis but did not specify an input tree.

beast analyses considered the Yule process tree prior, as

recommended for analyses of speciation (Drummond et al.,

2007). Three Markov chain Monte Carlo (MCMC) runs were

made, each with 3 · 107 generations, sampling every 100

generations with a burn-in period of 10% of the samples.

Table 2 Primers used to amplify and sequence cytochrome b (cyt b) and cytochrome c oxidase subunit III (COIII) from the Ctenosaura

hemilopha species complex, C. pectinata, Sauromalus ater and Petrosaurus thalassinus.

Target gene

Primer/annealing

temperature Sequence (5¢–3¢) Source

Cyt b GLUDG-L

50 �C

TGACTTGAARAACCAYCGTTG Palumbi et al. (1991)

CTEN-8H

50 �C

TTACTGTGGCGCCTCGGAAGGATATTTGGCCTCA Cryder (1999)

COIII L8618CO3

46 �C

CATGATAACACATAATGACCCACCAA Cryder (1999)

H9323CO3

46 �C

ACTACGTCTACGAAATGTCAGTATCA Cryder (1999)

Petrosaurus and Sauromalus cyt b

Cyt b B1L CCATCCAACATCTCAGCATGATGAAA Kocher et al. (1989)

Cyt b B6H

50 �C

GTCTTCAGTTTTTGGTTTACAAGAC Tim Birt (Queens University, pers. comm.)



We examined output files for each of the three runs in

Tracer (Rambaut & Drummond, 2007) to assess whether or

not they had converged on similar estimates of divergence

times. Next, we combined the results of the runs using

LogCombiner (Drummond et al., 2007) for further analysis,

sampling the combined runs every 300 generations for a final

sample of 89,991,300 states with a burn-in of 10% of the

samples. We considered effective sample size (ESS) values

> 200 to indicate good mixing and a valid estimate of

continuous parameters and likelihoods given the specified

priors (Drummond et al., 2007). We checked the distribution

of the standard deviation of the uncorrelated lognormal relaxed

clock model and its coefficient of variation in Tracer during

examination of the output files. Neither parameter approached

zero, indicating rate variation between branches and suggesting

that a strict clock would have been an inappropriate model for

our data. The maximum clade credibility tree for the combined

runs was computed using TreeAnnotator 1.4.7 (Drummond

et al., 2007). We used the estimated lower bound of the 95%

highest posterior density (HPD) region of the MRCA param-

eters to test the hypothesis that C. conspicuosa and C. nolascensis

could have diverged as a result of human-mediated dispersal,

that is, after human colonization of the Americas

(c. 16,500 years ago; Goebel et al., 2008).

RESULTS

Sequence analysis

Average percentage sequence divergences (p-distances) within

and between C. pectinata and species in the C. hemilopha

complex are summarized in Table 3. Sequence divergence

between C. pectinata and the C. hemilopha species complex

averaged 11.2%. Divergence between lineages within the

C. hemilopha species complex ranged from 0.8% to 4.5%,

with the highest percentage divergence occurring between two

lineages in C. nolascensis.

Of 1632 nucleotide sites, 547 were variable and 378 were

potentially phylogenetically informative. Within the sequences

from C. hemilopha and C. pectinata (excluding other out-

groups), 241 sites were potentially phylogenetically informative.

The MP analysis recovered 2111 most-parsimonious trees of

925 steps (consistency index = 0.765, retention index = 0.943).

The topologies of the MP strict consensus tree and the BI

majority-rule consensus tree differed slightly at the tips. The

trees also differed in their placement of Ctenosaura in relation

to the three outgroup genera, but both methods inferred the

same relationships between the five species of Ctenosaura, and

resolved the same major lineages within Ctenosaura, without

exception (Fig. 3). Six major mtDNA lineages were recovered.

Ctenosaura pectinata formed a distinct lineage distantly related

to the C. hemilopha complex. Ctenosaura nolascensis was

resolved into two distinct and distantly related lineages. The

first of these lineages (C. nolascensis-1) was resolved as sister to

a single sample of C. macrolopha from Culiacan, Sinaloa, and

this group was resolved as sister to C. conspicuosa from Isla San

Esteban. The remaining samples of C. nolascensis formed a

separate lineage (C. nolascensis-2), sister to a lineage containing

both C. hemilopha and C. macrolopha. There was high

bootstrap and posterior probability support for most nodes

between species (Fig. 3).

Our genealogy recovered the same mtDNA groups as Cryder

(1999), but differed slightly in the relationships between

C. nolascensis-2, C. hemilopha and C. macrolopha. Otherwise,

our genealogies agreed on the relationship between the

matrilines. Interestingly, the proportion of the two C. nolasc-

ensis haplotypes in our sample (5:3) approximates that shown

in Fig. 2 (3:2; Cryder, 1999). Based on the sample from

Culiacan (CH19), which was resolved as sister to the

C. nolascensis-1 lineage, C. macrolopha did not consist of a

single matrilineal lineage but contained at least two distinct

matrilines. Finally, the tree topology and p-distances indicated

that the degree of divergence between C. conspicuosa and

C. nolascensis-1 was comparable to the divergence between

C. macrolopha and C. hemilopha (Table 4).

Estimates of divergence time

Estimated divergence times within the major lineages and the

95% HPD of the estimates are summarized in Table 4.

Estimated divergence times for all major nodes are also shown

on the maximum clade credibility tree generated by

TreeAnnotator from the three combined MCMC runs

(Fig. 4). The estimated divergence time for the matrilines

within C. conspicuosa was 1.73 Ma, with a lower 95% HPD

of 326,200 years ago. Divergence between the C. nolascensis-1

Table 3 Average pairwise genetic divergence (percentage uncorrected p-distances) within and between Ctenosaura pectinata, C. hemilopha,

C. macrolopha, C. conspicuosa and C. nolascensis. The two matrilines within C. nolascensis are presented separately. The standard error of

percentage divergence is indicated in parentheses.

C. pectinata C. conspicuosa C. nolascensis-1 C. nolascensis-2 C. hemilopha C. macrolopha

C. pectinata 0.9 (± 0.2)

C. conspicuosa 11.1 (± 1.2) 0.1 (± 0.1)

C. nolascensis-1 11.2 (± 1.2) 0.8 (± 0.2) 0.0 (± 0.1)

C. nolascensis-2 11.2 (± 0.012) 4.0 (± 0.6) 4.5 (± 0.2) 0.0 (± 0.0)

C. hemilopha 11.3 (± 1.2) 3.9 (± 0.6) 4.0 (± 0.6) 1.1 (± 0.3) 0.0 (± 0.0)

C. macrolopha 11.3 (± 1.2) 4.3 (± 0.6) 1.5 (± 0.6) 1.5 (± 0.3) 0.9(± 0.2) 0.1 (± 0.0)

C. M. Davy et al.


C.h. 36C.h. 13C.h. 20

P. thalassinusC.h. 19C.h. 30

C.h. 32C.h. 35

C.h. 31

C.h. 24

C.h. 6

C.h. 22C.h. 23C.h. 1

C.h. 4C.h. 5

C.h. 3

C.h. 21C.h. 14

C.h. 2C.h. 37

C.h. 39C.h. 26

C.h. 38

C.h. 33C.h. 34C.p. 3

C.h. 7C.h. 25C.h. 27

C.h. 18C.h. 29

C.h. 28

C.p. 1C.p. 2

C.p. 4

I. iguana

C.p. 11C.p. 5C.p. 6

C.p. 10C.p. 8

C.p. 7

C.p. 9S4S2

S5S1

S3

1.0/97

0.93/100

*

*

*

*

*

0.92/77

1.0/91

0.93/98

0.75/86 0.97/64

1.0/99

1.0/93

0.93/63

1.0/99

0.64/58

0.55

0.98/85

0.65

0.59/61

0.961.0/91

0.68

0.96/51

C. macrolopha

C. conspicuosa

C. hemilopha

C. macrolopha

C. nolascensis-2

C. nolascensis-1

C. pectinata

Figure 3 Evolutionary history of the matri-

lines of the Ctenosaura hemilopha complex

inferred using Bayesian inference analysis of

cytochrome b and cytochrome c oxidase

subunit III sequence data. C.h., Ctenosaura

hemilopha complex; C.p., C. pectinata;

S, Sauromalus ater. Numbers at nodes indi-

cate Bayesian posterior probability values

followed by the percentage of replicate trees

in which the associated taxa clustered

together in the nonparametric bootstrap

analysis; * indicates a posterior probability/

bootstrap proportion = 1.0/100.

Table 4 Estimated dates of divergence from

the most recent common ancestor (MRCA)

between the major matrilines within the

Ctenosaura hemilopha species complex. Dates

(Ma) were estimated under an uncorrelated

relaxed clock model in beast, with the

analysis partitioned by gene and priors as

described in the Materials and Methods.

Mean estimated divergence dates are listed,

with the upper and lower bounds of the 95%

highest posterior density (HPD) of each

estimate.

MRCA Mean (Ma) 95% HPD upper 95% HPD lower

Between lineages

(hemilopha/macrolopha)

+ nolascensis-2

3.6723 6.7291 1.2188

hemilopha + macrolopha 2.7318 5.162 0.7606

conspicuosa + nolascensis-1 2.9032 5.5111 0.8421

nolascensis-1 + CH19

(C. macrolopha)

1.5714 3.3261 0.2287

Within lineages

pectinata 3.5842 5.6412 2.3001

hemilopha 1.3676 3.0473 0.1667

macrolopha 1.6646 3.4142 0.3553

conspicuosa 1.7283 3.6096 0.3367

nolascensis-1* 0.7433 1.807 0.0447

nolascensis-2 1.2582 3.1166 0.504

*Excluding the sample of C. macrolopha from Culiacan (CH19), which was resolved as sister to

this lineage.



and C. conspicuosa matrilines was estimated at 2.9 Ma

(5.5–0.8421 Ma). The most recent divergence occurred bet-

ween the matrilines within C. nolascensis-1 (1.8–0.0447 Ma).

DISCUSSION

Genealogies for the C. hemilopha complex and estimates of

divergence time between the species in the complex suggest

that historical human involvement in their divergence is highly

unlikely. We cannot refute the null hypothesis that C. conspic-

uosa diverged from the other taxa in the C. hemilopha complex

before humans arrived in North America, and we cannot

accept Seri translocation as the explanation for the presence

of C. conspicuosa on Isla San Esteban. Although this conclusion

differs from some previous interpretations, it is in agreement

with Seri traditional knowledge (Nabhan, 2002, 2003).

Ctenosaura hemilopha, C. macrolopha, C. nolascensis and

C. conspicuosa show no evidence of recent female dispersal

and gene flow between them, although there are interesting

patterns present in the genealogy, as we discuss below. The

occurrence of a C. nolascensis-like haplotype on the mainland

is especially intriguing and suggests historical dispersal

between Isla San Pedro Nolasco and the mainland. Our

conclusion leaves us in need of a new biogeographical

explanation for the distribution of the C. hemilopha

species complex.

No ‘express train’ for C. conspicuosa

The hypothesis that Seri translocations caused the initial

divergence between the insular species of Ctenosaura requires

the divergence of the matrilines found on the two islands to

occur after c. 16,500 years ago (Goebel et al., 2008), but the

estimated divergence time between the insular matrilines of

C. conspicuosa and C. nolascensis-1 is, at a minimum, 0.84 Ma

(Table 4). Consequently, the molecular data do not support

the theory that the Seri (or any other human culture) mediated

the initial divergence of C. nolascensis and C. conspicuosa.

This finding is unlikely to surprise the Seri, whose oral

histories do not include such a translocation (Nabhan, 2003).

As discussed earlier, the Seri’s reptilian translocations show

deliberation and planning. Details of other translocations

C.h. 14C.h. 20C.h. 13

C.h. 19C.h. 32C.h. 35

C.h. 31C.h. 36

C.h. 30

C.h. 21

C.h. 3

C.h. 22C.h. 2C.h. 4

C.h. 5C.h. 6

C.h. 1

C.h. 24C.h. 23

C.h. 7C.h. 38

C.h. 25C.h. 27

C.h. 28

C.h. 29C.p. 5C.p. 6

C.h. 37C.h. 18C.h. 26

C.h. 33C.h. 34

C.h. 39

C.p. 7C.p. 2

C.p. 10

I. iguana

C.p. 1C.p. 4C.p. 3

C.p. 8C.p. 9

C.p. 11

C. macrolopha

C. conspicuosa

C. hemilopha

C. macrolopha

C. nolascensis-2

C. nolascensis-1

C. pectinata

10.0 9.0 8.0 7.0 6.0 5.0 4.0 3.0 2.0 1.0 0.0

1.57

0.742.90

1.73 0.41

0.26

5.171.37

2.73

1.66

1.29

3.67

0.39

0.451.26

0.52

1.560.7

0.251.14

3.58

1.01

9.27

7.93

*

*

*

*

**

*

**

*

*

*

**

*

*

*

*

Figure 4 Chronogram of the Ctenosaura

hemilopha species complex: maximum clade

credibility tree from three combined Markov

chain Monte Carlo analyses performed in

beast. Ctenosaura pectinata and Iguana ig-

uana are included as outgroups. Posterior

estimates of divergence times were inferred

by partitioning analyses by gene, and placing

constraints on the divergence dates of two

nodes (see Materials and Methods). Values at

nodes indicate posterior mean ages (Ma), and

node bars represent the 95% highest proba-

bility density (HPD). * indicates Bayesian

posterior probabilities > 95%. The full extent

of the upper 95% HPD for the two most

basal nodes is not shown. The scale bar shows

time in millions of years ago.

C. M. Davy et al.


(including those of C. conspicuosa between Isla San Esteban

and Isla Cholludo) recorded by Nabhan suggest that such

events have been well documented in their oral history.

Furthermore, the Seri practice of breaking the legs of lizards

being transported for food (Nabhan, 2002) makes accidental

translocations unlikely. Iguanas with broken or dislocated legs

would be unlikely to escape successfully. Even if they did

escape, an injured male would have difficulty mating, and

crippled females might be unable to dig suitable nests. Thus,

they would be unlikely to contribute to the gene pool. Leg-

breaking was not used during deliberate translocations of

animals because the desired outcome (establishment of a new

population that subsequently could be harvested) would be

thwarted (Nabhan, 2002).

Other incidental evidence also suggests pre-Seri divergence

of C. conspicuosa and C. nolascensis. The population of

C. conspicuosa on Isla Cholludo founded by the Seri (Grismer,

2002; Nabhan, 2002) can be used (albeit cautiously) as a null

model for the expected genealogical pattern (i.e. incomplete

lineage sorting) caused by Seri translocation. Although we

could not include these sequences in our analysis, Cryder’s

(1999) analysis included two individuals from this population,

both of which fall undifferentiated into the lineage containing

samples from Isla San Esteban (Fig. 2). In contrast to these

patterns, the genealogical distinctiveness of populations on Isla

San Pedro Nolasco and Isla San Esteban provide further

evidence that these populations are not the result of human

translocations.

The oral history of the Seri is a valuable cultural resource,

not only for the Seri themselves, but also for the rest of

humanity. As such, Nabhan’s (2002, 2003) documentation of

the ethno-herpetology of this culture provides an important

record of Seri traditional knowledge, and a relatively unique

anthropological work. Unfortunately, several species of reptiles

pictured in the book are misidentified. For example, Derm-

achelys coriacea is labelled as Caretta caretta; Pituophis is

labelled as Lampropeltis; a desert tortoise (Gopherus agassizii) is

described as a ‘turtle’; a Sauromalus is labelled as Ctenosaura,

with the location of the photo incorrectly listed as Isla San

Esteban; and a Seri carving of a Ctenosaura is misidentified as

Sauromalus (Nabhan, 2003). These misidentifications raise the

question of whether other species described by Seri elders

could also be misidentified (i.e. assigned an incorrect scientific

name). This is not the case. The names associated with the

images are those in the photo archives of the Arizona-Sonora

Desert Museum, and the errors are editorial in nature (G.P.

Nabhan, University of Arizona, pers. comm. to R.W.M., 14

June 2010). The discrepancy in names does not invalidate the

traditional knowledge that Nabhan (2002, 2003) has so

carefully collected.

Along with its inherent value, traditional knowledge can be

an important source of scientific inspiration, and can inform

the development of scientific hypotheses and management

plans (e.g. Kimmins, 2008). However, the sharing of tradi-

tional knowledge by indigenous communities is a gesture of

trust, and selective interpretations of traditional knowledge by

members of the scientific community can damage that trust.

We acknowledge that the occurrence of C. conspicuosa on a

small, oceanic island far from any obvious founder popula-

tions is a biogeographical conundrum. Human (specifically

Seri Indian) activities are known to have strongly shaped the

biogeography of the Sea of Cortes, and human-mediated

dispersal of C. hemilopha between the islands was first

suggested to explain this puzzle nearly a century ago (Bailey,

1928). There is no doubt that the Seri are capable of

successfully founding insular populations of iguanid lizards

(Petren & Case, 1997, 2002; Murphy & Aguirre-Leon, 2002;

Nabhan, 2002, 2003), so Bailey’s original hypothesis of human-

mediated dispersal was a reasonable one. However, the current

question is not one of ability, but simply of whether or not

humans actually translocated C. hemilopha from Isla San Pedro

Nolasco to Isla San Esteban. At this time, traditional knowl-

edge and molecular biology both reject the hypothesis of

human-mediated dispersal of C. hemilopha between these two

islands, and a new interpretation of the biogeography of the

C. hemilopha complex is needed.

Biogeography of the C. hemilopha species complex

Our tree topology differs slightly from that shown in Fig. 2

(Cryder, 1999), but both genealogies indicate that at least two

independent colonization events were involved in the history

of C. nolascensis on Isla San Pedro Nolasco: one by an ancestor

shared with C. conspicuosa, and the other by an ancestor shared

with the mainland and peninsular species. Cryder’s tree places

C. nolascensis-2 as the immediate sister of C. macrolopha, while

our analyses resolves C. macrolopha and C. hemilopha in a

lineage sister to C. nolascensis-2. It is possible that we sampled

different haplotypes within C. nolascensis, which would suggest

the potential presence of three or more matrilines on Isla San

Pedro Nolasco. However, because the proportions of samples

falling into each C. nolascensis lineage are roughly equal in the

two studies, it is more likely that we sampled the same two

matrilines of C. nolascensis as Cryder. Although sampling was

limited in both studies, the frequencies of the two haplotypes

are about 60% C. nolascensis-1:40% C. nolascensis-2. These two

haplogroups had 4.5% divergence between them, a higher

divergence than occurred between any two recognized species

within the complex. Such genealogical patterns are often

interpreted as evidence for cryptic speciation (e.g. Tavares &

Baker, 2008). However, C. nolascensis is morphologically

distinct from the other species of Ctenosaura (Grismer,

1999), and we know of no previous mention of distinct

morphotypes within C. nolascensis on Isla San Pedro Nolasco.

Because of the morphological distinctness of C. nolascensis and

the lack of obvious mechanisms of reproductive isolation on

the island, we find the hypothesis of sympatric cryptic species

within C. nolascensis to be improbable.

Differences between Cryder’s and our trees probably result

from different sampling strategies. Cryder’s analysis included

the subspecies C. h. insulana from Isla Cerralvo, which may

have affected the inferred relationships among the species.



Furthermore, Cryder’s (1999) analysis of C. macrolopha was

based on individuals collected at a single locality within the

species’ wide range. Because this strategy was unlikely to

sample genetic diversity in mainland species, we collected

samples throughout the range of C. macrolopha along the coast

of Sonora and Sinaloa from the north to south extremes, as

well as for about half of the range for C. hemilopha on the

peninsula of Baja California (Fig. 1). However, our sampling

did not fully cover these species’ ranges, and sampling further

inland in Sonora and Sinaloa and further north on the

peninsula might have discovered additional lineages.

Further sampling of C. macrolopha could be extremely

informative, especially because the matrilines within this

species do not form a single lineage, and the species may

contain several more divergent lineages. One sample of

C. macrolopha (CH19, from Culiacan, Sinaloa) was resolved

as sister to C. nolascensis-1, and this is particularly intriguing.

The sample site is not near Isla San Pedro Nolasco (Fig. 1), and

the haplotype occurred alongside the more common haplotype

in C. macrolopha. Thus, there is no reason to suspect that

C. macrolopha haplotypes segregate geographically. There are

several potential explanations for the placement of this sample

in the genealogy. First, it could be the result of incomplete

lineage sorting. Second, the pattern could be caused by Seri (or

other human) transport of C. nolascensis to the mainland,

followed by deliberate or accidental introduction into the wild.

Given the estimated average divergence date of 1.57 Ma for

this haplotype (95% HPD = 3.32–0.23 Ma; Fig. 4), we find

these two explanations unlikely. Third, this pattern could

indicate historical dispersal from San Pedro Nolasco to the

mainland, followed by cytoplasmic capture and incorporation

of the C. nolascensis-like haplotype into C. macrolopha. The

presence of iguanids on many deep-water oceanic islands

testifies to their ability to disperse across oceans, and Isla San

Pedro Nolasco is only 14.6 km offshore. More rigorous

sampling of the matrilines present throughout Sonora and

Sinaloa may shed further light on the question.

The most perplexing aspect of the data is the counterin-

tuitive pattern of divergence, whereby the mainland and

peninsular species diverged after their origin from the two

insular species. Ctenosaura conspicuosa and C. nolascensis

became isolated from the mainland population of the

C. hemilopha complex after their divergence from C. pectinata.

The peninsula of Baja California, being formed more than

5 Ma (Murphy & Aguirre-Leon, 2002), is much older than the

minimum estimated Pleistocene divergence between the two

non-insular forms, C. hemilopha and C. macrolopha (Table 4).

This leads to two possible biogeographical scenarios. Ancestral

Ctenosaura from the mainland may have dispersed around

the head of the Sea of Cortes into the southern part of the

peninsula. Alternatively, the distribution may have been

continuous, and isolation could reflect Pleistocene climatic

changes. The absence of fossil Ctenosaura from California,

Arizona and the peninsula of Baja California suggests that

dispersal was probably involved. Regardless, isolation of the

peninsular population from the mainland population led to a

cladogenic event, probably during the Pleistocene. Evidence

from nuclear genes would allow the construction of a

more informative species phylogeny, which may clarify the

evolutionary history of these species. The detailed biogeo-

graphy of this species complex continues to defy detailed

interpretation, but we now know that humans were not

involved.

Human activities have played a pivotal role in the

biogeographical history of many species, but testing hypo-

theses of human translocations is often challenging, and

limited by the available evidence. We successfully used

traditional mtDNA analysis, together with Bayesian methods,

to refute the hypothesis of human-mediated dispersal in the

case of the C. hemilopha complex, and reached an alternative

conclusion that is in keeping with the traditional knowledge of

the Seri people. In our case, the traditional knowledge of the

Seri was carefully documented (Nabhan, 2002, 2003), but this

is often not the case. The teachings of many cultures are

rapidly being lost. It is our hope that the information

contained in traditional teachings can be preserved, and that

such knowledge will continue to inform scientific studies.

ACKNOWLEDGEMENTS

We especially thank the Seri people of Tiburon and Isla San

Esteban for permission to enter and sample lizards on their

traditional lands. Sample collection in Mexico was approved

by the Mexican government (SEMARNAT SGPA/ DGVS/

03489/07). Access to an MSc thesis from Loma Linda

University was kindly granted by W. Hays; R.L. Carter made

valiant attempts to retrieve M. Cryder’s sequence data; and

G.P. Nabhan graciously provided important information. We

thank C. Blair and two anonymous referees for valuable

comments on earlier versions of the manuscript. C.M.D. was

supported by a Canada Graduate Scholarship from the

National Research Council of Canada. This research was

supported by grants from the Natural Sciences and Engineer-

ing Research Council of Canada, Discovery Grant A3148, the

Royal Ontario Museum (ROM) Foundation, and the ROM

Members Volunteer Committee to R.W.M.

REFERENCES

Akaike, H. (1974) A new look at the statistical model identi-

fication. Institute of Electrical and Electronics Engineers

Transactions on Automatic Control, 19, 716–723.

Akaike, H. (1979) A Bayesian extension of the minimum AIC

procedure of autoregressive model fitting. Biometrika, 66,

237–242.

Austin, C.C. (1999) Lizards took express train to Polynesia.

Nature, 397, 113–114.

Bailey, J.W. (1928) A revision of the lizards of the genus

Ctenosaura. Proceedings of the United States National

Museum, 73, article 12, 1–57.

Benton, M.J. & Ayala, F.J. (2003) Dating the tree of life.

Science, 300, 1698–1700.

C. M. Davy et al.


Blair, C., Mendez de la Cruz, F.R., Ngo, A., Lindell, J., Lathrop,

A. & Murphy, R.W. (2009) Molecular phylogenetics and

taxonomy of leaf-toed geckos (Phyllodactylidae: Phyllo-

dactylus) inhabiting the peninsula of Baja California. Zoo-

taxa, 2027, 28–42.

Brandley, M.C., Schmitz, A. & Reeder, T.W. (2005) Partitioned

Bayesian analysis, partition choice, and the phylogenetic

relationships of scincid lizards. Systematic Biology, 54, 373–

390.

Carlton, J.T. (2003) Community assembly and historical

biogeography in the North Atlantic Ocean: the potential role

of human-mediated dispersal vectors. Hydrobiologia, 503,

1–8.

Carreno, A.L. & Helenes, J. (2002) Geology and ages of the

islands. A new island biogeography of the Sea of Cortes (ed. by

T.J. Case, M.L. Cody and E. Ezcurra), pp. 14–40. Oxford

University Press, New York.

Cryder, M. (1999) Molecular systematics and evolution of the

Ctenosaura hemilopha complex (Squamata; Iguanidae). MSc

Thesis, Loma Linda University, Loma Linda, CA.

Drummond, A.J., Ho, S.Y.W., Phillips, M.J. & Rambaut, A.

(2006) Relaxed phylogenetics and dating with confidence.

PLoS Biology, 4, 699–710.

Drummond, A.J., Ho, S.Y.W., Philips, M.J. & Rambaut, A.

(2007) BEAST: Bayesian evolutionary analysis by sampling

trees. BMC Evolutionary Biology, 7, 214–221.

Felsenstein, J. (1985) Confidence limits on phylogenies: an

approach using the bootstrap. Evolution, 39, 783–791.

Felsenstein, J. (2004) Inferring phylogenies. Sinauer Associates,

Sunderland, MA.

Goebel, T., Waters, M.R. & O’Rourke, D.H. (2008) The late

Pleistocene dispersal of modern humans in the Americas.

Science, 319, 1497–1502.

Grismer, L.L. (1994) Geographic origins for the reptiles on

islands in the Sea of Cortes, Mexico. Herpetological Natural

History, 2, 51–106.

Grismer, L.L. (1999) An evolutionary classification of reptiles

on islands in the Sea of Cortes, Mexico. Herpetologica, 55,

446–469.

Grismer, L.L. (2002) Spiny-tailed iguanas, insular evolution,

and Seri Indians: how long does it take to make a new

species and does it matter who makes it? Iguana Times, 9,

3–8.

Heckman, K.L., Mariani, C.L., Rasoloarison, R. & Yoder, A.D.

(2007) Multiple nuclear loci reveal patterns of incomplete

lineage sorting and complex species history within western

mouse lemurs (Microcebus). Molecular Phylogenetics and

Evolution, 43, 353–367.

Hillis, D.M. & Bull, J.J. (1993) An empirical test of boot-

strapping as a method for assessing confidence in phyloge-

netic analysis. Systematic Biology, 42, 182–192.

Huelsenbeck, J.P. & Ronquist, F. (2001) MRBAYES: Bayesian

inference of phylogenetic trees. Bioinformatics, 17, 754–755.

Kimmins, J.P. (2008) From science to stewardship: harnessing

forest ecology in the service of society. Forest Ecology and

Management, 256, 1625–1635.

Kocher, T.D., Thomas, W.K., Meyer, A., Edwards, S.V., Paabo,

S., Villablanca, F.X. & Wilson, A.C. (1989) Dynamics of

mitochondrial DNA evolution in animals: amplification and

sequencing with conserved primers. Proceedings of the

National Academy of Sciences USA, 86, 6196–6200.

Kohler, G., Schroth, W. & Streit, B. (2000) Systematics of the

Ctenosaura group of lizards (Reptilia: Sauria: Iguanidae).

Amphibia-Reptilia, 21, 177–191.

Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R.,

McGettigan, P.A., McWilliam, H., Valentin, F., Wallace,

I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J. &

Higgins, D.G. (2007) ClustalW and ClustalX version 2.0.

Bioinformatics, 23, 2947–2948.

Lowe, C.H., Jr & Norris, K.S. (1955) Analysis of the herpe-

tofauna of Baja California, Mexico. III. New and revived

reptilian subspecies of Isla San Esteban, Sea of Cortes,

Sonora, Mexico, with notes on the satellite islands of Isla

Tiburon. Herpetologica, 11, 89–96.

Morando, M., Avila, L.J., Baker, J. & Sites, J.W., Jr (2004)

Phylogeny and phylogeography of the Liolaemus darwinii

complex (Squamata: Liolaemidae): evidence for intro-

gression and incomplete lineage sorting. Evolution, 58,

842–861.

Murphy, R.W. & Aguirre-Leon, G. (2002) The nonavian

reptiles: origins and evolution. A new island biogeography

of the Sea of Cortes (ed. by T.J. Case, M.L. Cody and

E. Ezcurra), pp. 181–220. Oxford University Press, New

York.

Murphy, R.W., Sanchez-Pinero, F., Polis, G.A. & Aalbu, R.L.

(2002) New measurements of area and distance for islands

in the Sea of Cortes. A new island biogeography of the Sea of

Cortes (ed. by T.J. Case, M.L. Cody and E. Ezcurra), pp.

447–464. Oxford University Press, New York.

Nabhan, G.P. (2002) Cultural dispersal of plants and reptiles.

A new island biogeography of the Sea of Cortes (ed. by T.J.

Case, M.L. Cody and E. Ezcurra), pp. 407–416. Oxford


Nabhan, G.P. (2003) Singing the turtles to sea: the Comcaac

(Seri) art and science of reptiles. University of California

Press, Berkeley, CA.

Nei, M. & Kumar, S. (2000) Molecular evolution and phyloge-

netics. Oxford University Press, New York.

Nylander, J.A.A. (2004) MrModeltest v2. Program distributed

by the author. Evolutionary Biology Centre, Uppsala Uni-

versity. Available at: http://www.abc.se/~nylander/ (accessed

2 November 2008).

Palumbi, S.R., Martin, A., Romano, S., McMillan, W.O., Stice,

L. & Grabowski, G. (1991) The simple fool’s guide to PCR, v.

2.0. Department of Zoology and Kewalo Marine Laboratory,

University of Hawaii, Honolulu, HI.

Petren, K. & Case, T.J. (1997) A phylogenetic analysis of body

size evolution in chuckwallas (Sauromalus) and other

iguanines. Evolution, 51, 206–219.

Petren, K. & Case, T.J. (2002) Updated mtDNA phylogeny for

Sauromalus and implications for the evolution of gigantism.

A new island biogeography of the Sea of Cortes (ed. by T.J.



Case, M.L. Cody and E. Ezcurra), pp. 574–579. Oxford


Rambaut, A. & Drummond, A.J. (2007) Tracer v1.4. Available

at: http://tree.bio.ed.ac.uk/software/tracer/.

Reisz, R.R. & Muller, J. (2004) Molecular timescales and the

fossil record: a paleontological perspective. Trends in

Genetics, 20, 237–241.

Riddle, B.R., Dawson, M.N., Hadly, E.A., Hafner, D.J.,

Hickerson, M.J., Mantooth, S.J. & Yoder, A.D. (2008) The

role of molecular genetics in sculpting the future of inte-

grative biogeography. Progress in Physical Geography, 32,

173–202.

Ronquist, F. & Huelsenbeck, J.P. (2003) MrBayes 3: Bayesian

phylogenetic inference under mixed models. Bioinformatics,

19, 1572–1574.

Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R.,

Horn, G.T., Mullis, K.B. & Erlich, H.A. (1988) Primer-di-

rected enzymatic amplification of DNA with a thermostable

DNA polymerase. Science, 239, 487–491.

Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular

cloning – a laboratory manual, 2nd edn. Cold Spring Harbor

Laboratory Press, New York.

Smith, H.M. (1935) Miscellaneous notes on Mexican lizards.

University of Kansas Science Bulletin, 22, 119–155.

Smith, H.M. (1972) The Sonoran subspecies of the lizard

Ctenosaura hemilopha. Great Basin Naturalist, 32, 104–111.

Swofford, D.L. (2002) PAUP*. Phylogenetic analysis using

parsimony (*and other methods). Sinauer Associates, Sun-

derland, MA.

Tamura, K., Dudley, J., Nei, M. & Kumar, S. (2007) MEGA4:

Molecular evolutionary genetics analysis (MEGA) software

version 4.0. Molecular Biology and Evolution, 24, 1596–

1599.

Tavares, E.S. & Baker, A.J. (2008) Single mitochondrial gene

barcodes reliably identify sister-species in diverse clades of

birds. BMC Evolutionary Biology, 8, doi:10.1186/1471-2148-

8-81.

Upton, D.E. & Murphy, R.W. (1997) Phylogeny of the side-

blotched lizards (Phrynosomatidae: Uta) based on mtDNA

sequences: support for a midpeninsular seaway in Baja

California. Molecular Phylogenetics and Evolution, 8, 104–

113.

Zarza, E., Reynoso, V.H. & Emerson, B.C. (2008) Diversifica-

tion in the northern neotropics: mitochondrial and nuclear

DNA phylogeography of the iguana Ctenosaura pectinata

and related species. Molecular Ecology, 17, 3259–3275.

BIOSKETCH

Christina M. Davy is a PhD candidate at the University of

Toronto, supervised by Professor R.W. Murphy. Her other

research focuses on the applied conservation and conservation

genetics of freshwater turtles.

Author contributions: R.W.M., F.M.C. and C.M.D. planned

the study; F.M.C. and R.W.M. collected the samples; A.L.

performed the laboratory analyses; and C.M.D. analysed the

data and led the writing.

Editor: Brett Riddle

C. M. Davy et al.


Seri Indian traditional knowledge and molecular biology ...labs.eeb.utoronto.ca/murphy/PDFs of...

Documents

Transcript of Seri Indian traditional knowledge and molecular biology ...labs.eeb.utoronto.ca/murphy/PDFs of...