S-­‐1  

Supplementary  Data    

Septal localization of the Mycobacterium tuberculosis MtrB sensor kinase promotes MtrA

regulon expression

Renata Plocinska#, Gorla Purushotham#, Krishna Sarva, Indumathi S. Vadrevu, Emmanuel V. P.

Pandeeti, Naresh Arora, Przemyslaw Plocinski, Murty V. Madiraju* and Malini Rajagopalan*

 Table of contents:

1. Table S1: Strains and plasmids 2. Table S2. Oligonucleotides used for cloning 3. Table S3. Oligonucleotides used for qRT-PCR 4. Figures S1 to S6 with respective legends 5. References

  S-­‐2  

Table S1. Strains and plasmids   Name Description Reference STRAINS Top10F’ Escherichia coli strains Invitrogen BL21 (DE3) pLysS Novagen H37Rv Virulent wild type Mycobacterium tuberculosis Laboratory stock mC2155 M. smegmatis Laboratory stock FZ3 M. smegmatis FtsZ conditional expression strain,

Pami::ftsZ (see pLR27 below) (1)

FZ3-Ptet::mtrB-gfp FZ3 with pRD73 This study

Mtb-Ptet::mtrB-gfp M. tuberculosis with pKS4 integrated at attB locus and expressing mtrB-gfp

This study

Msmeg-Ptet::mtrB-gfp M. smegmatis with pKS4 integrated at attB locus and expressing mtrB-gfp

This study

ΔmtrB M. smegmatis mtrB deletion strain This study

Msmeg-Ptet::mtrBH305Y-gfp

M. smegmatis with pKS4H305Y-gfp This study

Msmeg-Ptet::mtrBH305D-gfp

M. smegmatis with pKS4H305D-gfp This study

Ptet::mtrBsol-gfp M. smegmatis with mtrBsol-gfp This study

CLONING VECTORS pMALC4E E. coli expression vector carrying N-terminal fusion

with MBP (maltose binding protein), Ampr New England Biolabs

pLR56 E. coli – Mycobacterium shuttle vector, integrating, with tet promoter and tet repressor, Kmr

(2)

pLR52 E. coli – Mycobacterium shuttle vector, replicating, with tet promoter and tet repressor, Hygr

(2)

pLR27 Pami::ftsZ from pJFR78 in pMV306K, Hygr This study pJFR78 Pami::ftsZTB in pMV306H, Hygr (1) pMG103 E. coli – Mycobacterium shuttle vector, replicating,

with amidase promoter, Kmr (2)

pKT25 E. coli expression vector allowing fusions to C-terminal of the T25 fragment of cyaA , Kmr

(3)

pUT18C E. coli expression vector allowing fusions to C-terminal of the T18 fragment of cyaA, Ampr

(3)

pKNT25 E. coli expression vector allowing fusions to N-terminal of the T25 fragment of cyaA , Kmr

(3)

pUT18 E. coli expression vector allowing fusions to N-terminal of the T18 fragment of cyaA, Ampr

(3)

p2NIL Non-replicating recombination vector, Kmr (4) pGOAL17 Plasmid carrying PacI cassette, Ampr (4)

pJFR19

Integration proficient Mycobacterium vector with amidase promoter, Hygr

(5)

  S-­‐3  

pMV306H Integration proficient Mycobacterium vector, promoter-less, Hygr

Cliff Barry, NIH

pMV306K Integration proficient Mycobacterium vector, promoter-less, Kmr

Cliff Barry, NIH

PLASMIDS USED IN THIS STUDY pDS21

mtrBTB C-terminal 334 aa cloned in pMALc4E, Ampr

(6)

pSVM4 mtrBTB cloned into pLR52 vector, Hygr This study pSVM16 mtrBH305D (C-terminal 334 aa) cloned in pMALc4E

vector, Ampr This study

pSVM17 mtrBH305Y (C-terminal 334 aa) cloned in pMALc4E vector, Ampr

This study

pSVM25 mtrBsol-gfp in pLR56, Hygr; mtrBsol (C-terminal 334 aa) replaced ftsZ in pRD3

This study

pRD3 ftsZTB-gfp under the Ptet promoter in pLR56, Kmr

(2)

pRD73 mtrBTB-gfp cloned in pLR52 vector, mtrBTB CDS replaced ftsZ in pRD3, Hygr

This study

pRD83 mtrBH305Y cloned in pLR56 vector, Kmr; Ptet:: mtrBH305Y-gfp

This study

pRD89 835 bp upstream fragment of mtrB gene cloned in p2NIL vector, Kmr

This study

pRD90 1007 bp fragment carrying 300 bp of 3’ end of mtrB gene and 700-bp of lpqB sequence cloned into pRD89 vector, Kmr

This study

pRD91 pRD90 with PacI cassette in p2NIL vector, Kmr This study pRD102 mtrB cloned in pJFR19 (Pami::mtrB), Hygr This study pRD105 ftsI cloned in pMG103 (Pami::ftsI), Kmr This study pKS4 mtrBTB-gfp cloned in pLR56 vector, mtrBTB CDS

replaced ftsZ in pRD3, Kmr This study

pKS4H305D mtrBH305D-gfp cloned in pLR56 vector, Kmr This study

pKS4H305Y mtrBH305Y-gfp cloned in pLR56 vector, Kmr This study pKNT25ftsZ ftsZTB cloned as C-terminal fusion into pKNT25 low

copy replicating vector, Kmr (2)

pUT18ftsZ ftsZTB cloned as C-terminal fusion into pUT18 high copy replicating vector, Ampr

(2)

pKS7 mtrBTB cloned as C-terminal fusion into pKNT25 low copy replicating vector, Kmr

This study

pKS9 mtrBTB cloned as C-terminal fusion into pUT18 high copy replicating vector, Ampr

This study

pNM19 devSTB-gfp cloned into replicating plasmid pLR52, Hygr

This study

pNM28 gfp-mtrBTB cloned into replicating plasmid pLR52, Hygr

This study

pDS4 mtrAY102C in pJFR19, Hygr This study

pDS13 mtrAY102C in pET19b, Ampr This study pMZ3 mtrAD13A in pJFR19, Hygr (6)

  S-­‐4  

pMZ6 mtrAD13A in pET19b, Ampr; coding region from pMZ3 cloned in pET19b

This study

  S-­‐5  

Table S2. Oligonucleotides used for cloning Name of primer Sequence (5’ -> 3’) Construct created MVM883 agaaccttaattaagagccccaccagggaggaagccgaacgatga

tcttcggctcgcgccg pSVM4, pKS4, pRD73, pRD83

MVM884 atcggatttaaattcaaccgctccactccgcg pSVM4, pRD83, MVM877 cggggtaccgatgtcgcgtcaggtggtggtgcc pDS21, pSVM16, pSVM17 MVM878 cccaagctttcaaccgctccactccgcgtg pDS21, pSVM16, pSVM17 MVM814 ttgctctagaaccgctccactccgcgtgctcacgt pKS4, pRD73, pSVM25 MVM892 cacctccgacgtcagcgacgaactgcgtacgccgc pKS4H305D MVM892R gcggcgtacgcagttcgtcgctgacgtcggaggtg pKS4H305D MVM891 cacctccgacgtcagctacgaactgcgtacgccgc pKS4H305Y MVM891R gcggcgtacgcagttcgtagctgacgtcggaggtg pKS4H305Y MVM908 ggaattccatatgagccgcgccgcccccaggc pRD105 MVM855 ttgctctagattactaggtggcctgcaagaccaa pRD105 MtrB_F gcctctagaatgatcttcggctcgcgccga pKS7, pKS9 MVM847 ttacttaggtacccgaccgctccactccgcgtgct pKS7, pKS9 MR91 gcaaaagtactccgcgtgtggtagccgagtt pRD89 MR92 gtcccaagcttccaacgcccacgtatgcgccg pRD89 MR89 gtcccaagcttgccgctcaagcctgcctcg pRD90 MR90 ataagaatgcggccgcgaggtctcccagccgtcggc pRD90 MR162 agaaccttaattaagagccccaccagggaggaagccgaacgatgt

cgcgtcaggtggtggtgcc pSVM25

MVM921 gcagtactaacaacaacctgcagatggtgagcaagggcgagga pSVM15 MVM922 gtagtctagattacttgtacagctcgtccatgc pSVM15 devS_F accttaattaagagccccaccagggaggaagccgaacgatgacaa

cagggggcctcgtcg pNM19

devS_R ttgctctagactgcgacaacggtgctgacca pNM19 mtrB-F gcctctagaatgatcttcggctcgcgccga pNM28 mtrB_R ccggagctcgatttaaattcaaccgctccactccgcg pNM28 gfp_F agaaccttaattaagagccccaccagggaggaagccgaacgatga

gtaaaggagaagaact pNM28

gfp_R ggctctagactgcaggttgttgtttttgtatagttcatccatgc pNM28, pKS44 gfp_swaI atcggatttaaattatttgtatagttcatccatgcc pRD73, pKS4 MVM782_F ttgccgcgctaaccgggcgg PripA, with 5’-FAM MVM783_R tcgactcagatctcctagggctcaa PripA with 5’-FAM Y102C_F cgggcgccgacgactgcatcatgaagccgttc pDS4, pDS13 Y102C_R gaacggcttcatgatgcagtcgtcggcgcccg pDS4, pDS13 MVM223 cgg  tcatcgccgtgatcgg For PCR confirmation

  S-­‐6  

Table S3. Oligonucleotides used for qRT-PCR Target/gene Primer Name Sequence (5’ -> 3’) sigA

sigAqRT_F sigAqRT_R

gtg ggc agc gac caa agc aag act tcg ccg ctg ttc gct tg

mtrA MR199-Msmg-MtrA_F MR199-Msmg-MtrA_R

tca ctg gcc gag atg ctc ac cac atc gat gcc gtt cat cc

mtrB Msmg-mtrBqRT1 Msmg-mtrBqRT2

tgc aga ccg aag ggt tct cc gcg cga tgg tgc tct cct cg

wag31 wag31-Msmeg-qRT1 wag31-Msmeg-qRT2

ttc cga gat cat ggg aac cat tg gag ctg cga ctc cag gta ggt c

ftsI MR197-Msmg-FtsIF MR197-Msmg-FtsIR

ccg acg gtt cgg tga cct ac ctt cgc cat ctg gac ctg c

dnaA dnaA-Msmeg-qRT1 dnaA-Msmeg-qRT2

ctt cat caa ctc gct gcg tga c tgg aag aac tcc tcc tgg atg c

ripA ripA-MsmgqRT1 ripA-MsmgqRT2

gtt cct gca gaa gct cgg aat c cac gag tag ggc aca ccg atc

fbpB MS85BqRT1 MS85BqRT2

ttc gag atg ttc ctc gac tc cca ctt gta ggt gac gca g

ftsZ M.smg.ftsZqRTF M.smg.ftsZqRTR

ggc cat cgg ctc ggc gcg cg cct cgt tga tct cga aga gc

chiZ M.smg.chiZqRTF M.smg.chiZqRTR

tcg gtc tcg tcg cgc agt tc ggt cac gga tct gct gga cc

pfkB pfkb-smg-qRTF pfkb-smg-qRTR

cct gga cgg acc ggt agt tg tga agc tct cac gcg tca cc

  S-­‐7  

Fig. S1

Figure S1: Western blot analysis of M. tuberculosis lysates: Approximately 5 µg protein lysates of wild-type (WT), Mtb-Ptet::mtrB (MtrB) and Mtb-Ptet::mtrB-gfp (MtrB-GFP) induced with 10 ng/ml tetracycline were resolved in 12% SDS-PA gels, transferred to PVDF membrane and immunoblotted with α-SigA (top panel) and α-MtrB (bottom panel) antibodies. The positions of SigA, MtrB and MtrB-GFP are marked with arrowheads. – and + indicate cultures treated without and with 10 ng/ml anhydrotetracycline. Please note that MtrB-GFP fusion protein in the cell-free lysates was found prone to degradation and the extent of degradation varied from experiment to experiment.

  S-­‐8  

Fig. S2

Figure S2: Visualization of GFP-MtrB structures in M. smegmatis. Actively growing cultures of M. smegmatis (i, ii) and ΔmtrB mutant (iii, iv) expressing Ptet::gfp-mtrB were induced with 10 ng/ ml anhydrotetracycline for 1.5 hrs and visualized by brightfield (i, iii) and fluorescent (ii, iv) microscopy. Distinct midcell (arrow) localizations were very few in both strains and these signals tended to bleach rapidly. Arrowheads – aberrant fluorescent aggregates.

  S-­‐9  

Fig. S3

Figure S3: BACTH analysis of FtsZ-MtrB interactions: E. coli BTH101 cotransformed with plasmids ftsZ/ftsZ, mtrB/ftsZ and gcn4/gcn4 were tested for their ability to produce blue color on indicator agar plates as described. Transformants bearing ftsZ/ftsZ and gcn4/gcn4 showed intense blue color indicating positive interaction, whereas that carrying mtrB/ftsZ did not.

  S-­‐10  

Fig. S4

Figure S4: MtrB does not interact with FtsZ: Pull-down assays: E. coli lysates with His-FtsZ and MBP-ClpX (i) or MBP-MtrB (ii) were incubated with NiNTA resin as described (2), bound proteins were eluted with buffer containing 0.3 M imidazole. Various fractions were separated in SDS-PA gels, transferred to PVDF membranes and proteins visualized by immunoblotting using indicated antibodies. L – Load, W – wash and E – elution fractions. ClpX but not MtrB was visible in elution fractions indicating lack of interaction between FtsZ and MtrB. Co-immunoprecipitation assays: M. smegmatis lysates containing FtsZ + MtrB (or CrgA) were incubated overnight with α-FtsZ antibodies coupled to magnetic beads (Bio-Mag amine). Beads were washed 5X with Tris-buffered saline (pH 7. 0) and FtsZ immunoprecipitates eluted with 100 mM glycine-HCl buffer (pH 2.5). Eluted proteins were neutralized with 1M Tris (pH 8.0) separated by SDS-PAGE and visualized following immunoblotting with α-FtsZ (top panels), α-MtrB (bottom left panel) or α–CrgA (bottom right panel) antibodies. FtsZ immunoprecipitates contained CrgA but not MtrB.

  S-­‐11  

Fig. S5

Figure S5: Visualization of mutant MtrB-GFP structures in Mtb. Actively growing M. tuberculosis cultures transformed with Ptet::mtrBH305Y-gfp and Ptet::mtrBH305D-gfp were visualized by brightfield (i, iii and v) and fluorescent (ii, iv and vi) microscopy. For comparison, data with Ptet::mtrBWT-gfp were also included.

  S-­‐12  

Fig. S6

Figure S6: Polyacrylamide gel analysis of oriC-MtrAD13A complexes. MtrAD13A protein was phosphorylated by EnvZ protein in the presence of ATP. MtrAD13A and MtrAD13A~P were incubated individually with 200 fmoles of FAM-labeled oriC region [550-bp; (7)] for 15 min at 370C, samples were resolved by polyacrylamide gel electrophoresis and visualized in a BioRad Molecular Imager Fx. The positions of oriC probe and MtrAD13A-oriC complexes are marked. MtrAD13A was used at 5, 10, 15, 20 and 25 µM.

  S-­‐13  

References:    1.   Dziadek,  J.,  Rutherford,  S.  A.,  Madiraju,  M.  V.,  Atkinson,  M.  A.,  and  Rajagopalan,  

M.  (2003)  Conditional  expression  of  Mycobacterium  smegmatis  ftsZ,  an  essential  cell  division  gene:Microbiology  149,  1593-­‐1603  

2.   Dziedzic,  R.,  Kiran,  M.,  Plocinski,  P.,  Ziolkiewicz,  M.,  Brzostek,  A.,  Moomey,  M.,  Vadrevu,  I.  S.,  Dziadek,  J.,  Madiraju,  M.,  and  Rajagopalan,  M.  (2010)  Mycobacterium  tuberculosis  ClpX  interacts  with  FtsZ  and  interferes  with  FtsZ  assembly:PLoS  ONE  5,  1-­‐14  

3.   Karimova,  G.,  Dautin,  N.,  and  Ladant,  D.  (2005)  Interaction  network  among  Escherichia  coli  membrane  proteins  involved  in  cell  division  as  revealed  by  bacterial  two-­‐hybrid  analysis:J.  Bacteriol.  187,  2233-­‐2243  

4.   Parish,  T.,  and  Stoker,  N.  G.  (2000)  Use  of  a  flexible  cassette  method  to  generate  a  double  unmarked  Mycobacterium  tuberculosis  tlyA  plcABC  mutant  by  gene  replacement:Microbiology  146  (  Pt  8),  1969-­‐1975  

5.   Fol,  M.,  Chauhan,  A.,  Nair,  N.  K.,  Maloney,  E.,  Moomey,  M.,  Jagannath,  C.,  Madiraju,  M.  V.,  and  Rajagopalan,  M.  (2006)  Modulation  of  Mycobacterium  tuberculosis  proliferation  by  MtrA,  an  essential  two-­‐component  response  regulator:Mol.  Microbiol.  60,  643-­‐657  

6.   Al  Zayer,  M.,  Stankowska,  D.,  Dziedzic,  R.,  Sarva,  K.,  Madiraju,  M.  V.,  and  Rajagopalan,  M.  (2011)  Mycobacterium  tuberculosis  mtrA  merodiploid  strains  with  point  mutations  in  the  signal-­‐receiving  domain  of  MtrA  exhibit  growth  defects  in  nutrient  broth:Plasmid  65,  210-­‐218  

7.   Rajagopalan,  M.,  Dziedzic,  R.,  Al  Zayer,  M.,  Stankowska,  D.,  Ouimet,  M.  C.,  Bastedo,  D.  P.,  Marczynski,  G.  T.,  and  Madiraju,  M.  V.  (2010)  Mycobacterium  tuberculosis  origin  of  replication  and  the  promoter  for  immunodominant  secreted  antigen  85B  are  the  targets  of  MtrA,  the  essential  response  regulator:J.  Biol.  Chem.    285,  15816-­‐15827