Seed transmission of Candidatus Liberibacter asiaticus in periwinkle and dodder along with low bacterial titer and without transmission of lethal disease

L.-J. Zhou1, Y.-P. Duan2, D. W. Gabriel1 and T. Gottwald2

1Dept. of Plant Pathology, UF, Gainesville, FL 32653 and 2USDA-ARS-USHRL, Fort Pierce, FL 34945

AbstractCanadidatus Canadidatus Liberibacter asiaticus (Las) is the most widely-distributed species among three Liberibacter asiaticus (Las) is the most widely-distributed species among three

species of Liberibacter that are associated with citrus Huanglongbing (HLB), a lethal species of Liberibacter that are associated with citrus Huanglongbing (HLB), a lethal

disease of citrus worldwide. In addition to citrus, periwinkle (disease of citrus worldwide. In addition to citrus, periwinkle (Catharanthus roseusCatharanthus roseus) and ) and

dodder (dodder (Cuscuta pentagonaCuscuta pentagona) are two experimental hosts in which the bacteria can multiply ) are two experimental hosts in which the bacteria can multiply

well. Symptoms of HLB in inoculated-periwinkle were characterized by progressive vein well. Symptoms of HLB in inoculated-periwinkle were characterized by progressive vein

and leaf yellowing, resulting in death of most HLB-infected periwinkles within six month and leaf yellowing, resulting in death of most HLB-infected periwinkles within six month

after first appearance of symptoms. Dodder plants did not exhibit symptoms, even when after first appearance of symptoms. Dodder plants did not exhibit symptoms, even when

they contain high titers of the bacterium. they contain high titers of the bacterium. Las was detected in 33.3% and 23.3% of seeds Las was detected in 33.3% and 23.3% of seeds

tested from HLB-infected periwinkle and dodder without resorting to nested PCRtested from HLB-infected periwinkle and dodder without resorting to nested PCR. The PCR . The PCR

amplicons were confirmed by sequence analysis. Germination rates of these Las-positive amplicons were confirmed by sequence analysis. Germination rates of these Las-positive

seeds from both plant species were normal. Over 80% of the periwinkle plants germinated seeds from both plant species were normal. Over 80% of the periwinkle plants germinated

from the infected seeds showed initial HLB symptoms of vein yellowing and leaf yellowing from the infected seeds showed initial HLB symptoms of vein yellowing and leaf yellowing

only when they were stressed by nutrient deficiency. Surprisingly, the disease progressed only when they were stressed by nutrient deficiency. Surprisingly, the disease progressed

slowly, and did not cause plant death, and all symptomatic plants became asymptomatic slowly, and did not cause plant death, and all symptomatic plants became asymptomatic

after the stress was removed. The Las population remained in very low titer; in most cases, after the stress was removed. The Las population remained in very low titer; in most cases,

detected only by nested PCR or regular PCR by increasing the concentration of the detected only by nested PCR or regular PCR by increasing the concentration of the

bacterial DNA. The periwinkles-infected with Las via seed transmission have been bacterial DNA. The periwinkles-infected with Las via seed transmission have been

maintained for over six months. These results suggest that although Las was seed maintained for over six months. These results suggest that although Las was seed

transmitted, a second, undescribed component of an HLB disease complex was not.transmitted, a second, undescribed component of an HLB disease complex was not.

Fig 1. Symptom of HLB-infected periwinkle. A: graft transmitted periwinkle with Fig 1. Symptom of HLB-infected periwinkle. A: graft transmitted periwinkle with yellowing and small leave; B: graft transmitted periwinkle with rapid systemic yellowing and small leave; B: graft transmitted periwinkle with rapid systemic movement of yellowing symptom; C: 4 month after dodder transmission showing leave movement of yellowing symptom; C: 4 month after dodder transmission showing leave yellowing and wilt tip resulting in death of plant; D. Dodder transmitted periwinkle yellowing and wilt tip resulting in death of plant; D. Dodder transmitted periwinkle survival over one year with complex symptom-survival over one year with complex symptom-half of the plant remains sick and the other half has become asymptomatic.

Introduction Citrus Huanglongbin (HLB), a lethal disease of citrus, has been widespread in most

citrus producing countries including Asian, Africa, Arabian Peninsula, and most

recently in Brazil and Florida (Bové 2006). By January 2008, the HLB has been spread

throughout thirty of the citrus producing counties in Florida since its first report on

August 2005. HLB is associated with phloem-limited fastidious α-proteobacteria in the

genus Candidatus Liberibacter. Canadidatus Liberibacter asiaticus (Las) is the most

widely-distributed species among three species of Candidatus Liberibacter that are

associated with citrus HLB, and the only species detected in Florida to date.

Las can be transmitted via insect vector Asian citrus psyllid (Diaphorina citri), by

grafting or through dodder transmission (Bové 2006, Halbert, 2004, Zhou et al., 2007),

however there is little information on the seed transmission of HL. Determination if

Las bacterium is seed transmissible is crucial for HLB disease control. Periwinkle

(Catharanthus roseus) and dodder (Cuscuta campestris) are two experimental host plant

in which HLB bacteria can multiply as well as or even better than those in citrus. The

main objective of this research was to determine if Las bacterium can presence in the

periwinkle or dodder seeds, and if Las bacterium can translocate from seeds to seedlings

and cause HLB in periwinkle.

Materials and Methods: Periwinkle and dodder are two HLB experimental hosts used in this study , and the later was also

used as plant vector to transmit HLB pathogen(s) from sweet orange to periwinkle or from periwinkle

to periwinkle. All the transmission experiments were performed in the HLB-proofed green house in

United State Horticulture Research Laboratory (USHRL), USDA-ARS, Fort Pierce, FL. HLB

infected source plant used for dodder transmission was potted sweet orange (Citrus sinensis) tree

moved from citrus orchard and maintained in the green house with typical HLB symptom.

Maintenance of Las in periwinkle was conducted by periodic top-grafting to healthy periwinkle .

Fifty dodder plants generated from HLB-infected dodder seeds were maintained on healthy

periwinkle plant before sampling for PCR test. From 2007-2008, 168 of periwinkle plants were

generated periodically from HLB-infected periwinkle seeds, and the leave sample were collected for

detection of Las bacteria after nutrient deficiency stressed for two month.

One hundred twenty seeds from each treatment were divided into 30 tubes with 4 seeds in each

tube, total DNA was extracted according to the instruction of Wizard Genomic DNA Purification Kit

(Promega Corp., Madison, WI) after freezing in liquid nitrogen and grinding seeds with disposable

plastic pestle in 1.5mL tube. Total DNA in midribs of periwinkle leaves from different treatment

were extracted as described by Irey et al.(2006) .

Conventional PCR and nest PCR primers listed in table 1. PCR product were cloned into the

TOPO TA cloning vector pCR2.1 , and subjected for sequence analysis. Real-time PCR

amplifications were performed using Applied Biosystems 7500 Real-Time PCR System, data were

analyzed using Applied Biosystems 7500 system SDS software version1.2. CT value less than 34.0

was considered as Las-positive.

Table 1. Primer list for conventional PCR, nest PCR and real-time PCR

Prime name

Target gene

Sequence (5'-3')Annealing Temp

Size of PCR product

Reference

OI1 16S rDNA GCGCGTATGCAATACGAGCGGCA 64°C   Jagoueix, et al., 1996

OI2C 16S rDNA GCCTCGCGACTTCGCAACCCAT 64°C 1160bp Jagoueix, et al., 1996

CGO3f 16S rDNA RGGGAAAGATTTTATTGGAG 53°C   Zhou, et al., 2007

CGO5r 16S rDNA GAAAATAYCATCTCTGATATCGT 53°C 798bp Zhou, et al., 2007

           

HLBas 16S rDNA TCGAGCGCGTATGCAATACG     Li, W. et al, 2005

HLBr 16S rDNA GCGTTATCCCGTAGAAAAAGGTAG 58°C 76bp Li, W. et al, 2005

PROBE          

HLBp   56-FAM/AGACGGGTGAGTAACGCG/3BHQ-1     Li, W. et al, 2005

Table 2: PCR test for the presence of Las bacterium in HLB-infected periwinkle and dodder

DNA sample Total No.Ratio of positive sample

Conventional PCR Nest PCR qPCR

PeriwinkleSeeds 30(120 seeds) 33.3% 56.7% 53.3%

Plant tissue 168 0 7.10% 0

DodderSeeds 30(120 seeds) 23.3% 40% 36.70%

Plant tissue 50 0 3.72% 0

Results

From 2007-2008, all of the 18 periwinkle plants connected to HLB infected sweet orange start to

showing symptom within three month after connection through dodder, all of the 40 graft-inoculated

periwinkle plant start to showing symptom within one month after grafting. Symptoms of HLB in all

inoculated-periwinkle were characterized by progressive vein and leaf yellowing, some of them

accompany with small leave and/or wilt (Fig1), resulting in death of most HLB-infected periwinkles

within six month after first appearance of symptoms (Fig 1 C), except for one of dodder transmitted

periwinkle which is one side recovery from diseased symptom with tested nest PCR negative, while

the other side still showing typical symptom and tested strong positive by conventional PCR. This

periwinkle plant has been survive for more than one and half years. Dodder plants did not exhibit

symptoms, even when they contain high titers of the bacterium.

Las was detected from 33.3% -56.7% of HLB-infected periwinkle seeds by conventional PCR and

nest PCR, and 23.3%-40% from infected dodder seeds by conventional PCR and nest PCR (Table 2),

the conventional PCR product were confirmed by sequence analysis, however no significant

morphological differences could be observed between HLB-infected and non-infected periwinkle and

dodder seeds (Fig 2, A-D), and germination rates of these Las-positive seeds from both plant species

were normal. Over 80% of the periwinkle plants germinated from the infected seeds showed initial

HLB symptoms of vein yellowing and leaf yellowing only when they were stressed by nutrient

deficiency(Fig2 E-F), among which 7.1% of periwinkle and 3.72% of dodder detected were HLB nest

PCR positive, all symptomatic plants became asymptomatic after the stress was removed. The disease

progressed slowly, and did not cause plant death, the periwinkles-infected with Las via seed

transmission have been maintained for over one year.

Fig 1. conventional PCR/nest PCR detection of the Las bacterium in periwinkle seeds collected Fig 1. conventional PCR/nest PCR detection of the Las bacterium in periwinkle seeds collected

from HLB-infected plants with primer OI1/OI2c for conventional PCR (A ) plus CGO3F/CGO5R from HLB-infected plants with primer OI1/OI2c for conventional PCR (A ) plus CGO3F/CGO5R

for nest PCR primers (B ).for nest PCR primers (B ). From left to right: 1kb DNA ladder; 1-30, 30 periwinkle seeds DNA sample; +, From left to right: 1kb DNA ladder; 1-30, 30 periwinkle seeds DNA sample; +,

positive control; -, negative control. positive control; -, negative control.

References CitedReferences Cited1. Bové, J. M. 2006. Huanglongbing: A destructive, newly emerging, century-old disease of citrus. J.

Plant Pathol. 88: 7-37.

2. Capoor, S. P., Rao, D. G. and Viswanath, S. M. 1967. Diaphorina citri Kuway., a vector of the

Huanglongbing disease of citrus in India. Indian J. Agr. Sci. 37: 572-576.

3. Halbert, S.E., Manjunath, K.L., 2004. Asian citrus psyllid (Sternorrhycha: Psyllidae) and greening

disease of citrus: A literature review and assessment of risk in Florida. Fla. Entomol. 87:330-353

4. Jagoueix, S., Bové, J. M. and Garnier, M. 1996. PCR detection of the two ‘Candidatus’ Liberobacter

species associated with greening disease of citrus. Mol. and Cell. Probes 10: 43-50.

5. Li, W.B., Hartung, J. S., and Levy, L. 2006. Quantitative real-time PCR for detection and

identification of Candidatus Liberibacter species associated with citrus huanglongbing. J. Microbiol.

Methods 66: 104-115.

6. Zhou L. J., Gabriel D. W., Duan Y. P., Halbert S. E., and Dixon W. N., 2007. First report of dodder

transmission of Huanglongbing from naturally infected Murraya paniculata to citrus. Plant Disease,

91:227.

Conclusion1. The Las population was high in HLB-infected periwinkle and dodder seeds, but remained very low

titer in seed transmitted periwinkle and dodder; in most cases, detected only by nested PCR.

2. The vein yellowing symptom on seed transmitted periwinkle plant only shown up when they were

stressed by nutrient deficiency, and back to normal after nutrient recovery.

3. Most of dodder transmitted or graft transmitted HLB infected periwinkle plant died within 6 month

after inoculation, but seed transmitted periwinkle plant has been survival for over one year.

4. The reason for the only one periwinkle with half symptomatic and half asymptomatic is due to plant

nature resistance or complex interaction among different endophyte bacteria still unknown.

5. These results suggest that although Las was seed transmitted, a second, undescribed component of

an HLB disease complex was involves or not still worth to know.

Fig. 2. Periwinkle and dodder seed transmission. A, B: HLB-infected and non-infected Fig. 2. Periwinkle and dodder seed transmission. A, B: HLB-infected and non-infected

periwinkle without morphological difference; C, D: HLB-infected and non-infected periwinkle without morphological difference; C, D: HLB-infected and non-infected

periwinkle without morphological difference ; E, F: vein yellowing symptom on seed periwinkle without morphological difference ; E, F: vein yellowing symptom on seed

transmitted periwinkle after nutrient deficiencytransmitted periwinkle after nutrient deficiency