SecretedFrizzled-RelatedProtein4RegulatesTwo...

Secreted Frizzled-Related Protein 4 Regulates TwoWnt7a Signaling Pathways and Inhibits Proliferationin Endometrial Cancer Cells

Kendra S. Carmon and David S. Loose

Department of Integrative Biology and Pharmacology, University of Texas Health ScienceCenter Houston, Houston, Texas

AbstractIn the endometrium, hormonal effects on epithelial

cells are often elicited through stromal hormone

receptors via unknown paracrine mechanisms. Several

lines of evidence support the hypothesis that Wnts

participate in stromal-epithelial cell communication.

Wnt7a is expressed in the luminal epithelium, whereas

the extracellular modulator of Wnt signaling, secreted

frizzled-related protein 4 (SFRP4), is localized to the

stroma. Studies have reported that SFRP4 expression is

significantly decreased in endometrial carcinoma and

that both SFRP4 and Wnt7a genes are differentially

regulated in response to estrogenic stimuli. Aberrant

Wnt7a signaling irrevocably causes organ defects and

infertility and contributes to the onset of disease.

However, specific frizzled receptors (Fzd) that bind

Wnt7a and the particular signal transduction pathway

each Wnt7a-Fzd pair activates have not been identified.

Additionally, the function of SFRP4 in the endometrium

has not been addressed. We show here that Wnt7a

coimmunoprecipitates with Fzd5, Fzd10, and SFRP4 in

Ishikawa cells. Wnt7a binding to Fzd5 was shown to

activate B-catenin/canonical Wnt signaling and increase

cellular proliferation. Conversely, Wnt7a signaling

mediated by Fzd10 induced a noncanonical c-Jun

NH2-terminal kinase–responsive pathway. SFRP4

suppresses activation of Wnt7a signaling in both an

autocrine and paracrine manner. Stable overexpression

of SFRP4 and treatment with recombinant SFRP4 protein

inhibited endometrial cancer cell growth in vitro . These

findings support a mechanism by which the nature of the

Wnt7a signal in the endometrium is dependent on the

Fzd repertoire of the cell and can be regulated by SFRP4.

(Mol Cancer Res 2008;6(6):1017–28)

IntroductionThe uterine endometrium is a complex tissue that responds

to numerous hormones and undergoes dynamic reorganization

during the menstrual cycle in preparation for implantation (1).

The development, growth, and functional differentiation of the

endometrium are dependent on a dynamic collaboration

between its constituent stromal and epithelial cells (2).

Hormonal effects on epithelial cells are often elicited through

stromal hormone receptors via paracrine mechanisms (3, 4).

Recombination experiments using estrogen receptor a knock-

out and wild-type tissues showed that it is the stromal cell

estrogen receptors that are responsible for mediating epithelial

proliferation induced by estrogen (5). Progesterone acting on

the stromal compartment opposes estrogen-induced epithelial

proliferation and regulates paracrine mediators that influence

epithelial gene expression. However, the complete nature of

the paracrine signaling and the molecular basis of how stromal

and epithelial cells communicate to one another remain largely

unknown. Wnt7a is expressed in the endometrium and levels

have been shown to fluctuate in response to circulating steroid

hormones during the menstrual cycle and pregnancy (6).

Wnt7a is required for proper differentiation and gland

formation during uterine development. Following postnatal

growth, Wnt7a expression becomes restricted primarily to the

luminal epithelium and is responsible for maintaining expres-

sion of other Wnts in the stroma (6-9). Given that Wnts

undergo hormone regulation and different Wnts are generally

localized to different cell types in the endometrium suggests

that Wnt signaling may play a key role in the action of steroid

hormones and in mediating intercellular communication in the

endometrium.

Members of the Wnt signaling family are highly conserved,

secreted glycoproteins that are vital to mammalian development

and many aspects of adult tissue homeostasis. Wnts regulate

important cellular processes, such as proliferation, differentia-

tion, and cell fate specification (10). The binding of a Wnt

ligand to its corresponding seven-transmembrane frizzled

receptor (Fzd) leads to the activation of at least one of the

three possible signaling pathways: (a) the h-catenin/canonicalpathway, (b) the planar cell polarity/c-Jun NH2-terminal kinase

(JNK) pathway, and (c) the Ca2+-mediated pathway (10, 11).

The complexity of mammalian Wnt signaling is exemplified by

the fact that there are currently 19 known mammalian Wnts and

10 Fzds (10, 12). Despite the numerous studies that have been

done to date, it has yet to be completely elucidated which

particular Wnts bind to which Fzds and what signal

transduction pathway each Wnt-Fzd pair activates.

Received 2/8/08; accepted 3/11/08.Grant support: Training fellowship from the Keck Center for InterdisciplinaryBioscience Training of the Gulf Coast Consortia NIH grant #5 T90 DK070109-03and 5 R90 DK071505-03, the American Legion Auxiliary Fellowship, andthe NIH Uterine Cancer Specialized Programs of Research Excellence grantP50-CA098258.The costs of publication of this article were defrayed in part by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.Requests for reprints: David S. Loose, University of Texas Health ScienceCenter Houston, 6431 Fannin Street, MSB 5.132A, Houston, TX 77030. Phone:713-500-7440; Fax: 713-500-7455. E-mail: [email protected] D 2008 American Association for Cancer Research.doi:10.1158/1541-7786.MCR-08-0039

Mol Cancer Res 2008;6(6). June 2008 1017on August 9, 2019. © 2008 American Association for Cancer Research.mcr.aacrjournals.org Downloaded from

http://mcr.aacrjournals.org/

In the traditional canonical pathway, Wnts released from or

presented on the surface of signaling cells act on target cells

by binding with high affinity to Fzd, which forms a complex

with Lrp5/6 coreceptor (13). This interaction results in the

cytoplasmic accumulation of stabilized h-catenin, which trans-

locates to the nucleus where it can associate with members of

the lymphoid enhancer factor/T-cell factor class of transcription

factors and induce transcription of genes, including c-myc and

cyclin D (14-17). In the absence of a Wnt signal, cytoplasmic

h-catenin levels are otherwise kept low through a proteasome-

mediated degradation (18). It has been established that the

b-catenin gene is mutated at a frequency rate of 30% in type I

endometrial carcinoma (19, 20). Mutated b-catenin can resist

degradation and subsequently act as an oncogene affecting cell

adhesion and constitutively activating Wnt target gene

expression. In the noncanonical planar cell polarity/JNK

pathway, Wnt interaction with Fzd facilitates the recruitment

of small GTPases RhoA/Rac/cdc42 and triggers the consequent

phosphorylation and activation of c-Jun (12, 21). The Ca2+-

mediated pathway involves heterotrimeric G proteins and

subsequent activation of protein kinase C, Ca2+-calmodulin–

dependent kinase II, nuclear factor associated with T cells, and

other downstream effectors (22-24).

There are a host of diverse proteins that function as

extracellular modulators of Wnt signaling, including members

of the secreted frizzled-related protein (SFRP) family (25).

SFRPs share sequence homology with the cysteine-rich domain

(CRD) of Fzd and are thought to antagonize Wnt action by

competing with Fzd for the binding of Wnts and preventing

Wnt-Fzd interaction (25). The identification of specific Wnt-

SFRP associations is another important, but ill defined, area of

Wnt research that requires a further in-depth exploration.

SFRP4 is restricted to the endometrial stroma and its

expression has been shown to peak during the proliferative

(or estrogen dominated) phase of the menstrual cycle.

Quantitative reverse transcription-PCR (RT-PCR) studies done

in our laboratory found that in postmenopausal women treated

with estrogen for 3 months SFRP4 expression in the

endometrium increased 9-fold.1 SFRP4 expression levels are

significantly decreased in endometrial cancer (26-29). Down-

regulation of SFRP4 and associated promoter hypermethylation

has been reported in several other cancers, including mesothe-

lioma, chronic lymphocytic leukemia, and esophageal adeno-

carcinoma (30-32). Although it is recognized that SFRP4 plays

a role in adult uterine function and is a potential biomarker for

certain cancers, its Wnt binding partners and overall mechanism

of action remain unclear.

In the present study, we report that Wnt7a activates h-catenin/canonical signaling and functions to induce endometrial

cell proliferation in the presence of Fzd5 but not Fzd10. Wnt7a

signaling mediated by Fz10 was shown to stimulate the

noncanonical JNK-responsive pathway. Activation of both

Wnt7a-induced pathways was inhibited through the addition

of SFRP4. We also show that SFRP4 inhibition of endometrial

cancer cell growth signifies its potential role as a tumor

suppressor. These observations indicate that the Fzd receptor

milieu within the cell dictates which signal Wnt7a elicits within

the endometrium and that SFRP4 is a key regulator of Wnt7a

action.

ResultsIdentification of Wnt Components in Ishikawa Cells

Using microarray analysis, we assessed the relative

expression levels for each Wnt, Fzd, and Wnt signaling

antagonist from grouped sample data of the well-differentiated

human endometrial adenocarcinoma Ishikawa cell line. Results

listed in Table 1 indicate gene symbol, detection signal, and

P value scores where significance level is P V 0.01 based on a

t test following background subtraction and rank invariant

normalization. Our survey revealed that Wnt3, Wnt3a , and

Wnt7a were expressed at the highest levels. It was anticipated

that Wnt7a would be expressed because it is of epithelial cell

TABLE 1. Microarray Analysis of Wnt Component GeneExpression

Wnt Component Ishikawa Cells

GeneSymbol

Accession AverageSignal

P Significance

Ligands WNT1 NM_005430 4.6 0.210 NSWNT2 NM_003391 �1.0 0.457 NSWNT2B NM_024494 1.5 0.401 NSWNT3 NM_030753 54.0 0.001 SWNT3A NM_033131 27.3 0.009 SWNT4 NM_030761 4.2 0.216 NSWNT5A NM_003392 2.6 0.364 NSWNT5B NM_030775 17.2 0.037 NSWNT6 NM_006522 3.9 0.226 NSWNT7A NM_004625 133.3 <0.001 SWNT7B NM_058238 �1.5 0.616 NSWNT8A NM_031933 4.0 0.234 NSWNT8B NM_003393 7.7 0.120 NSWNT9A NM_003395 8.3 0.125 NSWNT9B NM_003396 2.7 0.280 NSWNT10A NM_025216 4.5 0.214 NSWNT10B NM_003394 6.3 0.196 NSWNT11 NM_004626 �6.5 0.828 NSWNT16 NM_016087 2.9 0.297 NS

Receptors FZD1 NM_003505 101.5 <0.001 SFZD2 NM_001466 437.7 <0.001 SFZD3 NM_017412 17.0 0.030 NSFZD4 NM_012193 47.1 0.003 SFZD5 NM_003468 89.0 0.001 SFZD6 NM_003506 374.1 <0.001 SFZD7 NM_003507 79.7 0.001 SFZD8 NM_031866 1.5 0.364 NSFZD9 NM_003508 185.4 <0.001 SFZD10 NM_007197 9.5 0.089 NS

Antagonists SFRP1 NM_003012 207.0 <0.001 SSFRP2 XM_050625 13.6 0.044 NSSFRP3 NA NA NA —SFRP4 NM_003014 �3.0 0.711 NSSFRP5 NM_003015 3.9 0.240 NSDKK1 NM_012242 �5.6 0.812 NSDKK2 NM_014421 �0.8 0.528 NSDKK3 NM_013253 109.3 <0.001 SDKK4 NM_014420 1.2 0.372 NSWIF1 NM_007191 3.7 0.248 NSCER1 NM_005454 0.5 0.430 NS

NOTE: Results of Illumina microarray analysis used to identify gene expressionof Wnt components. Analysis is representative of four samples. Biologicalreplicate data were grouped and normalized with rank invariant statistics usingBeadStudio 3 software.Abbreviations: S, significance of P V 0.01; NS, nonsignificance; NA, notavailable.1Unpublished data.

Carmon and Loose

Mol Cancer Res 2008;6(6). June 2008

1018

on August 9, 2019. © 2008 American Association for Cancer Research.mcr.aacrjournals.org Downloaded from


origin in the mammalian endometrium. Among the Fzd

receptors, Fzd1, Fzd2, Fzd4, Fzd5, Fzd6, Fzd7 , and Fzd9

were significantly detected. Expression of these Wnts and Fzds

was validated using an independent set of primers by RT-PCR

(data not shown). Wnt signaling antagonists determined to be

appreciably expressed in Ishikawa cells included SFRP1 and

DKK3 , which were expressed to a level that reached signif-

icance. The fact that SFRP4 was not expressed in Ishikawa

cells suggests that its expression is confined solely to the stroma

of the endometrium.

Localization of Wnt7a, Fzd5, Fzd10, and SFRP4Our previous quantitative RT-PCR screening studies have

revealed mRNA expression of Fzd5 and Fzd10 in both human

and rat endometrium.1 We investigated the cell type–specific

expression of Wnt7a, Fzd5, Fzd10, and SFRP4 in tissue

sections taken from rat uteri. In situ hybridization using

antisense probes revealed specific distributions of the Wnt7a

transcripts in the luminal epithelium and SFRP4 in the stroma

(Fig. 1). Fzd5 expression was apparent in both stromal and

glandular epithelial cell types, with minimal expression in the

luminal epithelium. Fzd10 localization was restricted mainly to

the stroma (Fig. 1) and was not detectable in the luminal

epithelium. Control sections treated with sense probes specific

to each individual Wnt component showed no detectable

signals. These findings indicate a complex pattern of tissue

expression within the endometrium.

Interaction of Wnt7a with Fzd5 and Fzd10To address the question of whether Wnt7a can associate

physically with the extracellular Wnt binding region of Fzd5

and/or Fzd10, we did a series of coimmunoprecipitation

experiments. Cells were transfected with empty vector (EV)

and Wnt7a or cotransfected with Wnt7a and Fzd5 or Wnt7a and

Fzd10 and then lysates were coimmunoprecipitated with an

antibody directed against Wnt7a. Western blot analysis using

antibody against the V5 tag confirmed that both Fzd5 and

Fzd10 successfully pulled down with Wnt7a (Fig. 2A). As a

negative control, lysate from cells overexpressing Fzd5 was

immunoprecipitated with anti-Wnt7a to verify that Fzd5 did not

bind nonspecifically (Fig. 2A, middle). We also did a reverse

experiment to show that Wnt7a ligand coimmunoprecipitates

with receptor by using a Fzd5 antibody (Fig. 2A, right). The

experiment was not repeated for Fzd10 due to the unavailability

of a quality Fzd10 antibody. These data corroborate that Wnt7a

interacts with both Fzd5 and Fzd10.

Wnt7a Activation of the b-Catenin/Canonical PathwayOccurs via Fzd5

To determine if the Wnt7a interaction with Fzd5 and Fzd10

could induce h-catenin/canonical Wnt signaling, we used the

luciferase reporter construct TopFlash. The TopFlash construct

contains T-cell factor–binding sites, which are directly

activated by the T-cell factor/h-catenin complex. Alternatively,

the FopFlash construct, which contains mutated T-cell factor–

binding sites, served as a negative control. Ishikawa cells were

transiently transfected with TopFlash or FopFlash and Wnt7a,

Fzd receptor, or Wnt7a plus Fzd receptor. A Renilla-TK

luciferase reporter was cotransfected for assay normalization.

Cotransfection of Wnt7a and Fzd5 was shown to significantly

induce TopFlash activity 5.6-fold (P V 0.05; Fig. 2B).

Transfection of Fzd5 alone yielded a slight increase in TopFlash

but did not reach significance. Fzd10, Wnt7a, and Wnt7a-

Fzd10 failed to induce any reporter activity. Because Ishikawa

cells contain endogenous Wnts, including Wnt7a, it is likely

that the binding of endogenous Wnts to Fzd5 accounts for the

increase in TopFlash activity when Fzd5 is transfected alone.

Altogether, it is apparent that Wnt7a activation of h-catenin/canonical Wnt signaling is mediated through Fzd5 and not

Fzd10 in Ishikawa cells.

As a means to test whether Wnt7a could activate h-catenin/canonical signaling in a concentration-dependent manner,

TopFlash experiments were done using Ishikawa cells trans-

fected with Fzd5 and increasing amounts of the Wnt7a

FIGURE 1. Localization of Wnt components in the endometrium. In situ hybridization was carried out on tissue sections of the rat uterus using sense andantisense digoxigenin-labeled RNA probes. Wnt7a is localized to the luminal epithelium of the endometrium. Fzd5 expression is apparent in both the stromaand glandular epithelium, whereas Fzd10 and SFRP4 are confined solely to the stroma. g, glands; le, luminal epithelium; s, stroma. Arrows designate areasof expression.

SFRP4 Inhibits Wnt7a Signaling


1019



expression construct. Western blot analysis verified that the

level of Wnt7a protein expression increased with greater

amounts of transfected Wnt7a construct, whereas Fzd5 receptor

levels remained constant (Fig. 2C). The appearance of a slight

increase in Fzd5 expression with cotransfection of 2 and 4 Agof Wnt7a can be attributed to overexposure. A longer exposure

time was necessary to visualize the smaller amounts of Wnt7a.

Luciferase measurements confirmed that 2 Ag Wnt7a cotrans-

fected with 1 Ag Fzd5 was sufficient to produce significant

activation of h-catenin when compared with 1 Ag Fzd5 baseline

(P V 0.05; Fig. 2D). Transfection of 1, 2, and 4 Ag increased

h-catenin signaling 1.7-, 2.8-, and 4.3-fold, respectively. This

illustrates that, in Ishikawa cells, h-catenin/canonical signalingcan be induced by Wnt7a in a dose-responsive manner in the

presence of Fzd5.

SFRP4 Inhibition of b-Catenin/Canonical SignalingTo detect potential inhibition of Wnt7a signaling, SFRP4

was transfected alone or cotransfected with Fzd5 and Wnt7a.

Cotransfection of SFRP4 with Wnt7a and Fzd5 significantly

diminished TopFlash activity to near baseline levels (Fig. 3A).

To confirm an interaction between Wnt7a and SFRP4,

coimmunoprecipitation experiments were done (Fig. 3B). Cells

were transfected with Wnt7a or SFRP4 plus or minus Wnt7a.

Because SFRPs are secreted proteins, transfected cells were

treated with the hydrophilic cross-linking reagent 3,3¶-dithio-bis(sulfosuccinimidylpropionate) (DTSSP) to capture protein-

protein interactions occurring at the cell surface. Lysates were

immunoprecipitated with either anti-Wnt7a or anti-SFRP4 and

Western blotted with anti-V5. Our results suggest that inhibition

of Wnt7a-mediated h-catenin/canonical signaling in transfected

cells occurs through a direct interaction of Wnt7a with SFRP4.

To assess the levels of accumulated h-catenin protein,

cytosolic extracts were prepared from Ishikawa cells transfected

with EV, Wnt7a and Fzd5, or Wnt7a and Fzd5 plus SFRP4.

A cellular fractionation method was necessary to ensure that

only cytosolic h-catenin protein stabilized due to Wnt signaling

would be detected and not the relatively stable pool of

FIGURE 2. Wnt7a coimmunoprecipitates with Fzd5 and Fzd10 and induces h-catenin/canonical Wnt signaling via Fzd5. A. Cell extracts from Ishikawacells overexpressing Wnt7a plus or minus Fzd5 or Fzd10 were immunoprecipitated (IP ) with antibody to Wnt7a. Anti-Wnt7a immunoprecipitation of lysatefrom cells overexpressing Fzd5 served as a control for specificity. Cell extracts expressing Fzd5 or Fzd5 and Wnt7a were immunoprecipitated with anti-Fzd5.An EV transfection served as a control. Immunoprecipitates were immunoblotted (IB ) with antibody specific to V5-tag to detect both Wnt7a and its associatedFzds. Fzd10 migrates at the anticipated molecular weight just above Fzd5. B. Cotransfection of Wnt7a and Fzd5 into Ishikawa cells promotes significantactivation of the h-catenin TopFlash gene reporter. Wnt7a failed to activate TopFlash in the presence of Fzd10. Cells were transfected with expressionvectors as indicated above along with TopFlash (or negative control construct FopFlash) and Renilla -TK for normalization. Luciferase activity was measured24 h after transfection. Results are representative of at least three separate experiments done in duplicate. Columns, mean; bars, SE. **, P V 0.01, comparedwith control EV cells based on ANOVA and Bonferroni post hoc for multiple comparisons. C. Western blot indicates expression of Fzd5 and increasingconcentrations of Wnt7a protein in Ishikawa cells using anti-V5 and anti-h-actin for loading control. D. Wnt7a was shown to activate h-catenin in a dose-responsive manner. Cells were transfected with 1 Ag Fzd5 in the presence of increasing amounts of Wnt7a and TopFlash luciferase measurements wererecorded 24 h after transfection. Points, mean; bars, SE. *, P V 0.05, Student’s t test; **, P V 0.01, Student’s t test, compared with cells transfected with Fzd5alone.

Carmon and Loose


1020



h-catenin that is membrane associated with cadherins. A 9.8-

fold increase in cytosolic h-catenin accumulation was observed

in the presence of Wnt7a and Fzd5 compared with control

transfectants (Fig. 3C). A 2-fold reduction in the h-cateninlevels was observed as a consequence of SFRP4. These data

indicate that the Wnt7a signal is initiated in the presence of

Fzd5 and can be at least partially ablated by SFRP4.

SFRP4 Suppresses b-Catenin/Canonical Signalingthrough a Paracrine Mechanism

To determine whether SFRP4 could inhibit Wnt7a-induced

canonical signaling in a paracrine fashion, a series of

coculture experiments were done. One cell population,

referred to as effector cells, was either transfected with EV

or manipulated to overexpress SFRP4. The target cell

population was transfected with EV or Fzd5 receptor plus

Wnt7a, Renilla-TK, and the TopFlash reporter gene. When

these two cell populations were mixed, SFRP4 effector cells

significantly inhibited h-catenin/canonical signaling in both

EV and Wnt7a/Fzd5 target cells by 2- and 2.8-fold,

respectively (Fig. 3D). The coculture experiment was also

done using a constitutively active form of h-catenin as a

negative control for SFRP4 inhibition and to show that SFRP4

was not toxic to the target cell population. As shown in

FIGURE 3. SFRP4 binds to Wnt7a and promotes inhibition of h-catenin/canonical signaling in an autocrine and paracrine manner. A. Wnt7a canonicalsignaling via Fzd5 is inhibited by the extracellular antagonist SFRP4. TopFlash (FopFlash) experiments were done as described previously. Columns, mean;bars, SE. *, P V 0.05, Student’s t test, compared with control cells; **, P V 0.01, Student’s t test, compared with Wnt7a-Fzd5– transfected cells. B. SFRP4directly binds Wnt7a in endometrial cells. Ishikawa cells were transfected to overexpress EV, Wnt7a, SFRP4, or SFRP4 plus Wnt7a and treated with2 mmol/L DTSSP hydrophilic cross-linker before lysis. Cell extracts were then immunoprecipitated with antibody to either Wnt7a or SFRP4. Anti-Wnt7aimmunoprecipitation of lysate from cells overexpressing SFRP4 served as a control for specificity. Western blot of coimmunoprecipitates with total cell lysateand IgG control was probed with anti-V5. C. The Wnt7a-Fzd5 interaction increases cytosolic h-catenin levels, which can be alternatively inhibited by SFRP4.Ishikawa cells were transfected to express the proteins as indicated and then hypotonically lysed for Western blot analysis of cytosolic fractions. Blots wereprobed with anti-V5 to confirm expression of transfected proteins, anti-h-catenin, and anti-h-actin for loading control. Quantification of h-catenin wasnormalized to levels of h-actin and designated as fold difference relative to control transfection. D. SFRP4 inhibits Wnt7a-Fzd5–stimulated TopFlash activityin a paracrine assay. Target Ishikawa cells, cotransfected with EV or Fzd5 plus Wnt7a, TopFlash reporter, and Renilla-TK, were cocultured with EV orSFRP4 effector cells 24 h after transfection. Cells were assayed for luciferase activity 24 h after effector cell seeding. Inset, coculture experiment done usinga constitutively active h-catenin expression construct shows a negative control for SFRP4 inhibition of canonical signaling. Results are representative of atleast three separate experiments (two for h-catenin control) done in duplicate. Columns, mean; bars, SE. **, P V 0.01, Student’s t test; #, P V 0.001,Student’s t test, compared with EV/EV coculture.



1021



Fig. 3D (inset), SFRP4 coculture had no significant effect on

h-catenin signaling. This is due to the fact that the constitutive

h-catenin activity occurs downstream of SFRP4 inhibition.

These data indicate that SFRP4 associates with Wnt7a in a

paracrine mechanism to suppress h-catenin/canonical signal-

ing mediated by Fzd5 in endometrial cells.

Wnt7a Induction of JNK/Noncanonical Signaling viaFzd10 and Repression by SFRP4

Wnt ligands can activate either canonical or noncanonical

pathways, often in a cell- or tissue-dependent manner.

Because Wnt7a did not activate h-catenin/canonical signalingvia Fzd10 in Ishikawa cells, we wanted to test whether Wnt7a

could activate the noncanonical JNK pathway. To determine

whether Wnt7a activated the JNK pathway through Fzd10,

we used a transcriptional reporter system to measure

activation of JNK. This assay measures the change in gene

transcription through phosphorylation of c-Jun when fused to

the GAL4 DNA-binding domain, resulting in luciferase

activity. We observed that Wnt7a significantly activated

JNK when cotransfected with Fzd10 as indicated by a 2.6-

fold induction of luciferase activity compared with control

cells (P V 0.05; Fig. 4A). Coexpression of SFRP4 diminished

JNK activation mediated by Wnt7a-Fzd10. Cotransfection of

Wnt7a with Fzd5 and Fzd5 alone was unable to activate JNK

signaling. Western blots of total cell lysates are shown in

Fig. 4B. Coexpression of Wnt7a and Fzd10 in Ishikawa cells

increased the level of c-Jun phosphorylation, whereas

coexpression of Wnt7a and Fzd10 with SFRP4 repressed

c-Jun phosphorylation (Fig. 4C). An equivalent amount of

total c-Jun was observed in each sample, indicating no change

in c-Jun protein expression. These data indicate that Wnt7a is

capable of activating planar cell polarity/JNK-dependent

noncanonical signaling via Fzd10 and that the signal is

inhibited by SFRP4.

SFRP4 Protein Directly Binds Purified Wnt7a to InhibitActivation of b-Catenin/Canonical Signaling

Previous reports have shown that SFRPs not only bind to

Wnts as a means to modulate Wnt signaling but can also bind

Fzd. Given this knowledge, we tested whether SFRP4 was

directly binding to Wnt7a or Fzd5 to inhibit downstream

signaling. Purified Wnt7a and/or SFRP4 were incubated with

protein A/G agarose and a purified fusion protein consisting of

the CRD of Fzd5 and the Fc portion of human IgG or Fc IgG as

a negative control. Western blot analysis confirmed that Wnt7a

bound to the CRD of Fzd5 as expected, whereas SFRP4 did not

(Fig. 5A). Direct association between purified SFRP4 and

Wnt7a was shown by immunoprecipitation with anti-Wnt7a.

These findings verify that SFRP4 directly binds Wnt7a and not

the CRD of Fzd5 to inhibit canonical signaling.

We next tested whether our purified Wnt7a and SFRP4

proteins were biologically active and capable of transducing

and inhibiting the canonical signal, respectively. We found that,

FIGURE 4. Wnt7a activation of thenoncanonical planar cell polarity/JNKpathway mediated by Fzd10 andinhibition by SFRP4. A. Ishikawa cellswere transiently transfected withWnt7a, Fzd5, and Fzd10 as specifiedalong with constructs from a Path-Detect c-Jun Trans -Reporting Systemand Renilla -TK for normalization.Cells were incubated for 24 h, andluciferase activities were then mea-sured. Columns, relative light units(firefly/Renilla) of three independentexperiments; bars, SE. Statistical sig-nificance is based on ANOVA andBonferroni post hoc for multiple com-parisons. *, P V 0.05, compared withthe activity in control EV-transfectedcells; **, P V 0.01, compared withWnt7a-Fzd10 cells. B. Western blotindicates expression of transfectedproteins using anti-V5 and anti-h-actinfor loading control. It should be notedthat Fzd10 tends to form hetero-dimers indicated by smeared band.C. Western blots showing c-Junphosphorylation with baseline re-sponse to EV expression, inductionwith Wnt7a plus Fzd10, and reductionwith Wnt7a plus Fzd10 and SFRP4.The total amount of c-Jun protein wasused to control for loading and anti-V5was used to confirm expression oftransfected proteins.

Carmon and Loose


1022



when transiently transfected into Ishikawa cells, the TopFlash

reporter activated in response to treatment with purified Wnt7a

and exhibited dose dependency. As shown in Fig. 5B, Wnt7a

protein induces a 2- and 3.5-fold increase in reporter activation

in control and cells stably expressing Fzd5, respectively. We

also calculated the EC50 value to be between 60 and 65 ng/mL

for both cell types. We then tested whether the addition of

SFRP4 protein could inhibit Wnt7a-induced reporter activity.

Using a concentration of Wnt7a protein just above the EC50

(100 ng/mL), SFRP4 protein was concurrently added to Fzd5

cells with Wnt7a at increasing doses. As shown in Fig. 5C,

SFRP4 elicits a dose-responsive reduction in Wnt7a-mediated

reporter activation. No effect was observed when SFRP4 was

added alone, indicating that SFRP4 is suppressing h-catenin/canonical signaling induced by the purified Wnt7a protein.

SFRP4 Functionally Inhibits Wnt7a-Induced Proliferationin Endometrial Cancer Cells

To determine the functional effect of Wnt7a and SFRP4 in

Ishikawa cells, we used a 3-(4,5-dimethylthiazol-2-yl)-5-(3-

carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium salt

(MTS) assay to assess cell proliferation. At 48 h, a statistically

significant increase in proliferation was observed when Fzd5

was cotransfected with Wnt7a (P V 0.001). Additionally,

we found that SFRP4 significantly inhibited cell growth

induced by Wnt7a/Fzd5 (P V 0.001; Fig. 6A). No relevant

effects on Ishikawa cell proliferation were observed in the

presence of Fzd10. This result indicates that proliferation

induced by Wnt7a is thereby an effect of canonical signaling

mediated by Fzd5 and not the Fzd10-mediated JNK pathway.

We then aimed to parallel this finding using purified Wnt7a

and SFRP4 proteins in Ishikawa cells stably overexpressing

Fzd5. A statistically significant increase in proliferation was

observed when Fzd5-overexpressing cells were treated with

100 ng/mLWnt7a (P V 0.05). More intriguingly, we found that

SFRP4 significantly inhibited cell growth induced by Wnt7a in

a dose-dependent manner and also inhibited proliferation in the

absence of exogenous Wnt7a (Fig. 6B).

We next assayed the ability of SFRP4 to suppress

endometrial cancer cell growth. Ishikawa cells were selected

FIGURE 5. Purified SFRP4 directly binds Wnt7a protein and not the Fzd5 CRD to inhibit activation of h-catenin/canonical signaling.A.Wnt7a and SFRP4proteins were incubated with protein A/G agarose and a purified fusion protein consisting of the CRD of Fzd5 and the Fc portion of human IgG or Fc alone.Direct SFRP4/Wnt7a binding was shown by immunoprecipitation with anti-Wnt7a. Western blot analysis was done with anti-V5 and rabbit anti-human IgG. B.TopFlash dose-response experiment indicates activation of canonical signaling by purified Wnt7a protein in Ishikawa cells (gray columns ) and to a greaterextent in stable Fzd5-overexpressing Ishikawa cells (black columns ) C. Concurrent addition of SFRP4 protein inhibits purified Wnt7a activation of theTopFlash reporter in Fzd5-overexpressing cells.



1023



as a model because they do not natively express SFRP4. Cells

were transfected with a SFRP4 construct and individual

SFRP4-expressing and SFRP4-Null (cells transfected with

SFRP4 construct, but not SFRP4 expressing based on Western

blot) stable clones were selected for colony growth assays.

SFRP4 expression markedly decreased colony formation by an

overall average of f65% (Fig. 6C).

DiscussionPrevious studies have established that Wnt7a is important in

the development and differentiation of the female reproductive

tract. Although Wnt7a has been recognized as a major ligand in

the endometrium, no information is available about its cognate

Fzd partners or underlying signaling mechanism in the adult.

Wnt7a has been shown to activate both canonical and

noncanonical pathways in other cellular environments

(33-36). Therefore, it could be expected that Wnt7a has

multiple functions in the endometrium. Wnt7a was shown to

signal via Fzd5/Lrp6 in neuronal PC12 cells as measured by

increased h-catenin stability and activation of a T-cell factor

reporter construct (37). In situ hybridization of mouse embryos

showed that Fzd10 is expressed in the same regions as Wnt7a in

the neural tube, limb buds, and Mullerian duct (38). Coinjection

of Wnt7a and Fzd10 synergistically induces Wnt target genes

in Xenopus embryos (39). We conducted a microarray analysis

to compile a panel of all Wnt components in the Ishikawa cell

line and found significant expression of seven different Fzds,

including Fzd5. Quantitative RT-PCR studies revealed positive

expression of both Fzd5 and Fzd10 in human endometrial

tissue.1 Interestingly, little has been published on the localiza-

tion of Fzds in the endometrium. Our in situ hybridization

experiments confirmed that Fzd5 expression was restricted to

both stroma and epithelium, whereas Fzd10 was localized

solely to the stroma. Based on this information, Fzd5 and Fzd10

were predicted to be likely candidates for binding Wnt7a.

Our work confirms that Fzd5 and Fzd10 function as Wnt7a

receptors in the endometrium and shows that Wnt7a can signal

FIGURE 6. SFRP4 inhibits endometrial cancer cell proliferation. MTS assay of Ishikawa cells (A) transfected with Wnt component constructs and (B)Fzd5-overexpressing Ishikawa cells treated with purified Wnt7a and/or SFRP4 proteins. Proliferation was measured 48 h after seeding for transfected cellsand 3 d after treatment with purified proteins. Absorbance was measured at 490 nm 2 h after addition of MTS reagent. Columns, mean of three separateexperiments in triplicate; bars, SE. Statistical significance is based on ANOVA and Bonferroni post hoc for multiple comparisons. *, P V 0.05, compared withEV or untreated controls; ***, P V 0.001, compared with EV or untreated controls; #, P V 0.01, compared with Wnt7a-treated cells; ##, P V 0.001, comparedwith Wnt7a-treated cells. C. Colony formation assay of SFRP4-Null and SFRP4 Ishikawa stable cell lines after selection with G418 for 2 wk. Colonies werequantified by crystal violet extraction. Columns, mean of three individual experiments; bars, SD. * P V 0.001, for SFRP4 stable clones compared with eachSFRP4-Null clone based on Student’s t test analysis.

Carmon and Loose


1024



via the h-catenin/canonical or noncanonical JNK-mediated

pathway depending on which Fzd receptor it binds to on the

cell. Wnt7a interaction with Fzd5 resulted in stabilization of

cytoplasmic h-catenin and subsequent activation of h-catenin/canonical signaling in a concentration-dependent manner. The

binding of Wnt7a to Fzd10 induced the noncanonical JNK-

mediated pathway and increased phosphorylation of c-Jun.

Because Fzd10 is localized to the endometrial stroma and our

studies were done in epithelial cells, it may be of interest to

further test whether the Wnt7a-Fzd10 interaction induces JNK

signaling in endometrial stromal cells. The potential for one

Wnt ligand to activate two separate signaling pathways in a cell

through different receptors has also been recently shown by

Mikels and Nusse (40). However, this has never been reported

for two individual Fzd receptors. The purification of large

quantities of soluble active Wnt protein is extremely difficult

and the biochemical properties of all 19 individual Wnts are not

completely understood. We provide evidence that treatment of

cells with purified recombinant Wnt7a protein is able to directly

stimulate canonical Wnt signaling in a dose-dependent manner

and induce proliferation.

There are several secreted proteins that can also interact with

Wnt, including members of the SFRP family. SFRPs compete

with Fzds to bind Wnt ligands and, in turn, modulate Wnt

action. However, we should also note that previous publications

have provided evidence for the formation of nonfunctional

complexes between SFRP and Fzds (41). The specific SFRPs

that inhibit Wnt7a-Fzd interactions to provide feedback

regulation in the endometrium have not been identified. In

the present study, we have found that SFRP4 is localized to the

endometrial stroma and its expression is significantly down-

regulated in certain types of endometrial carcinoma (26, 28,

29).1 SFRP4 expression peaks with high levels of estrogen

during the proliferative phase of the menstrual cycle and

significantly declines during the progesterone-dominated se-

cretory phase (26, 42). In contrast, epithelial expression of

Wnt7a is much lower throughout the estrogen-driven prolifer-

ative phase (6). Thus, increased expression of SFRP4 in

response to estrogenic stimuli may assist in the estrogen-

dependent down-regulation of Wnt7a through the binding of

excess Wnt7a. We have discovered that SFRP4 can directly

bind Wnt7a, and not the CRD of Fzd5, to prevent Wnt7a

signaling in both an autocrine and paracrine fashion. We also

found that purified SFRP4 inhibits Wnt7a-mediated prolifera-

tion and stable overexpression of SFRP4 functions to suppress

endometrial cancer cell growth in vitro .

The intimate collaboration between endometrial stromal

and epithelial cells is essential for normal adult function as

well as for mediating the hormone-driven remodeling that

accompanies the menstrual cycle (3, 4). Given that Wnts are

generally localized to different cell types and regulated by

both estrogen and progesterone, it is presumed that they are

key participants in this stromal-epithelial molecular dialogue.

Wnt7a signaling mediated through its cognate Fzd5 and Fzd10

receptors may provide a molecular dialogue between epithelial

and stromal cells, which can be modulated by SFRP4. We

believe that disruption of this intercellular communication,

through loss of SFRP4 expression, leads to excessive Wnt

signaling, overactive h-catenin, and increased proliferation

that may ultimately contribute to the onset of endometrial

cancer. Based on our current findings, we believe that under

normal circumstances SFRP4 can function as a suppressor of

cell growth and may prove to hold therapeutic potential for

endometrial carcinoma.

Materials and MethodsCloning of Rat Wnt7a, Fzd5, Fzd10, and SFRP4

Rat uterine total RNA was isolated with Tri-Reagent

(Molecular Research Center) and further purified using phenol

chloroform extraction and isopropanol precipitation. RNA was

washed with ethanol and resuspended in RNase-free diethyl

pyrocarbonate water. Oligonucleotide primers were designed to

flank the entire coding regions of rat Wnt7a, Fzd5, Fzd10, and

SFRP4 for RT-PCR and subsequent ligation of recombinant

cDNA into a pcDNA3.1 directional V5/6xHis TOPO vector

(Invitrogen). Primer sequences for Wnt7a, Fzd5, and SFRP4

(Table 2) were designed against rat sequences in Genbank and

modified to incorporate a COOH-terminal V5/6xHis-tag. Fzd10

was cloned by alignment of human Fzd10 Genbank sequence

with the homologous region of the rat genome. Fzd10 cloning

primers were designed to include the stop codon (Table 2). Site-

directed mutagenesis was carried out using the cloned Fzd10

pcDNA3.1 construct and primers shown in Table 2 to convert

the stop codon to a serine and reincorporate the COOH-terminal

V5/6xHis-tag of pcDNA3.1.

TABLE 2. List of Primers

Forward (5¶-3¶) Reverse (5¶-3¶)

CloningWnt7a [XM_342723] CACCGGACTATGACCCGGAA CTTGCACGTATACATCTCTGTGCGCTFzd5 [NM_173838] CACCGGCGATGGCTAGAC TACGTGCGACAGGGACACTTGFzd10 [NM_007197] CACCGGCGCCACCATGCAACA TCACACGCAGGCTGAAGGCTSFRP4 [NM_053544] CACCACAGTGCGATGCTCCT GCTTGTACTTTTCTTTGGGTTTGA

Site-directed mutagenesisFzd10 pcDNA3.1 TCAGCCTGCGTGTCAAAGGGTCAAGAC GTCTTGACCCTTTGACACGCAGGCTGA

In situ hybridizationWnt7a [XM_342723] CTGGGCCACCTCTTTCTCA AGGCCTGGGATCTTGTTACAGFzd5 [NM_173838] CAAAACCTGAACTCGCTACGAG GACACGAAGCCTGCCAGAFzd10 [NM_007197] CCCCGATTATGGAGCAGTT TCCATGCACAGGTAGTTGGSFRP4 [NM_053544] GCTTCAGGAACAGCAGAGAA AGGTTTGGAAGCAGGTGAC

NOTE: Wnt components listed with corresponding Genbank accession numbers.



1025



Microarray Analysis Using BeadChip ArraysMicroarray experiments were done on four Ishikawa

biological replicates. RNA was isolated as described above

and microarray analysis was done using HumanRef-8 BeadChip

arrays (24,000 gene sequences/array) from Illumina. Briefly,

RNA was amplified and cDNA was synthesized via reverse

transcription. The cDNA was converted to cRNA containing

biotinylated UTPs and incubated with avidin-labeled Cy3 dye.

Each sample was then hybridized to a separate array on the

BeadChip and incubated at 58jC overnight. Next day, bead

chips were washed and scanned. BeadStudio 3 software

(Illumina) was used for microarray data analysis.

In situ Hybridization of Endometrial TissueTwenty-one-day-old female Sprague-Dawley rats were

purchased from Harlan and housed in accredited facilities

at the University of Texas Houston Medical School. All

federal guidelines and institutional policies about their

treatment were followed. Animals were ovariectomized via

a dorsal approach and uterine tissue was removed 5 d later.

Tissue was formalin fixed and then cut into 10-Am paraffin-

embedded sections by the University of Texas Houston

Histology Department. Digoxigenin-labeled mRNA sense and

antisense probes targeting the 5¶ end of rat Wnt7a, Fzd5,

Fzd10, and SFRP4 transcripts were generated using primers

listed in Table 2 and in vitro transcription using the

digoxigenin RNA labeling kit (Roche). In situ hybridization

analysis was done using the methodology previously

described (43). Images were gathered by means of bright-

field microscopy at �100 magnification.

Cell Culture and TransfectionIshikawa cells were grown in RPMI 1640 with glutamine,

without phenol red (Invitrogen-Life Technologies), and supple-

mented with 10% fetal bovine serum, 0.01 mol/L HEPES, and

penicillin/streptomycin. Cells were split 2 d before transient

transfection and grown to 60% to 70% confluency. Transient

transfections of Ishikawa cells (unless otherwise indicated)

were conducted in 60-mm culture plates using FuGene 6

(Roche) according to the manufacturer’s guidelines. All

constructs were transfected at 1 Ag/dish unless otherwise

specified.

To generate cell lines stably expressing Wnt7a-V5/His,

SFRP4-V5/His, or the Fzd5-V5/His receptor, cells were plated

out in 1:40 dilution 24 h after transfection and cultured under

neomycin selection (600 Ag/mL G418) for 10 to 14 d. At least

12 clones expanded from single cells were screened for

expression via RT-PCR and Western blot analysis.

Purification of Recombinant Wnt7a and SFRP4 6xHis-Tagged Proteins

6xHis-tagged proteins were purified from stable cells

expressing Wnt7a-V5/His or SFRP4-V5/His by loading

cleared lysate into Ni-NTA spin columns (Qiagen) and

following protocol for mammalian cells under native con-

ditions. Eluted samples were run through a second column

and then dialyzed against PBS (pH 7.4) with addition of 1.0%

CHAPS. Protein expression and purity were verified via

Western blot analysis and Coomassie staining, respectively.

Quantification was done using a 6xHis-tag–based ELISA

protocol.

TopFlash and Phospho-c-Jun Luciferase AssaysThe TopFlash and FopFlash firefly luciferase reporter

constructs were transfected at 0.5 Ag/plate along with 0.1 Ag/plate of the Renilla (pRL-TK) reporter to permit normalization

of transfection efficiencies. Cells were harvested 24 h follow-

ing transfection in 1� passive lysis buffer (Promega Corp.).

For coculture experiments, target cells were transfected in 60-

mm plates and then reseeded into 12-well plates 24 h after

transfection. Cells were allowed to recover for 6 h and then

EV pcDNA3.0 or SFRP4-transfected effector cells from near-

confluent 60-mm plates were seeded onto the target cells to a

final ratio of 2:1. Cells were harvested 24 h after seeding of

effector cells. Wnt7a protein dose-response experiments were

done in a similar manner. In place of effector cell coculture,

cells were treated with purified recombinant Wnt7a and

SFRP4 proteins as described in the text. For analysis of c-Jun

activity, cells were transfected in six-well plates with 1 Ag/well of pFR-Luc reporter construct and 0.05 Ag/well pFA2-c-Jun from the PathDetect c-Jun Trans-Reporting System

(Stratagene), and 0.05 Ag/well of the Renilla (pRL-TK)

reporter to permit normalization. All other expression

constructs were transfected at 0.5 Ag/well. Luciferase activity

was measured by a Monolight 2010 luminometer (Analytical

Luminescence Laboratory) using the Dual-Luciferase Reporter

Assay (Promega) as indicated by the manufacturer. Each

experiment was repeated at least thrice in duplicate to ensure

reproducibility.

CoimmunoprecipitationFor the Wnt7a-Fzd coimmunoprecipitation experiment,

Ishikawa cells were harvested with radioimmunoprecipitation

assay buffer [150 mmol/L NaCl, 1% Triton X-100, 1.0%

deoxycholate, 0.1% SDS, 50 mmol/L Tris (pH 7.5), 5 mmol/L

EDTA, 0.5 mmol/L phenylmethylsulfonyl fluoride] 24 h fol-

lowing transfection. Cell extracts were immunoprecipitated

with goat anti-Wnt7a or goat anti-Fzd5 (Santa Cruz

Biotechnology) using Protein A/G Plus-Agarose (Santa Cruz

Biotechnology).

To detect interactions between Wnt7a and SFRP4,

Ishikawa cells were treated with 2 mmol/L DTSSP cross-

linker (Pierce) 24 h after transfection for 30 min to capture

protein-protein interactions at the extracellular membrane.

The cross-linking reaction was terminated by addition of

10 mmol/L Tris (pH 7.5) and cell lysis was done in Triton

X-100 buffer (20 mmol/L HEPES, 1.0% Triton X-100,

250 mmol/L NaCl, 10% glycerol, 2 mmol/L EDTA, 1 mmol/L

phenylmethylsulfonyl fluoride, 2.5 Ag/mL aprotinin, 2.5 Ag/mL

leupeptin, 100 Amol/L sodium orthovanadate, 50 mmol/L

sodium fluoride). Coimmunoprecipitation was conducted

using either goat anti-Wnt7a or goat anti-SFRP4 (Santa Cruz

Biotechnology). For experiments using purified proteins,

500 ng/mL Wnt7a and/or SFRP4 were immunoprecipitated

in Triton X-100 buffer with either 500 ng/mL Fzd5CRD-Fc

IgG (R&D Systems), Fc IgG (Bethyl Laboratories), or 1 Aggoat anti-Wnt7a.

Carmon and Loose


1026



Western Blot AnalysisProteins isolated from coimmunoprecipitation experiments

were electrophoresed on SDS-polyacrylamide gels and Western

blot analysis was done using mouse anti-V5 (Invitrogen) or

rabbit anti-human IgG (Santa Cruz Biotechnology). Immuno-

reactive proteins were visualized using secondary antibodies

and the enhanced chemiluminescence Western blotting system

(Amersham Biosciences).

To assess cytoplasmic h-catenin accumulation, transfected

Ishikawa cells were lysed by hypotonic lysis as previously

described (40). Western blot was done with mouse anti-h-catenin (Santa Cruz Biotechnology) and mouse anti-h-actin(Chemicon International) for loading control normalization.

Quantitation was done using GeneTools software (Syngene).

To determine c-Jun phosphorylation, Western blot was done on

total cell lysate using mouse anti-phospho-c-Jun and rabbit anti-

c-Jun antibody (Santa Cruz Biotechnology). Protein expression

of all transfected constructs was confirmed by Western blot

analysis using mouse anti-V5.

Cell Proliferation AssayIshikawa cells were transfected with the Wnt component

constructs as indicated in 60-mm plates. Transfectants were

reseeded at 5 � 103 cells per well in a 96-well culture plate

24 h after transfection. Cells stably overexpressing Fzd5 were

seeded at 2.5 � 103 per well in a 96-well culture plate. Cells

were allowed to recover for 6 to 8 h and treated with 100 ng/mL

Wnt7a and purified SFRP4 protein as indicated. The number

of viable cells was evaluated 48 h after reseeding of transfected

cells and 3 d after treatment with purified proteins by

incubating for 2 h with the CellTiter 96 Aqueous Non-

Radioactive Cell Proliferation MTS Assay Reagent (Promega).

Plates were read with a plate reader at a wavelength of 490 nm.

Colony Formation AssayIshikawa stable SFRP4 and SFRP4-Null cell lines were

plated at 1,000 per well in six-well plate and grown with

selection in G418 (600 Ag/mL) for 2 wk. Cells were stained

with crystal violet, which was extracted with 1% SDS and

quantificated at an absorbance of 590 nm.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

AcknowledgmentsWe thank the following individuals for providing reagents: O. Destree andH. Clevers (University of Utrecht) for TopFlash and FopFlash and P.D. McCrea(University of Texas M. D. Anderson Cancer Center) for constitutively activeB-catenin pcDNA3.1.

References1. Cunha GR. Epithelial-stromal interactions in development of urogenital tract.Int Rev Cytol 1976;47:137–94.

2. Arnold JT, Kaufman DG, Seppala M, Lessey BA. Endometrial stromal cellsregulate epithelial cell growth in vitro : a new co-culture model. Hum Reprod2001;16:836–45.

3. Cooke PS, Uchima FDA, Fujii DK, Bern HA, Cunha GR. Restoration ofnormal morphology and estrogen responsiveness in cultured vaginal and uterineepithelia transplanted with stroma. Proc Natl Acad Sci U S A 1986;83:2109– 13.

4. Cunha GR, Cooke PS, Kurita T. Role of stromal-epithelial interactions inhormonal responses. Arch Histol Cytol 2004;67:417– 34.

5. Cooke PS, Buchanan DL, Young P, et al. Stromal estrogen receptors mediatemitogenic effects of estradiol on uterine epithelium. Proc Natl Acad Sci U S A1997;94:6535–40.

6. Miller C, Pavlova A, Sassoon DA. Differential expression patterns of Wntgenes in the murine female reproductive tract during development and the estrouscycle. Mech Dev 1998;76:91– 9.

7. Mericskay M, Kitajewski J, Sassoon D. Wnt5a is required for properepithelial-mesenchymal interactions in the uterus. Development 2004;131:2061– 72.

8. Miller C, Sassoon DA. Wnt-7a maintains appropriate uterine patterning duringthe development of the mouse female reproductive tract. Development 1998;125:3201– 11.

9. Parr BA, McMahon AP. Sexually dimorphic development of the mammalianreproductive tract requires Wnt-7a. Nature 1998;395:707 –10.

10. Logan CY, Nusse R. The Wnt signaling pathway in development and disease.Annu Rev Cell Dev Biol 2004;20:781– 810.

11. Mlodzik M. Planar cell polarization: do the same mechanisms regulateDrosophila tissue polarity and vertebrate gastrulation? Trends Genet 2002;18:564 –71.

12. Miller JR. The Wnts. Genome Biol 2002;3:REVIEWS3001.

13. Tamai K, Zeng X, Liu CM, et al. A mechanism for Wnt coreceptoractivation. Mol Cell 2004;13:149 –56.

14. He TC, Sparks AB, Rago C, et al. Identification of c-MYC as a target of theAPC pathway. Science 1998;281:1509–12.

15. Itoh K, Krupnik VE, Sokol SY. Axis determination in Xenopus involvesbiochemical interactions of axin, glycogen synthase kinase 3 and h-catenin. CurrBiol 1998;8:591 –4.

16. Kishida S, Yamamoto H, Hino S, Ikeda S, Kishida M, Kikuchi A. DIXdomains of Dvl and axin are necessary for protein interactions and their ability toregulate h-catenin stability. Mol Cell Biol 1999;19:4414–22.

17. Shtutman M, Zhurinsky J, Simcha I, et al. The cyclin D1 gene is a target ofthe h-catenin/LEF-1 pathway. Proc Natl Acad Sci U S A 1999;96:5522– 7.

18. Ikeda S, Kishida S, Yamamoto H, Murai H, Koyama S, Kikuchi A. Axin, anegative regulator of the Wnt signaling pathway, forms a complex with GSK-3hand h-catenin and promotes GSK-3h-dependent phosphorylation of h-catenin.EMBO J 1998;17:1371– 84.

19. Machin P, Catasus L, Pons C, Munoz J, Matias-Guiu X, Prat J. CTNNB1mutations and h-catenin expression in endometrial carcinomas. Hum Pathol 2002;33:206–12.

20. Prat J, Gallardo A, Cuatrecasas M, Catasus L. Endometrial carcinoma:pathology and genetics. Pathology 2007;39:72– 87.

21. Li L, Yuan HD, Xie W, et al. Dishevelled proteins lead to two signalingpathways. Regulation of LEF-1 and c-Jun N-terminal kinase in mammalian cells.J Biol Chem 1999;274:129 –34.

22. Ahumada A, Slusarski DC, Liu XX, Moon RT, Malbon CC, Wang HY.Signaling of rat Frizzled-2 through phosphodiesterase and cyclic GMP. Science2002;298:2006–10.

23. Kuhl M. The WNT/calcium pathway: biochemical mediators, tools andfuture requirements. Front Biosci 2004;9:967 –74.

24. Sheldahl LC, Park M, Malbon CC, Moon RT. Protein kinase C isdifferentially stimulated by Wnt and Frizzled homologs in a G-protein-dependentmanner. Curr Biol 1999;9:695– 8.

25. Kawano Y, Kypta R. Secreted antagonists of the Wnt signalling pathway.J Cell Sci 2003;116:2627–34.

26. Abu-Jawdeh G, Comella N, Tomita Y, et al. Differential expression of frpHE:a novel human stromal protein of the secreted frizzled gene family, during theendometrial cycle and malignancy. Lab Invest 1999;79:439–47.

27. Fujita M, Ogawa S, Fukuoka H, et al. Differential expression of secretedfrizzled-related protein 4 in decidual cells during pregnancy. J Mol Endocrinol2002;28:213–23.

28. Hrzenjak A, Tippl M, Kremser ML, et al. Inverse correlation of secretedfrizzled-related protein 4 and h-catenin expression in endometrial stromalsarcomas. J Pathol 2004;204:19 –27.

29. Risinger JI, Maxwell GL, Chandramouli GVR, et al. Gene expressionprofiling of microsatellite unstable and microsatellite stable endometrialcancers indicates distinct pathways of aberrant signaling. Cancer Res 2005;65:5031– 7.

30. Lee AY, He B, You L, et al. Expression of the secreted frizzled-relatedprotein gene family is downregulated in human mesothelioma. Oncogene 2004;23:6672–6.

31. Liu TH, Raval A, Chen SS, Matkovic JJ, Byrd JC, Plass C. CpG island



1027



methylation and expression of the secreted frizzled-related protein gene family inchronic lymphocytic leukemia. Cancer Res 2006;66:653– 8.

32. Zou HZ, Molina JR, Harrington JJ, et al. Aberrant methylation of secretedfrizzled-related protein genes in esophageal adenocarcinoma and Barrett’sesophagus. Int J Cancer 2005;116:584– 91.

33. Hirabayashi Y, Itoh Y, Tabata H, et al. The Wnt/h-catenin pathway directsneuronal differentiation of cortical neural precursor cells. Development 2004;131:2791–801.

34. Lucas FR, Salinas PC. WNT-7a induces axonal remodeling and increasessynapsin I levels in cerebellar neurons. Dev Biol 1997;192:31–44.

35. Lyu J, Joo CK. Wnt-7a up-regulates matrix metalloproteinase-12 expressionand promotes cell proliferation in corneal epithelial cells during wound healing.J Biol Chem 2005;280:21653–60.

36. Winn RA, Marek L, Han SY, et al. Restoration of Wnt-7a expression reversesnon-small cell lung cancer cellular transformation through frizzled-9-mediatedgrowth inhibition and promotion of cell differentiation. J Biol Chem 2005;280:19625 –34.

37. Caricasole A, Ferraro T, Iacovelli L, et al. Functional characterization ofWNT7A signaling in PC12 cells: interaction with a FZD5 center dot LRP6

receptor complex and modulation by Dickkopf proteins. J Biol Chem 2003;278:37024 –31.

38. Nunnally AP, Parr BA. Analysis of Fz10 expression in mouse embryos. DevGenes Evol 2004;214:144 –8.

39. Kawakami Y, Wada N, Nishimatsu S, Nohno T. Involvement of Frizzled-10in Wnt-7a signaling during chick limb development. Dev Growth Differ 2000;42:561 –9.

40. Mikels AJ, Nusse R. Purified Wnt5a protein activates or inhibits h-catenin-TCF signaling depending on receptor context. PLoS Biol 2006;4:570 –82.

41. Bafico A, Gazit A, Pramila T, Finch PW, Yaniv A, Aaronson SA. Interactionof frizzled related protein (FRP) with Wnt ligands and the frizzled receptorsuggests alternative mechanisms for FRP inhibition of Wnt signaling. J BiolChem 1999;274:16180– 7.

42. Ace CI, Okulicz WC. Microarray profiling of progesterone-regulatedendometrial genes during the rhesus monkey secretory phase. Reprod BiolEndocrinol 2004;2:54.

43. Komminoth P. Digoxigenin as an alternative probe labeling for in situ

hybridization. Diagn Mol Pathol 1992;1:142 –50.

Carmon and Loose


1028



2008;6:1017-1028. Mol Cancer Res Kendra S. Carmon and David S. Loose Cancer CellsSignaling Pathways and Inhibits Proliferation in Endometrial Secreted Frizzled-Related Protein 4 Regulates Two Wnt7a

Updated version

http://mcr.aacrjournals.org/content/6/6/1017

Access the most recent version of this article at:

Cited articles

http://mcr.aacrjournals.org/content/6/6/1017.full#ref-list-1

This article cites 43 articles, 19 of which you can access for free at:

Citing articles

http://mcr.aacrjournals.org/content/6/6/1017.full#related-urls

This article has been cited by 7 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://mcr.aacrjournals.org/content/6/6/1017To request permission to re-use all or part of this article, use this link



http://mcr.aacrjournals.org/content/6/6/1017.full#ref-list-1

http://mcr.aacrjournals.org/content/6/6/1017.full#related-urls

http://mcr.aacrjournals.org/cgi/alerts

mailto:[email protected]



SecretedFrizzled-RelatedProtein4RegulatesTwo...

Documents

Transcript of SecretedFrizzled-RelatedProtein4RegulatesTwo...