SCREENING OF TRICHODERMA HARZIANUM RIFAI (1969)...

© by PSP Volume 27 No. 6/2018 pages 4232-4238 Fresenius Environmental Bulletin

4232

SCREENING OF TRICHODERMA HARZIANUM RIFAI (1969)

ISOLATES OF DOMESTIC PLANT ORIGIN AGAINST DIFFERENT FUNGAL PLANT PATHOGENS FOR USE

AS BIOPESTICIDE

Elif Tozlu*, Nasibe Tekiner, Recep Kotan

Ataturk University, Faculty of Agriculture, Department of Plant Protection, TR-25240-Erzurum, Turkey

ABSTRACT

With the emergence of negative effects of

chemicals on humans and environment and with the increasing awareness on environmental conscious, alternative methods were sought to cope with dis-eases; and in this context, successful results were ob-tained by conducting studies to suppress pathogens with fungi, which may be employed in biological control.

In this study, the effects of 2 isolates of Tricho-derma harzianum isolated from domestic plant origin (Aesculus hippocastanum and Pinus syl-vestris) were tested on Fusarium oxysporum (ET 21, ET 32, ET 34, ET 46, ET 53, ET 55, ET56) obtained from potato and pepper; Alternaria alternata (ET 9, ET 42) obtained from apple and tomato; Sclerotinia sclerotiorum (ET 30, ET 48) obtained from cucum-ber; Fusarium solani (ET 45, ET 50) obtained from cucumber; and Geotrichum candidum (ET 13) ob-tained from carrot. ET 4 bioagent isolates showed at a high effect on G. candidum and low effect on F. oxysporum, S. sclerotiorum, F. solani and A. alter-nata and the ET 14 bioagent isolates showed high ef-fect on A. alternata and low to the others.

If the control against these pathogens, the em-ployability of T. harzianum must be tested in field conditions, and environmental-friendly preparations may be prepared, which will have important contri-butions to agriculture.

KEYWORDS: Trichoderma harzianum, biological control, fungal patho-gens

INTRODUCTION Perhaps one of the most important problems of

our present day is being able to cover the nutrition need of fast-increasing world population. The popu-lation of the world is increasing at a fast pace. It is estimated that the population of the world will rise to 9 billion by 2040. Parallel to the increase in popula-tion, the sources in the world are ending. In order to

cover the needs of the world, food production must be increased at a rate of 50% by 2030 [1]. However, increasing the amount of the production that is ob-tained from unit area will only be possible when ag-riculture is made with sustainable methods, and when the sources that will cover the nutrition needs of future generations are protected. The rate of losses that stem from diseases and harmful weeds, which is one of the most important factors that limit the pro-duction and yield, is 35%, and the losses that stem from plant diseases is around 13% in the world [2]. The losses that stem from fungal pathogens in this 13% are extremely important.

Precautions were taken and control methods were applied for the purpose of decreasing the losses in the fields after the harvest; however, as a result of the use of synthetic chemicals after 1940s, problems started to appear due to the phytotoxicity of fungi-cides, fungal residues, environmental pollution and harmful effects for human health [3].

The use of fungus and bacteria is also included among these alternative methods in the control against plant diseases. Among these methods, the importance of the use of fungi is increasing because they have many species, their hosts are well-known, many fungi species may be reproduced easily in ar-tificial nutrient media and are suitable for commer-cial production and for biological control [4]. Espe-cially in biological control of the soil-based plant pathogens, Trichoderma hamatum of Trichoderma species; and Trichoderma harzianum, Trichoderma koningii, Trichoderma pseudokoningii [5], Tricho-derma viride [5, 6] and Trichoderma virens [5] are used successfully.

In this study, due to the importance of Tricho-derma species in biological control, the effects of 2 isolates of T. harzianum isolated from domestic plant origin (Aesculus hippocastanum and Pinus syl-vestris) against a total of 15 plant fungal pathogens isolates including 5 different genus were tested under in vitro conditions.


4233

MATERIALS AND METHODS Material. The materials of the study were 14

plant fungal pathogen-isolates isolated from apple (ET 9), carrot (ET 13), cucumber (ET 30, ET 46, ET 48, ET 50), pepper (ET 32, ET 34), tomato (ET 42, ET 45) and potato (ET 21, ET 53, ET 55, ET 56); and 2 T. harzianum isolates from Aesculus hippocasta-num (ET 4) and Pinus sylvestris (ET 14).

Method. The Pathogenicity of Pathogen

Fungi. Each fungus isolates were tested for patho-genicity on the parts of the plant tissue which the pathogenic fungus were isolated from this tissue. Af-ter the plants were washed with tap water, superficial disinfection was applied with 10% ethanol. The my-celial disks taken from the tips of the pathogen fun-gus, which were developed for 7 days on PDA at 260C, were placed on the wound that was opened on the plants. The plants, which were inoculated with the pathogen, were kept at room temperature for 10 days. In control application, only PDA disk was placed on the wounds. The pathogen fungi were ob-tained by re-isolating from the symptoms, and thus, the Koch postulates were completed. The isolates were kept at slant agar which contained Potato Dex-trose Agar (PDA) at 40C in Atatürk University, Ag-riculture Faculty, Plant Protection Department, Plant Clinic Laboratory.

Molecular Identification of the Bioagent

Fungi and Pathogen Fungi. The DNA samples from the mycelia of the 15 pathogen-fungus isolates and 2 bio-agent fungus isolates, were clarified by us-ing the ITS1 primer (TCCGTAGGTGAAC-CTGCGG) on ITS region 18S rDNA and the ITS4 primer (TCCTCCGCTTATTGATATGC) on 28S rRNA [7]. For separation, bromide was added in aga-rose gel and walked at ABI 3100 Genetic Analyzer, and left at UV. The sequence analysis was made at RefGen Company (Ankara, Turkey) and deposited with the GenBank database.

Determining the Development of Bioagent

Fungi in Different Media. The 6 mm disks taken from the tips of the cultures of ET4 and ET 14 iso-lates of T. harzianum, which were developed in PDA, were placed on petri dishes (9 cm) containing 20 ml Malt Extract Agar (MEA), Nutrient Agar (NA), PDA, Sabourd Dextrose Agar (SDA) and Wa-ter Agar (WA) media, and their developments were followed for 7 days on these medium at 260C and identificated according to [8].

In vitro Assays. In these experiments, petri

dishes (9 cm) containing 20 ml PDA medium were used. The ET 4 and ET 14 isolates, tested as bio-agents, and ET 9, ET 13, ET 21, ET 30, ET 32, ET

34, ET 42, ET 45, ET 46, ET 48, ET 50, ET 53, ET 55, ET 56 isolates as pathogens were taken into cul-ture in PDA medium at 26oC for 4-5 days.

6 mm disks of fungal isolates whose efficiency was tested as bioagents with 6 mm disk taken from pathogen fungus culture were placed facing each other to the sides that are close to the edges of petri dishes that included PDA. As the controls, only path-ogen fungus and bioagent fungus isolates were planted in petri dishes that contained PDA and the mycelium of the fungal isolates tested as bioagents in control petri were left for incubation at 25oC to cover the agar surface fully. 3 petri dishes were used in the study for each bacterial isolate and 3 repeti-tions were made in random parcel study design.

The Data Analyses. The semi-diameter (R1) of

the pathogen in the control petri and the semi-diam-eter of the bioagent and the pathogen planted in the petri (R2) were measured, and the percentage inter-ference of the radial development were calculated according to Skidmore and Dickinson [9] (Fig. 1).

FIGURE 1

Measurement of radial development of the pathogen mycelia

PIRG (%) = R1 - R2 x 100 R1

PIRG = Percentage interference rate (%) R1 = The semi-diameter of the pathogen myce-

lium in the control petri R2= The semi-diameter of the pathogen myce-

lium in the double culture petri (ET 4 or ET 14 and pathogen fungus)

PIRG > %75 : Very high -: Ineffective


4234

TABLE 1 The identification and pathogenicity test results of the pathogen and bio-agent fungus

isolates used in the study Isolates Isolated from ITS identification results Identify (%) ITS Sequence* Pathogenecity Pathogens ET 21 Potatoes Fusarium oxysporum 98 KT807795 + ET 32 Pepper Fusarium oxysporum 99 KC808090 + ET 34 Pepper Fusarium oxysporum 97 KT807795 + ET 46 Cucumber Fusarium oxysporum 98 KX015960 + ET 53 Potatoes Fusarium oxysporum 99 KT807795 + ET 55 Potatoes Fusarium oxysporum 99 KX058138 + ET 56 Potatoes Fusarium oxysporum 99 KX015960 + ET 9 Apple Alternaria alternata 99 KP003986 + ET 42 Tomato Alternaria alternata 98 KT150100 + ET 30 Cucumber Sclerotinia sclerotiorum 98 CP017820 + ET 33 Egg plant Sclerotinia sclerotiorum 99 CP017820 + ET 48 Cucumber Sclerotinia sclerotiorum 98 CP017820 + ET 45 Tomato Fusarium solani 99 KJ874345 + ET 50 Cucumber Fusarium solani 99 KJ874345 + ET 13 Carrot Geotrichum candidum 99 KY977411 + Bioagents ET 4 Aesculus hippocastanum Trichoderma harzianum 87 KY806127 -

ET 14 Pinus sylvestris Trichoderma harzianum 97 KY806128 -

*GenBank database

FIGURE 2 The microscopic view of the development of Trichoderma harzianum ET4 and ET 14 isolates in different

media (right: petri view, sol: microscopic view of the development of petri (40X))

RESULTS The identification and pathogenicity test results

of the pathogen and bio-agent fungus isolates used in the study were given in Table 1. According to the identification test results of the pathogenic fungi, ET 21, ET 32, ET 34, ET 46, ET 53, ET 55 and ET 56 isolates were identified as Fusarium oxysporum; ET 30 and ET 48 isolates as Sclerotinia sclerotiorum; ET 9 and ET 42 isolates as Alternaria alternata; ET 45 and ET 50 isolates as Fusarium solani; ET 13 iso-late as Geotrichum candidum. Bioagent fungi iso-lates ET 4 and ET 14 were identified as T. harzi-anum. Pathogenetic test result of the ET 13, ET 21, ET 30, ET 32, ET 34, ET 42, ET 45, ET 46, ET 48, ET 50, ET 53, ET 55, ET 56ET 21, ET 32, ET 34, ET 46, ET 53, ET 55, ET 56 isolates were positive, but not ET 4 and ET 14.

The developments of T. harzianum ET 4 and ET 14 isolates, which were planted in different me-dia, are given in Fig. 2. When the daily growth of the bioagent fungi were examined. The fastest growth of

bioagent fungi were observed in SDA followed in or-der by MEA, PDA, NA.

The hyperparasitic effects of T. harzianum iso-lates in in vitro experiments are given in Table 2. In the present study, the hyperparasitic effect of the bio-agents changed between -33.30 and 80.24% for ET 4, and between -95.24 and 79.04% for ET 14 in Ta-ble 2. The pathogen isolates from which negative ef-fects were received were evaluated as being ineffi-cient (Table 2).

It was determined that the hyperparasitic effect of ET4 isolates was low in 11 pathogen isolates, at medium level in 1 pathogen isolates, at very high level in 1 pathogen isolates, and ineffective in 1 path-ogen isolates. The 11 isolates in which the effects were at low level were F. oxysporum (6), A. alternata (1), S. sclerotiorum (2) and F. solani (2), the 1 isolate in which the effects were at medium level was A. al-ternata, the 1 isolates in which the effects was at very high was G. candidum. It was observed that it was ineffective in 1 isolate of F. oxysporum (Table 2). It was also determined that the hyperparasitic effect of


4235

ET 14 isolates was low in 8 pathogen isolates, at me-dium level in 1 pathogen isolate, high in 2 pathogen isolates, at very high level in 1 pathogen isolate, and ineffective in 2 pathogen isolates. The 8 isolates in which low effect was determined were F. oxysporum (5), F. solani (2) and G. candidum (1), the 1 isolate

in which medium effect was determined was F. ox-ysporum (1), the 2 isolates in which high effect was determined were A. alternata (2) and 1 isolate in which very high effects were determined was S. scle-rotiorum (1). It was determined that the bioagent fungus E 14 was ineffective in 2 isolate of F. ox-ysporum and S. sclerotiorum (Table 2).

TABLE 2

Hyperparasitic effects of Trichoderma harzianum isolates tested against the pathogens in in vitro conditions

Pathogens

ET 4 ET 14 Isolates PIRG (%) HL Isolates PIRG (%) HL

Fusarium oxysporum

ET 21 13.87 + ET 21 49.33 + ET 32 33.33 + ET 32 45.00 + ET 34 -33.30 - ET 34 -93.33 - ET 46 00.00 + ET 46 39.99 + ET 53 44.40 + ET 53 37.25 + ET 55 14.28 + ET 55 16.67 + ET 56 17.77 + ET 56 57.33 ++

Average 12.91 + 21.75 + Alternaria alternata ET 9 28.87 + ET 9 64.40 +++

ET 42 54.17 ++ ET 42 66.63 +++ Average 41.52 + 65.51 +++ Sclerotinia sclerotiorum

ET 30 28.57 + ET 30 -95.24 - ET 48 30.55 + ET 48 79.04 ++++

Average 29.28 + -16.24 - Fusarium solani ET 45 10.25 + ET 45 18.33 +

ET 50 3.33 + ET 50 2.21 + Average 06.79 + 10.27 + Geotrichum candidum ET 13 80.24 ++++ ET 13 29.63 + Average 80.24 ++++ 29.63 +

PIRG: Percentage interference rate (%), HL: Hyperparasitic level, +: Low, ++: Medium, +++: High, ++++: Very high, -: Ineffective

FIGURE 3

The hyperparasitic effects of Trichoderma harzianum ET 4 (1st and 2nd column) and ET 14 (3rd and 4th column) in in vitro conditions (left: only pathogen; middle, pathogen and bioagent isolate, right: only bio-

agent isolate)


4236

According to, plant pathogen specieses, ET 4 were low in 6 isolates of F. oxysporum, ineffective in 1 isolate, low in 1 isolate of A. alternata, medium in 1 isolate, low in 2 isolates of S. sclerotiorum and F. solani and very high in 1 isolate of G. candidum, ET 14 were low in 5 isolates of F. oxysporum, me-dium in 1 isolate, ineffective in 1 isolate, high in 2 isolates of A. alternata, very high in 1 isolate of S. sclerotiorum, ineffective in 1 isolate, low in 2 iso-lates of F. solani and 1 isolate of G. candidum (Table 2).

When the average percentage interference rates were examined, it was determined that ET 4 was ef-fective at very high level in G. candidum and at low level in the other pathogens. According to average percentage intervention rates, ET 14 isolate was ef-fective at high level in A. alternata, low effect in the other pathogens except for S. sclerotiorum. ET 14 was ineffective S. sclerotiorum (Table 2).

The developments of T. harzianum ET 4 isolate was the most effective against F. oxysporum (ET 53 (44.40%)), A. alternata (ET 42 (54.17%)), S. sclero-tiorum (ET 48 (30.55%)), F. solani (ET 45 (10.25%)), G. candidum (ET 13 (80.24%)) and T. harzianum ET 14 isolate was the most effective against F. oxysporum (ET 21 (49.33%)), A. alternata (ET 42 (66.63%)), S. sclerotiorum (ET48 (79.04%)), F. solani (ET 45 (18.33%)), G. candidum (ET 13 (26.93%)). These are given in Fig. 3.

DISCUSSION Fungucides are commonly used technique to

control soil-borne diseases. However, this method, besides being time-consuming and uneconomical, pollute the atmosphere, and are environmentally harmful as the chemicals accumulate in the soil and water. In this respect, microbial biocontrol agents have shown great potential as an alternative to fun-gicides and offer an environmentally friendly alter-native to the use of pesticides [10]. One of this mi-crobial biocontrol agents is Trichoderma species. Es-pecially, Trichoderma the most frequently investi-gated biocontrol microorganism [11] may be isolated from natural habitats of the target pathogens (i.e., in-fested soil or plants). This approach has, indeed, led to the isolation of several strains of T. harzianum an-tagonistic to and effective in controlling plant patho-genic fungi [12] and there were many studies demon-strating soil-borne disease control by T. harzianum [13-21]. Different pathogens such as F. oxysporum [15, 18, 22, 23], S. sclerotiorum [24-26], F. solani [16, 18, 22, 27], A. alternata [14, 28] and G. can-didum [29] were reported among them, too.

T. harzianum has effect mechanisms like chi--1- -1-4 glucanase produc-

tion, antibiotics, competitions, inorganic plant nutri-ent resolution, disabling pathogen enzymes, and en-couraging endurance [30-32] and in addition to this,

production of essential metabolites that suppress soil-based fungal pathogens and production of non-volatile antibiotic production, competition in terms of place and nutrients, and antagonism mechanisms [13, 14, 33]. The fungal cell wall has several constit-

-1,3- -1,6-glucan, mannosylated mannoproteins, and phospolipoman-nan [34]. With this aspect, T. harzianum is important biological control of plant pathogen fungi. The cell wall of the fungal plant pathogens tested in this study consisted chitin, b-1,3-glucan, and a-1,3-glucan [35-37].

Also, it was revealed in previous studies that they cause changes in plant metabolism by being col-onized on plant surfaces [38, 39]. They play im-portant roles in plant development by decreasing the development of plant pathogens, producing hormone like metabolites, and dissolving the nutrients from soil or organic substances [38, 40].

Hyperparasitic effect of T. harzianum was ob-served directly on plates of PDA medium using my-celial discs and hyperparasitic effect of growing T. harzianum against growth of all pathogenic fungal isolates was observed. In this study, hyperparasitic effects of T. harzianum isolates were investigated ac-cording to percentage interference rate, and the pre-vention of the pathogens was classified as low, me-dium, high, very high and ineffective level. Accord-ing to the average values, ET 4 isolate was effective at a high level on G. candidum, and the ET 14 isolate was effective at a medium level on A. alternata.

CONCLUSIONS This study matters to highlight the successful

usage of an environment-friendly, natural, and for health of humans and other livings, risk-free product against plant diseases in substitution for the chemical pesticides that are intensely used and harmful for en-vironment, natural balance and human health.

The present study showed that T. harzianum (ET 4 and ET 14) may be useful as potential biocon-trol agents against F. oxysporum, A. alternata, S. sclerotiorum, F. solani and G. candidum.

REFERENCES

[1] Anonymous (2009) Turkish The Benefist of Bi-otechnology Comperdium (accessed: http:// www.census.gov/ipc/,www/idp/worldpopinfo. html)

[2] Agrios, G.N. (1997) Plant Pathology. Fourth Edition. Academic Press. USA.


4237

[3] Varol, A.F. (2008) Efficacies of some disinfect-ants in control of root rot pathogens (spp, spp., spp.) of to-mato. Msc thesis. Ege University, Graduate School of Natural and Applied Science, Bor-

71p. (in Turkish). [4] Eken, C. and Demirci, E. (1997) Using fungi in

biological control. Atatürk University, Journal of Agricultural Faculty 28(1), 138-152. (in Turkish).

[5] Parmar, H.J., Bodar, N.P., Lakhani, H.N., Patel, S.V., Umrania, V.V. and Hassan, M.M. (2015) Production of lytic enzymes by Trichoderma strains during in vitro antagonism with Sclero-tium rolfsii, the causal agent of stem rot of groundnut. African Journal of Microbiology Re-search. 9(6), 365-372.

[6] John, R.P., Tyagi, R.D., prevost, D., Brar, S.K., Pouler, S. and Surampalli, R.Y. (2010) Myco-parasitic Trichoderma viride as a biocontrol agent against Fusarium oxysporum f. sp. adzuki and Pythium arrhenomanes and as a growth pro-moter of soybean. Crop Protection. 29(2010), 1452e1459.

[7] White, T.J., Brauns, T., Lee, S. and Taylor, J. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J. (eds.) PCR Protocols. A guide to Methods and Applications. Academic Press, San Diego. 315-322.

[8] (1991) Soil Microfungi. Atatürk University. Publications. 11, Vol: 1-7, Erzurum.

[9] Skidmore, A.M. and Dickinson, C.M. (1976) Colony Interactions and Hyphal Interference Between Sepatoria nodorum and Phylloplane Fungi. Trans. Br. Mycol. Soc. 66, 57 -64.

[10] Kotan, R., Sahin, F., Demirci, E. and Eken, C. (2009) Biological control of the potato dry rot caused by Fusarium species using PGPR strains. Biological Control. 50, 194-198.

[11] Harman, G.E., Howell, C.R., Viterbo, A., Lorito, I.M. (2004) Trichoderma species-oppor-tunistic, avirulent plant symbionts. Nat Rev. 2, 43-56.

[12] Chet, I and Inbar, J. (1994) Biological Control of Fungal Pathogens. Applied Biochemistry and Biotechnology. 48, 37-43.

[13] Elad, Y., Chet, I., Boyle, P. and Henis, Y. (1983) Parasitism of Trichoderma spp. on Rhizoctonia solani and Sclerotinia rolfsii- scanning electron microscopy and fluorescence microscopy. Phys-ioloy and Biochemistry. 73(1), 85-88.

[14] Benhamou, N. and Chet, I. (1993) Hyphal inter-actions between Trichoderma harzianum and Rhizoctonia solani: ultrastructure and gold cyto-chemistry of mycoparasitic process. Cytology and Histology. 83(10), 1062-1071.

[15] Grondona, I., Hermosa, R., Tejada, M., Gomis, M.D., Mateos, P.F., Bridge, P.D., Monte, E. and Garcia-Acha, I. (1997) Physiological and Bio-chemical Characterization of Trichoderma har-zianum, a Biological Control Agent against Soilborne Fungal Plant Pathogens. Applied and Environmental Microbiology. 63(8), 3189-3198.

[16] Asran-Amal, A., Moustafa-Mahmoud, S.M., Sabet, K.K. and El Banna, O.H. (2010) In vitro antagonism of cotton seedlings fungi and char-acterization of chitinase isozyme activities in Trichoderma harzianum. Saudi Journal of Bio-logical Sciences. 17, 153 157.

[17] Seema, M. and Devaki, N.S. (2012) In vitro evaluation of biological control agents against Rhizoctonia solani Journal of Agricultural Technology. 8(1), 233-240.

[18] Akrami, M. (2015) Effects of Trichoderma spp. in Bio-controlling Fusarium solani and F. ox-ysporum of Cucumber (Cucumis sativus). J. Appl. Environ. Biol. Sci. 4(3), 241-245.

[19] , Determi-nation of the In vitro Effect of Trichoderma har-zianum on Phytopathogenic Strains of Fusarium oxysporum. Not Bot Horti Agrobo. 43(2), 494-500.

[20] Basumatary, M., Dutta, B.K and Singha, D.M. (2015) Some in vitro Observations on the Bio-logical Control of Sclerotium rolfsii, a Serious Pathogen of Various Agricultural Crop Plants. Journal of Agriculture and Veterinary Science. 8(2), 87-94.

[21] Barari, H. (2016) Biocontrol of tomato Fusarium wilt by Trichoderma species under in vitro and in vivo conditionsnomice în Moldova. 49(1), 91-98.

[22] Akrami, M., Khiavi, H.K., Shikhlinski, H. and Khoshvaghtei, H. (2012) Bio controlling two pathogens of chickpea Fusarium solani and Fusarium oxysporum by different combinations of Trichoderma harzianum, Trichoderma asperellum and Trichoderma virens under field condition. International Journal of Agricultural Science Research. 1(3), 41-45.

[23] Saravanakumar, K., Yu, C., Dou, K., Wang, M., Li, Y. and Chen, J. (2016) Synergistic effect of Trichoderma-derived antifungal metabolites and cell wall degrading enzymes on enhanced biocontrol of Fusarium oxysporum. Biological Control. 94, 37 46.

[24] Inbar, J., Menendez, A. and Chet, I. (1996) Hy-pha

and S and its . Soil Biol. Biochem.

28(6), 757-763. [25] Elad, Y. and Kapat, A. (2000) The role of

Trichoderma harzianum protease in the biocon-trol of Botrytis cinerea. Eur J Plant Pathol. 105, 177-189.


4238

[26] Figueirêdo, G.S., Figueirêdo, L.C., Cavalcanti, F.C.N., Santos, A.C., Costa, A.F. and Oliveira, N.T. (2010) Biological and Chemical Control of Sclerotinia sclerotiorum using Trichoderma spp. and Ulocladium atrum and Pathogenicity to Bean Plants. Brazilian Archives of Biology and Technology. 53(1), 1-9.

[27] Rojo, F.G., Reynoso, M.M., Ferez, M., Chulze, S.N., Torres, A.M. (2007) Biological control by Trichoderma species of Fusarium solani caus-ing peanut brown root rot under field conditions. Crop Protection. 26, 549 555.

[28] Verma, M., Brar, S.K., Tyagi, R.D., Surampalli, R.Y. and Valero, J.R. (2007) Antagonistic fungi, Trichoderma spp.: Panoply of biological con-trol. Biochemical Engineering Journal. 37 (2007) 1 20.

[29] De-Matos, A.P. (1983) Chemical and microbio-logical factors influencing the infection of lem-ons by Geotrichum candidum and Penicillium digitatum. Ph.D. Thesis. University of Califor-nia, Riverside. 106 p.

[30] Elad, Y. and Kapat, A. (2000) The role of Trichoderma harzianum protease in the biocon-trol of Botrytis cinerea. Eur J Plant Pathol. 105, 177-189.

[31] Harman, G.E. (2006) Overview of mechanisms and uses of Trichoderma spp. Phytopathol. 96, 190-194.

[32] Jeffries, P. and Young, T.W.K. (1994) Interfun-gal Parasitic Relationships. CAB International, Wallingford, United Kingdom, 296.

[33] Altomare, C, Norvell, W.A., Bjbrkman, T. and Harman, G.E. (1999) Solubilization of phos-phates and micronutrients by the plantgrowth promoting and biocontrol fungus Trichoderma harzianum Rifai 1295-22. Applied Environ Mi-crobiol. 65, 2926-2933.

[34] Fernandes, C., Anjos, J., Walker, L.A., Silva, B.M.A., Cortes, L., Mota, M., Munro, C.A., Gow, N.A.R. and Gonçalves, T. (2014) Modu-lation of Alternaria infectoria Cell Wall Chitin and Glucan Synthesis by Cell Wall Synthase In-hibitors. Antimicrob Agents Chemother. 58(5), 2894 2904.

[35] Schoffelmeer, E.A.M., Klis, F.M., Sietsma, J.H. and Cornelissen, B.J.C. (1999) The Cell Wall of Fusarium oxysporum. Fungal Genetics and Bi-ology. 27, 275 282.

[36] Anitha, A. and Rabeeth,M. (2010) Degradation of fungal cell walls of phytopathogenic fungi by lytic enzyme of Streptomyces griseus. African Journal of Plant Science. 4(3), 61-66.

[37] Liu, L. and Free, S.J. (2016) Characterization of the Sclerotinia sclerotiorum cell wall proteome. Molecular Plant Pathology. 17(6), 985-995.

[38] Howel, C.R. (2003) Mechanisms employed by Trichoderma species in the of biological control disease the history and evolution current con-cepts. Plant Dis. 87, 4-10.

[39] Kleifeld, O. and Chet, I. (1992) Trichoderma harzianum interaction with plants on effect on growth response. Plant Soil. 144, 267-272.

[40] Vinale, F.R., Scala, F., Ghisalberti, E.L., Lorito, M., Sivasithamparam, K. (2006) Major second-ary school metabolites produced by two com-mercial Trichoderma strains active against dif-ferent Phytopatholgens. Lett Appl. Microbiol. 43, 143-148.

Received: 11.11.2017 Accepted: 26.03.2018 CORRESPONDING AUTHOR Elif Tozlu Atatürk University, Faculty of Agriculture, Department of Plant Protection, TR-25240-Erzurum -Turkey e-mail: [email protected]

SCREENING OF TRICHODERMA HARZIANUM RIFAI (1969)...

Documents

Transcript of SCREENING OF TRICHODERMA HARZIANUM RIFAI (1969)...