SCALE-IT Faculty Workshop Pandemic Flu: Past and Present A Problem Based Approach to Pandemic Flu

33
SCALE-IT Faculty Workshop Pandemic Flu: Past and Present A Problem Based Approach to Pandemic Flu Ethel Stanley, Beloit College >Texas2009227831823 ATGAATCCAAACCAAAAGATAATAACCATTGGTTCGGTCTGTATGACAATTGGAATGGCTAACTTAATAT TACAAATTGGAAACATAATCTCAATATGGATTAGCCACTCAATTCAACTTGGGAATCAAAATCAGATTGA AACATGCAATCAAAGCGTCATTACTTATGAAAACAACACTTGGGTAAATCAGACATATGTTAACATCAGC AACACCAACTTTGCTGCTGGACAGTCAGTGGTTTCCGTGAAATTAGCGGGCAATTCCTCTCTCTGCCCTG TTAGTGGATGGGCTATATACAGTAAAGACAACAGTGTAAGAATCGGTTCCAAGGGGGATGTGTTTGTCAT AAGGGAACCATTCATATCATGCTCCCCCTTGGAATGCAGAACCTTCTTCTTGACTCAAGGGGCCTTGCTA AATGACAAACATTCCAATGGAACCATTAAAGACAGGAGCCCATATCGAACCCTAATGAGCTGTCCTATTG GTGAAGTTCCCTCTCCATACAACTCAAGATTTGAGTCAGTCGCTTGGTCAGCAAGTGCTTGTCATGATGG CATCAATTGGCTAACAATTGGAATTTCTGGCCCAGACAATGGGGCAGTGGCTGTGTTAAAGTACAACGGC ATAATAACAGACACTATCAAGAGTTGGAGAAACAATATATTGAGAACACAAGAGTCTGAATGTGCATGTG TAAATGGTTCTTGCTTTACTGTAATGACCGATGGACCAAGTAATGGACAGGCCTCATACAAGATCTTCAG AATAGAAAAGGGAAAGATAGTCAAATCAGTCGAAATGAATGCCCCTAATTATCACTATGAGGAATGCTCC TGTTATCCTGATTCTAGTGAAATCACATGTGTGTGCAGGGATAACTGGCATGGCTCGAATCGACCGTGGG TGTCTTTCAACCAGAATCTGGAATATCAGATAGGATACATATGCAGTGGGATTTTCGGAGACAATCCACG CCCTAATGATAAGACAGGCAGTTGTGGTCCAGTATCGTCTAATGGAGCAAATGGAGTAAAAGGATTTTCA TTCAAATACGGCAATGGTGTTTGGATAGGGAGAACTAAAAGCATTAGTTCAAGAAACGGTTTTGAGATGA TTTGGGATCCGAACGGATGGACTGGGACAGACAATAACTTCTCAATAAAGCAAGATATCGTAGGAATAAA TGAGTGGTCAGGATATAGCGGGAGTTTTGTTCAGCATCCAGAACTAACAGGGCTGGATTGTATAAGACCT TGCTTCTGGGTTGAACTAATCAGAGGGCGACCCAAAGAGAACACAATCTGGACTAGCGGGAGCAGCATAT CCTTTTGTGGTGTAAACAGTGACACTGTGGGTTGGTCTTGGCCAGACGGTGCTGAGTTGCCATTTACCAT TGACAAGTAA

description

SCALE-IT Faculty Workshop Pandemic Flu: Past and Present A Problem Based Approach to Pandemic Flu Ethel Stanley, Beloit College. >Texas2009227831823 ATGAATCCAAACCAAAAGATAATAACCATTGGTTCGGTCTGTATGACAATTGGAATGGCTAACTTAATAT TACAAATTGGAAACATAATCTCAATATGGATTAGCCACTCAATTCAACTTGGGAATCAAAATCAGATTGA - PowerPoint PPT Presentation

Transcript of SCALE-IT Faculty Workshop Pandemic Flu: Past and Present A Problem Based Approach to Pandemic Flu

Page 1: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

SCALE-IT Faculty WorkshopPandemic Flu: Past and Present

A Problem Based Approach to Pandemic Flu Ethel Stanley, Beloit College

>Texas2009227831823ATGAATCCAAACCAAAAGATAATAACCATTGGTTCGGTCTGTATGACAATTGGAATGGCTAACTTAATATTACAAATTGGAAACATAATCTCAATATGGATTAGCCACTCAATTCAACTTGGGAATCAAAATCAGATTGAAACATGCAATCAAAGCGTCATTACTTATGAAAACAACACTTGGGTAAATCAGACATATGTTAACATCAGCAACACCAACTTTGCTGCTGGACAGTCAGTGGTTTCCGTGAAATTAGCGGGCAATTCCTCTCTCTGCCCTGTTAGTGGATGGGCTATATACAGTAAAGACAACAGTGTAAGAATCGGTTCCAAGGGGGATGTGTTTGTCATAAGGGAACCATTCATATCATGCTCCCCCTTGGAATGCAGAACCTTCTTCTTGACTCAAGGGGCCTTGCTAAATGACAAACATTCCAATGGAACCATTAAAGACAGGAGCCCATATCGAACCCTAATGAGCTGTCCTATTGGTGAAGTTCCCTCTCCATACAACTCAAGATTTGAGTCAGTCGCTTGGTCAGCAAGTGCTTGTCATGATGGCATCAATTGGCTAACAATTGGAATTTCTGGCCCAGACAATGGGGCAGTGGCTGTGTTAAAGTACAACGGCATAATAACAGACACTATCAAGAGTTGGAGAAACAATATATTGAGAACACAAGAGTCTGAATGTGCATGTGTAAATGGTTCTTGCTTTACTGTAATGACCGATGGACCAAGTAATGGACAGGCCTCATACAAGATCTTCAGAATAGAAAAGGGAAAGATAGTCAAATCAGTCGAAATGAATGCCCCTAATTATCACTATGAGGAATGCTCCTGTTATCCTGATTCTAGTGAAATCACATGTGTGTGCAGGGATAACTGGCATGGCTCGAATCGACCGTGGGTGTCTTTCAACCAGAATCTGGAATATCAGATAGGATACATATGCAGTGGGATTTTCGGAGACAATCCACGCCCTAATGATAAGACAGGCAGTTGTGGTCCAGTATCGTCTAATGGAGCAAATGGAGTAAAAGGATTTTCATTCAAATACGGCAATGGTGTTTGGATAGGGAGAACTAAAAGCATTAGTTCAAGAAACGGTTTTGAGATGATTTGGGATCCGAACGGATGGACTGGGACAGACAATAACTTCTCAATAAAGCAAGATATCGTAGGAATAAATGAGTGGTCAGGATATAGCGGGAGTTTTGTTCAGCATCCAGAACTAACAGGGCTGGATTGTATAAGACCTTGCTTCTGGGTTGAACTAATCAGAGGGCGACCCAAAGAGAACACAATCTGGACTAGCGGGAGCAGCATATCCTTTTGTGGTGTAAACAGTGACACTGTGGGTTGGTCTTGGCCAGACGGTGCTGAGTTGCCATTTACCATTGACAAGTAA

Page 2: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

This workshop focuses on two pedagogical strategies to support collaborative, open-ended inquiry:

• investigative casesbioquest.org/icbl

• problem spacesbioquest.org/bedrock/problem_spaces/

Page 3: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

The international Commission on Biology Education (CBE) raised the bar for scientists and educators:

“Influencing almost all our activities, from inception to the grave, this (biological) revolution will require profound decisions with respect to the ethical, legal, social, cultural, educational, and development issues that are sure to arise, affecting our personal lives and society in ways that we have never experienced before.” (Vohra 2000)

Page 4: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

“Build into every course inquiry*, the processes of science, a knowledge of what practitioners do, and the excitement of cutting edge research.”

“involving the student in asking questions and finding answers” Shaping the Future: New Expectations for Undergraduate Education in Science, Mathematics, Engineering and Technology NSF, 1996. (p. 53)

Criticism of the way we teach science

Page 5: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

Entry into Cyberlearning

Our students engage in new methodologies as do we: Self-directed Instant information retrieval Social construction/collaboration Open resources Open Science / eScience

Page 6: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

“Crossing the Chasm” of Curricular Reform: BioQUEST Curriculum Consortium Invites CAL-laboration CAL-laborate Volume 4 June 2000

One strategy to address contemporary biology education is to use investigative cases.

Page 7: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

In this session, we will consider the pandemic flu case:

• an oral history by a survivor of the deadly influenza pandemic of 1918 believed to be responsible for at least 40 million deaths worldwide

• responses from learners in introductory biology

• multiple approaches to investigating influenza A viruses such as 1918 H1N1, H1N5, and the 2009 H1N1

• online tools, data, and resources to support the investigation of pandemic flu

Page 8: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

T. BARTLEY:    . . you ain't old enough to rememberthe year the flu struck the people so bad in this . . . in this country, do you?    HAWKINS: Yeah, I think that both my… both my great-grandparents died in that.    T. BARTLEY:   It was the saddest lookin‘ time then that ever you saw in your life. My brother lived over there in the camps then and I was working over there and I was dropping cars onto the tipple. And that, that epidemic broke out and people went to dyin’ and there just four and five dyin‘ every night dyin’ right there in the camps, every night. And I began goin‘ over there, my brother and all his family took down with it, what’d they call it, the flu? Yeah, 1918 flu. And, uh, when I’d get over there I’d ride my horse and, and go over there in the evening and I’d stay with my brother about three hours and do what I could to help ’em. And every one of them was in the bed and sometimes Doctor Preston would come while I was there, he was the doctor. And he said “I’m a tryin‘ to save their lives but I’m afraid I’m not going to.”And they were so bad off. And, and every, nearly every porch, every porch that I’d look at had—would have a casket box a sittin’ on it. And men a diggin‘ graves just as hard as they could and the mines had to shut down there wasn’t a nary a man, there wasn’t a, there wasn’t a mine arunnin’ a lump of coal or runnin' no work. Stayed that away for about six weeks. .

http://historymatters.gmu.edu/d/107“There Wasn’t a Mine Runnin’ a Lump O’ Coal”: A Kentucky Coal Miner

Remembers the Influenza Pandemic of 1918–1919

Page 9: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

1.What is this narrative about?

2.What do you already know? What would you like to know more about?

KNOW NEED TO KNOW

Page 10: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

1. What is this case about?Flu of 1918 and its effects on coal mining, community

Know Need to Know

There was a pandemic of flu in 1918.It killed many people.It interrupted work, mines closed.Some people lived in camps.It lasted about 6 weeks, according to the transcript.The doctor felt he couldn’t help people get better.Dealing with the dead was a huge issue.In 1918, World War I was ending.There were no vaccines then.Viruses were unknown.Influenza is caused by a virus.There’s a flu shot that you get every year.

Did soldiers/sailors bring the flu from elsewhere?Was there flu in other countries besides the US?How long did it last? What treatments were available then?What treatments were available now? How is flu spread?Why did so many people die of it?What made this particular flu so deadly?Do people die of flu today, like the annual flu? Have there been other epidemics of flu?Could it happen again?

Page 11: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu
Page 12: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

http://www.demog.berkeley.edu/~andrew/1918/

Data

Page 13: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

Year Male Female1911 50.9 54.41912 51.5 55.91913 50.3 551914 52 56.81915 52.5 56.81916 49.6 54.31917 48.4 541918 36.6 42.21919 53.5 56

Average Age at Death from 1911 until 1919 (Noymer 2007)

Page 14: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

Age 1917 1918<1 2944.5 4540.9

1--4 422.7 1436.25--14 47.9 352.715-24 78 1175.725-34 117.7 199835-44 193.2 1097.645-54 292.3 686.8

US Deaths per 100,000 Attributed to Influenza and Pneumonia in 1917 and 1918 (Noymer 2007)

Page 15: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

Street car conductor in Seattle not allowing passengers aboard without a mask.

Record held at: National Archives at College Park, MD. 165-WW-269B-11

In 1918, Seattle public health officials required all passengers and employees mass transit systems wear masks. At that time no one knew what caused the influenza and vaccines were not available. It was understood that coughing and sneezing contributed to the spread of the disease. Spitting was also prohibited in many cities.

Strategies

Page 16: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

Predict generally what changes you’d expect to see in the SIR model results with respect to S, I, and R individuals if you were to simulate the use of masks. (Hint: Assume a 10% decrease in transmission.)

0

20

40

60

80

100

120

140

160

180

200

0 20 40 60 80 100Time

# Pe

ople

Susceptible # Infected # Recovered #

Tools

Page 17: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

Simulation Results for Scenario 2 of Avian Influenza with 200 people (200 susceptible) and the use of masks with a 10% reduction in transmission.

Masks are used starting on day 30, when the epidemic has already nearly run its course.

Page 18: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

Simulation Results for Scenario 3 of Avian Influenza with 200 people (200 susceptible) and the use of masks with a 10% reduction in transmission.

Masks are used starting on day 10, when the epidemic is still in its growth phase.

Page 19: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu
Page 20: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

The effect of public health measures on the 1918 influenza pandemic in U.S. cities.Bootsma MC, Ferguson NM.Mathematical Institute, Faculty of Sciences, Utrecht University, Budapestlaan 6, 3508 TA Utrecht, The Netherlands.

During the 1918 influenza pandemic, the U.S., unlike Europe, put considerable effort into public health interventions. There was also more geographic variation in the autumn wave of the pandemic in the U.S. compared with Europe, with some cities seeing only a single large peak in mortality and others seeing double-peaked epidemics. Here we examine whether differences in the public health measures adopted by different cities can explain the variation in epidemic patterns and overall mortality observed. We show that city-specific per-capita excess mortality in 1918 was significantly correlated with 1917 per-capita mortality, indicating some intrinsic variation in overall mortality, perhaps related to sociodemographic factors. In the subset of 23 cities for which we had partial data on the timing of interventions, an even stronger correlation was found between excess mortality and how early in the epidemic interventions were introduced. We then fitted an epidemic model to weekly mortality in 16 cities with nearly complete intervention-timing data and estimated the impact of interventions. The model reproduced the observed epidemic patterns well. In line with theoretical arguments, we found the time-limited interventions used reduced total mortality only moderately (perhaps 10-30%), and that the impact was often very limited because of interventions being introduced too late and lifted too early. San Francisco, St. Louis, Milwaukee, and Kansas City had the most effective interventions, reducing transmission rates by up to 30-50%. Our analysis also suggests that individuals reactively reduced their contact rates in response to high levels of mortality during the pandemic.

http://www.pnas.org/cgi/reprint/0611071104v1

Page 21: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

                                                                                                            

                                    

Fig. 2.Effects of transient imperfect health interventions on epidemic dynamics. Results derived from a simple deterministic susceptible–infected–recovered (SIR) epidemic model. Weekly infection incidence over 6 months from a SIR model with 3.5-day infectious period, R0 = 2, 100,000 population, two seed infections at time 0, and controls imposed from day 25. Green curve, no controls; red curve, over-effective controls that reduce R by 40% and stop on day 75 (leading to a second wave); blue curve, controls that reduce R by 32.5% and stop on day 110 (giving the minimal possible epidemic size).

Page 22: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

InterventionsPharmacological Interventions

Nonpharmacologic interventions (NPIs) – efficacy and gaining compliance

• Community mitigation (school closures, restrictions on movements)

• Quarantine and isolation of healthy and sick individuals

• Travel restrictions locally and globally• Social distancing • Use of masks and increased hygiene

• Vaccination• Antivirals as prophylactics

Page 24: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

Suggested resources related to pandemic planning:

Pandemicplanning.govAvianflu.govNational Governor’s Association document on Preparing for Pandemic InfluenzaCenters for Disease Control and Prevention (cdc.gov)World Health Organization (www.who.int/en/)PubMed (www.ncbi.nlm.nih.gov/

Page 25: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

Mapping the flu in the 21st century Many of the maps that track the current H5N1 avian flu in humans and birds are interactive http://www.pbs.org/newshour/indepth_coverage/health/birdflu/map_flash.html

http://news.bbc.co.uk/1/shared/spl/hi/world/05/bird_flu_map/html/1.stm

http://online.wsj.com/public/resources/documents/info-flash05a.html?project=avianflumap05&h=500&w=780&hasAd=1

First install Google Earth from http://earth.google.com .Next load the Bird Flu  layer: http://www.daden.co.uk/newsglobe/birdflu.kmz

Page 26: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

http://www.gapminder.org/videos/swine-flu-alert-news-death-ratio-tuberculosis/

Page 27: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu
Page 28: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

Currently, 16 antigenically distinct groups of H molecules and 9 distinct groups of N molecules have been identified in Influenza A.

The immune system responds specifically to each of the H and N surface proteins found in a virus particle.

Human glycoprotein receptors (eyes, nose, upper throat) for H1, H2 and H3 influenza A facilitate transmission of these strains among humans.

Neuraminidase help virus particles through the respiratory tract mucus and virions emerge from the infected cell.

Page 29: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

Influenza H1N1 2009 is a novel virus quite unlike other H1N1 influenza viruses that have preceded it.

Hemagglutinin is 27.2% and Neuraminidase is 18.2% different in amino acid sequence from the H1N1 2008.

Influenza H1N1 2009 significant pandemic potential.

Page 30: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

>Texas2009227831823ATGAATCCAAACCAAAAGATAATAACCATTGGTTCGGTCTGTATGACAATTGGAATGGCTAACTTAATATTACAAATTGGAAACATAATCTCAATATGGATTAGCCACTCAATTCAACTTGGGAATCAAAATCAGATTGAAACATGCAATCAAAGCGTCATTACTTATGAAAACAACACTTGGGTAAATCAGACATATGTTAACATCAGCAACACCAACTTTGCTGCTGGACAGTCAGTGGTTTCCGTGAAATTAGCGGGCAATTCCTCTCTCTGCCCTGTTAGTGGATGGGCTATATACAGTAAAGACAACAGTGTAAGAATCGGTTCCAAGGGGGATGTGTTTGTCATAAGGGAACCATTCATATCATGCTCCCCCTTGGAATGCAGAACCTTCTTCTTGACTCAAGGGGCCTTGCTAAATGACAAACATTCCAATGGAACCATTAAAGACAGGAGCCCATATCGAACCCTAATGAGCTGTCCTATTGGTGAAGTTCCCTCTCCATACAACTCAAGATTTGAGTCAGTCGCTTGGTCAGCAAGTGCTTGTCATGATGGCATCAATTGGCTAACAATTGGAATTTCTGGCCCAGACAATGGGGCAGTGGCTGTGTTAAAGTACAACGGCATAATAACAGACACTATCAAGAGTTGGAGAAACAATATATTGAGAACACAAGAGTCTGAATGTGCATGTGTAAATGGTTCTTGCTTTACTGTAATGACCGATGGACCAAGTAATGGACAGGCCTCATACAAGATCTTCAGAATAGAAAAGGGAAAGATAGTCAAATCAGTCGAAATGAATGCCCCTAATTATCACTATGAGGAATGCTCCTGTTATCCTGATTCTAGTGAAATCACATGTGTGTGCAGGGATAACTGGCATGGCTCGAATCGACCGTGGGTGTCTTTCAACCAGAATCTGGAATATCAGATAGGATACATATGCAGTGGGATTTTCGGAGACAATCCACGCCCTAATGATAAGACAGGCAGTTGTGGTCCAGTATCGTCTAATGGAGCAAATGGAGTAAAAGGATTTTCATTCAAATACGGCAATGGTGTTTGGATAGGGAGAACTAAAAGCATTAGTTCAAGAAACGGTTTTGAGATGATTTGGGATCCGAACGGATGGACTGGGACAGACAATAACTTCTCAATAAAGCAAGATATCGTAGGAATAAATGAGTGGTCAGGATATAGCGGGAGTTTTGTTCAGCATCCAGAACTAACAGGGCTGGATTGTATAAGACCTTGCTTCTGGGTTGAACTAATCAGAGGGCGACCCAAAGAGAACACAATCTGGACTAGCGGGAGCAGCATATCCTTTTGTGGTGTAAACAGTGACACTGTGGGTTGGTCTTGGCCAGACGGTGCTGAGTTGCCATTTACCATTGACAAGTAA

NeuraminidaseH1N1 2009 segment 6

What questions could you explore using Biology WorkBench and PDB sites?

NDJINNBlastN

Page 31: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

http://oercommons.org

Page 32: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

http://bioquest.org/

BioQUEST Curriculum Consortium Symposium

Page 33: SCALE-IT Faculty Workshop Pandemic Flu: Past and  Present A Problem Based Approach to Pandemic Flu

Resources from Biological ESTEEM (Excel Simulations and Tools for Exploratory, Experiential Mathematics), Numbers Count, Investigative Cases, BEDROCK Problem Spaces, Microbes Count!, and the BioQUEST Library introduce quantitative reasoning, models, simulations, data analysis, and strategies for introductory biology problem solving.

http://bioquest.org/