Saint Cecilia Church · 2020. 9. 6. · This is our Saint Cecilia statue, which stands above the...
Transcript of Saint Cecilia Church · 2020. 9. 6. · This is our Saint Cecilia statue, which stands above the...
23 Sunday in Ordinary Time
September 6, 2020
Saint Cecilia Church
#179 2
OFFICES Rectory 215.725.1240 Eleanor Kerwick Business 215.725.1240 Susan Wagner PREP 215.725.2821 Eileen Litka School 215.725.8588 Bobbie Mitchell Tuition 215.725.2201 Lisa Hnat Fax 215.725.2130 Website: www.stceciliafc.org School: scsfoxchase.org CYO Facebook: Saint Cecilia Catholic Youth Organization
Rectory Office Hours Currently closed ~ call 215-725-1240 for emergency.
Saint Cecilia Church 535 Rhawn Street
Philadelphia, Pennsylvania 19111
PASTOR Reverend Charles E. Bonner
PASTOR EMERITUS Reverend Msgr. Francis X. Dreger
PAROCHIAL VICAR Reverend Robert Lucas PERMANENT DEACON Deacon Patrick Diamond
PRINCIPAL Sister Catherine Irene Masino , IHM
VICE PRINCIPAL Sister Carolyn Elizabeth Braun, IHM
SACRAMENTS Baptism First three Sundays of the month at 12:15pm. Arrangements must be made at least two weeks prior to the Baptism. At-tendance at a Pre-Jordan class is required for first time par-ents. Please pre-register for class by contacting the Rectory at 215-725-1240. Marriage Couples must contact a priest six months prior to the wedding. Reconciliation Saturdays from 4:00 to 5:00pm Homebound Visitation Please contact the Rectory.
Mass Schedule for Weekend ~ Sept. 12 & 13 Saturday (Vigil) 5:00pm Celebrant: Fr. Lucas Lector: Rita Malfara 6:30am Celebrant: Fr. Bonner Lector: Richard McIvor 8:00am Celebrant: Fr. Bonner Lector: Rose Messina 9:30am Celebrant: Fr. Lucas Lector: Frank Slavin 11:00am Celebrant: Fr. Lucas Lector: Michelle Riccobono
Mass is live-streamed 9:30am on Sundays
https://www.facebook.com/St-Cecilia-Church-Fox-Chase
Sunday Vigil 5:00pm (Saturday)
6:30am, 8:00am, 9:30am, 11:00am
Monday through Friday 6:30 and 8:30 am
Saturday 8:30 am
This is our Saint Cecilia statue, which stands above the entrance of the church.
It was professionally power washed. As you can see, it needs some attention.
We gave her a bath but she needs the beauty salon!
In order to take better care of it, the statue will be placed at a lower level in the near future.
R E T O R A T I O N
#179 3
My Jesus, I believe that You are present in the Most Holy Sacra-ment. I love You above all things, and I desire to receive You into my soul. Since I cannot at this moment receive You
sacramentally, come at least spiritually into my heart. I embrace You as if You were already there and unite myself wholly to You. Never permit me to be separated from You. Amen.
23rd Sunday in Ordinary Time The Liturgy of the Word First Reading Book of Prophet Ezekiel 33:7-9 Thus says the LORD: You, son of man, I have appointed watchman for the house of Israel; when you hear me say any-thing, you shall warn them for me. If I tell the wicked, “O wicked one, you shall surely die, ” and you do not speak out to dissuade the wicked from his way, the wicked shall die for his guilt, but I will hold you responsible for his death. But if you warn the wicked, trying to turn him from his way, and he refuses to turn from his way, he shall die for his guilt, but you shall save yourself. The word of the Lord. Thanks be to God. Responsorial Psalm If today you hear his voice, harden not your hearts. Second Reading Letter of St. Paul to the Romans 13:8-10
Brothers and sisters: Owe nothing to anyone, except to love one another; for the one who loves another has fulfilled the law. The commandments, “You shall not commit adultery; you shall not kill; you shall not steal; you shall not covet, ” and whatever other commandment there may be, are summed up in this saying, namely, “You shall love your neighbor as yourself.” Love does no evil to the neighbor; hence, love is the fulfillment of the law. The word of the Lord. Thanks be to God. Gospel The holy Gospel according to Matthew 18:15-20
Jesus said to his disciples: “If your brother sins against you, go and tell him his fault between you and him alone. If he listens to you, you have won over your brother. If he does not listen, take one or two others along with you, so that ‘every fact may be established on the testimony of two or three witnesses.’ If he refuses to listen to them, tell the church. If he refuses to listen even to the church, then treat him as you would a Gentile or a tax collector. Amen, I say to you, whatever you bind on earth shall be bound in heaven, and whatever you loose on earth shall be loosed in heaven. Again, amen, I say to you, if two of you agree on earth about anything for which they are to pray, it shall be granted to them by my heavenly Father. For where two or three are gathered together in my name, there am I in the midst of them.” The Gospel of the Lord. Praise to you, Lord Jesus Christ.
FOCUS: Love your neighbor as yourself.
Our readings today work togeth-er to teach us about the real obli-gations of the law, which include gently correcting one another so that our communities may be in harmony. Paul ex-plains how we must do this, and do all things, with love. And Jesus promises to remain with us always. LITURGY OF THE WORD: In the first reading, the Lord tells Ezekiel that he will be held responsible for the death of the wicked one if he does not speak out to dis-suade him from his way. In the Letter to the Romans, Paul writes that the one who loves another has fulfilled the law. In the Gospel, Jesus gives instructions for cor-recting another, gives authority to bind and loose, and promises where two or three are gathered together in my name, there am I in the midst of them. REFLECTION: As Jesus’ disciples we are to be a peo-ple who reflect his presence in our midst. Since for-giveness is such a rare commodity among individuals, communities, religions, tribes, races and nations, a com-munity that is characterized by forgiveness would cer-tainly be a way of announcing Jesus Christ to the world. If forgiveness were the hallmark of our Christian com-munity, we would be what Jesus hoped for us to be – "a city built on a hilltop," a " light to the nations." So we ask ourselves:
What effect has forgiveness had on my own life?
What person or institution am I called to forgive?
Let me begin the forgiveness process by praying for the one(s) who have offended me.
Let us pray with the Holy Father during the month of September that the planet’s resources will not be plundered, but shared in a just and respectful manner.
#179 4
PREP Parish Religious Education Program
CLASSES BEGIN SUNDAY ~ SEPTEMBER 13
online via Zoom
Teachers will contact students regarding time and details for Zoom Classes
Study Book pick up will be Saturday, September 12 9:00am to Noon for all late registrations.
Contact the rectory at 215-725-1240 to register.
Lectio Divina (from A Minute in the Church by Gus Lloyd) Have you ever read something and forgotten what you read just mo-ments later? When it comes to sa-cred Scripture, that’s not a good thing. That’s why you may want to try lectio divina. Lectio divina is Latin for “divine reading.” It’s a method of praying with the Scriptures. There are generally four steps to lectio divina: reading, medi-tation, contemplation and prayer. The first step—reading—is about quality and not quantity . Choose a very short pas-sage of Scripture, maybe just a verse or two. From there you may want to concentrate on a single word or phrase. Take it slowly, and allow God to speak to you. This leads to the second step, meditation, where you really reflect on what is read, leaving behind all the worldly dis-tractions that get in the way of hearing the voice of God. From there comes contemplation. This is where you relate what you’ve read into your daily life experiences, allowing God to enlighten you and apply his holy Word into your heart and your life. And finally, there is prayer, where we speak to God, listen to his voice and allow his Word to change us. Mission Co-Op
The Archdiocese of Philadelphia had assigned the Missionary Sisters of the Holy Rosary to our parish to make the annual Missionary Cooperation Plan appeal. The community was founded in Ireland in 1924 to work with the women of Nigeria, West Africa. The Missionary Sisters of the Holy Rosary are now an international community working in nine countries of Africa and in Brazil. They are a strictly missionary group with no institutions in the United States or Canada, so therefore rely almost exclusively on funds provided through the Society for the Propagation of the Faith and the generosity of the people back home to support their sisters on mission. If you would like to see more about them, their website is: www.mshr.org. Their appeal was scheduled for last Sunday but the Sisters were unable to come. In place of a second col-lection, the parish sent the Sisters a donation of $1,200.00 in your name.
Sunday Second Collections Today’s second collection is for the Black and Indian Missions. Mandated by the III Plenary Council in 1884, this National Col-lection for Black and Indian people continues as the embodiment of the Church’s concern for evangelizing the Black and Indian peoples of the United States. The funds are distributed as grants to dioceses throughout the U.S. sup-porting and strengthening evangelization programs.
Next Sunday, September 13, the second collection will be tak-en up for the Military Services. This collection was estab-lished by St. John Paul II in 1985 to provide a full range of Catholic pastoral ministries to those in the U.S. Armed Forces. This collection has been postponed from Lent until now.
Thank you for your generosity and support of these collec-tions.
Lord, on this Labor Day, we thank You for the blessing of work. We ask for strength to complete each day. We ask for rest when we are weary. We ask Your guidance for everyone seeking employ-ment, and we ask that You be with those whose faces we might never see but who work tirelessly each day for the good of us all. Amen.
for making this possible.
Permanent Diaconate Information Night (on Zoom) Lay men of the Archdiocese (above the age of 29) are invited to an online infor-mation session on Wednesday, September 30 at 7:00pm to learn about the vocation of the Permanent Deacon in the Church. No commitment is re-quired to attend. Register at archphila.org/deacon
Wedding Anniversary Mass The annual Mass to celebrate all those married, and especially those married 25 years or more and 50 years or more will be held at the Cathedral Basilica of SS Peter & Paul on Saturday, Oct. 17 at 5:15pm. For more info visit phillycatholiclife.org
Happy
Anniversary
#179 5
Opening Day for Students in Grades 2 to 8 Wednesday ~ September 9
Tuesday—September 8 Orientation Day for Teachers Wednesday—September 9 First Day of School for Grades 2 through 8; Students will report directly to their Homerooms at 8:00am Dismissal 12:30pm Special directions will be sent to Pre-K, Kindergarten and Grade 1 families Thursday—September 10 Grades 1 to 8 will report 8:00am and dismissal at 12:30pm; CARES meeting with parents will be virtual Friday—September 11 Grades 1 to 8 will report 8:00am and dismissal at 12:30pm Monday—September 14 First full day of classes; hot lunch program begins; CARES begins Back to School nights will be virtual this year. Directions will be sent out to each class for your date and time. Please check your email for details about arrival, dismissal and lunch.
Check the school’s website at www.scsfoxchase.org for important information.
Openings in Pre-K4 We would love to have you join us in Pre-K4 this year.
To register, please contact Lisa Hnat at 215-725-2201 or email her at [email protected]
Students must be 4 years of age by September 1, 2020 and you need the following to register:
1. State Birth Certificate (not the hospital certificate) 2. Baptismal Certificate (if baptized at St. Cecilia Church, please bring the original certificate) 3. Immunization Records
FEES FOR PRE-K: Registration $175; Lunch $50; Tuition $4,025
Sponsor a Student (2020-2021) This program helps our families who want to send their children to Saint Cecilia School and may have some financial difficulty along the way. With your help these families can keep their child in our school and receive a good Catholic education.
There are several gifting levels and payment options - You can make a one time payment or select any option you wish. We will identify those students with the greatest need and allocate the funds accordingly. For more information on this program or to give a tax deductible gift, please feel free to contact Lisa Hnat, Tuition Coordinator at 215-725-2201 or email her at [email protected].
Need help with Tuition? Apply for Scholarships on time Purchase Scrip Support the parish financially by using your church envelopes
Contact the Tuition Office at 215-725-2201 for information on the above.
179 Church of St. Cecilia, Philadelphia, PA (3rd) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
Stone • Brick • Concrete • Pointing • EP Henry • Stucco • Waterproofi ngZucaroZucaroCONTRACTINGCONTRACTING
Masonry ContractorsSince 1922
215.533.1934215.533.1934
20% Discounton Labor for all Mechanical Work
15% Cash Paidfor Accident Referrals
$39.00+tax
Inspection & Emissions
$19.95Oil Change
(Most Cars)
Auto Body & Repair Shop
612 Huntingdon Pike, Rockledge 215-379-3113 www.abbysautocenter.com
Lifetime Warranty on all Paint & Body Work. Satisfaction Guaranteed
In Our 4th Decade of Quality Service
French Drains • Foundation Repair • Mold Remediation
215-639-8500www.morganbasementwaterproofing.com
All Work Guaranteed
Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if we can help Save you money with your monthly
payments on your commercial property. Multi-Family, Retail, Offi ce Building, Apartment and Condos. Can close in as little as 45 days! Four
season customer service is our top priority.
www.duqfunding.com1650 Market Street - Suite 3600, Philadelphia, PA 19103
• Physical, Occupational & Speech Therapy• Short & Long Term Care• Beautiful On-Site Chapel With Daily Mass• Memory Support • Respite Stay• Adult Daycare • Woundcare• IV Therapy • Trach Care
ST. JOHN NEUMANN CENTERFOR REHAB AND HEALTHCARE
10400 Roosevelt Blvd.Philadelphia, PA
215-698-5600www.stnrehab.org
BUILD YOUR COMMUNITYBUILD YOUR COMMUNITY- Shop Local -
P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !
Advertise Your Business Here800-333-3166
ext. 161www.jppc.net
Rafferty Roofi ng215-281-0771
PA062531
For Quality & Honest Work at Reasonable PricesFree Estimates • Licensed & Insured
20 YEAR GUARANTEE ON HOT WHITE RUBBER ROOF
Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications
To all those essential workers keeping us safe,
yourservice is
invaluable & appreciated.
rivate & Public Healthcare - La- - - -- -- - - - nforcement, Public Safety - OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOfficeccecececececececececececece
ponders - Fooooooooooood &d & d &d & d & d & d & d &d & d &d &d &d & d & d & AAAAAAgrAAAAAAAAlture - Energy Sector rrrrrrrr rrrrr - Wa- Wa- Wa- WWW- Wa- Wa- Wa- WaWa- Wa- Wa- WWaste
Waterwaste - Transportattattattattattattatattatattattattattta ion ion ion ononononon on on onon on on on & Lo&&&&&&&& gics - Public Woooooooorks r & - & Infrfffffffffffff astastrastrtstttstaststtsttstst uctur
Communicatatatttttttatattatttioionononsionsionionionionsionionsiooniono & I&&&&&&&&& nforf matioy Workeorkekkekekekekekekekekekkekers -rs -rs -rs -rs -rs -rs -rs rs -rs -rs -rs -rs -s -s - Community
overnment WWWWWWWWWWWWWWWorkeorkeorkeorkeorkorkorkeorkeorkeorkeorkeorkorkorkeorkerrs - Critical Maacturing -g ---g --g -g ---g --g --- CheCheCheCheCheCheCheCheCheCheCheCheCheCheChemical & Hazardouateteeeeeeeeeeeeeerialrrrrrrrrrrrrrr s FiFiFiFiFiFiFiFiFiFiFiFiFiFiFinancnancnannannananaannanannancnancnancan ial Services - Defensdustristristristristristrstrtristristristritristritritrial Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Baasasasasasasase - Commercial Faciesssssessessssssss WorWorWorWorWorWorWorWorWorWorWorWorWorWorWorkkkkkkekekekerskekekkkk - Resid ti l & Sh ltervicesicesicesicescescecescesicesicesicescescescesces & Facilities - Hygiene Prod
To all thoserivate & Publicrivate & nforcement Pubnforcement Pub
ssentialFirst RespFirst Resp
workersWaterwaste Waterwaste
keepingcs - PublicuCommunCommun
s safe,chnologychnology
yzardouzardouD fD
service isvices DefensDefenmercial Facimercial Faci
invaluable &idential & Shelteidential & ShelteH i P dH i Ptha
nk yo
u
afeeeefeeeeeeeefefefefetyty --ttty --ttttty t -tt -- OffiOOOOOOOOOOOOO cers & First RespondeFFFoFFFFFF od &d &d &d &&&d &&d &&od d &&d &d &d &d &d &d &d &d &d AgrAAgrAAAAAgrAAAAAgrgrrgrrAggrrrAgrA rrgAAA rAAAgrAAgg iculicucuiculuiculiculiculcuiculiiicuicultureturetureurertureurturertureurrrurerrrurrtur - E- E- EE- E- E- E-- EEE- EEEnergy Se
ooroorror rrr - WaWa- WaWa- Wa- WW- WaWWWWWW- W- WWaa- WWaWaWaaWaasteststtstee stesssteetsteetts ess ees e & Wa& Wa& W& Wa& WaWaWW& Wa& Wa& WaW& Wa& Wa& WaWWWaa&& W& WaWa& Waterwterwterwterwteterwterwterwterwerwtterwe wteteerwerwerwrwwterwtterwwwasteastasteaasteasteaastesteteasteaassteasteaststststeeeeeee - TTT- T- TT- TT- T--- T- TT- T-- ranrarrarararrararraararaaaraarortrtrtrtrtrrrttttttatioatitiatiotitatiattiiatataatatataaaa n &&n & n &&n &nn Logistics - Public Wor
After
MASSES FOR THE WEEK OF September 7
MONDAY, September 7 6:30am – Gerardo & Giulia Incollingo 8:30am – John & Mary McMenamin
TUESDAY, September 8 6:30am – Jack Maynes 8:30am – Anna Behan Conk & Barbara Mahoney
WEDNESDAY, September 9 6:30am – William MacNeal 8:30am – John Flannery
THURSDAY, September 10 6:30am – Angelo Pilla 8:30am – Frank & Jean Sebold
FRIDAY, September 11 6:30am – Anthony & Susie DiJulio 8:30am – Jim & Barbara McKissick
SATURDAY, September 12 8:30am – Ora Gorry 5:00pm – Joseph R. Wagner, Sr.
Remember Our Sick and Suffering Walter Hnat Ed Lieber Christopher Rodgers Patricia Moore James J. Tobin Mary Schultz Ann Marie Tobin Masgai Charles Friel Meghan Kovacs Joan Marie Reiley John Lawrysk Maki Turner Kirsten Hosack-Edling Stephanie Morgan James Potts Owen Doyle Mary Benson Esther Sharp Mary Jane Brough Leo Wuestkamp Stephen Ruczynski Helen Tobin Mike McKee Andrew Slivjak Melissa Fischer George Burbage Patricia Greenleaf Rita Giordano Daniel Mitchell Lisa Kovacs-Breuer Gregory Farrell Ed MacNew Timothy Martin John Smykal Julia McCauley Alice Davis Mary Matthews Josephine O’Donnell Marguerite Zeltman Alice Zmijewski Jack Vogler Eileen Gaynor Alberta DeMasi Eleanor DeNoble Eugenia DiSilva Marian Diel Kathi Silcox Catherine Needham Connie Merkel Ellen Jones Roberta Mitchell
Let us pray for the souls of all the faithful departed
179 Church of St. Cecilia, Philadelphia, PA (i) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
FOX CHASE WINDOWS & DOORSSALES - INSTALLATION
Please Call ... 215-725-4211
FREE ESTIMATES
Parish Member
ALL TYPES WIRING & REPAIRS215–329–9456 Parish Member
G.J. ROSSI & SONELECTRICIANS
Now In Our 3rd Generation
PATRICK J. FOY(215) 281-9656
Interior & Exterior PaintingWallpapering & Scraping
FREE Estimates • Reliable • Honest
309 Central Ave., Cheltenham379-0881
JOSEPH P. FARLEYPLUMBING & HEATING
Alterations-Jobbing
Reg. No. 3121P.A. 043294
Classic OpticalDR. AMY C. TAN, O.D. 215-722-2242
*Eye Exams * Contact Lenses * Eyeglasses6516 R S A . (G R S )
Sweeney’sVerree Tavern
KITCHEN OPEN FROM 11 AM TO MIDNIGHT
The all new Kim’s Crab CakesPhilly’s Largest Wings
All Soups & Chili HomemadeTAKE OUT AVAILABLE
All Major Sporting Events With 6 Colored TV’s
Finest Tavern Food Now Available in our
New Private Dining Room
7968 VERREE RD.215–725-3366
Mariann OwensOffi ce: (215) 698-2000Direct: (215) 698-2027Cell: (215) 280-7222Email: [email protected] Buyers and Sellersin Philadelphia, Bucks, and Montgomery CountiesEach Offi ce Independently Owned and Operated
2000
SENIOR CITIZEN DISCOUNTS
ReliableFull Service Plumber
PLUMBING, HEATING & DRAIN CLEANING EMERGENCY SERVICE
INSURED • FREE ESTIMATES215-722-6783215-379-8300
SERVING ENTIRE CITY & SUBURBS
CITY VIOLATIONS CORRECTED
SEWER LINES REPLACED • HOT WATER HEATERSFROZEN PIPES • WATER PRESSURE INCREASED
DIGGING & EXCAVATION SPECIALISTS
Reg. Master Plumber #4287Michael Zalewski
Experience Peace of Mind:Pre-Arrange Your Burial at an
Archdiocese of Philadelphia Cemetery.
• Save today through pre-planning• Convenient terms for all of your burial needs• Traditional in ground, mausoleum & cremation options available at most cemeteries
CALL 215-352-4001 TODAY
Leslie AitaVocalist
Parishioner
Visit Us At Our New Location
Rockledge Plaza Huntingdon Pike
408 Huntingdon PikeRockledge, PA 19046215-379-2100
Family Ownedand Operated
Since 1948
$350Off Any New Stairlift With This Ad
• FREE in home evaluations• Family owned & operated for more than 20 years
1.888.900.8883
www.Tri-StateStairlifts.com
Traditional Funerals, Church Funerals & Memorial Services, Cremations“ONE FAMILY HELPING ANOTHER”
7450 Oxford Ave Phila, PA 19111 215-728-1050
David G RichardsonSupervisor/Owner
Cher l A Webb-RichardsonManager & LCBA Insurance Rep
Parishioner
richardsonsfuneralhome.com Councilman Brian O’Neill
Northeast offi ces near St. Cecilia ParishionersFox Chase - 432 Rhawn Street • 215-685-6431 • Rhawnhurst - 7522 Castor Ave • 215-685-0438
FreeNotaryPublic
Free copies
& Faxes
Karon MassadoReal Estate Salesperson
o 267.435.8015 m [email protected]
1601 Market St.- Fl. 19, Phila, PA
Wackerman Funeral Home, Inc.Wackerman Funeral Home, Inc.8060 Verree Rd. Philadelphia, PA 19111
www.wackermanfuneralhome.com 215-342-5200 Elizabeth Wackerman Bailey, Supervisor 1944 – Austin C. Wackerman - 2017 Emily Wackerman Funeral Director
Free & Confi dential Pregnancy Services24 Hour Hotline: 1-800-550-4900
www.BirthRight.org
“It is the right of every pregnant woman to give birth, and the right of every child to be born.”
~Birthright Charter7986 Oxford Avenue
Philadelphia, PA 19111215-728-0385
A Blessing from God
John DeCristofaroROOFING
Specializing in: Hot Asphalt RoofsShingle Roofs • Gutters • Spouts
215-379-2953 Member of St. Cecilia
A Tompkins Community BankFormerly Madison Bank
8000 Verree Rd., Philadelphia(215) 722-4566
www.risingsunhomecare.org
Providing The Highest Quality Care
Parishioner of St. Cecilia
215-605-9555
catering For your next event, call ahead to order
- Pickup or Delivery -WHITMAN SQUARE 215-969-3455 x1
Eric McHughParishioner
CYO Volunteer OFFERING AUTO, HOME, LIFE,
& BUSINESS INSURANCE Call for a quote
215-328-9990 x7001 or email [email protected]
210 Huntingdon Pike, Rockledge
Patronize the Adve isers who make this bulletin possible!
BUILD YOUR COMMUNITY!
Patt o i e the A
SHOP LOCAL
To advertise your business in this weekly bulletin,contact us at 1.800.333.3166
or visit us at www.jppc.net
Local, trusted, proven, effective, supportive, referrals, relationships, affordable, repetitious, versatile, lasting.
This describes the power of...
Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN!
Call 1.800.333.3166 TODAY!
179 - Church of St. Cecilia, Philadelphia, PA (b) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
Schmidt’s Florist 700 Solly Ave., Phila., PA 19111
www.schmidtsfl orist.com 215-745-6234
LAW OFFICES
PAUL A. COGHLAN437 RHAWN STREET
PHILADELPHIA, PA 19111(215) 725-5998
FAX (215) 725-3904
Robert Wetzel, F.D.419 Huntingdon Pike, Rockledge
Erich Wetzel, Supv.Willow Grove - Bill Herchenroder, Supv. INC.
Funeral Directors Since 1881 215-663-8550 • www.wetzelandson.com
Stewart and McGowanATTORNEYS-AT-LAW
6221 RISING SUN AVE. (Opposite St. William’s Church)338-2800
S W D ’ E
WE DELIVER~ Traditional Pizza~ White Pizza~ Tomato Pies
The Original
Pizza6500 Rising Sun Ave. • 215-745-9992
Nora McCloskeyParishioner
Fine Art ClassesWorkshops & Partiesfor Children & Adults215-301-0103
www.bloomingartiststudio.comwww.bloomingartiststudio.com
PLUMBING, HEATING, DRAIN CLEANING & AIR CONDITIONING
SENIOR CITIZEN DISCOUNTFREE ESTIMATES
Ph: (215) 728-1482Fax: (215) 742-7098
8675 Torresdale Ave.Philadelphia, PA 19136
WWW.BILLFRUSCO.COM
O’Donnell PaintingInterior and Exterior
House Painting & Drywall RepairNeat Clean Work • No Job Too SmallFree Estimates 215-677-5854
JOHN F. GIVNISH(3rd Generation)
JOHN F.X. GIVNISH, III(4th Generation)
Serving the Archdioceseof Philadelphia with
grace and dignity since 1928
1-800-GIVNISH
Each Offi ce Independently Owned and Operated
Larry AitaREALTOR®
Seniors Real Estate SpecialistOutstanding Agents. Outstanding Results.
Regency Realty
Cell: (215) 478-4344Offi ce: (215) [email protected]’s Get Moving!
2018 Outstanding
Agentof the Year
s.
Parishioner
Serving Families Since 1900
Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick, F.D. 1924-2013
Th omas M. McGoldrick, F.D. SupervisorJames T. Meyers, F.D. • Timothy J. Meyers, F.D.
215-884-0800 507 West Avenue, Jenkintown, PA 19046 www.mcgoldrickfh .com
Mallory’s Army FoundationUnited Together In The Fight Against Bullying...
Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com
(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send your email address by text message:
Text MALLORYSARMY to 22828 to get started.Message and data rates may apply.
Advertise Your Business Here800-333-3166
ext. 161www.jppc.net
What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering their vehicle
to make sure it is the car they are supposed to enter.
In Remembrance of Samantha Josephson
#WHATSMYNAME
JIM CASEYWallcoveringPainting • ScrapingClean Work • Since 1986215-379-0558 Member of Parish
Professionals Serving Professionals
Jay B. ComlyBuilding & Offi ce Maintenance
w/an A+ Rating
Commercial • AutomotiveResidential • Safes
Fully Equipped RadioDispatched Mobile Trucks
7936 Oxford Ave. 215-745-5007
Full Service Locksmith Since 1978Member of Parish
VERREEPHARMACY
7960 VERREE RD.(AT RHAWN)Free Delivery
M-F 9AM - 8PMSat. 9AM - 6PM
Sun. 9AM - 1 PM215-342-0100
Mitchell Spivack, R. PH.
HandymanElectric, PlumbingOdd jobs... Just Ask!
From McCloy’s TV 267-231-8785
Tax & AccountingFrancis J. McConnell CPA
Tax Preparation • Individual & Business(Across from St. Williams)
Call (215) 742-3428 for Appointments
Charles P. Elliott, PC 110 Central Ave
Cheltenham, PA 19012
215-663-2500We Make House Calls
Complimentary InitialConsultation
We are here for all your tax, IRS, fraud investigations,
& inheritance tax.
RENEE ROACHEREALTOR ~ PARISHIONER
FOX CHASE SPECIALISTBuying or Selling a Home?
Call Today!
Office 215-961-6000 Cell [email protected]
EASTERNEEEAEAAEAEEEEEEEEEEEEEEEEAEASTSTTTSTTTSSTTTTTTTTTEEREEEEEEEEEEEEEEAEAEAEEEEEEEEASTSTTTSTTSSTTTEEEREEEE
A Signature Hair Salon llc$10 OFF Color ServiceMen | Women | Children
7950 Bustleton Ave., Philadelphia, PA215-821-3522
Cochrane Construction LLC
ROOFINGSIDING * GUTTERS
Chimney Restorations & RepairsLicensed & Insured PA # 154589
Senior Citizen Discounts • Free Est.215-839-4317
www.cochraneconstruction.org
Friends, Family, Neighbors!
1-844-640-4200 PaulsRun.org/Living
Wedding Invitations Wedding Invitations & Holiday Cards& Holiday CardsLog onto Log onto www.jppc.netwww.jppc.netconveniently from yourconveniently from yourhome or offi ce.home or offi ce.Online CatalogOnline CatalogOnline OrderingOnline OrderingOnline ProofingOnline ProofingAll Major Credit All Major Credit Cards AcceptedCards Accepted
FREE UPS FREE UPS GROUND GROUND SHIPPINGSHIPPING!
WE CARE AND IT SHOWS
Beautiful On-Site Chapel with Daily Mass - Respite Stay Available
We Acknowledge We Appreciate
2990 Holme Ave., Phila.215-335-2100
www.imrehab.org
IMMACULATE MARYCENTER
Rehabilitation & Healthcare
Advertise Your Business Here
800-333-3166 ext. 161www.jppc.net
www.DesignerOfSmiles.com/cares