S WILLIAM Our Mission - St. William the Abbot

8
SERVED BY: Rev. Thomas Maher, Pastor Rev. James Redstone, Weekend Assistant Deacon Michael Abatemarco Deacon George Prevosti Deacon Kevin Smith SACRAMENT OF BAPTISM Baptisms may be arranged for most Sundays of the year at 1:00PM. Please call the parish office to schedule a Baptism. SACRAMENT OF RECONCILIATION Confessions are heard every Saturday after The 9:00AM Mass, 1/2 hour before each weekend Mass and Wednesday evenings at 6:00PM. RITE OF CHRISTIAN INITIATION OF ADULTS Those who wish to enter the Catholic faith and Catholics who wish to complete the sacraments of First Communion and Confirmation are most welcome to begin the journey at any time. Please call the parish office if interested. SACRAMENT OF MARRIAGE Engaged couples should call the parish office for an interview appointment one year before the wedding date. SACRAMENT OF THE SICK The Sacrament of the Anointing of the Sick will be administered at anytime. Please call the parish office. OBTAIN A MASS CARD During office hours we welcome those who would like to request that their special intentions or deceased loved ones be prayed for particularly at a weekday or weekend Mass. We ask for a donation of $10 per Mass. OBTAIN A CERTIFICATATE OF ELIGIBILITY: Registered parishioners who have been asked to be a Godparent or Confirmation Sponsor, should call the parish office to request a certificate of eligibility. REGISTER FOR THE PARISH We are so happy to welcome new members of our Parish Family! Please come to the parish office so that we can get your information and meet you. OFFICE HOURS: Monday thru Friday 9:30AM to 3:00PM The Parish Family of ST. WILLIAM THE ABBOT 2740 Lakewood Allenwood Road, Howell, NJ 07731 732-840-3535 www.stwilliamtheabbot.com email: [email protected] Our Mission We, the parish family of St. William the Abbot, a welcoming Catholic community, led by the Holy Spirit, are called to proclaim, and to witness to, the Good News of Salvation, so that we may grow together, among all generations, and advance the Kingdom of God, in our love and service of God and neighbor. COME WORSHIP WITH US Weekends Saturday: 5:00PM Sunday: 8:00AM, 10:15AM, 11:45AM Weekdays Monday & Tuesday: 9:00AM Wednesday: 9:00AM & 7:00PM Thursday, Friday & Saturday: 9:00AM Third Sunday of Easter April 18, 2021

Transcript of S WILLIAM Our Mission - St. William the Abbot

Page 1: S WILLIAM Our Mission - St. William the Abbot

SERVED BY: Rev. Thomas Maher, Pastor Rev. James Redstone, Weekend Assistant Deacon Michael Abatemarco Deacon George Prevosti Deacon Kevin Smith SACRAMENT OF BAPTISM Baptisms may be arranged for most Sundays of the year at 1:00PM. Please call the parish office to schedule a Baptism. SACRAMENT OF RECONCILIATION Confessions are heard every Saturday after The 9:00AM Mass, 1/2 hour before each weekend Mass and Wednesday evenings at 6:00PM. RITE OF CHRISTIAN INITIATION OF ADULTS Those who wish to enter the Catholic faith and Catholics who wish to complete the sacraments of First Communion and Confirmation are most welcome to begin the journey at any time. Please call the parish office if interested. SACRAMENT OF MARRIAGE Engaged couples should call the parish office for an interview appointment one year before the wedding date. SACRAMENT OF THE SICK The Sacrament of the Anointing of the Sick will be administered at anytime. Please call the parish office. OBTAIN A MASS CARD During office hours we welcome those who would like to request that their special intentions or deceased loved ones be prayed for particularly at a weekday or weekend Mass. We ask for a donation of $10 per Mass. OBTAIN A CERTIFICATATE OF ELIGIBILITY: Registered parishioners who have been asked to be a Godparent or Confirmation Sponsor, should call the parish office to request a certificate of eligibility. REGISTER FOR THE PARISH We are so happy to welcome new members of our Parish Family! Please come to the parish office so that we can get your information and meet you. OFFICE HOURS: Monday thru Friday 9:30AM to 3:00PM

The Parish Family of

ST. WILLIAM THE ABBOT

2740 Lakewood Allenwood Road, Howell, NJ 07731 732-840-3535

www.stwilliamtheabbot.com email: [email protected]

Our Mission We, the parish family of St. William the Abbot, a welcoming Catholic community, led by the Holy Spirit, are called to proclaim, and to witness to,

the Good News of Salvation, so that we may grow together, among all generations, and

advance the Kingdom of God, in our love and service of God and neighbor.

COME WORSHIP WITH US

Weekends Saturday: 5:00PM

Sunday: 8:00AM, 10:15AM, 11:45AM

Weekdays

Monday & Tuesday: 9:00AM Wednesday: 9:00AM & 7:00PM

Thursday, Friday & Saturday: 9:00AM

Third Sunday of Easter April 18, 2021

Page 2: S WILLIAM Our Mission - St. William the Abbot

Why is it so important to register with a parish? Registration is the official way we join a parish community. Some people think that because they attend a particular parish they automatically belong. Registering as parishioners requires signing up, formally enrolling yourself in a parish. Registration is a commitment to a community, a way to be included in the religious, social and ministerial activities of your parish. Registration shows you belong. It is also necessary for cer-tain benefits, like scheduling sacraments, obtain-ing a sponsor certificate, and getting donation statements for your taxes. Most importantly, it lets the parish count on you, to call on you to assist in its mission. Registering in your parish is a statement of faith and confidence in the life and work of your parish.

Rosary

Thank you to everyone who handed in their tally sheets for praying the rosary. So far we have prayed the rosary 2,465 times. Congratulations! Keep up the good work! Remember

to pray one decade for St. William the Abbot Parish.

Here is the link to our Facebook page: https://m.facebook.com/Saint-William-the-Abbot-Catholic-Church-174135519840986/?tsid=0.37482415393666724&source=result

April 18, 2021 Page 1 #566

Weekly Collection for April 11 $4,238 Capital Contribution 690 Total $4,928 89 Envelopes Thank you for your generosity! If you are inter-ested in our online giving program, please go to our website and click on the link for WeShare.

Requirements to Obtain a Sponsor Certifi-cate/Letter of Eligibility The godparents, together with the parents, must

be willing to help the baptized grow in love for

Christ and neighbor. By word and example, the

godparents will encourage the candidate to live

the Christian life and fulfill faithfully the obliga-

tions connected with it. (cf. Code of Canon Law,

c. 872-874)

• A sponsor must have received the Sacra-

ments of Baptism, Holy Eucharist, Confirma-

tion, and if married, married in the Catholic

Church.

• A sponsor must be at least 16 years old.

• A sponsor attends Mass faithfully participat-

ing in the life and support of the Church,

receiving the Eucharist, and leading a life

according to the teachings of the Church.

• A sponsor must be registered here at St.

William. If he/she received all his/her sacra-

ments here at St. William, but does not live

here, they are not a member of this parish

but a member of the parish whose territory

he/she now resides in. That parish is the

one to go to, to receive a sponsor certificate.

Catholic Charities provides as-sistance with food, housing, drug addiction, domestic vio-lence and immigration services. If you know of a parishioner needing help, please contact us

at www.catholiccharitiestrenton.org or call 800-360-7711. Catholic Charities is in need of adult diapers. If you would like to donate some, please put them near the food bin and we will bring them to their facility. Thank you!

Rest in peace Please pray for those who have recently died, may they rest in peace. Eternal rest grant unto them, O Lord, and let thy perpetual light shine upon them. And may the souls of all the faithful departed, through the mercy of God, rest in peace. Amen

Page 3: S WILLIAM Our Mission - St. William the Abbot

Please bring health, healing and hope to those

in our community who are sick especially Ana

Guillermo, Jonathon Capriotti, Emily Capriotti,

Dakota Schick, Judy O’Connor, Anna O’Connor,

Evelyn Zeliff, Robby Isabella, Liz Czar, Michele

Barbito, Maribel Mejias, Nuala Brennan, Ann

Murphy, we also ask you Lord, to watch over

all those with incurable autoimmune diseases

and for all those who are afflicted with MS, CF,

Lou Gehrig’s disease, for those who suffer from

Alzheimer disease, dementia, addictions, and

their families.

God of all consolation, give life and health

to our sisters and brothers for whom we

pray in your Holy Name. Amen.

“It is a holy and wholesome thing to pray for the living and the dead.” II Mac. 12:46

Saturday, April 17 5:00 Dominick Vecchiarelli r/o St. William the Abbot Sunday, April 18 8:00 Bob & Ellamae New r/o The New Family 10:15 People of the parish 11:45 Brian O’Reilly r/o Grace Cantone Monday, April 19 9:00 Special Intention for Steven Raiser r/o Bill Raiser Tuesday, April 20 9:00 Peter Cerreta, Sr. r/o Donna Lukenbill Wednesday, April 21 9:00 Leocadia Burt Budnick r/o The Zucconi Family 7:00 James Donnelly r/o M/M Charles Garofano Thursday, April 22 9:00 Special Intention for Mary Ciallella r/o The Beyer Family Friday, April 23 9:00 Mike Duggan r/o Sal Ciardiello Saturday, April 24 9:00 Christine Winterfield r/o The Beyer Family 5:00 Rosemary Ferraro r/o The Ferraro Family Sunday, April 25 8:00 Charlie Walsh r/o The Cisek Family 10:15 Joseph Iacangelo r/o M/M Rich Capitan 11:45 People of the parish

April 18, 2021 Page 2 #566

The Annual Catholic Appeal has begun. Let’s make our goal again!

Why is the Annual Catholic Appeal important? As members of our diocesan family, we are called up-on to love and serve all of our brothers and sisters – both within our Catholic community and beyond. Your contribution to the Annual Catholic Appeal allows our

diocese to continue to serve as a resource to the parishes and other organizations in their efforts to provide service, evangelization and outreach to people throughout Burlington, Mercer, Monmouth and Ocean Counties. Thank you to the 92 donors who have already donated. They have given $18,722, which is 67% of our goal of $28,000. If you haven’t given yet, please consider it. Pledge cards are in the parish office.

The Word Among Us is available in the parish office for purchase. It is a monthly publication that has the Mass and meditations for a month. It is $5.

Page 4: S WILLIAM Our Mission - St. William the Abbot

April 18, 2021 Page 3 #566

Marking the 50 days of Easter

Several themes of Luke’s gospel come together in this last section. Such are ta-ble fellowship, God’s promises fulfilled in Jesus; forgiveness of sins; witnessing; the Holy Spirit; Jesus’ journey to the Father is complete. “My secret is very simple: I pray. Through prayer I become one in love with Christ. I realize that praying to Him is loving Him.” St. Mother Teresa

Sunday April 18 The Third Sunday of Easter

Monday April 19

Feast day for St. Elphege, Archbishop, who was born in the year 954. He started out as a monk and hermit then founded a community and became an abbot. When he was 30 he became a bishop in Canterbury, and was captured and ransomed. He wouldn’t let anyone pay his ransom so he was stoned and then beheaded. He died on Easter Saturday, April 19, 1012. His last words being a prayer for his murderers. A church dedicated to him still stands upon the place of his martyrdom at Greenwich.

Tuesday April 20

Feast day for St. Marcellinus, Bishop who was born in Africa. “Without the burden of afflictions it is impossible to reach the height of grace. The gift of grace increases as the struggle increases.” St. Rose of Lima

Wednesday April 21

Feast day for St. Anselm, Archbishop, Saint Anselm of Canterbury, also called Anselm of Aosta after his birthplace and Anselm of Bec after his monastery, was an Italian Benedic-tine monk, abbot, philosopher and theologian of the Catholic Church, who held the office of Archbishop of Canterbury from 1093 to 1109. Whoever, like St. Anselm, contends for the Church’s rights, is fighting on the side of God against the tyranny of Satan.

Thursday April 22

The Church of the Beatitudes is located on what is traditionally known as the Mount of Beatitudes. When the Franciscans began to excavate the site for a new church in the 1930s, they found the ruins of a Byzantine church dating back to the fourth century that had been destroyed by Arab invaders two centuries later. Designed by Italian architect, Antonio Barluzzi, the new church was built of basalt in 1938. The church is octagonal, commemorating the eight beatitudes. Its roof is copper, and its windows are underlined with Scriptural passages in Latin. The Sea of Galilee can be seen from many of its win-dows. The church is maintained by the Franciscan Sister of the Immaculate Heart of Mary, who live in a hospice built at the site in 1912. The church’s famous visitors include Presi-dent George W. Bush in 2008 and St. Pope John Paul in 2000.

Friday April 23

Feast day for St. George, Martyr, who died in the year 303A.D. When George was old enough, he was welcomed into Diocletian’s army. He then became a Tribunus and served as an imperial guard for the Emperor at Nicomedia. When it was announced that every Christian the army passed would be arrested, George refused to abide this order. Diocle-tian attempted to convert George to believe in the Roman gods, but George refused. Fi-nally Diocletian ordered George’s execution. He was lacerated on a wheel of swords and required resuscitation three times, but still George did not turn from God. He was finally decapitated on April 23, 303. St. George is also know for fighting dragons. A dragon made its nest at a spring that provided water to Silene, believed to be modern-day Lcyrene in Libya. The people would offer the dragon sheep to get him to leave his nest so they could collect water. When the sheep disappeared the townspeople decided that a maiden would be just as effective, so they drew straws to see would be sacrificed. When the prin-cess was chosen the monarch begged for her to be spared but the people would not have it. She was offered to the dragon, but before she could be devoured, George appeared. He faced the dragon, protected himself with the sign of the Cross, and slayed the dragon. After saving the town, the citizens abandoned their paganism and were all converted to Christianity.

Page 5: S WILLIAM Our Mission - St. William the Abbot

April 18, 2021 Page 4 #566

Page 6: S WILLIAM Our Mission - St. William the Abbot

Help us celebrate the month of Mary. Please bring the following items during the

month of May. We will donate them to Good Counsel Homes.

May 3 & 4 – diapers and wipes, newborn size to toddler

May 10 & 11 – baby food and formula May 17 & 18 – clothes for babies and children May 24 & 25 – toiletries for moms (shampoo,

soap, etc.)

Thank you in advance for all of your donations!

April 18, 2021 Page 5 #566

Page 7: S WILLIAM Our Mission - St. William the Abbot

566 St. William the Abbot, Howell, NJ (inside) Sh John Patrick Publishing Company (800) 333-3166 • www.jppc.net

Quail Creek Pharmacy2 Ramtown-Greenville Rd

Corner Newtons Corner Rd., Howell785-9711 • Fax 785-1543

Open EverydayMona Salama - PharmacistRaouf Salama - Pharmacist

Personalized Service • Gifts • Greeting Cards

Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Work-ers - Critical Manufacturing - Chemi-cal & Hazardous Materials Financial Service - Private & Public Healthcare - Law Enforcement, Public Safety - Of-fi cers & First Responders - Food & Agriculture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & G W k C i i l M

To all those essential workers keeping us safe,

yourservice is

invaluable & appreciated.

afety --- OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOf cercercercercececeFirst Responders - Food & d & d & d &d &d &d &d &d &d d d d d d AgAgAAAAgAgAgAgrAgrAgrAgAgAgrAg

y Sector - WaWaWaWaWaWaWaWaWaWaWaWaWaWaWastestestestestesteteestestestestestestest &Waterwaste - Transportatatatttttttttion ionion ionioionion ioniononion onion & L& L& L& L& L& L& L& Lo& L& L& L& L& & gis

cs - Public Works & - Infrnfrnfrnfrnfrnfrnfnfnfnfnfrnfrnfrnfrnfrastructuucucucucucucuc rCommunications & IIIIIIIIIIIIIIInfornfornfornfornfornfornfornfonfornfornfornfornfornfornformatimammmmmmammmmmm o

echnology Workers - ComComComComComComComComComComComComComComCommunimumumummmmmmm ty &Workers -s -s -s -s -s -s -s -s -s -s --- CriCriCriririririiiiriiticacaticacacaticaticaticaticaticaticaticaticaticatical Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml Mal l Ml M n

acturing - Chemical &&&&&&&&&&&l & l & l &l & HazaHazaHazaHazaHazaHazaHazaHazaHazaHazaHHHH rdourdrdrdrdrdrdrrdrdrdrdncial Services - DDDDDDDDDefeeeeeeefefens

dustrial Base - Commercial Faciles Workerssrssssss - RResidesidesidesidesidesidesidesididesidesidesidesideentientientientientientientientientiential &aaaaaaaa Shelteervices & FFFFFFFFFFFFFFFaciaciacilacilacilacilacilacilacilcilaciacilacilacilacilitieitieitieitieitieitietieitietieitieies -s -s - - - - - HyHyHygiHyHyHyHyHyHyHyHyHH ene Prodcts & Services es esesesesesesesesessss - Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Priiiiivivivivivivivaivaivativ e & Publiealthcare - Lawawawawawawawawawaw EnfEnfEnfnfnfnffnfnffffffforcorcorcorcorcorcorcorcorcorcorcorceorc ment, Publiafety - Officercercercercerererercercers &&&s &s &s &s &s &s &s &s &s &s &s &s & FiFiFiFFirsFFFFFFFFF t ResponderFood & Agrgrgrgrrrrriculiculiculiculiculiculiculiculiculiculicuiculiculicic turturturturturturureturturturturturtutut - Energy Secr - Waste e eee ee & Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& ttttterwtttettt aste - Trans

ortation &&&&& & & & & &&&&&& LogiLogiLogiLogiLogiogiogiogiLogiLogLogLogiLogLogLog stististststststisticststststsss s - Public Work- Infrastrtrrrrrrrrrrrrrrucucucucucuctctctuucucucucuctucuc re -e e e ee e CommunicationInformatioatioatioiooooooioooooonnn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Technology Worker

CoCoCoCoCoCoCoCoCoCoCoCoCoCoCommunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunity ity ity ity ity ity ity ity ity ity ity ity ityityity & Go&&&&&&&&&&& vernment Works - CrCrCrCrCrCrCrCrCrCrCrCrCrCrCriticiticiticticiticiticticiticiticticiiticiticiticitical al Mal Mal Mal Mal Mal Mal Mal a anufacturing - Cheml l ll & Ha& Ha& H& H& H& H& H& H& H& H&&&&& zardzardzardzardzardzardardardardardardardzardardardooooooous ooooooo Materials Financia

ervrvrvvvvice ice ice ice ice iceicicice icicicicicic - P- Pr- Pr- P- P- P- P- - - P- - - - ivativaivivvvvvvv e & Public HealthcarLaw EnEEE forcforcforcffforcforcforforcforcforcforceement, Public Safety - O

To all thosenforcement, Public Sanforcement, Public Sa

essentiallture - Energylture - EnergyWater aste TraWater aste Tra

workerscs - Public Wors - Public WorCommunicatioCommunicatio

keepingechnology Wochnology Woovernment Wovernment W

us safe,acturing Caterials Finanaterials Finan

yournicationnicationWorkerWorke

service isovernment Workovernment Workacturing Chemacturing Chem

invaluable &us Materials Financiaus Materials Financiae & Public Healthcare & Public Healthcar

ment, Public Safety - OSafety - Othan

k yo

u

g gyWatateatttatatatattaaaaaa rwaswaswawaswwaswwwwaswwaswwwwasswasawawaw ste -tettttttetttee Transportation & Log

cccscccccc - PPPPPPPPPPPPPPPubliubliubliubliublililublibubbliubuubuuubu c c WoWoc WoWWWoWoWoWWoWWWoWc oc WoWWc Woc WWc WWWWccc rks rksrrksrkskrrkkkkrrk & - & -& -&& -&& -&&&&&&& --&&&& -&&& -&&& InfrInfInfrnfrInfInfrnfrII ffI ffInI fnfI fInfnfInnfnfn astructuCCoCoCoCoCoCoCCoCCoCCCCoooCCCCCCC mmunmmunmmmmmmunmm nmmmm nmmmmm nmmmm nnm nm nmmmm nicaticacaticaticatcatcatcatcattcatcatcatcattcatcatcatccacatcccatcc ionsionsionsnsionononsonsiooionssonsonsonsionoonoooon & I&&& I&& I&&& I& II& I& I& I&& nfornfornfornfornfornforforfornfornfoforfnfnfornfornfornfornforfofornfornforrrrnnffforrrmatimatimatmatmatiamatimatmattimatiatitimatiattatmatmatimattattmattmmmati

echhhhhhhhhnolonononoonnoloonolonnoln lonnolonooolonolonolonnnn on oonoo ggy Wgggg orkers - Community

Local, trusted, proven, effective, supportive, referrals, relationships, affordable, repetitious, versatile, lasting.

This describes the power of...

Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN!

Call 1.800.333.3166 TODAY!

RIDESHAREZONES

A

M

I#WHATSMYNAME

toptop

sksk

atchatch

nformnform

Page 8: S WILLIAM Our Mission - St. William the Abbot

566 St. William the Abbot-Howell, NJ (BACK) Sh John Patrick Publishing Company (800) 333-3166 • www.jppc.net

Kevin C. O’Brien, Manager - NJ Lic. No. 4805Kevin C. O’Brien, Manager - NJ Lic. No. 4805www.obrienfuneralhome.comwww.obrienfuneralhome.com

505 Burnt Tavern Road • Brick, NJ 08724505 Burnt Tavern Road • Brick, NJ 08724732-899-8600732-899-8600

2028 Highway 35 • Wall Twp., NJ 077192028 Highway 35 • Wall Twp., NJ 07719732-449-6900732-449-6900

Family Owned-Family Owned-Family FirstFamily First-Family Operated-Family Operated

FUNERAL HOME

Residential & Commercial

751-1560~ Parishioner ~NJ State Lic. #10329

LANGAN’SLANGAN’S P

H LLC

EmergencyService

Fully Insured

Atlantic Medical ImagingThe region’s premier medical imaging experts

MRI • CT • Coronary CTA • UltrasoundNuclear Medicine • DexaMammography • PET/CT

Centers of Excellence:Wall, Brick, Toms River, Galloway, Mays Landing, Egg Harbor Township, Northfi eld, Somers Point, Cape May, Hammonton

(732) 223-XRAY (9729)

Mark A. Santomenna, D.D.S.

Experience Positive, Personalized CareRamtown Plaza • 137 Newton’s Corner RoadHowell, New Jersey 07731

Tel 732-206-0408Fax 732-206-9807 www.RamtownDental.com

BASEMENT WATERPROOFINGMOLD REMEDIATIONFOUNDATION REPAIR

732-308-9988www.RightwayWaterproofi ng.com

RIGHTWAY WATERPROOFING CO.

FREE INSPECTIONLicensed & Insured

Family Owned and Operated Since 1987

Church

Member

Discounts

Mallory’s Army FoundationUnited Together In The Fight Against Bullying...

Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com

(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send

your email address by text message: Text MALLORYSARMY to 22828 to get started.

Message and data rates may apply.

Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if we can help Save you moneywith your monthly payments on your

commercial property. Multi-Family, Retail, Offi ce Building, Apartment and Condos.

Can close in as little as 45 days! Four season customer service is our top priority.

www.duqfunding.com1650 Market Street - Suite 3600

Philadelphia, PA 19103

Advertise Your Business Here800-333-3166

ext. 161or visit

www.jppc.net

Connecting businesses to customers in realtime!