S Rivière et al. Nature 000 , 1-4 (2009) doi:10.1038/nature08029

1
S Rivière et al. Nature 000, 1-4 (2009) doi:10.1038/nature08029 Exclusive expression of FPR genes in vomeronasal neurons.

description

Exclusive expression of FPR genes in vomeronasal neurons. S Rivière et al. Nature 000 , 1-4 (2009) doi:10.1038/nature08029. - PowerPoint PPT Presentation

Transcript of S Rivière et al. Nature 000 , 1-4 (2009) doi:10.1038/nature08029

Page 1: S Rivière et al. Nature 000 , 1-4 (2009) doi:10.1038/nature08029

S Rivière et al. Nature 000, 1-4 (2009) doi:10.1038/nature08029

Exclusive expression of FPR genes in vomeronasal neurons.

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

DOI: 10.1038/NGEO2405 Moist convection in hydrogen ...

DOI: 10.1038/NGEO2405 Moist convection in hydrogen ...

17 September 2009 doi:10.1038/nature08355 LETTERS

17 September 2009 doi:10.1038/nature08355 LETTERS

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

DOI: 10.1038/NMAT3074 Maltodextrin based imaging … · and in vivo SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3074 ©

DOI: 10.1038/NMAT3074 Maltodextrin based imaging … · and in vivo SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3074 ©

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The ...

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The ...

GI Motility online (May 2006) | doi:10.1038/gimo48

GI Motility online (May 2006) | doi:10.1038/gimo48

Nat. Neurosci.; doi:10.1038/nn.3725 Leptin signaling in astrocytes … · 2014-06-25 · nature neuroscience correction notice Nat. Neurosci.; doi:10.1038/nn.3725 Leptin signaling

Nat. Neurosci.; doi:10.1038/nn.3725 Leptin signaling in astrocytes … · 2014-06-25 · nature neuroscience correction notice Nat. Neurosci.; doi:10.1038/nn.3725 Leptin signaling

Published in Nature Materials (2016) doi:10.1038/nmat4569 ...

Published in Nature Materials (2016) doi:10.1038/nmat4569 ...

Nature Biotechnology: doi:10.1038/nbt

Nature Biotechnology: doi:10.1038/nbt

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

doi:10.1038/nature05150 LETTERS

doi:10.1038/nature05150 LETTERS

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

DOI: 10.1038/NMAT4204 Supplementary Information · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4204. NATURE MATERIALS | . 1. 1 . Supplementary Information . High-precision realization

DOI: 10.1038/NMAT4204 Supplementary Information · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4204. NATURE MATERIALS | . 1. 1 . Supplementary Information . High-precision realization

Nature, 2008, Doi:10.1038/nature07103 Semrah Kati 09.02.2009.

Nature, 2008, Doi:10.1038/nature07103 Semrah Kati 09.02.2009.