Role of Vascular Endothelial Growth Factor-A in Diabetic Kidney Disease

By

Gavasker Arulmaran Sivaskandarajah

A thesis submitted in conformity with the requirements for the degree of Master of Science

Physiology University of Toronto

© Copyright by Gavasker Arulmaran Sivaskandarajah 2011

ii

Role of Vascular Endothelial Growth Factor-A in Diabetic Kidney

Disease

Gavasker Arulmaran Sivaskandarajah

Master of Science

Physiology University of Toronto

2011

Abstract

Vascular endothelial growth factor-A (VEGF) is required for endothelial cell differentiation and

survival. To investigate the renoprotective properties of VEGF in diabetes an inducible Cre-loxP

gene targeting system was used to excise VEGF from podocytes of adult mice (VEGFKO).

Diabetes was induced by streptozotocin (STZ) at 2.5 weeks of age and VEGFKO was induced

by doxycycline (dox) at 3-4 weeks of age. Blood and urine were collected weekly to monitor

for hyperglycaemia and proteinuria, respectively. Mice were dissected 8 weeks after diabetes

induction or earlier if morbidly ill; twenty percent of the mice in the DM+VEGFKO group died

before the surrogate endpoint. Glomerular VEGF mRNA expression was decreased in VEGFKO

mice compared to controls. However, DM+VEGFKO mice had significantly greater proteinuria,

degrees of glomerular sclerosis, and glomerular cell apoptosis. These results confirm that VEGF

is normally upregulated in diabetes but reducing VEGF expression in diabetes causes severe

kidney injury.

iii

Acknowledgments

I would like to thank my supervisor Dr. Susan Quaggin for her support and encouragement

during my time as a Masters student. Her expertise, knowledge, and patience were invaluable to me. In

our discussions, she encouraged my creative thinking and supported my exploration of a wide variety of

methodologies to resolve emerging questions. My experiments sometimes may not have turned out as

expected but the learning experience in her lab was both exciting and enlightening. Dr. Quaggin’s

enthusiasm for scientific discovery has been an inspiration for me.

I would also like to thank the following people who have contributed to the data in this thesis.

Dr. Vera Eremina provided me with technical advice and assisted me with the in situ hybridization

procedure to detect for mRNA expression in kidney sections. Dr. Marie Jeansson assisted me in isolating

glomeruli and performing quantitative real-time PCR. Dr. Yoshiro Maezawa imaged the

immunofluorescent sections. Also, Dr. Hans Baelde (Leiden University, Netherlands), a renal

pathologist, performed all the glomerular scoring and the apoptosis staining for cleaved caspase-3 on the

paraffin embedded kidneys of my mice.

Furthermore, I would like to show my gratitude to the amazing group of people of the Quaggin

lab. They have provided an environment where my scientific training was nurtured and supported to

withstand the rigours of academia. Not only have I been productive here, but I also have enjoyed the

years spent at the lab and have made many good friends.

Finally, I am forever grateful for the love and support of my parents. No matter what path I took

in life their faith in my ability to succeed has been unwavering. Their confidence in me has propelled me

to pursue my dreams wholeheartedly.

iv

Table of Contents

Acknowledgments ......................................................................................................................... iii 

Table of Contents ............................................................................................................................ iv 

List of Figures ................................................................................................................................. vi 

List of Tables ................................................................................................................................. vii 

List of Abbreviations ................................................................................................................... viii 

1  Introduction ................................................................................................................................. 1 

1.1  Kidney Glomerulus .............................................................................................................. 1 

1.1.1  Fluid dynamics ........................................................................................................ 1 

1.1.2  Glomerular filtration barrier .................................................................................... 2 

1.2  VEGF ................................................................................................................................. 10 

1.2.1  Genetic structures .................................................................................................. 10 

1.2.2  Expression and function ........................................................................................ 12 

1.2.3  Regulation .............................................................................................................. 13 

1.2.4  Signalling Pathways............................................................................................... 16 

1.3  Diabetic Nephropathy ........................................................................................................ 18 

1.3.1  Epidemiology and Clinical Features ...................................................................... 18 

1.3.2  Glomerular Pathobiology and Histology ............................................................... 23 

1.3.3  Molecular Pathways in Diabetic Nephropathy ...................................................... 26 

1.3.4  Mouse models ........................................................................................................ 30 

2  Hypothesis ................................................................................................................................ 40 

3  Materials and Methods .............................................................................................................. 41 

4  Results ....................................................................................................................................... 50 

5  Discussion ................................................................................................................................. 64 

6  Conclusion ................................................................................................................................ 69 

v

7  Future directions ....................................................................................................................... 70 

Appendix ....................................................................................................................................... 72 

Retinopathy study .......................................................................................................................... 72 

References...................................................................................................................................... 75 

vi

List of Figures

Figure 1-1. Adult mouse kidney glomerulus. ................................................................................ 8 

Figure 1-2. Schematic of the glomerular filtration barrier. .......................................................... 8 

Figure 1-3. Exon structure of the VEGF gene and the VEGF isoforms due to alternative splicing

of the VEGF gene. ....................................................................................................................... 11 

Figure 1-4. VEGFR-2 receptor. ................................................................................................... 17 

Figure 1-5. Hypothetical diabetic pathways in endothelial cells. ................................................ 27 

Figure 1-6. Cell-specific Cre-loxP system. ................................................................................. 37 

Figure 1-7. Cell-specific inducible rtTA-tetO Cre system. ......................................................... 38 

Figure 4-1. The transgenic mouse system and experimental protocol. ....................................... 54 

Figure 4-2. Observed proteinuria in DM+VEGFKO mice. ......................................................... 55 

Figure 4-3. DM+VEGFKO and DM mice more likely to die early. ........................................... 56 

Figure 4-4. DM+VEGFKO mice in the STZ-Dox group had severe glomerular injury and

significant glomerular expansion. ................................................................................................ 57 

Figure 4-5. Only DM+VEGFKO mice in the STZ-Dox group had severe glomerular injury,

according to histological scoring. ................................................................................................ 58 

vii

Figure 4-6. In situ mRNA expression of WT1, Nephrin, and VEGF in the kidney at early and

late time points. ............................................................................................................................ 59 

Figure 4-7. Glomerular VEGF mRNA increased only in DM mice compared to control groups,

while the groups with VEGFKO had reduced VEGF expression, as assessed by real-time PCR

analysis at the early time point. ................................................................................................... 60 

Figure 4-8. The DM+VEGFKO mice glomerular cells underwent apoptosis. ............................ 61 

Figure 4-9. Simplification of tomato lectin stained capillaries in DM+VEGFKO glomeruli. .... 62 

4-10. Confocal microscopy indicates a loss of PECAM staining endothelial cells in

DM+VEGFKO glomeruli. ........................................................................................................... 63 

List of Tables

Table 1-1. Examples of sites of possible injuries in the GFB and related rodent models and

human diseases. ............................................................................................................................. 9 

Table 1-2. Developmental defects due to alteration of glomerular VEGF expression. ............... 11 

Table 1-3. Conditional mouse lines for the kidney...................................................................... 36 

Table 4-1. Summary of mice involved in experiment. ................................................................ 53 

viii

List of Abbreviations

AAV adeno-associated virus

ACE angiotensin-converting enzyme

AGE advanced glycation end-product

AKT/PKB protein kinase B

AMDCC Animal Models of Diabetic Complications Consortium

Ang-2 angiopoietin-2

ARB angiotensin receptor blockers

AREs adenlyate/uridylate rich elements

ARP2/3 actin-related proteins 2 and 3

BAC bacterial artificial chromosome

DAPI 4',6-diamidino-2-phenylindole

DM mouse treatment group only given STZ and not dox

DM+VEGFKO mouse treatment group induced with STZ and dox

DEPC diethyl pyrocarbonate

DN diabetic nephropathy

Dox doxycycline

DR diabetic retinopathy

ES embryonic stem

ESRD end stage renal disease

FAK focal adhesion kinase

FSGS focal segmental glomerulosclerosis

GBM glomerular basement membrane

GFB glomerular filtration barrier

GFR glomerular filtration rate

ix

HIF-1 hypoxia-inducible factor-1

HRE hypoxia-responsive enhancer elements

HSP27 heat shock protein 27

ILK integrins-linked kinase

MAPK mitogen-activated protein kinase

MET mesenchymal epithelial transition factor

NIDDK National Institute of Diabetes and Digestive and Kidney Disease

NPSH1 nephrin gene

NPSH2 podocin gene

PAS periodic acid-Schiff

PBS phosphate buffer saline

PFA paraformaldehyde

PI3K phosphatidylinositol 3’ kinase

PIGF placental growth factor

PKC protein kinase C

PLCγ phospholipase C-γ

ROS reactive oxygen species

RPE retinal pigment epithelium

rtTA reverse tetracycline transactivator

tetO Tet operator

SNP single-nucleotide polymorphism

STZ streptozotocin

Tie-2 endothelium-specific receptor tyrosine kinase 2

VEGF vascular endothelial growth factor-A

VEGFKO mouse treatment group given sham buffer injection and induced with dox

x

VEGFR-1 VEGF receptor 1

VEGFR-1 VEGF receptor 1

VEGFR-2 VEGF receptor 2

WT mouse treatment group only given sham buffer injections

WT1 Wilms tumor supressor

1

1 Introduction

1.1 Kidney Glomerulus

The kidney is involved in blood-ion concentration, pH regulation, blood pressure, waste

excretion, hormone production, and fluid homeostasis; one of the primary functions of the

kidney is the production of urine through the filtration of blood [1]. The first segment of the

urine filtration apparatus is the glomerulus that is a 200 μm globular fenestrated endothelial cell

network nested alongside mesangial cells in the Bowman’s capsule, which is composed of an

inner podocyte layer, a urinary space, and an outer layer of parietal cells (Fig. 1.1.) [2]. The

physiological role of the glomerulus is to allow the flow of fluid into the urinary space of the

Bowman’s capsule, but prevent the passage of blood proteins, such as albumin, into the urine.

1.1.1 Fluid dynamics

The volume of fluid that passes from the glomerulus into the urinary space determines

the glomerular filtration rate (GFR), which is used as a marker for kidney function [3]. The

GFR is influenced by changes in the hydrostatic pressure of blood that passes through the

glomerulus. The fluid pressure within the glomerulus is controlled by the afferent arteriole that

carries blood to the glomerulus and the efferent arteriole that carries blood away from the

glomerulus to either the peritubular capillary (in cortical nephrons) or the vasa recta (in

juxtamedullary nephrons) and ultimately back to the venous circulation via the renal vein [2].

An increase in hydrostatic pressure by vasodilation and vasoconstriction of the afferent and

efferent arteriole, respectively, causes an increase in GFR; whereas, efferent arteriolar

vasodilation with an increase (or no change) in afferent arteriolar vascular tone results in a

decrease in hydrostatic pressure and a drop in GFR. Therefore, a healthy individual with an

estimated one million glomeruli in each kidney and a mean arterial pressure between 80mmHg

2

and 180 mmHg can maintain a constant GFR of 180 litres of plasma every day as long as all

components of the filtration barrier are intact [1].

1.1.2 Glomerular filtration barrier

Importantly, the GFR is also affected by the functional surface area of the glomerular

capillaries and the permeability of the glomerular interface; these two factors make up the

filtration coefficient that is altered in diseases states, such as minimal change disease,

preeclampsia, or diabetic nephropathy [4]. In healthy individuals, the filtration is a highly

selective process that discriminates between size and charge of particles that are allowed to pass

through glomerular filtration barrier (GFB), which is composed of three layers: the fenestrated

endothelium, the acellular glomerular basement membrane (GBM), and finally the slit

membrane of podocyte foot processes [2, 5] (Fig. 1.2.). A summary of the GFB and some

possible defects can be found in Table 1.1.

1.1.2.1 Endothelium

In the glomerulus, the first layer of the filtration barrier that is in direct contact with the

blood is the fenestrated endothelial layer with the associated glycocalyx. The significance of the

glycocalyx in filtration has been debated extensively [5, 6]. The glycocalyx on the luminal side

of the endothelium is coated with proteogylcans, glycosaminoglycans, and plasma proteins

making a negatively charged gel-like structure [5]. This structure is thought to measure 50nm to

300nm thick, but since the standard electron microscopy preparation involves dehydration

followed by cationic probe staining of the the highly hydrated glycocalyx it is likely that this

value is an underestimate and the true thickness could be as thick as 500nm[7]. The permeability

of this structure has been studied by examining the enzymatic digestion of the mouse glycocalyx

in vivo by hyaluronidase, heparinase, or chondroitinase that reduces the thickness of it and

3

increases the passage of albumin, which is negatively charged, but the passage of neutral Ficoll

particles of the same size remain unchanged[6]. The negative charge of the glycocalyx and the

density of the gel form a barrier that appears to prevent negatively charged particles from

crossing the fenestrated endothelium but has little effect on uncharged particles of the same size

reaching the endothelium.

The endothelial cell layer of the GBM is different from capillaries found elsewhere. For

example, the fenestra are larger (at 60-100 nm in diameter), more numerous, more irregular, and

lack diaphragms [2, 8]. The endothelial cells also contain numerous aquaporin-1 channels that

allow for the passage of fluid through themselves, even though most fluid flows around them

[2]. These characteristics of the endothelial layer suggest that as plasma flows into the GBM

there is a minimal selection for size. However, definitive studies to determine the role of the

glycocalyx in vivo have not been performed.

1.1.2.2 Glomerular Basement Membrane (GBM)

The GBM is composed of an unusually thick acellular layer of type IV collagen,

sialoglycoproteins, laminin, nidogen, fibronectin and other proteoglycans and

glycosaminoglycan all formed by the a fusion of the endothelial basement membrane upstream

and the podocyte basement membrane downstream of urine flow [2, 7-9]. This thick layer of

300-350nm can be divided by composition: lamina rara interna, lamina rara externa, and lamina

densa. The lamina rara interna and externa are nearest to the endothelial and podocyte layers,

respectively. These layers are composed primarily of heparan sulphate proteogylcans and many

other polyanions that form a barrier against negatively charged particles[2]. The lamina densa

contains a network of type IV collagen, laminin and other proteins that separate particles

according to size[8].

4

GBM dysfunction has been studied by inducing genetic alterations in the expression of

various components of the GBM in mouse models and by observing patients with genetic or

autoimmune disorders that affect this particular structure. The collagen IV protein is composed

of a loosely coiled structure of three of the possible six chains, and is essential for proper

glomerular function. Genetic removal of the 3 collagen IV chains in mice cause progressive

renal disease with proteinuria and glomerular scarring, due to incorrect folding or degradation of

the monomers; this results in a glomerular lesion that is similar to the pathological lesion

observed in patients with Alport syndrome, which results from a mutation in the human

COL4A3, COL4A4, and COL4A5 genes[10]. Another disorder affecting collagen IV is

Goodpasture’s syndrome which a devastating pulmonary-renal disorder, where the patients

develop kidney failure within weeks to months from circulating autoantibodies to the

noncollagenous domain (NC1) at the C-terminus of collagen IV [11]. The laminins are another

set of GBM proteins which have been investigated in mice. Laminins consist of , and

chains. Mice with targeted mutations in the β chain result in GBM damage and severe

proteinuria resulting in death within 3 to 5 weeks [9]. In humans, mutations in the laminin β2

genes cause Pierson’s syndrome, which is a lethal congenital nephrotic syndrome caused by

major defects in the GBM [12].

Therefore, the GBM plays an important role in glomerular function and restricts

particles that are larger than 7.2 nm in diameter; however, albumin is approximately 7 nm and is

very close to the effective size of the filter, which may indicate why albumin is sometimes

present in the urinary space [2]. But before urine filtrate can enter the urinary space the fluid

must be filtered through a final barrier comprised of podocytes.

5

1.1.2.3 Podocyte

The glomerular capillaries are wrapped by specialized terminally differentiated pericytes

called podocytes. A common molecular marker for the detection of podocytes is the

transcription factor Wilms Tumour, WT1, which correlates with podocyte number in the

glomerulus [13]. Functionally, WT1 is required for the expression of podocyte-specific genes;

mutations in the Wt1 gene results in glomerular disease (e.g. Denys-Drash and Fraisier’s

syndromes) [12].

Structurally, each podocyte cell has primary processes that project from the cell body and

subdivide further into many secondary processes. These secondary foot processes interdigitate

with one another as they wrap tightly around the underlying capillaries and connect to the GBM

by integrins [1]. Therefore, it is not surprising that the attachment of podocyte foot processes to

the GBM is an important part of the GFB. In particular, the integrins expressed on the

basolateral surface of the podocyte are among the molecules necessary for anchoring these cells

to the GBM [14]. These integrins are transmembrane receptors that bind to type IV collagen,

laminin, and fibronectin in the GBM. The podocyte primarily expresses the 31 integrin that is

linked to the podocyte actin-cytoskeleton by paxillin, talin and vinculin [15]. In general,

integrins can signal across the cell membrane bidirectionally; thus, extracellular events can

trigger a number of downstream signalling pathways affecting actin dynamics and cell

morphology via focal adhesion kinase (FAK), integrin-linked kinase (ILK) and actin-related

proteins 2 and 3 (Arp2/3); and intracellular stimuli can result in upstream signalling affecting

integrin adhesion[16]. Their importance is underscored by the fact that 31integrin-deficient

mice do not form podocyte foot processes [17].

6

The actin cytoskeleton of the podocyte is required to provide the unique cell shape that

can support the high fluid flux across the GFB. The primary processes contain microtubules and

intermediate filaments, while actin microfilaments are found in the secondary foot processes

[18]. Normally, foot processes have contractile actin filament bundles organized in a parallel

manner, and disruption of this network results in renal dysfunction. For example, effaced foot

processes develop thickening parallel contractile bundles that reduce their ability to handle

mechanical stresses. In particular, a mutation in the -actinin-4 gene, an actin filament cross-

linking protein, has been associated with adult-onset autosomal dominant focal segmental

glomerulosclerosis (FSGS) [19]. This has been confirmed in transgenic mice that lack -actinin-

4, as these mice exhibit effacement of podocyte foot processes and subsequently develop

proteinuria [20].

The foot processes are separated by narrow gaps called the filtration slits. These gaps

measure 25-60nm wide and are spanned by slit diaphragms [2]. These filtration slits can restrict

the passage of macromolecules based on size, shape, and charge by the actions of the molecular

components of the slit diaphragm, many of which are specific to the podocyte; furthermore,

absence of these proteins that comprises or localize to the slit diaphragm results in excess

protein leakage into the urinary space. For example, when the nephrin gene (NPHS1) is mutated

in humans there is severe proteinuria resulting in congenital nephrotic syndrome of the Finnish

type, which is characterized by the loss of slit diaphragms [21]. Another example of a slit

diaphragm-associated molecule is podocin, NPHS2; a mutation of this gene results in steroid-

resistant nephrotic syndrome that is milder than the Finnish type but still results in proteinuria

caused by the disruption of the slit diaphragm and the podocyte foot process structure [22].

Podocin binds to nephrin and CD2AP, the intracellular adaptor protein involved in anchoring all

three to the actin cytoskeleton [23, 24]. This complex is necessary for organizing and stabilizing

7

the slit diaphragm since CD2AP-deficient mice develop podocyte foot process effacement and

proteinuria leading to kidney failure [25].

The slit diaphragm can filter particles by size and has been conventionally

conceptualized as a “zipper” structure between the podocyte foot processes. High resolution

magnetic resonance imaging shows that the slit protein filaments form a structure that resembles

a zipper, with a central filament and alternating teeth[26]. This configuration results in gaps of

4x14 nm, which is believed to prevent the passage of albumin and many other proteins due only

to the size selectivity of the gaps. However, this model does not explain the ease that 6 nm

Ficoll particles can pass through isolated glomeruli[27]. To explain the Ficoll data, a modified

zipper model using a “ladder rung” structure has been postulated that lacks the middle filament

resulting in irregular spacing, which would account for the previous data and be consistent with

the Ficoll results [28]. Typically, 40-80 mg of protein per day that passes the glomerular

filtration barrier into the urine is absorbed by the proximal tubular cells and degraded, resulting

in the following proportions of proteins that remain in the urine: albumin (30–40%), Tamm–

Horsfall protein (50%), immunoglobulins (5–10%), and light chains (5%)”[8].

8

Figure 1-1. Adult mouse kidney glomerulus.

Light microscope image of a Periodic Acid-Schiff stain at magnification of 400x.

Figure 1-2. Schematic of the glomerular filtration barrier.

9

Layer Site involved

Cause Effects Related Human Disease

Endothelium Glycocalyx Enzymatic digestion in mice

Glycocalyx thickness is reduced and albuminuria [6]

GBM 3 collagen IV Genetic mutation

Collagen IV misfolds and is degraded [10]

Alport’s syndrome [10]

Autoimmune Same effect as gene mutation but antibody binding to Col IV [11]

Goodpasture’s syndrome [11]

Defect in laminin β2 gene

Genetic mutation

GBM damage and severe proteinuria. Mice die 3-5 weeks after birth [9]

Pierson’s syndrome [12]

Podocyte Mutation in the WT1 gene

Genetic mutation

Diffuse mesangial sclerosis and nephrotic syndrome resulting in death[12]

Denys-Drash and associated with Fraisier’s syndrome [12]

31 integrin

Genetic mutation

31 deficient mice do not form podocyte foot processes [17]

-actinin-4 (ACTN4)

Genetic mutation

Podocyte foot processes effacement resulting in proteinuria in mice [20]

adult-onset autosomal dominant focal segmental glomerulosclerosis (FSGS) [19]

Nephrin (NPHS1)

Genetic mutation

Lack slit diaphragms, podocyte foot processes loss, and severe proteinuria [21]

congenital nephrotic syndrome of the Finnish type [21]

Podocin (NPHS2)

Genetic mutation

Disrupted slit diaphragm and foot process. Milder proteinuria. [22]

steroid-resistant nephrotic syndrome [22]

CD2AP Genetic mutation

Podocyte effacement and proteinuria. Result in kidney failure [25]

Table 1-1. Examples of sites of possible injuries in the GFB and related rodent models and

human diseases.

10

1.2 VEGF

Vascular endothelial growth factor-A (VEGF) is the major secreted glycoprotein of the

PDGF superfamily of growth factors that also contains VEGF-B, VEGF-C, VEGF-D, and

placental growth factor (PIGF)[29].

1.2.1 Genetic structures

In humans, the VEGF gene has a coding region of 14 kb and is located on chromosome

6p12 which contains 8 separate exons that are alternatively spliced to form multiple

isoforms[30]. There are at least 6 alternatively splice variants containing exons 1-5 and 8 but

differ in exons 6 and 7: VEGF-121, VEGF-145, VEGF-165, VEGF-183, VEGF-189, and

VEGF-206 [29, 31](Fig. 1.3). Another 6 splice variants exist that are referred to as the VEGF-

xxxb isoforms; they are identical to the above but contain an alternate exon 8. These variants are

believed to be endogenous inhibitors of VEGF signalling and instead of Cys-Asp-Lys-Pro-Arg-

Arg, they contain Ser-Leu-Thr-Arg-Lys-Asp[32, 33].

The VEGF gene is highly conserved in mice with the only difference being the lack of

the codon for Glycine-8 that results in a missing amino acid in the final polypeptide of all

isoforms, resulting in slightly shorter proteins (i.e. VEGF-120, VEGF-164, etc.)[34]. In both

humans and mice each isoform of VEGF are structurally similar but have characterized

differences in function and binding. The dominate VEGF variant in humans is VEGF165, which

is a globular 45 kDa homodimer with two subunits of 165 amino acids each with a duplication

of exon 7 and lack of exon 6 that can be found either free-floating or bound to the matrix by

heparain binding domains in exon 7 [35]. In contrast, VEGF-121 lacks both exon 6 and 7, and

thus is not bound to heparan sulphates while VEGF-188 is highly cell-associated [36].

11

Figure 1-3. Exon structure of the VEGF gene and the VEGF isoforms due to alternative

splicing of the VEGF gene.

Table 1-2. Developmental defects due to alteration of glomerular VEGF expression.

Adapted from Eremina et al (2007) [29].

12

1.2.2 Expression and function

Systemically in the body during both development and adulthood, VEGF is required for

glomerular endothelial migration, differentiation, and survival [37]. Specifically, the heparin-

binding VEGF164 and VEGF188 isoform are required for proper kidney vasculature

development and maintenance; whereas the shorter isoform, VEGF120, alone is insufficient for

proper vascular development which suggests that VEGF binding to the extracellular matrix

provides important cues for endothelial signalling [36]. In the kidney the primary secretory cell

of VEGF is the podocyte.

1.2.2.1 Development

VEGF is essential for normal angiogenesis during development. This is demonstrated by

the fact conventional knockout mice for VEGF die 9.5 days after conception due to devastating

problems of vascular development [38]. Importantly, heterozygotes that carry one null and one

functional VEGF allele also die at mid-gestation due to abnormal vessel formation [38].

Specifically, in glomerular development, which starts 13.5 days after conception,

podocyte precursors secrete VEGF during the formation of the glomerular capillary loop, and at

the same time VEGFR-2 expressing endothelial cells respond to VEGF and migrate into the

developing vascular cleft to form the glomerular tuft[29]. To understand the role of VEGF in the

kidney, the Cre-loxP gene targeting system with podocyte-specific VEGF deletion was used.

The total elimination of podocyte VEGF results in death at birth from urinary failure due to the

lack of endothelial cells in the glomerulus; this study also showed that VEGF expression must

be tightly regulated in the glomerulus [39]. In addition, there is an increasing severity of

glomerular endothelial defect inversely correlated with the amount of VEGF produced by the

podocyte [29]. For example, the GFB develops normally in a mouse with a single VEGF

13

expressing allele in the podocyte until endotheliosis occurs at 2.5 weeks and the mouse dies at

9-12 weeks with glomerular sclerosis. More dramatic reduction of VEGF in the podocyte

(approximately 25% normal VEGF) results in rapid loss of glomerular endothelial cells within 5

days of birth and death due to renal failure by 3 weeks postnatal [37]. In contrast, a 15 fold

increase of VEGF results in the collapse of the capillary loop, hyperfiltration and proteinuria

and kidney failure 5 days after birth. Thus, a decrease or an increase of podocyte specific VEGF

both result in severe glomerular defects in development (Table 1.2).

1.2.2.2 Adult

Surprisingly, podocytes continuously secrete VEGF into the relatively quiescent

glomerular capillaries throughout adulthood, though not at the same rate of expression as during

development [40]. To determine the role of podocyte-derived VEGF in the adult kidney

Eremina et al. used a podocyte-specific inducible Cre-loxP mouse system to create homozygous

and heterozygous podocyte-specific knockouts of VEGF [39]. Deletion of VEGF from

podocytes following glomerular maturation, of 3 weeks of age, results in glomerular endothelial

injury and thrombotic microangiopathy within 8-12 weeks. The pathological lesion resembles

the glomerular injury observed in patients treated with VEGF inhibitors [41].

1.2.3 Regulation

During glomerular development, the microenvironment is hypoxic, which encourages

angiogenesis. The VEGF gene promoter contains a hypoxia-inducible factor-1 (HIF-1) signal

transducer called hypoxia-responsive enhancer elements (HRE) in both the 5’ and 3’ UTR

regions of the mRNA transcript [30]. Therefore under low oxygen the HIF-1 is not ubiquinated

and degraded by von Hippel-Landau protein; instead, HIF-1 forms a complex with ARNT and

CBP/p300 then localizes to the nucleus and binds to the HRE region in endothelial cells (or

14

other VEGF expressible cells) to induce transcription of VEGF [42]. As well as transcriptional

regulation, the VEGF mRNA transcript’s half life is increased in hypoxia via the HuR, an

mRNA stabilization factor, with its associated proteins that bind to the adenlyate/uridylate rich

elements (AREs) in the VEGF transcripts and increase the relatively short half-life of VEGF

(less than an hour) by double or triple the normal [30]. While hypoxic regulation is likely during

glomerular development, the adult glomerulus is not hypoxic. The mechanism of VEGF

regulation in the adult glomerular is not clear although in vitro and in vivo evidence suggests

that it might involve integrins, since deletion of the α3β1-integrin results in an increased VEGF

regulated angiogenesis response [43].

In addition to positive regulators of VEGF transcription, there are negative regulators of

VEGF function that may modulate its function. As mentioned before, VEGF is expressed in the

adult glomerulus after development concludes in spite of the fully developed healthy glomerulus

not being hypoxic [44]. One possible location of VEGF regulation is through the heparan

sulphate binding domain of exons 6 and 7. This domain is able to bind to the heparan sulphate

and other matrix-associated proteins that are found in the GBM. Since the GBM separates the

VEGF secreting podocytes from the VEGF receptor containing endothelial cells the GBM is a

prime location for the binding of excess VEGF to form a reservoir of VEGF protein that can be

released by the degradation of the matrix proteins of the GBM. This has been demonstrated by

the matrix metalloproteinases that react with the GBM’s matrix or VEGF directly to release

VEGF [45].

VEGF can be negatively regulated by circulating sVEGFR-1. This protein binds to

VEGF with a greater affinity than VEGFR-2, the primary signalling receptor. In humans,

sVEGFR-1 is found to be expressed in the glomerulus greater than either VEGFR-1 or VEGFR-

15

2, according to mRNA expression [46]. The sVEGFR-1 protein has a selective inhibitory action

on VEGF by competitive binding of the VEGF ligand itself or forms a heterodimer with

VEGFR-1 or VEGFR-2 that would prevent normal dimerization required for signal transduction

[47].

Another inhibitory regulator for VEGF signalling is the inhibitory isoforms of VEGF

due to the altered 8th exon, called 8b. This alteration is a change of the terminal amino acids

from Cys-Asp-Lys-Pro-Arg-Arg to Ser-Leu-Thr-Arg-Lys-Asp [48]. The inhibitory isoform

VEGF165b is normally found in the human kidneys and glomeruli and thus may play a role in

preventing unwanted angiogenesis in this quiescent capillary bed since VEGF165b inhibits

VEGF caused migration and proliferation of endothelial cells in vitro [48, 49]. The regulatory

ability of VEGF165b is still ambiguous since since in immortalized podocytes the VEGF165b

isoform is a fraction of VEGF expression, but in primary cell cultures of podocytes VEGF165b

is highly expressed[33]. The regulation of splicing is still unclear but in disease processes the

inhibitory splicing can be upregulated by TGF-β or downregulated by IGF, PDGF, and TNF-

α[50].

In disease states, such as diabetic nephropathy, both the glomerular endothelial cells and

the podocytes may become hypoxic, which can induce VEGF expression as a result of

injury[29]. In vitro studies show that hyperglycaemia, increased angiotensin and glycated

albumin can upregulate VEGF expression at the podocyte [51-53]. However, there are few

conclusive studies looking at the control of VEGF upregulation; thus, it remains an area for

active investigation.

16

1.2.4 Signalling Pathways

The VEGF that is secreted by podocytes acts in a paracrine manner appears to occur

affecting endothelial cells located directly across from the GBM; thus, VEGF is delivered

against the direction of net urine flow until it binds to the VEGF receptors found on the surface

of the endothelial cells. Both podocytes and endothelial cells also express VEGF receptor 1

(VEGFR-1) that has a minimal signal response but binds VEGF with a 10 time greater affinity

than VEGF receptor-2 (VEGFR-2) [54].

The VEGF signalling occurs in endothelial cells primarily through tyrosine kinase

transmembrane receptor, VEGFR-2. VEGFR-2 contains an extracellular region with 7

immunoglobulin-like domains, a transmembrane domain and an intracellular region with two

tyrosine kinase domains. The binding of VEGF to VEGFR-2 at Ig domain-2 allows for the

formation of a homodimer that results in autophosphorylation of its numerous tyrosine-kinase

residues; in humans these are Tyr 951, 1054, 1059. 1175, and 1214[55]. The receptors then

recruit many proteins involved in the signal transduction pathway. Some of the messenger

proteins activated include: Src tyrosine kinase, PI3K, AKT/PKB, eNOS, PLCγ, PKC,

p38MAPK, etc [54-56]. These secondary messenger proteins are involved in vascular

permeability, cell survival, angiogenesis, actin remodelling, cell migration, and cell proliferation

(Fig 1.4). The effects can also be modulated by the simultaneous inhibition or activation of

other tyrosine kinase receptors, such as the insulin receptor or the Tie-2 receptor, which is

regulated by angiopoietins.

17

Figure 1-4. VEGFR-2 receptor.

Structural domains indicated on left and signalling transduction pathways on right.

Phospholipase C-γ (PLCγ), phosphatidylinositol 3’ kinase (PI3K), mitogen-activated protein

kinase (MAPK), Protein Kinase C (PKC), kinase B (AKT/PKB), Heat-shock protein 27

(HSP27), mesenchymal epithelial transition factor (MET),. Adapted from Olsson et al.

(2006)[55].

18

1.2.4.1.1 Angiopoietins

The angiopoietin-2 (Ang-2) ligand can act synergistically with VEGF signalling. Ang-1

is an agonist and Ang-2 is an antagonist on receptor endothelium-specific receptor tyrosine

kinase 2 (Tie-2), a tyrosine kinase receptor found on vascular endothelial cells [54]. Ang-1 binds

to Tie-2 and activates survival and reduces cell permeability; whereas, Ang-2 inhibition of Tie-2

results in endothelial cell death, pericyte loss, vessel-regression and vessel-destabilization. In

developing and adult glomeruli, the angiopoietins and VEGF are both expressed, with their

respective receptors [57, 58]. Specifically, the high expression of both VEGF and Ang-2 results

in endothelial cell proliferation, migration, and angiogenesis[59].

1.3 Diabetic Nephropathy

1.3.1 Epidemiology and Clinical Features

The prevalence of diabetes in the industrial world and the increasing incidence in the

developing world is a major concern for public health due to the long term financial and health

consequences. The incidence of diabetes jumped from 30 million in 1985 to 171 million in

2000, affecting almost 5 percent of the adult population [60]. Even though diabetes has been

predominantly a disease of the developed world, the greatest increase of diabetes has occurred

in the developing world since 1995 [60]. The two most common types of diabetes are: insulin-

dependent diabetes and insulin-independent diabetes, also called type 1 and type 2 diabetes,

respectively. Type 1 is caused by an autoimmune reaction that kills the insulin producing

pancreatic β-cells in the pancreas, and is treated by exogenous injection of insulin. Type 2 is a

different form that results in cellular resistance to insulin signalling and eventual impaired

insulin secretion, which results in poor uptake of sugar resulting in high blood sugar

concentration and glycation of tissue proteins[61]. The treatment regimen of type 2 diabetes

involves making the insulin-resistant cells responsive to insulin; commonly metformin treatment

19

is used together with diet and exercise modifications [62, 63]. The increase in diabetes

worldwide is primary attributed to type 2 diabetes that is associated with obesity and old age

[64]. But in all cases, diabetes is a significant risk factor in the development of vascular

complications [64].

The highly vascular nature of the kidney makes it susceptible to alteration in blood

biochemistry such as hyperglycemia in diabetes. Thus, the kidney is one of the significant target

organs injured in diabetes and affects those suffering from both type 1 and type 2 diabetes. Of

all the newly diagnosed patients with kidney failure in the United States in 2006, 45% had

diabetes [3]. Due to the nature of diabetic nephropathy the speed of progression of the disease is

not well defined, with type 2 diabetes having a more variable clinical course[65]. The best

clinical sign for early detection of kidney disease is persistent microalbuminuria (urinary

albumin secretion of 30-300mg per gram of creatinine) that is preceded by a period of

hyperfiltration, occurring as early as 5 years after the onset of diabetes [3, 8]. The amount of

albumin and protein lost in the urine increases progressively until macroalbuminuria, which is a

urine albumin greater than 300mg of albumin per gram of creatinine, occurs and is associated

with significant glomerular injury [66].

As the degree of proteinuria is positively correlated with significance of glomerular

injury, one goal of treatment is to reduce the amount of albuminuria. Reducing systemic blood

pressure to a goal of 130/80 is one method to limit the passage of protein through the GBM,

since increased proteins flow through the GBM may damage the kidneys further [67]. The most

effective treatment for blood pressure control in diabetes is renin-angiotensin inhibitor therapy.

These can include prescribing patients with angiotensin converting enzyme (ACE) inhibitors or

angiotensin receptor blockers (ARBs) [68]. ACE inhibitors block ACE from cleaving

20

angiotensin I and converting it into the active angiotensin II that upregulates systemic blood

pressure; whereas ARBs act antagonistically and block the angiotensin II receptors and reduce

blood pressure. In addition, inhibitors of the renin-angiotensin system have been found to reduce

albumin secretion independent of reducing blood pressure, and newer drugs that inhibit renin are

also in clinical use do not demonstrate the strong renal protective effect of ACE inhibitors [69].

But ultimately, this just postpones eventual kidney failure and is not curative. That is why after a

period of overt macroalbuminuria, glomerular filtration declines and kidneys effectively cease

functioning, at which point the only treatment options that remain are either haemodialysis or

kidney transplantation.

1.3.1.1 Environmental Factors

The risk for developing diabetic nephropathy is conventionally thought to be due to the

duration of diabetes and the level of glycemic control since diabetic nephropathy does not occur

unless hyperglycaemia is present and better glycaemic control has been found to delay or

prevent the development of proteinuria, glomerular injury, and other vascular injuries associated

with diabetes [70, 71]. That is why one significant action that both type 1and type 2 diabetic

patients can do to prevent the development of nephropathy and microvascular injury is to

maintain tight control of blood glucose concentration, according to the UK Prospective Diabetes

Study and the Diabetes Control and Complications Trial Research Group that studied the role of

intensive glycaemic control in type 2 and type 1 diabetes, respectively [71, 72]. For this decade-

long type 2 diabetes study, patients were randomized to undergo the conventional treatment of

maintaining a fasting glucose concentration of 6.1mmol/L to 15mmol/L through diet alone,

unless their blood sugar was greater than 15mmol/L or other indicators of dangerous degrees of

hyperglycemia at which time drugs and insulin were used. The intensive group maintained a

fasting glucose of less than 6mmol/L with the use of both drugs and diet, and insulin if required.

21

For the 6.5 year type 1 diabetes study, the patients were assigned conventional 1-2 daily insulin

injections and the intensive group were assigned 3 or more insulin injections or provided an

insulin pump to maintain normoglycemia. The intensive group had an average blood glucose

measurement 8.6mmol/L, as compared to 12.3mmol/L in the conventional group. In both

studies, the intensively controlled treatment groups had lower rates of diabetic complications

and reduced degrees of albuminuria.

1.3.1.2 Genetics

Diabetic nephropathy has a complex etiology since not all patients with diabetes develop

renal injury, nor does intensive blood glucose control prevent some from developing renal and

other diabetic complications; however, there is a subset of patients that have diabetes for

decades without developing nephropathy[73]. Another subset have a higher risk of developing

diabetic nephropathy; they are diabetic sibling of those who develop the disease [74-76]. This

indicates a possible genetic link that separates diabetic patients who will develop nephropathy

and others who remain unaffected.

Unfortunately, determining valid and consistent genetic associations in a large

population and in a complex disease, such as diabetes, is difficult. One issue is the enormous

number of regions that can be searched by genetic analysis, which often results in false positives

if a P value of 0.05 is used; one way this can be overcome is by only assessing genes identified

with function by multiple independent investigators[77]. Another issue is to determine a

consistent and exacting description of the phenotype so as not to conflate different independent

genetic effects; thus kidney biopsy data could be used instead of albuminuria as an indicator for

kidney damage caused by diabetes.

22

The two genes with strong association studies for either worsening or ameliorating

diabetic nephropathy are ACE and VEGF, respectively [78].

In patients with diabetic kidney disease ACE inhibitor therapy is used for treatment to

postpone further kidney damage and different alleles of the ACE protein could be protective in

diabetic nephropathy. ACE inhibitors are known to both decrease blood pressure, as well as

provide general renal protective effects not dependent on blood pressure. A review of 47

population studies from 1994 to 2004 with a total of 14 727 type 1 and type 2 diabetic subjects

were examined for an ACE insertion/deletion polymorphism (rs1799752) of the Alu repeat

sequence located at 287 bp in intron 16 on chromosome 17q23[79]. This particular region was

chosen because individuals homozygous for the insertion in this region had been reported to be

protected against diabetic nephropathy due to type 1 diabetes. Furthermore, this polymorphism

is correlated with lower circulation of ACE [80]. The review found that the insertion allele in

East Asian populations with type 2 diabetes had a 35% reduced risk as compared to the reduced

risk of only 10% for European populations[79]. In another meta-review, the ACE deletion

variant was also found to be positively associated with diabetic nephropathy in East Asians, but

not in Europeans[78]. The information on the ACE allele could assist in predicting patients that

would progress [81]. Although the inability to replicate this study in many independent

populations suggests the finding may not be broadly applicable.

The VEGF allelic variants have also been assessed by meta-analysis. In a recent paper, a

VEGF variant has been found to be associated with diabetic nephropathy in two studies

involving type 1 diabetes in European patients. Of the 24 genetic variants associated with

diabetic nephropathy the VEGF variant rs833061 in Europeans shows the strongest protective

effect [78]. This indicates that different alleles of VEGF may protect or enhance diabetic

nephropathy that could explain why nephropathy only affects a subset of patients with diabetes.

23

This recent meta-analysis suggests and an association of the risk of diabetic nephropathy with a

specific variant of the VEGF allele and this may be used in the future to screen patients;

however, at this time this correlation is not definitive and also may not be biologically relevant

to the disease.

These studies do not explain the biological role of the proteins involved but are

important for determining candidate genes to investigate and also to assess the gene’s effect in

different populations. The association studies of ACE and VEGF indicate that different alleles

may either promote or resist the development of diabetic nephropathy; thus indicating these

genetic variants may play a functional role in patient and suggest that the role of these proteins

is interesting to investigate in patients.

1.3.2 Glomerular Pathobiology and Histology

The clinical symptoms of diabetic nephropathy are indicative of the substantial

morphological changes that occur at the glomerulus.

1.3.2.1 GBM thickening

Before any of the clinical symptoms become evident, the GBM increases in thickness as

little as 2 years after the onset of diabetes without proteinuria, suggesting that thickening of the

GBM may be more a symptom of hyperglycaemia and not the initiating factor in nephropathy

[3, 8]. However in both types 1 and 2 diabetes the increasing thickness of the GBM is matched

by increasing severity of proteinuria. For example, human subjects with clinical diabetic

nephropathy ( ≥300mg of albumin per gram of creatinine) had a ~40-225% increase in GBM

thickness with diabetes for only 6 years; whereas, patients with microalbuminuria only had a

~15-75% increase in GBM thickness after 13 years of diabetes[82]. This thicker but more

permeable GBM is created by the increased deposition of Type IV collagen (chains α1-4),

24

possibly by the podocyte due to increased glucose, angiotensin II, or VEGF [8, 83].

Concurrently, in diabetic nephropathy there is a decrease in the production of the matrix

degradation enzymes, such as matrix metalloproteinases, and an increase in their inhibitors [84].

This paradoxical increase in leakiness with increased GBM thickening could be explained by

the loss of charge selectivity of the GBM that is accompanied by the increase in activity of

podocyte heparanase that degrades heparin sulphate [85]. On the other hand, the thicker more

disorganized GBM may reduce cell binding and promote podocyte detachment [8].

1.3.2.2 Mesangial matrix deposition and mesangial expansion

Glomerular hypertrophy correlates with an increase in the GFR in diabetic nephropathy,

possibly due to increased hydrostatic forces and increased blood flow from the afferent

arterioles[86]. The increased capillary diameter would elevate the GFR further, as well as

increase the shear stress and mechanical strain on the glomerulus[82]. These forces may result

in injury as well as differential expression of local cytokines and growth factors. As kidney

function worsens the GFR declines as glomeruli experience mesengial matrix expansion, which

also correlates with increased extracellular matrix proteins, worsening albuminuria, and

hypertension [87]. In total, the increased size of mesengial cells accounts for one-third of

glomerular hypertrophy with the remaining two-thirds due to increased deposition of

extracellular matrix proteins[8]. Mesangial expansion was thought to be the primary

characteristic of early diabetic nephropathy due to its negative effect on GFR, since it not only

precedes the development of albuminuria but can also develop without the occurrence of

albuminuria[88].

25

1.3.2.3 Kimmelstiel-Wilson Nodules

The hallmark of diabetic nephropathy are the Kimmelstiel-Wilson nodules; these

structures appear in glomeruli as kidney disease progresses from the early to the late stage,

possibly caused by microvascular injury due to mesangiolysis. These sclerotic nodules are

acellular areas of matrix proteins, hyaline, small lipid proteins, and cellular debris that are

located in the glomerular capillary loops that destroy the glomerular tufts [3, 89]. In pathological

scoring a single Kimmelstiel-Wilson nodule indicates a high risk of further progression of

diabetic nephropathy and retinopathy[89]. These nodules are predominantly found in patients

with severe proteinuria and glomerulosclerosis [3].

1.3.2.4 Podocyte Changes

During the progression of diabetic nephropathy from microalbuminuria to

macroalbuminuria, glomerulosclerosis and ESRD, the kidney podocyte undergoes significant

changes. In biopsies from patients with diabetic nephropathy, podocyte injury is associated with

proteinuria and foot process effacement that eventually results in glomerular sclerosis [82].

There are a number of stressors such as macroalbuminuria, hyperglycaemia, and high

hydrostatic forces that affect the podocyte in diabetic nephropathy that are pro-apoptotic or

encourage detachment. The reduced remaining population of podocytes hypertropy and extend

their foot processes to maintain the same area of the GBM as before[8]. This results in fewer

podocytes per glomerulus with widened and effaced foot processes that decreases slit pore

density[90]. In spite of this adaptation, the result of these structural changes is further

glomerular injury and increased permeability of the GFB.

26

1.3.3 Molecular Pathways in Diabetic Nephropathy

A major complication of diabetes is diabetic nephropathy, but the exact molecular

mechanism is not well understood. Currently, many factors are thought to play a role in the

development of diabetic nephropathy and are under investigation.

1.3.3.1 Hyperglycaemia

Hyperglycaemia is thought cause kidney injury by interfering with the normal metabolic

pathways in kidney cells. The traditional mechanism that has been suggested is: high

intracellular glucose results in superoxide formation in the mitochondria that partially inhibits

the glycolytic enzyme GAPDH; thereby diverting upstream metabolites from glycolysis into

pathways of glucose overutilization [91]. This would result in damage. The exact mechanism of

diabetic damage is not known but a few hypothetical pathways have been investigated : reactive

oxygen species(ROS), polyol, hexosamine, protein kinase C, advanced glycation end-product

(AGE) pathways [92] (Fig 1.5).

27

Figure 1-5. Hypothetical diabetic pathways in endothelial cells.

Hyperglycemia causes increased ROS production by the mitochondria resulting in inhibition of

GAPDH that causes an increase in intermediate products of glycolysis to be diverted to the

Polyl, hexosamine, PKC, and AGE pathways. This results in reduction of NADPH and

depletion of glutathione (i.e. glutathione detoxifies reactive aldehydes). The result is an increase

signalling through known causal pathways of vascular complications. Adapted from Brownlee

(2001)[92].

28

1.3.3.2 Role of VEGF in Diabetic Nephropathy

VEGF is an important molecule in the pathogenesis of renal diseases, such as diabetic

nephropathy [29]. This was demonstrated by Robert and others using in situ hybridization and

RT-PCR [40]. They found VEGF secretion by podocytes is upregulated in the kidney during

development in glomerular endothelial cells in mice and found lower level expression in adults.

The addition of VEGF to mouse podocytes in cell culture stimulate the production of the α3-

chain of type IV collagen; this signalling can be blocked by incubating the cells with the

VEGFR-2 inhibitor SU416 [83]. Protein leakage at the GBM can also be modulated by VEGF

secretion or through the uncoupling of endothelial cell-cell junctions (e.g. VE-cadherins) [93].

The upregulation and downregulation of glomerular VEGF levels during kidney development or

in adulthood can lead to glomerular diseases in mice, such as renal thrombotic microangiopathy

[41, 94]. These results demonstrate that proper regulation of VEGF expression is critical for a

healthy glomerulus.

VEGF is intimately involved in the pathogenesis of DN. Yang et al. studied 232

individuals with diabetes and classified them according to their microvascular complications

[95]. They found that patients had a greater likelihood of developing diabetic nephropathy with

the presence of the deletion mutation in the promoter region of the VEGF gene, a mutation

known to increase VEGF transcription. An increase in VEGF has also been documented in renal

biopsies and plasma from patients with Type 2 and Type 1 diabetes, respectively [96, 97]. These

observations led numerous investigators to propose that the increased level of VEGF is

detrimental in diabetes [90, 98]. However, others have found that patients with DN had a

reduced expression of VEGF. In renal biopsies of diabetic patients with nephrotic range

proteinuria there were fewer glomerular cells with VEGF mRNA or protein [99, 100]. Also,

29

others have found that a downregulation of glomerular VEGF mRNA levels is often associated

with proteinuria and glomerular damage in DN [13, 101].

In rodents, insulin-insufficient and insulin-resistant forms of diabetes were observed to

have an increase in renal VEGF production [102, 103]. To determine the functional role of

VEGF, Schrijvers et al. injected diabetic rats with VEGF antibodies to reduce the level of

circulating VEGF and found that the rats with antibodies did not develop glomerular

hypertrophy, though no significant effect on urinary albumin levels or creatinine clearance were

found [104]. But rodent studies have also not been without controversy, since Gudehithlu et al.

observed that diabetic rats induced with STZ had reduced glomerular VEGF production [105].

Furthermore, a variety of VEGF inhibitor studies have been performed in rodent models of

diabetic nephropathy with mixed results; some groups demonstrate protection or slowed

progression while others have seen no benefit [47, 104, 106, 107].

As demonstrated above, the exact mechanism of VEGF action at the level of the

glomerulus or how VEGF secretion is regulated in diabetic nephropathy is not well known.

There are multiple contradicting models of how VEGF could function at the level of the

glomerulus in diabetic nephropathy. The reason there are different models to explain diabetic

nephropathy may be that VEGF levels fluctuate according to the different stages of the disease.

VEGF levels in humans increase during the early stages of DN and thereafter decrease below

normal during the course of DN [4]. The increase in VEGF could be the primary cause or even a

secondary cause of diabetic nephropathy[108]. Two other hypotheses are: local hypoxia results

in an activation of hypoxic factors resulting in an increase in VEGF leading to diabetic

nephropathy; and, a loss of VEGF production at the podocyte results in endothelial injury which

30

leads to an up-regulation of VEGF as a “rebound phenomenon” [29]. However, it is not possible

to confirm these hypotheses without further inquiry into the order of events that lead to disease.

A greater understanding of the factors involved in the progression of diabetic

nephropathy would be useful in developing therapies but a great deal remains unclear. One

reason for this state of affairs is the lack of an animal model that can recapitulate both the

histological and physiological characteristics of diabetic nephropathy.

1.3.4 Mouse models

1.3.4.1 Diabetic Models

One method to induce insulin-dependent diabetes efficiently in the mouse is the use of

STZ, a pancreatic β-cell toxin, to be injected to kill the insulin producing cells [109]. STZ is

absorbed by pancreatic β-cells via GLUT2. Once inside the cell, the primary action of STZ that

causes cell death is the alkylation of cellular DNA [110]. In addition, STZ functions as a nitric

oxide donor that causes an increase in xanthine oxidase and a subsequent increase in reactive

oxygen species which can react with nitric oxide to form highly toxic peroxynitrate [111]. The

lethal side effects of STZ can be mitigated by employing a low dose protocol, but the

mechanism of action is then primarily an autoimmune reaction [112]. Different mouse strains

react to the treatment differently. In order of severity, the mice strains DBA/2, C57BL/6,

MRL/Mp, 129/SvEv, and BALB/c develop albuminuria and diabetes, but males always have

more severe glycaemia than females[113]. The strain found to have the most severe

hyperglycaemia and albuminuria was DBA/2, but it only exhibits minimal glomerular changes.

The typical renal features observed in STZ-induced diabetic mouse models include: increased

glomerular matrix proteins, thickening of the GBM, loss of podocytes, widening of foot

processes and reduced nephrin expression[114]. These studies allude to the significant role

31

podocytes play in the development of glomerular disease and the possibility of modeling

nephropathy in animals by causing podocyte dysfunction[82].

In turn, STZ-induced diabetes in genetic models may produce more profound changes.

For instance, the eNOS pathway is responsible for the release of nitric oxide, a key regulator of

vasodilation; this pathway has also been implicated in diabetic endothelial dysfunction [98]. To

investigate the role of eNOS in DN, Kanetsuna et al. caused STZ-induced diabetes in a

nephropathic-resistant strain of eNOS knockout mice [115]. Through this model they

demonstrated that eNOS deficiency leads to albuminuria, hypertension, mesangiolysis, and

GBM thickening in diabetes [115].

Another approach to model DN is to use mice with genetic mutations that predispose

them to insulin-resistant diabetes, such as db/db or ob/ob, and like mice induced with STZ, they

may eventually develop glomerular hypertrophy or mesangial expansion. In this way diabetes is

induced, but the dramatic renal injury found in patients with DN does not occur [116]. However,

Hudkins et al. introducing an ob/ob mutation, removes the appetite suppressing hormone leptin,

into the naturally hyperinsulimic BTBR mouse strain to develop a model that mimics many of

the features of DN previous models lacked [117, 118]. Their model developed diabetes at 8

weeks of age; and by 8-22 weeks it reproduced many of the features of DN such as: diffuse

mesangiosclerosis, mesangiolysis, podocyte loss, and proteinuria.

1.3.4.2 Transgenic Models

To study molecular pathways in living systems the transgenic mouse system has been

revolutionary. These mice have fragments of exogenous DNA inserted into their genome that

can be from mouse or any other species. This method has been used to create loss or gain of

function mutations of many different genes. Due to developmental and physiological similarities

32

between mice and humans this model system allows for in depth investigation of important

biological and pathological pathways.

Germline gene targeting is done by inserting a targeting cassette into embryonic stem

(ES) cells via homologous recombination. The targeted ES cells are either inserted into a

blastocyst by microinjection or into an aggregation of diploid embryos and inserted into a

pseudopregnant mother for the first litter of chimeric mice[119]. These chimeras are crossed to

obtain a line of pure transgenic mice for the gene of interest. The mouse’s phenotype can be

characterized and the role of the gene of interest can be evaluated.

Using this method to produce whole body knockout mice is powerful, but there are

drawbacks. After the chimera stage, the second litter has a complete alteration of the gene of

interest from conception to adulthood. If the gene disruption is critical for development, the

mouse may die at any stage starting from conception; therefore, if the gene causes death at a

particular age then any effect of the gene after that age cannot be assessed. For example,

homozygote and heterozygote whole-body deletion of VEGF expression causes mice to die at

embryonic day 9.5 and 11.5, respectively, due to impaired vascular development [41].

1.3.4.3 Cell-specific Genetic Manipulation

Instead of whole body alterations, cell-specific genetic alteration is another method that

has been used in studying the effects of genes in the kidneys. This system utilizes tissue-specific

promoters to drive the expression of genes by using cassettes with cell-specific promoters of the

genes of interest that target different regions of the genome. In the kidney, many different

promoters have been used in the past to produce conditional mouse lines that can specifically

target genes that are only expressed in particular cells. For example, the promoters nephrin

(NPSH1) and podocin (NPSH2) have been used to restrict the expression or knockout of target

33

genes to the kidney podocyte [120]. There are many other promoters used in creating

conditional mouse lines that are specific to the various regions of the kidney (Table. 1-3). This

system can be used to characterize the result of altering the molecular pathway in a single cell-

type in an organ so that the role of that cell-type can be better understood. This system can be

problematic because insertion of the cassette is random so the number of cassettes inserted and

the location in the genome may vary, resulting in possible multiple insertions/copies and

possible insertion in transcriptionally inactive region of the genome or even disruption of

another gene. To determine the number of insertion events DNA is digested with restriction

enzymes and run on a Southern blot and probed for the insertion in question; however, gene

expression often differs dramatically with copy number due to the regulatory environment of the

insertion loci [121].

Gene targeting with larger genetic insertions is required to overcome the problem of

random integration and many systems have been used to resolve this issue. One such system is

the bacterial artificial chromosome (BAC). BACs are based on the E. coli F factor plasmid and

used in the Human Genome Project since these plasmids can contain DNA inserts up to 700kb

[122]. The large inserts that are possible in this system allows for the inclusion of the gene of

interest as well as any regulatory sequences far from coding regions. Due to the inclusion of

regulator sequences the insertion number has been found to correlate to the expression level of

the gene [123].

The inserted gene can be further regulated by site-specific recombinase to knockdown or

over-express genes and the most widely used conditional gene targeting system is Cre-loxP

[124] (Figure 1-6). The Cre recombinase is a bacteriophage P1 enzyme that mediates site-

specific DNA recombinase at the 34-bp inverted 13-bp and 8-bp spacer regions called loxP sites

34

that are created to flank the gene of interest. The Cre excises the region if the loxP regions are in

the same orientation or the segment is inverted if the loxP regions are in opposite orientations

[120]. The Cre protein is generated by a DNA construct with a cell-specific promoter, such as

nephrin, and the protein will cleave the loxP sites in the same cell. Since two separate transgenic

cassettes are required two strains of mice are needed; one with the cell-specific promoter with

Cre and the other with the floxed gene of interest. Mice with loxP usually have no phenotype,

but Cre expression may have toxic effects. This system is useful in studying developmental

defects caused by specific developmental genes that are expressed during differentiation.

Two other types of recombinatory systems commonly used in mice are FLP and PhiC31

integrase. FLP requires a short 34-bp FRT consensus sequence flanking the gene of interest for

excision to occur, which is analogous to the Cre lox-P system[120]. However, unlike Cre, wild

type FLP recombinase is not biochemically active over the same temperature range [125]. But

FLPe, a mutated variant of FLP, is as enzymatically active in ES cells and in vivo as Cre and can

be used in an identical manner [125, 126]. In contrast, the Streptomyces phage integrase PhiC31

is less efficient than both Cre and FLPe, but can be used for irreversible unidirectional site-

specific integration of genes [127, 128]. The PhiC31 system recombines between two att

integration sites (attP or attB for phage and bacterial sites, respectively)[128]. Once an att site is

inserted at a particular locus in the genome any gene of interest may be integrated into the exact

same locus and compared; thus, negating the positional effects of the particular locus.

A drawback with these systems is that genes cannot be studied long after differentiation

and maturation has occurred. Using an inducible transgenic system means that diseases that

affect adults can be studied by altering genetic expression for proteins that are involved in

pathology. The tetracycline derivative doxycycline (dox) has been most often used for inducible

35

systems[120] (Figure 1-7). The system uses a reverse tetracycline transactivator (rtTA) under

the control of a cell-specific promoter and that binds to the tet operator (tetO) only when dox is

administrated, usually through the drinking water. This tetO promoter is upstream of the Cre

gene and the gene of interest is floxed. Thus, the rtTA binds to dox and the tetO operator that

result in the expression of Cre and the subsequent excision of the loxP flanked gene of interest.

This powerful system can determine the role of disease genes specifically in the mature kidney,

such as diabetic nephropathy

A problem with this system is that three separate genes are required for it to work: the

rtTA, tetO-Cre, and the floxed gene of interest. One possible solution that has been investigated

is using 4-OH-tamoxifen, an estrogen receptor antagonist, to induce Cre or FLPe activation.

Thus, the Cre or FLPe fusion protein with an estrogen receptor ligand binding domain is under

the control of a tissue specific promoter so the fusion protein is produced in the cytoplasm in

specific cells [129]. The administration of 4-OH-tamoxifen causes the fusion protein to be

transported to the nucleus where the Cre or FLPe component recombines the targeted gene. The

problem with this system is that the concentration of 4-OH-tamoxifen is often cytotoxic;

furthermore, it has not been successfully demonstrated in the kidney [120, 130].

36

Promoter Renal Expression Extrarenal Expression Reference

Kidney androgen promoter 2

Proximal tubules Brain [131]

-Glutamyl transpeptidase

Cortical tubules None [132]

Na/glucose cotransporter (SGLT2)

Proximal tubules None [133]

PEPCK Proximal tubules Liver [134]

Aquaporin-2 Principal cells of collecting duct Testis, vas deferens [135]

Hox-B7 Collecting ducts, Ureteric bud, Wolffian bud, ureter

Spinal cord, dorsal root ganglia

[136]

Ksp-cadherin Renal tubules, collecting ducts, ureteric bud, Wolffian duct, mesonephros

Müllerian duct [137]

Tamm-Horsfall protein

Thick ascending limbs of loops of Henle

Testis, brain [138]

Nephrin Podocytes Brain [139, 140]

Podocin Podocytes None [141]

Renin Juxtaglomerular cells, afferent arterioles

Adrenal gland, testis, sympathetic ganglia, etc.

[142]

FoxD1/BF2 Stromal cells ? [143]

Six2 Cap mesenchyme Anterior cranial base [144, 145]

Pax3 Metanephric mesenchyme Neural tube, neural crest [146, 147]

Pax2 Metanephric mesenchyme, UB Inner ear, midbrain, cerebellum,olfactory bulb

[148]

Cited1 Cap mesenchyme melanocytes [149, 150]

Pax8 Proximal , distal tubule and collecting duct (tet-on system)

thyroid [151, 152]

Table 1-3. Conditional mouse lines for the kidney.

Adapted from Quaggin et al (2008). [153]

37

Figure 1-6. Cell-specific Cre-loxP system.

A cell specific promoter regulates Cre recombinase expression only in tissues or cells where and

when the promoter is active. The gene of interest is flanked by loxP sites. Cre will excise the

gene of interest only in the cell where the promoter is active and cause cell-specific gene

excision.

38

Figure 1-7. Cell-specific inducible rtTA-tetO Cre system.

A cell-specific promoter regulates rtTA expression only in tissues or cells where and when the

promoter is active. Dox induction causes rtTA to bind to the Tet-operator promoter and activate

Cre recombinase. The gene of interest is flanked by loxP sites to allow for excision by Cre.

39

1.3.4.4 Differences between Mouse Models and Human Disease

The search for a robust mouse model for diabetic nephropathy is of great importance due

to the reliance of research on genetic manipulation of the mice to understand disease

mechanisms and treatment. The use of mouse systems to validate treatment for diabetic

nephropathy before testing on humans makes creating a working model system enticing. But, no

mouse model has recapitulated all the significant features of diabetic nephropathy such as:

glomerular sclerosis, Kimmelstiel-Wilson nodules and overt proteinuria with a progressive loss

of kidney function[108].

In rodent models, there is evidence that proteinuria progresses from microalbuminuria to

macroalbuminuria that corresponds to worsening renal function. During the course of diabetes,

the glomerular basement membrane thickens, the mesangial matrix expands and sclerosis of the

glomerulus occurs. These features found in diabetic nephropathy in humans have been seen in

STZ injected rodent models, but are much milder than in the human disease state [109]. One

feature that has yet to be recapitulated in rodents is the pathognomonic features of diabetic

nephropathy: the Kimmelstiel-Wilson nodules and complete renal failure.

There are various explanations for this mild phenotype in rodents. In human patients

diabetic nephropathy often progresses over many years, but a mouse’s life span is extremely

short in comparison and thus the disease cannot progress as long as it does in humans. Also,

mice do not get hypertension that often accompanies human cases[154]. There are also

differences in the metabolic pathways in lipid and cholesterol digestion [108]. Even with the

over 450 inbred mouse strains, the genetic and environmental effect in diabetic nephropathy

would be difficult to mimic in mice housed in pathogen-free environments that protect them

from environmental insults or “hits” that are often the trigger for injury.

40

2 Hypothesis

The VEGF ligand is needed for the maintenance of the glomerular filtration barrier of

diabetic mice. We posit that loss of local VEGF production in podocytes of diabetic mice will

accelerate glomerular damage. Furthermore, we predict that the mechanism of injury will result

from endothelial damage.

To determine the role of VEGF in the progression of diabetic nephropathy, we used the

STZ model of type 1 diabetes in mice that carry the pod-rtTA, tetOCre and 2 floxed VEGF

alleles [120]. This allows us to manipulate VEGF gene expression in podocytes of diabetic mice

in a time-specific fashion.

41

3 Materials and Methods

Experimental animals. The transgenic mice used in this experiment already contained the

following transgenes: podocin-rtTA (NPHS2-rtTA), tetOCre (tetO-Cre) and VEGFloxP (+/+) on

a mixed genetic background. The NPHS2-rtTA mouse construct contained the human podocin

promoter, NPSH2, upstream of the gene that transcribes the rtTA enzyme to restrict the

expression of rtTA to the podocyte from embryonic day 13.5 onward [155]. This enzyme is

known to bind to the tetO promoter in the presence of dox and activate the synthesis of Cre

recombinase. The Cre, in turn, causes site specific deletion of the region between, what is

known as the loxP sites, 34-bp repeat inserts, and delete the “floxed” gene [156]. These mice

lacked wildtype VEGF and instead were homozygous for the VEGFloxP, which has the VEGF

gene with the loxP sites flanking exon 3. Thus, the mice constitutively produced rtTA only in

podocytes without producing any noticeable phenotype. Only with the addition of dox can the

rtTA bind to the tetO promoter to produce Cre to subsequently recombine and knock-out the

floxed VEGF region. This results in the production of a dysfunctional truncated mRNA

messenger (Fig. 4-1-1A) but no functional VEGF protein. Dox can be added to the food or

drinking water to activate the Cre recomininase at any time after the podocin promoter becomes

active. The excision efficiency of this genetic system was verified previously by our laboratory

[41].

Standard diet (Harlan Teklad Global 18% Rodent Diet) and water were provided ad

libitum. The mice were bred and maintained in a pathogen-free exclusion barrier facility and

animal procedures were in accordance with the Canadian Guide for the Care and Use of

Laboratory Animals and approved by the Animal Care Committee at the Samuel Lunenfeld

Research Institute.

42

Genotyping. Genomic DNA was extracted from tail clippings of 3 week old mice. The tails

were digested in tail lysis buffer and proteinase K (50mM Tris-HCl, pH 8.0, 50mM EDTA, pH

8.0, 0.5% SDS, and 0.25mg/ml proteinase K) in a 55°C oven overnight. Afterwards, 75μl of 8M

potassium acetate and 0.5mL of chloroform were added; the mixture was chilled at 4°C for 30

minutes to precipitate proteins and dissolve DNA in the aqueous phase due to the high salt

concentration, and DNA extracted. The DNA containing solution was added to 100% ethanol to

precipitate the DNA and centrifuged to pellet the sample, followed by ethanol washes of

decreasing concentration. The remaining sample was dried and suspended in TE buffer (10 mM

Tris, with 1 mM EDTA, pH 8) overnight. The presence of the three transgenes was confirmed

using PCR oligonucleotides primers. Presence of the floxed VEGF gene was detected by PCR

using the oligonucleotide primers muVEGF 419.F (5′-CCTGGCCCTCAAGTACACCTT-3′)

and muVEGF 567.R (5′-CCGTACGACGCATTTCTAG-3′) that creates a 148-bp DNA

fragment with the presence of VEGF with the loxP-1 site, or a 40 bp shorter fragment if wild-

type VEGF allele is present. TetO-Cre was confirmed with primers CreF (5’-

GTGCAAGTTGAATAACCGGAAATGG-3’) and CreR (5’-

AGATCATCCTTAGCGCCGTAAATCAAT-3’) that makes a 300 bp fragment. Podocin-rtTA

primers were Podoprobe-F (5’- CGCACTTCAGTTACTTCAGGTCCTC -3’ and Podoprobe-B

(5’-GCTTATGCCTGATGTTGATGATGC-3’) generates a 455 bp fragment in the presences of

podocin-rtTA [156].

For all the PCR programs, before cycling the samples were heated to 94°C for 1 minute

to improve the denaturation of the first step of the cycle; furthermore, after the end of the

cycling a final extension step at 72°C for 7 minutes was used to finish the elongation of the PCR

products of the last cycle. For the Cre and rtTA primer the following program was cycled 34

times: 94°C denaturation for 45 s, 51°C annealing for 45 s, and 72°C extension for 60 s.

43

The annealing temperatures for the programs were determined to by the primer with

lowest estimated melting point (the temperature where half the DNA strands are single stranded

and half are double-stranded, which is higher with more guanine and cytosine bases). But both

VEGF primers had a lower estimated melting point and larger difference in melting points than

the primers for Cre and rtTA; therefore, the annealing temperature and program cycle number

was increased to compensate for the poorer reaction efficiency resulting in the following VEGF

program that cycled 39 times: 95°C denaturation for 30 s, 58°C annealing for 60 s, and 72°C

extension for 120 s.

Experimental protocol. Diabetes was induced in mice at 2.5 weeks of age by daily

intraperitoneal injections of streptozotocin (50mg/kg in fresh 0.1mol/L citrate buffer, pH 4.5)

for 5 consecutive days, according to the Low-Dose Streptozotocin Induction Protocol (mouse)

from the National Institute of Diabetes and Digestive and Kidney Disease (NIDDK) for Animal

Models of Diabetic Complications Consortium (AMDCC) (available from

http://www.amdcc.org); diabetes was confirmed, defined by positive for urinary glucose on

dipstick or random blood glucose greater than 15mmol/L. At approximately 3.5 weeks of age

the VEGF gene was deleted in a time-specific manner from only the podocyte cells of the

kidney by the administration of 2mg/mL of dox to the drinking water for one week. In each

litter, mice were randomly separated into four groups: mice induced with STZ and dox

(DM+VEGFKO); only given STZ and not dox (DM); given sham buffer injection and induced

with dox (VEGFKO); or only given sham buffer injections (WT). Throughout the course of the

experiment the mice were weighed, urine collected, and blood glucose monitored with a

Contour Blood Glucose Monitoring System (Bayer, Toronto, ON, Canada) on a weekly basis.

At the end of the experiment glycated hemoglobin level was measured from a 5 μL sample of

tail vein blood using the Bayer DCA 2000+ Analyzer. The early group of mice was dissected at

44

3-4 weeks after STZ injection to confirm start of disease progression and confirm excision of

VEGF. The late group of mice was sacrificed at 7-8 weeks after STZ, or earlier if demise was

imminent and the kidneys were harvested in all mice to assess injury.

Urinalysis. Spot urine was collected and examined for the presence or absence of glucose and

albumin using a urine dipstick (Chemstrip 5L; Roche Diagnostics Corp., Indianapolis, Indiana,

USA). Urinary protein concentration was measured using the Bio-Rad Protein Assay Dye

Reagent Concentrate (Catalog # 500-0006, Bio-Rad Laboratories, Hercules, CA, USA)

according to the manufacturer’s instructions, based on the Bradford method[157]. The Bio-Rad

dye changes colour in response to increasing protein concentrations in concordance with the

absorbance maximum for an acidic solution of Coomassie Brilliant Blue dye that shifts from

465nm to 595nm when binding to protein. The urine was diluted 1:10 and 200μL of dye (diluted

1:5 in PBS) was added to every 10μL of diluted urine and to the BSA standard curve wells.

Protein concentrations were normalized using the urine creatinine levels as measured by the

Jaffe method [158]. Therefore, twenty-five micro-litres of diluted urine and creatinine standards

were added with 50μL of reagent comprised of one part 37mM picric acid and one part 0.3M

sodium hydroxide that binds to creatinine yielding a bright orange at 492nm. The assays were

measured with a standard colorimeter, according to manufacturer’s instructions (μQuant, Bio-

Tek Instruments Inc., Vermont USA). These absorption values were used to determine the

protein to creatinine ratio in mg/mg.

Fixation for histology and electron microscopy. Tissue for histological analysis was fixed in

10% formalin/PBS, then embedded in paraffin, and sectioned 4μm thick. These sections were

subsequently stained with periodic acid-Schiff (PAS) and photographed with a DC200 Leica

camera and Leica DMLB microscope (Leica Microsystems Inc., Deerfield, IL). Kidney tissue

45

for electron microscopy was fixed in 2% glutaraldehyde in 0.1M sodium cacodylate buffer pH

7.3 and embedded in Quetol-Spurr resin (Canemco Inc., Saint Laurent, Quebec Canada), and

sectioned.

Glomerular morphology. Glomerular sclerosis was scored by a renal pathologist in a blinded

manner using approximately 30 glomerular cross-sections of each mouse. The following rubric

was used: 0, normal glomerulus; +1, mesangial matrix expansion of the glomerulus; +2, severe

mesangial matrix expansion; +3, severe mesangial matrix expansion and/or segmental

glomerulosclerosis; +4, global glomerulosclerosis (>50% of the glomerulus) [89, 159]. The

mean score per glomerulus in each kidney was determined then averaged for each treatment

group. In addition, slides were scanned with a Pannoramic scanner (3Dhistech, Budapest,

Hungary) and glomerular area was measured with the Pannoramic viewer software for all

glomeruli that were scored [160].

Apoptosis detection by cleaved caspase-3. Paraffin blocks were sectioned 5μm thick and fixed

on to glass slides, which were subsequently deparaffinized and rehydrated with PBS. Antigen

retrieval of slides was done by boiling slides in a 0.01mol/l citrate buffer at pH 6.0 for 20

minutes and then incubated overnight with the primary antibody and then incubated with

biotinylated swine anti-rabbit IgG antibody (Dako), diluted 1:100. Sections were then treated

with peroxidase-labeled streptavidin-biotin-peroxidase complex (Dako) and developed with

hydrogen peroxide and 3,3-diamebenzidinetetrahydrochloride and counterstained with

haematoxylin, as explained elsewhere [161]. Negative controls lacked primary antibodies. The

extent of apoptosis in a sample was determined by calculating the number of cleaved caspase-3

positive cells per 50 glomeruli (three fields per section were measured at a magnification of

400x).

46

Isolation of glomeruli. Mice were anesthetized by an intraperitoneal injection of Avertin (2,2,2-

tribromoethyl and tertiary amyl alcohol; 17µl/g mouse weight). After mouse lost consciousness

the abdominal cavity was opened to visualize the kidney during the perfusion procedure. The

apex of the heart was punctured with a 25G needle (Becton Dickinson and Co., Franklin Lakes,

NJ, USA) and the pulmonary artery was cut. Ice-cold PBS was perfused through the heart until

the mouse kidney turned pale, which was followed by the perfusion of cold PBS with 1.25%

Fe2O3(Sigma-Aldrich Inc., St. Louis, MO, USA) until kidneys turned grey-black in color. After

harvesting each kidney, they were washed in PBS and pressed sequentially through a 106-μm

and 71-μm mesh steel screen (Endecotts Ltd., London, England) and collected in individual

eppendorf tubes. Iron-perfused glomeruli were gathered with a magnetic particle concentrator

and supernatant discarded. The remaining tissue was digested in 1mg/ml of collagenase A for 30

minutes at 37°C, with gentle agitation. All glomeruli were isolated by the magnetic particle

concentrator and washed three times with PBS.

Glomerular mRNA expression via quantitative real-time PCR. RNA was extracted from

mouse glomeruli with TRIzol reagent (Invitrogen) and reverse transcribed into cDNA using

iScript cDNA Synthesis Kit according to the manufacturer’s instructions (Bio-Rad Laboratories,

Inc). The cDNA samples were amplified in qPCR MasterMix Plus machine (7900HT Sequence

Detection Systems, Applied Biosystems) for SYBR Green I (BioRad) and analyzed. The

comparative CT method was used to measure the relative expression of the target gene [162].

The ΔCT value was calculated by determining the difference of the HPRT CT value of each

sample from the respective CT of the gene of interest; sample mRNA was assayed in duplicates.

Fold-changes in gene expression of the target gene were equivalent to 2 -ΔΔCT. The oligo primers

used for mRNA amplification for VEGF was 5’-CAGGCTGCTGTAACGATGAA-3’ for the

sense and 5’-CTATGTGCTGGCTTTGGTGA-3’ for the antisense; VEGF expression was

47

normalized by comparison to the expression of the 138bp region of the housekeeping gene

HPRT: 5’-GGCTATAAGTTCTTTGCTGACCTG-3’ for the sense and 5’-

AACTTTTATGTCCCCCGTTGA-3’for the antisense.

In situ hybridization. Dissected kidneys from mice were washed in RNAse-free PBS before

submersing them overnight in 4% paraformaldehyde/PBS treated with diethyl pyrocarbinate

(DEPC). The tissue was placed in 30% sucrose for 24 hours and subsequently embedded in

Tissue-Tek O.C.T. 4583 (Sakura Finetek USA Inc., Torrance CA, USA) and snap frozen. The

frozen tissue was subsequently sectioned in 10μm thick samples using a Leica Jung cryostat

(Leica Microsystems Inc.) and transferred to Superfrost microscope slides (Fisher Scientific

Labs, Pittsburgh, PA, USA) and stored at -20°C. Digoxigenin-labeled probes were prepared for

kidney tissue staining. The podocyte-specific Wilms tumor suppressor (WT1) and nephrin

(NPSH1) probes were used for in situ to identify glomerular podocytes and the VEGF-A probe

was used to detect expression of all isoforms of VEGF. Sections were air dried for 2 hours at

room temperature and then treated with 15ng/ml of proteinase K with depc-treated PBS at 37°C

for 5 minutes. Thereafter, the slides were washed in depc-treated PBS, fixed in 4% PFA at room

temperature for 7 minutes, washed in depc-treated PBS again and finally washed in 2x SSC (pH

7) at room temperature.

Slides were then prehybridized in mailer solution for 1 hour at 60°C using hybridization

buffer (2.5ml of 20x SSC, 5ml of formamide, 250μl of 20% CHAPS, 100μl of 10% Triton X-

100, 50μl of 10mg/ml yeast RNA, 25μl of 20 mg/ml Heparin, 100μl of 0.5 EDTA, 0.2g blocking

powder, and 1.2ml depc H2O). Then the sections were hybridized with the appropriate probe

(1ng/ml) diluted in hybridization buffer at 60°’C overnight. After which, slides were washed in

0.2XSSC followed by a wash in formamide/0.2x SSC. The tissue was then blocked with

48

blocking solution from Roche according to the protocol and then incubated with anti-DIG

antibody for 2 hours. The antibody solution was then washed off and the substrate was added.

Slides were washed again and then counterstained with Fast Red, dehydrated and mounted.

Immunofluorescence. Paraffin fixed sections were deparaffinized and rehydrated with PBS.

Antigen retrieval was performed by boiling slides in DAKO Retrieval solution and heated by a

microwave oven twice. PFA fixed sections were not heated but washed in acetone twice, but

then subsequently treated the same as paraffin fixed sections throughout the remainder of the

procedure.

To prevent non-specific binding the slides were incubated with blocking solution (0.3%

Triton X, 1mM MgCl2, 1mM CaCl2 in PBS solution) for one hour at room temperature. The

samples, both the paraffin and snap frozen, were incubated with the rabbit polyclonal podocin

primary antibody at a dilution of 1:500 overnight at 4°C in a sealed chamber. The snap frozen

samples were also incubated with rat anti-mouse CD31 (PECAM-1) monoclonal antibody (BD

bioscience) diluted 1:500, but not the paraffin samples. The podocin antibody was used to

identify podocyte cells in the glomerulus and the PECAM antibody identified endothelial cells.

The next day the slides were washed with PBS three times and the fluorescent secondary

anti-body was added. For the snap frozen samples, the green Alexa Fluor 488 goat-anti-rabbit

antibody (Invitrogen) was used to bind to the podocin primary antibody, and the red Cy3 goat

anti-rat antibody was used to bind to the PECAM primary antibody; for both a dilution of 1:500

was used. For the paraffin samples, instead of using PECAM antibody to detect endothelial cells

a tomato lectin was used since previous studies have indicated that this lectin specifically binds

to capillaries [163]. DyLight 594 conjugated labelled tomato lectin (Vector Labs) that fluoresces

red was used during the secondary antibody step at a dilution of 1:100. The sections were then

49

incubated for 1 hour at room temperature in the dark, washed with PBS 4 times 5 minutes each

and mounted with Vectashield Mounting Medium with 4',6-diamidino-2-phenylindole (DAPI)

(Vector Labs).

The tomato lectin stained samples were photographed by an immunofluorescence

microscope (BX61 Upright Fluorescence Microscope, Olympus). The frozen PFA sections with

the podocin and PECAM antibodies were imaged using a spinning disk confocal microscope

(Axiovert 200M, Carl Zeiss, Goettingen, Germany).

Statistical Analysis. Results are expressed as means ± SEM, unless otherwise stated. Group

comparisons were done by one-way ANOVA followed by post hoc Tukey’s multiple

comparison tests using GraphPad Prism software (San Diego, CA, USA). A P value of less than

0.05 was considered to be statistically significant.

50

4 Results

Model of VEGF reduction in glomeruli of diabetic mice. VEGF secretion has been shown to

be altered in the kidneys of diabetic patients and rodents. In both, the podocyte is the major

source of VEGF in the kidney. To test our hypothesis that VEGF is needed for the protection of

the glomerular filtration barrier in diabetic mice, we used an inducible podocyte-specific VEGF

knock-out mouse (Fig. 4-1A). Each litter was randomly divided into four groups; two of the

four groups were made diabetic with STZ or given sham injections with citrate; podocyte-

selective deletion of the VEGF gene was accomplished through induction of Cre recombinase

using dox for one week. The four groups were designated as WT (wildtype), DM (diabetes),

VEGFKO (VEGF KO), DM+VEGFKO (VEGF KO and diabetes). Both male and female mice

were pooled since there was no difference in the severity of diabetes or resulting glomerular

injury (Fig. 4-1B). Long-term glucose control was not different in DM or DM+VEGFKO mice,

as the glycosylated hemoglobin levels of HbA1c were similar (Fig. 4-1D). One week after STZ

injection, mice were induced with dox at 1 week of age to knockout VEGF from podocytes. A

total of 106 mice were studied (Table 4-I). After 7-8 weeks of treatment, both groups of STZ

injected mice weighed less than the non-diabetic mice (p<0.01, Table 1). STZ injected mice

become hyperglycemic (blood glucose > 15mmol/L) within 2 weeks from the start of first

injection (Fig. 4-1C); there was no significant difference in blood glucose or weight between

DM and DM+VEGFKO mice.

STZ-diabetes may cause an increase in glomerular mRNA expression of VEGF. To

determine the level of VEGF in glomeruli of STZ induced diabetic and non-diabetic mice in a

quantitative fashion, glomerular RNA was isolated and realtime PCR performed. VEGF levels

were decreased in VEGF KO mice as early as 1 week after the completion of dox induction with

a non-significant increase in VEGF expression in DM mice (Fig. 4-6A).

51

DM+VEGFKO mice develop marked proteinuria. The first clinical sign of diabetic

nephropathy is increased permeability to albumin and proteins across the glomerular filtration

barrier. Accordingly, we measured protein:creatinine ratios in diabetic and non-diabetic mice at

weekly intervals. We found that the mice in the DM+VEGKO group began to show increased

protein-to-creatinine ratios that compared to other groups beginning at 3 weeks from start of

STZ injections; this ratio remained significantly higher in the DM+VEGFKO group until

sacrifice (Fig. 4-2A). Immediately preceding sacrifice the DM+VEGFKO mice had an

approximately five-fold higher average amount of proteinuria than the other groups (Fig. 4-2B,

ANOVA P=0.0011). It is important to note that the background strain of mice is mixed in these

studies, which may contribute to variability within groups – as the degree of proteinuria varies

among strains following STZ-induced diabetes[109].

DM+VEGFKO exhibit increased mortality. During the course of the experiment a significant

proportion of mice in the DM+VEGFKO group become wasted and hunched. These mice either

died early or had to be euthanized before the surrogate endpoint (defined as 7-8 weeks after day

0 of STZ injection). The survival of mice in each group was plotted using a Kaplan-Meier curve

with 95% confidence intervals and the survival curves were found to be significantly different

(Fig. 4-3, Logrank test with P=0.0364).

DM+VEGFKO mice exhibit aggressive glomerular injury. At the surrogate endpoints (10

weeks following STZ injection) mice were sacrificed and the kidneys were examined for

structural change and features of diabetic nephropathy. The DM kidneys had mild mesangial

matrix expansion and hypertrophy of the tubules. DM+VEGFKO mice had dramatic kidney

injury with enlarged tubules, containing protein deposits, significant glomerular matrix

expansion, and sclerosis (Fig. 4-4). The sections were scored in a blinded manner for glomerular

52

injury and glomerular hypertrophy and showed that DM mice had increased glomerular injury

compared to WT mice (P<0.5) but only DM+VEGFKO mice had significant mesangial matrix

expansion (P<0.05) and severe glomerular sclerosis compared to the WT control, DM only, or

VEGFKO alone (P<0.01, Fig. 4-5).

Molecular Characterization of Glomeruli. Kidney tissue from mice sacrificed at both early

(3-4 weeks) and late (7-8 weeks) time points were assessed by in situ hybridization to detect the

degree of VEGF excision and determine level of expression of molecular markers specific for

differentiated podocytes (Fig. 4-6). VEGF expression was reduced in both VEGFKO and

VEGFKO+DM mice, while there was and no change in intensity of VEGF staining in the

glomeruli from DM mice which is consistent with the realtime PCR data (Fig. 4-7). There was

no change in expression of podocyte specific markers Wilms tumor 1 (WT1) or Nephrin

(NPHS1). In sclerotic glomeruli from VEGFKO+DM mice, a reduction in the number of WT1

and nephrin positive cells was not observed in glomeruli and this is different from the podocyte

‘drop out’ that has been reported by others in DN [13] (Fig. 4-6).

Increased apoptosis is a feature commonly observed in glomeruli from rodent models

and patients with diabetes. We stained kidney sections from DM and DM+VEGFKO groups

with cleaved caspase-3 and quantified the number of apoptotic cells. There was a significant

increase in the number of cleaved caspase-3 positive cells within the glomeruli of DM+VEGF

KO mice compared with the WT group (Fig. 4-8). This increase in apoptosis also correlates

with dramatic endothelial cell loss in glomeruli of mice in the DM+VEGF KO group as shown

by the decreased endothelial cell staining and the simplification of the glomeruluar capillary

loop structure (Fig. 4-9, Fig. 4-10).

53

Table 4-1. Summary of mice involved in experiment.

54

Figure 4-1. The transgenic mouse system and experimental protocol.

(A) The tetO-Cre x Podocin-rtTA x VEGF floxed/floxed mouse used allows for a time-specific

and cell-specific knockout of VEGF in podocytes. (B) The mice were separated into four

groups: WT were not injected with STZ or induced with dox for one week; DM were only

injected with STZ at week 0; VEGFKO were induced with dox at week 1; and, DM+VEGFKO

that were injected with STZ at week 0 and induced with dox at week 1. (C) Random Blood

glucose through course of experiment was significantly higher in both diabetic groups. There

was no difference between the diabetic groups (n=14-25). (D) HbA1c measurements at time of

dissection confirmed consistent hyperglycemia (n=3-6). *P<0.05, **P< 0.01.

55

Figure 4-2. Observed proteinuria in DM+VEGFKO mice.

(A) Proteinuria began at approximately 3 weeks from start of STZ injections and worsened until

sacrifice for the DM+VEGFKO mice. Weeks 2-3 (n=3-11) and weeks 4-8 (n=23). (B)

Protein/creatinine ratio of late mice at time of dissection indicates a significant increase in

proteinuria in DM+VEGFKO mice, as compared to controls. *P<0.05, **P< 0.01.

56

Figure 4-3. DM+VEGFKO and DM mice more likely to die early.

There is a significant decrease in survival of both the DM+VEGFKO and DM mice. Only “wt

vs DM+VEGFKO” and “VEGFKO vs DM+VEGFKO” comparisons are significantly different

from wt, P values are 0.0272 and 0.0374, respectively. Logrank value was 0.0364.

*

57

Figure 4-4. DM+VEGFKO mice in the STZ-Dox group had severe glomerular injury and

significant glomerular expansion.

(A) Some diabetic mice had kidneys with mesangial expansion and open capillary loops and

some VEGFKO mice had obliterated capillaries, but most did not have kidney injury. (B)

DM+VEGFKO mice had the most significant number of severely injured glomeruli, enlarged

tubules, and protein deposit. DM+VEGFKO mice had severely injured glomeruli and protein in

the tubules.

58

Figure 4-5. Only DM+VEGFKO mice in the STZ-Dox group had severe glomerular

injury, according to histological scoring.

(A, C) A blinded measurement of kidney glomerular area indicated that only the DB+VEGFKO

mice in the late time point had any significant expansion. (B, D) DB+VEGFKO mice had the

most significant number of severely injured glomeruli determined by modified semi-quantitative

scoring of glomerular injury compared to the other groups at both early and late time points.

*P<0.05, **P<0.01, ***P<0.001. Early: WT (n=2), DM (n=3), VEGFKO(n=4), DM+VEGFKO

(n=3). Late: WT (n=14), DM (n=14), VEGFKO (n= 10), DM+VEGFKO (n=20).

59

Figure 4-6. In situ mRNA expression of WT1, Nephrin, and VEGF in the kidney at early

and late time points.

WT1 and nephrin expression was determined to be consistent in all groups and VEGF

expression is reduced in the VEGFKO and DM+VEGFKO groups.

60

Figure 4-7. Glomerular VEGF mRNA increased only in DM mice compared to control

groups, while the groups with VEGFKO had reduced VEGF expression, as assessed by

real-time PCR analysis at the early time point.

Glomerular mRNA expression measured fold change as compared to WT mice. VEGF

expression decreased both in DM and DM+VEGFKO confirming VEGF excision. All mRNA

expression analysis was compared against the house-keeping gene, HPRT and fold change

compared to WT.

61

Figure 4-8. The DM+VEGFKO mice glomerular cells underwent apoptosis.

(A) PAS stain shows a glomerulus stained with antibody for cleaved caspase-3 with arrow

pointing to a single positive cell. (B) The comparison of average positive cleaved capase-3 cells

per 50 glomeruli shows that DM+VEGFKO mice were most affected (C) The scatter plot shows

the same data as the previous plot but indicates the variability of the DM+VEGFKO mice,

individual data points and median values indicated (n=7-12). ANOVA P-value = 0.0407 and

Dunnet test shows there is a difference between WT and DM+VEGFKO. *P-value <0.05.

A

*

62

Figure 4-9. Simplification of tomato lectin stained capillaries in DM+VEGFKO glomeruli.

The first row indicates fluorescence for podocin (green), tomato lectin (red), and DAPI (blue)

that identifies podocytes, endothelial cells, and nuclei, respectively. The second row shows only

the red channel to indicate the tomato lectin stained endothelial cells.

63

4-10. Confocal microscopy indicates a loss of PECAM staining endothelial cells in

DM+VEGFKO glomeruli.

First row indicates fluorescence for podocin (green) and PECAM (red) that identifies podocytes

and endothelial cells. The second row indicates PECAM stained endothelial cells. The PECAM

indicates.

64

5 Discussion

Diabetic nephropathy is the leading cause of end-stage kidney failure in North America

and is increasing at alarming rates throughout the Western and developing worlds. The

pathogenesis of DN is complex with genetic, environmental and metabolic components [71, 72,

95, 164-167] . While 30% to 40% of patients with Type 1 diabetes will develop DN after 20

years of disease, the other 60% to 70% do not, despite similar levels of hyperglycemia[168].

These data suggest endogenous protective factors exert major modifying effects in this disease.

In contrast to the many studies devoted to disturbances and pathways initiated by poor glycemic

control, less work has been devoted to understanding the role of endogenous factors that may

protect tissues in diabetes. As these factors may represent new therapeutic targets and

biomarkers, they are critical pieces of the puzzle.

Here we explored the role of one such factor –VEGF– in the development and

progression of diabetic nephropathy. VEGF has received much attention in the complications of

diabetes as both circulating and local tissue levels of VEGF are increased [96, 97]. VEGF is a

potent angiogenic factor that signals through its tyrosine kinase receptor, VEGFR-2, to promote

new vessel sprouting, endothelial migration, proliferation, differentiation and survival [37].

Neo-angiogenesis resulting in the formation of leaky, immature blood vessels is a common

feature of both DR and also DN, suggesting that the elevated VEGF levels are pathogenic [98,

169]. These findings led numerous agencies and investigators to consider VEGF as a logical

therapeutic target to treat the devastating complications of diabetes; indeed numerous studies are

ongoing to explore the effect of VEGF inhibition in diabetic complications, with DR trials

already underway in patients[170].

65

The clinical significance of neoangioenesis in diabetes was first recognized in the retina

where it results in vitreal hemorrhage and fibrosis[171]. While vascular proliferation is clearly

problematic for the diabetic eye, it has also been observed in the kidney[172]. Renal biopsies

taken in the first decade of diabetes clearly show abnormal blood vessels with increased

diameters, increased vessel length and proliferating new blood vessels at the vascular pole and

in Bowman’s capsule that surrounds the urinary space[88]. This is associated with changes in

vascular permeability that results in micro- followed by macro-albuminuria. Full-blown DN

develops over years and is characterized by nodular glomerulosclerosis, thickening of the GBM,

Kimmelstiel-Wilson nodules, and fibrin cap lesions [3, 88]. During the early angiogenic phase

of diabetic nephropathy, VEGF levels are elevated in renal podocytes similar to the increased

VEGF levels found in cells of the retina. The similarity in pathologic findings and

microvascular structure, elevated local tissue VEGF levels and the fact that almost all patients

with Type 1 diabetes and DN, also have diabetic retinopathy (DR), strongly argues for a

common pathway[173].

Given the accessibility of the retinal vasculature to local therapies, attempts to normalize

the vasculature in patients include the injection of VEGF inhibitors directly into the eye [174].

Although early results are promising and proliferation is reduced with short-term improvements

in visual acuity, long-term effects of VEGF inhibition on the retinal vasculature and vision are

not known[175]. In fact, a recent study has highlighted the possible toxicity of VEGF inhibitors

in the eyes due to a dose dependent decrease in ganglion cells and an increase in apoptosis that

occurs before any change in the vasculature become apparent by light microscopy [176]. Thus,

despite the logic, it does not necessarily follow that increased VEGF expression in the

glomerulus is detrimental and the elimination of VEGF will be beneficial. In fact, the elevated

VEGF levels may represent the tissue mediated regulation to normalize endothelial injury that

66

occurs early in the course of diabetes in an attempt to restore function. Here we provide

evidence that in fact the latter model is correct.

In the kidney, results of VEGF inhibition in experimental animal models of diabetes

have provided conflicting results with some papers showing slowed progression and others

showing no improvement [47, 103, 106, 107] or more aggressive disease [177]. A major

difficulty in the interpretation of these studies is that it is impossible to know the degree,

specificity and location of VEGF knockdown. In these studies a number of different agents

were administered systemically – everything from small molecule inhibitors to the VEGF

receptors (TKIs/tyrosine kinase inhibitors), to VEGF or VEGFR antibodies to competing VEGF

aptamers have been tried. More recently, it has become apparent that VEGF inhibition in

patients has a significant renal toxicity in non-diabetic patients, raising additional safety

concerns [41, 178, 179].

Here we took a genetic approach to extinguish VEGF production in a cell and time-

specific manner in diabetic mice. The inducible Cre-loxP system permits precision in timing

and location of VEGF inhibition allowing us to determine the role of glomerular VEGF in

progression of DN in a mouse model. While deletion of VEGF post-natally results in

glomerular injury in non-diabetic mice by 3 months of age, there are no obvious glomerular

defects in non-diabetic VEGFKO mice within the first 8 weeks following excision.

In a previous study we showed that VEGFKO in a healthy glomerulus is bad [41];

however, here we show that VEGFKO in a diabetic glomerulus is disastrous! Why is this the

case? VEGF produced by podocytes is required to signal in a paracrine fashion to adjacent

glomerular endothelial cells to maintain a healthy fenestrated glomerular vasculature via

VEGFR2 activation and subsequent intracellular signalling. Loss of VEGF or VEGFR2 results

67

in endothelial swelling followed by endothelial cell loss and thrombotic microangiopathy [41,

180-182].

In the STZ model of Type I diabetes in mice, glomerular injury is relatively mild and not

apparent until late in the course, usually after 20 weeks of hyperglycemia [116, 183]. By

contrast, loss of glomerular VEGF in this diabetic model, results in aggressive glomerular

injury, scarring, apoptosis and a significant increase in mortality by 8 weeks after STZ induction

with end-stage kidney failure occurring in some mice 5 weeks after induction. Apoptosis was

quantified with a cleaved caspase-3 antibody and was significantly higher in diabetic mice that

lack VEGF than in any of the other groups (diabetes or VEGF KO alone). It was not possible to

determine the cell compartment that underwent enhanced apoptosis, and instead we posited that

endothelial cell loss is increased in the DM+VEGFKO mice. This is supported by the reduction

in PECAM and tomato lectin staining within the glomeruli of DM+VEGFKO mice.

In diabetes, dysregulation of VEGF does not occur in isolation but numerous angiogenic

pathways have been implicated. In particular, the levels of angiopoietin-2 produced by

glomerular endothelial cells increases in diabetic mice (Jeansson et al. JCI, in press) and

elevated circulating levels have been found in patients [184]. Ang-2 functions to antagonize the

endothelial tyrosine kinase receptor, Tie2; in the absence of VEGF, Ang-2 promotes vessel

regression and endothelial cell apoptosis [59]. Thus, it is important to consider the interaction

of different pathways, since inhibition of a single factor may not be sufficient to treat the

changes in the glomerular structure and function due to disease.

Our genetic model provides a robust knockdown of VEGF production in the podocyte; it

remains possible that a more moderate reduction in VEGF will not be harmful. However, given

the need for correct and tight regulation of the VEGF-VEGFR2 signalling pathway in the

68

healthy glomerulus, this will be a difficult goal to accomplish therapeutically. The incidence of

significant renal toxicity in patients receiving VEGF inhibitors for treatment of various solid

tumours underscores this point.

Our results clearly demonstrate that VEGF is required for glomerular health and this

requirement is more critical in the setting of hyperglycemia (diabetes). Taken together, our

study emphasizes the importance of endogenous factors to protect the diabetic vasculature,

while normalization of glucose levels and metabolic disturbances is important, additional

insights and leverage in treatment can be gained from understanding the role of endogenous

factors.

69

6 Conclusion

In summary, we have demonstrated that reduction of locally produced podocyte VEGF

increases albuminuria, glomerular injury, intrinsic glomerular cell apoptosis, and reduces

survival, in the setting of diabetes. We posit that a reduction of local glomerular VEGF during

diabetes causes endothelial injury and accelerates the progression of diabetic nephropathy.

These results suggest endogenous VEGF is tightly regulated in vivo and VEGF inhibitor therapy

for diabetic patients may be associated with a greater risk of renal toxicity, increased proteinuria

and glomerular cell apoptosis.

Our investigation demonstrates that VEGF is required for glomerular health; moreover

in diabetes VEGF expression is critical. Thus, in addition to normalizing blood glucose

concentration and minimizing metabolic disturbances, endogenous factors can play important

roles in diabetic complications and might lead to future treatments.

70

7 Future directions

Further studies can be used to confirm the mechanism of VEGF in diabetic glomeruli.

To confirm that diabetic injury is due to VEGF knockout and not due to Cre or dox toxicity,

exogenous VEGF could be administrated to the kidneys of VEGFKO mice to alter the

phenotype. This could be performed by injecting the soluble form of VEGF, VEGF-121, and

observing for improved outcome, as done previously [41]. Therefore, if the DM+VEGFKO

mice injected with soluble VEGF-121 had improved glomerular health as compared to the

DM+VEGFKO mice this would support the hypothesis that the reduction of VEGF in diabetes

promotes glomerular injury. Previous studies, however, suggest that circulating levels of VEGF

will not rescue local reduction [41].

Downstream VEGF signalling occurs through the tyrosine-kinase receptor VEGFR-2

found on the surface of the glomerular endothelial cells. The activation of this receptor results in

numerous downstream signalling pathways that may be involved in injury: Src, PI3K/AKT,

MAPK, and eNOS. Specifically, the eNOS pathway has been implicated in abnormal

angiogenesis in diabetic nephropathy since eNOS is under direct control of the survival factor

AKT that is downstream of both the insulin receptor and VEGFR-2[98]. But in diabetes an

upregulation of VEGF that coincides with a downregulation of nitric oxide, what is referred to

as an uncoupling of VEGF with NO [98]. To test the hypothesis that downstream NO expression

causes injury, the DM+VEGFKO could be contained in an inhaled nitric oxide apparatus that

would increase atmospheric NO, which has been shown in humans to increase urine filtration

through the mechanism is uncertain [185]. A rescue would support the hypothesis that NO is

involved in injury. Unfortunately, since NO is systemically administered any effects could be

due to the hemodynamic effects of NO in the systemic circulation.

71

The role of Ang-2 could be studied by breeding the inducible podocyte specific

VEGFKO mice with podocyte-specific Ang-2 overexpressers or Ang-2 knockout mice to

demonstrate if Ang-2 upregulation in the face of VEGFKO due to diabetes is the cause of

endothelial dysfunction.

72

Appendix

Retinopathy study

Age-related macular degeneration and diabetic retinopathy are diseases that are the

leading causes of blindness in seniors[174]. The region that is affected is the retinal pigment

epithelium (RPE), which is located on the underside of the retina close to the choroid plexus. In

both diseases neovascularisation occurs at the retina that results in highly permeable blood

vessels that have a tendency to leak and rupture and bleed into the retina and this eventually

leads to scarring and declining vision[186, 187]. The neovascularisation and vessel

permeability of the retina is thought to be caused by an upregulation of VEGF that is normally

produced by RPE cells that causes increased injury[188]. In mice, the overexpression of VEGF

results in neovascularisation surrounding the retina.

73

The current treatment is the administration of injections of ant-VEGF drugs such as

Bevacizumab (off-label) or the FDA approved treatment of Ranibizumab, both of which are

humanized antibody fragments that inhibit VEGF and need to be injected into the eye on a

monthly basis to prevent progression of disease[189].

Materials and Method

Diabetic nephropathy in humans is commonly associated with retinopathy; since both

diseases are due to microvascular complications; VEGF is believed to be involved in both [95,

190]. No new mice lines were created for studying the effect of VEGF knockout in the retina

since the existing mouse system contains floxed VEGF in all its cells. Thus, to generate the

74

appropriate experimental system the mice were injected subretinally with an adeno-associated

virus (AAV) Cre recombinase. Thus, the adenovirus’ Cre excised VEGF’s exon 3 without the

requirement of dox.

The mice were sacrificed at 3-4 weeks after injection of the virus and

immunohistochemistry using ant-GFP antibody was used to determine Cre mediated excision.

This was successful and AAV-Cre (AAV serotypes 2 and 2/6 were used) was be injected into

the eyes of mice with floxed VEGF. The mice were observed for 2-4 weeks and sacrificed and

the retina and choroid plexus was stained with PECAM.

We are currently determining the optimal method to quantitate PECAM staining of the

flat mounted retina to observe for abnormal angiogenesis caused by VEGFKO.

The effectiveness of the AAV-Cre using

subretinal injections of AAV-Cre in one

eye of a Z/EG reporter mice. The arrows

indicate the successful transformation of

RPE cells 3 days after injection.

75

References

1. Silverthorn, D.U., The Kidneys, in Human physiology : an integrated approach, D.U. Silverthorn, Editor 2007, Pearson/Benjamin Cummings: San Francisco. p. 613-640.

2. Ross, M.H., G.I. Kaye, and P. W., Urinary system, in Histology : A text and atlas with cell and molecular biology, K. Scogna, Editor 2006, Lippincott Wiliams & Wilkins.: Baltimore, MD. p. 602-640.

3. Najafian, B. and M. Mauer, Progression of diabetic nephropathy in type 1 diabetic patients. Diabetes Res Clin Pract, 2009. 83(1): p. 1-8.

4. !!! INVALID CITATION !!!

5. Haraldsson, B. and J. Sorensson, Why do we not all have proteinuria? An update of our current understanding of the glomerular barrier. News Physiol Sci, 2004. 19: p. 7-10.

6. Jeansson, M. and B. Haraldsson, Morphological and functional evidence for an important role of the endothelial cell glycocalyx in the glomerular barrier. Am J Physiol Renal Physiol, 2006. 290(1): p. F111-6.

7. Singh, A., et al., Glomerular endothelial glycocalyx constitutes a barrier to protein permeability. J Am Soc Nephrol, 2007. 18(11): p. 2885-93.

8. Jefferson, J.A., S.J. Shankland, and R.H. Pichler, Proteinuria in diabetic kidney disease: a mechanistic viewpoint. Kidney Int, 2008. 74(1): p. 22-36.

9. Jarad, G., et al., Proteinuria precedes podocyte abnormalities inLamb2-/- mice, implicating the glomerular basement membrane as an albumin barrier. J Clin Invest, 2006. 116(8): p. 2272-9.

10. Miner, J.H. and J.R. Sanes, Molecular and functional defects in kidneys of mice lacking collagen alpha 3(IV): implications for Alport syndrome. J Cell Biol, 1996. 135(5): p. 1403-13.

11. Hudson, B.G., et al., Alport's syndrome, Goodpasture's syndrome, and type IV collagen. N Engl J Med, 2003. 348(25): p. 2543-56.

12. Tryggvason, K., J. Patrakka, and J. Wartiovaara, Hereditary proteinuria syndromes and mechanisms of proteinuria. N Engl J Med, 2006. 354(13): p. 1387-401.

13. Baelde, H.J., et al., Reduction of VEGF-A and CTGF expression in diabetic nephropathy is associated with podocyte loss. Kidney Int, 2007. 71(7): p. 637-45.

14. Kreidberg, J.A. and J.M. Symons, Integrins in kidney development, function, and disease. Am J Physiol Renal Physiol, 2000. 279(2): p. F233-42.

15. Korhonen, M., et al., Distribution of beta 1 and beta 3 integrins in human fetal and adult kidney. Lab Invest, 1990. 62(5): p. 616-25.

76

16. Alberts, B., et al., Cell Junctions, Cell Adhesion, and the Extracellular Matrix, in Molecular biology of the cell2002, Garland Science: New York. p. 949-1010.

17. Kreidberg, J.A., et al., Alpha 3 beta 1 integrin has a crucial role in kidney and lung organogenesis. Development, 1996. 122(11): p. 3537-47.

18. Faul, C., et al., Actin up: regulation of podocyte structure and function by components of the actin cytoskeleton. Trends Cell Biol, 2007. 17(9): p. 428-37.

19. Kaplan, J.M., et al., Mutations in ACTN4, encoding alpha-actinin-4, cause familial focal segmental glomerulosclerosis. Nat Genet, 2000. 24(3): p. 251-6.

20. Kos, C.H., et al., Mice deficient in alpha-actinin-4 have severe glomerular disease. J Clin Invest, 2003. 111(11): p. 1683-90.

21. Kestila, M., et al., Positionally cloned gene for a novel glomerular protein--nephrin--is mutated in congenital nephrotic syndrome. Mol Cell, 1998. 1(4): p. 575-82.

22. Boute, N., et al., NPHS2, encoding the glomerular protein podocin, is mutated in autosomal recessive steroid-resistant nephrotic syndrome. Nat Genet, 2000. 24(4): p. 349-54.

23. Roselli, S., et al., Podocin localizes in the kidney to the slit diaphragm area. Am J Pathol, 2002. 160(1): p. 131-9.

24. Schwarz, K., et al., Podocin, a raft-associated component of the glomerular slit diaphragm, interacts with CD2AP and nephrin. J Clin Invest, 2001. 108(11): p. 1621-9.

25. Shih, N.Y., et al., Congenital nephrotic syndrome in mice lacking CD2-associated protein. Science, 1999. 286(5438): p. 312-5.

26. Rodewald, R. and M.J. Karnovsky, Porous substructure of the glomerular slit diaphragm in the rat and mouse. J Cell Biol, 1974. 60(2): p. 423-33.

27. Edwards, A., W.M. Deen, and B.S. Daniels, Hindered transport of macromolecules in isolated glomeruli. I. Diffusion across intact and cell-free capillaries. Biophys J, 1997. 72(1): p. 204-13.

28. Deen, W.M., M.J. Lazzara, and B.D. Myers, Structural determinants of glomerular permeability. Am J Physiol Renal Physiol, 2001. 281(4): p. F579-96.

29. Eremina, V., H.J. Baelde, and S.E. Quaggin, Role of the VEGF--a signaling pathway in the glomerulus: evidence for crosstalk between components of the glomerular filtration barrier. Nephron Physiol, 2007. 106(2): p. p32-7.

30. Birk, D.M., et al., Current insights on the biology and clinical aspects of VEGF regulation. Vasc Endovascular Surg, 2008. 42(6): p. 517-30.

31. Mac Gabhann, F. and A.S. Popel, Systems biology of vascular endothelial growth factors. Microcirculation, 2008. 15(8): p. 715-38.

77

32. Varey, A.H., et al., VEGF 165 b, an antiangiogenic VEGF-A isoform, binds and inhibits bevacizumab treatment in experimental colorectal carcinoma: balance of pro- and antiangiogenic VEGF-A isoforms has implications for therapy. Br J Cancer, 2008. 98(8): p. 1366-79.

33. Woolard, J., et al., Molecular diversity of VEGF-A as a regulator of its biological activity. Microcirculation, 2009. 16(7): p. 572-92.

34. Ferrara, N., H.P. Gerber, and J. LeCouter, The biology of VEGF and its receptors. Nat Med, 2003. 9(6): p. 669-76.

35. Ferrara, N., Vascular endothelial growth factor. Arterioscler Thromb Vasc Biol, 2009. 29(6): p. 789-91.

36. Mattot, V., et al., Loss of the VEGF(164) and VEGF(188) isoforms impairs postnatal glomerular angiogenesis and renal arteriogenesis in mice. J Am Soc Nephrol, 2002. 13(6): p. 1548-60.

37. Eremina, V., et al., Vascular endothelial growth factor a signaling in the podocyte-endothelial compartment is required for mesangial cell migration and survival. J Am Soc Nephrol, 2006. 17(3): p. 724-35.

38. Carmeliet, P., et al., Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele. Nature, 1996. 380(6573): p. 435-9.

39. Eremina, V., et al., Glomerular-specific alterations of VEGF-A expression lead to distinct congenital and acquired renal diseases. J Clin Invest, 2003. 111(5): p. 707-16.

40. Robert, B., X. Zhao, and D.R. Abrahamson, Coexpression of neuropilin-1, Flk1, and VEGF(164) in developing and mature mouse kidney glomeruli. Am J Physiol Renal Physiol, 2000. 279(2): p. F275-82.

41. Eremina, V., et al., VEGF inhibition and renal thrombotic microangiopathy. N Engl J Med, 2008. 358(11): p. 1129-36.

42. Fedele, A.O., M.L. Whitelaw, and D.J. Peet, Regulation of gene expression by the hypoxia-inducible factors. Mol Interv, 2002. 2(4): p. 229-43.

43. da Silva, R.G., et al., Endothelial alpha3beta1-integrin represses pathological angiogenesis and sustains endothelial-VEGF. Am J Pathol, 2010. 177(3): p. 1534-48.

44. Freeburg, P.B., et al., Podocyte expression of hypoxia-inducible factor (HIF)-1 and HIF-2 during glomerular development. J Am Soc Nephrol, 2003. 14(4): p. 927-38.

45. Lee, S., et al., Processing of VEGF-A by matrix metalloproteinases regulates bioavailability and vascular patterning in tumors. J Cell Biol, 2005. 169(4): p. 681-91.

46. Whittle, C., et al., Heterogeneous vascular endothelial growth factor (VEGF) isoform mRNA and receptor mRNA expression in human glomeruli, and the identification of

78

VEGF148 mRNA, a novel truncated splice variant. Clin Sci (Lond), 1999. 97(3): p. 303-12.

47. Ku, C.H., et al., Inducible overexpression of sFlt-1 in podocytes ameliorates glomerulopathy in diabetic mice. Diabetes, 2008. 57(10): p. 2824-33.

48. Bates, D.O., et al., VEGF165b, an inhibitory splice variant of vascular endothelial growth factor, is down-regulated in renal cell carcinoma. Cancer Res, 2002. 62(14): p. 4123-31.

49. Bevan, H.S., et al., The alternatively spliced anti-angiogenic family of VEGF isoforms VEGFxxxb in human kidney development. Nephron Physiol, 2008. 110(4): p. p57-67.

50. Nowak, D.G., et al., Expression of pro- and anti-angiogenic isoforms of VEGF is differentially regulated by splicing and growth factors. J Cell Sci, 2008. 121(Pt 20): p. 3487-95.

51. Hoshi, S., et al., High glucose induced VEGF expression via PKC and ERK in glomerular podocytes. Biochem Biophys Res Commun, 2002. 290(1): p. 177-84.

52. Kang, Y.S., et al., Angiotensin II stimulates the synthesis of vascular endothelial growth factor through the p38 mitogen activated protein kinase pathway in cultured mouse podocytes. J Mol Endocrinol, 2006. 36(2): p. 377-88.

53. Cohen, M.P., et al., Evidence linking glycated albumin to altered glomerular nephrin and VEGF expression, proteinuria, and diabetic nephropathy. Kidney Int, 2005. 68(4): p. 1554-61.

54. Kerbel, R.S., Tumor angiogenesis. N Engl J Med, 2008. 358(19): p. 2039-49.

55. Olsson, A.K., et al., VEGF receptor signalling - in control of vascular function. Nat Rev Mol Cell Biol, 2006. 7(5): p. 359-71.

56. Shibuya, M. and L. Claesson-Welsh, Signal transduction by VEGF receptors in regulation of angiogenesis and lymphangiogenesis. Exp Cell Res, 2006. 312(5): p. 549-60.

57. Satchell, S.C., K.L. Anderson, and P.W. Mathieson, Angiopoietin 1 and vascular endothelial growth factor modulate human glomerular endothelial cell barrier properties. J Am Soc Nephrol, 2004. 15(3): p. 566-74.

58. Satchell, S.C., et al., Human podocytes express angiopoietin 1, a potential regulator of glomerular vascular endothelial growth factor. J Am Soc Nephrol, 2002. 13(2): p. 544-50.

59. Augustin, H.G., et al., Control of vascular morphogenesis and homeostasis through the angiopoietin-Tie system. Nat Rev Mol Cell Biol, 2009. 10(3): p. 165-77.

60. Wild, S., et al., Global prevalence of diabetes: estimates for the year 2000 and projections for 2030. Diabetes Care, 2004. 27(5): p. 1047-53.

79

61. Dejkhamron, P., R.K. Menon, and M.A. Sperling, Childhood diabetes mellitus: recent advances & future prospects. Indian J Med Res, 2007. 125(3): p. 231-50.

62. Stumvoll, M., et al., Metabolic effects of metformin in non-insulin-dependent diabetes mellitus. N Engl J Med, 1995. 333(9): p. 550-4.

63. Torjesen, P.A., et al., Lifestyle changes may reverse development of the insulin resistance syndrome. The Oslo Diet and Exercise Study: a randomized trial. Diabetes Care, 1997. 20(1): p. 26-31.

64. Uusitupa, M.I., et al., 5-year incidence of atherosclerotic vascular disease in relation to general risk factors, insulin level, and abnormalities in lipoprotein composition in non-insulin-dependent diabetic and nondiabetic subjects. Circulation, 1990. 82(1): p. 27-36.

65. Fioretto, P. and M. Mauer, Diabetic nephropathy: diabetic nephropathy-challenges in pathologic classification. Nat Rev Nephrol. 6(9): p. 508-10.

66. Ronco, P., Proteinuria: is it all in the foot? J Clin Invest, 2007. 117(8): p. 2079-82.

67. Remuzzi, G. and T. Bertani, Is glomerulosclerosis a consequence of altered glomerular permeability to macromolecules? Kidney Int, 1990. 38(3): p. 384-94.

68. Mauer, M., et al., ACE-I and ARBs in early diabetic nephropathy. J Renin Angiotensin Aldosterone Syst, 2002. 3(4): p. 262-9.

69. Bakris, G., Are there effects of renin-angiotensin system antagonists beyond blood pressure control? Am J Cardiol, 2010. 105(1 Suppl): p. 21A-9A.

70. Retinopathy and nephropathy in patients with type 1 diabetes four years after a trial of intensive therapy. The Diabetes Control and Complications Trial/Epidemiology of Diabetes Interventions and Complications Research Group. N Engl J Med, 2000. 342(6): p. 381-9.

71. Intensive blood-glucose control with sulphonylureas or insulin compared with conventional treatment and risk of complications in patients with type 2 diabetes (UKPDS 33). UK Prospective Diabetes Study (UKPDS) Group. Lancet, 1998. 352(9131): p. 837-53.

72. The effect of intensive treatment of diabetes on the development and progression of long-term complications in insulin-dependent diabetes mellitus. The Diabetes Control and Complications Trial Research Group. N Engl J Med, 1993. 329(14): p. 977-86.

73. Krolewski, A.S., et al., Epidemiologic approach to the etiology of type I diabetes mellitus and its complications. N Engl J Med, 1987. 317(22): p. 1390-8.

74. Harjutsalo, V., et al., Population-based assessment of familial clustering of diabetic nephropathy in type 1 diabetes. Diabetes, 2004. 53(9): p. 2449-54.

75. Seaquist, E.R., et al., Familial clustering of diabetic kidney disease. Evidence for genetic susceptibility to diabetic nephropathy. N Engl J Med, 1989. 320(18): p. 1161-5.

80

76. Pettitt, D.J., et al., Familial predisposition to renal disease in two generations of Pima Indians with type 2 (non-insulin-dependent) diabetes mellitus. Diabetologia, 1990. 33(7): p. 438-43.

77. Wacholder, S., et al., Assessing the probability that a positive report is false: an approach for molecular epidemiology studies. J Natl Cancer Inst, 2004. 96(6): p. 434-42.

78. Mooyaart, A.L., et al., Genetic associations in diabetic nephropathy: a meta-analysis. Diabetologia, 2010.

79. Ng, D.P., et al., Angiotensin-I converting enzyme insertion/deletion polymorphism and its association with diabetic nephropathy: a meta-analysis of studies reported between 1994 and 2004 and comprising 14,727 subjects. Diabetologia, 2005. 48(5): p. 1008-16.

80. Marre, M., et al., Relationships between angiotensin I converting enzyme gene polymorphism, plasma levels, and diabetic retinal and renal complications. Diabetes, 1994. 43(3): p. 384-8.

81. Mogensen, C.E., et al., Prevention of diabetic renal disease with special reference to microalbuminuria. Lancet, 1995. 346(8982): p. 1080-4.

82. Pagtalunan, M.E., et al., Podocyte loss and progressive glomerular injury in type II diabetes. J Clin Invest, 1997. 99(2): p. 342-8.

83. Chen, S., et al., Podocyte-derived vascular endothelial growth factor mediates the stimulation of alpha3(IV) collagen production by transforming growth factor-beta1 in mouse podocytes. Diabetes, 2004. 53(11): p. 2939-49.

84. McLennan, S.V., et al., Advanced glycation end products decrease mesangial cell MMP-7: a role in matrix accumulation in diabetic nephropathy? Kidney Int, 2007. 72(4): p. 481-8.

85. van den Born, J., et al., No change in glomerular heparan sulfate structure in early human and experimental diabetic nephropathy. J Biol Chem, 2006. 281(40): p. 29606-13.

86. Wolf, G. and F.N. Ziyadeh, Molecular mechanisms of diabetic renal hypertrophy. Kidney Int, 1999. 56(2): p. 393-405.

87. Mauer, S.M., et al., Structural-functional relationships in diabetic nephropathy. J Clin Invest, 1984. 74(4): p. 1143-55.

88. Drummond, K. and M. Mauer, The early natural history of nephropathy in type 1 diabetes: II. Early renal structural changes in type 1 diabetes. Diabetes, 2002. 51(5): p. 1580-7.

89. Tervaert, T.W., et al., Pathologic classification of diabetic nephropathy. J Am Soc Nephrol, 2010. 21(4): p. 556-63.

81

90. Chen, S. and F.N. Ziyadeh, Vascular endothelial growth factor and diabetic nephropathy. Curr Diab Rep, 2008. 8(6): p. 470-6.

91. Du, X., et al., Inhibition of GAPDH activity by poly(ADP-ribose) polymerase activates three major pathways of hyperglycemic damage in endothelial cells. J Clin Invest, 2003. 112(7): p. 1049-57.

92. Brownlee, M., Biochemistry and molecular cell biology of diabetic complications. Nature, 2001. 414(6865): p. 813-20.

93. Weis, S.M. and D.A. Cheresh, Pathophysiological consequences of VEGF-induced vascular permeability. Nature, 2005. 437(7058): p. 497-504.

94. Veron, D., et al., Overexpression of VEGF-A in podocytes of adult mice causes glomerular disease. Kidney Int, 2010. 77(11): p. 989-99.

95. Yang, B., et al., Polymorphisms of the vascular endothelial growth factor and susceptibility to diabetic microvascular complications in patients with type 1 diabetes mellitus. J Diabetes Complications, 2003. 17(1): p. 1-6.

96. Hohenstein, B., et al., Local VEGF activity but not VEGF expression is tightly regulated during diabetic nephropathy in man. Kidney Int, 2006. 69(9): p. 1654-61.

97. Hovind, P., et al., Elevated vascular endothelial growth factor in type 1 diabetic patients with diabetic nephropathy. Kidney Int Suppl, 2000. 75: p. S56-61.

98. Nakagawa, T., et al., Abnormal angiogenesis in diabetic nephropathy. Diabetes, 2009. 58(7): p. 1471-8.

99. Bailey, E., et al., Vascular endothelial growth factor mRNA expression in minimal change, membranous, and diabetic nephropathy demonstrated by non-isotopic in situ hybridisation. J Clin Pathol, 1999. 52(10): p. 735-8.

100. Shulman, K., et al., Expression of vascular permeability factor (VPF/VEGF) is altered in many glomerular diseases. J Am Soc Nephrol, 1996. 7(5): p. 661-6.

101. Bortoloso, E., et al., Quantitave and qualitative changes in vascular endothelial growth factor gene expression in glomeruli of patients with type 2 diabetes. Eur J Endocrinol, 2004. 150(6): p. 799-807.

102. Cooper, M.E., et al., Increased renal expression of vascular endothelial growth factor (VEGF) and its receptor VEGFR-2 in experimental diabetes. Diabetes, 1999. 48(11): p. 2229-39.

103. Flyvbjerg, A., et al., Amelioration of long-term renal changes in obese type 2 diabetic mice by a neutralizing vascular endothelial growth factor antibody. Diabetes, 2002. 51(10): p. 3090-4.

82

104. Schrijvers, B.F., et al., A neutralizing VEGF antibody prevents glomerular hypertrophy in a model of obese type 2 diabetes, the Zucker diabetic fatty rat. Nephrol Dial Transplant, 2006. 21(2): p. 324-9.

105. Singh, A.K., et al., Vascular factors altered in glucose-treated mesangial cells and diabetic glomeruli. Changes in vascular factors impair endothelial cell growth and matrix. Lab Invest, 2004. 84(5): p. 597-606.

106. Sung, S.H., et al., Blockade of vascular endothelial growth factor signaling ameliorates diabetic albuminuria in mice. J Am Soc Nephrol, 2006. 17(11): p. 3093-104.

107. Schrijvers, B.F., et al., Inhibition of vascular endothelial growth factor (VEGF) does not affect early renal changes in a rat model of lean type 2 diabetes. Horm Metab Res, 2005. 37(1): p. 21-5.

108. Quaggin, S.E. and T.M. Coffman, Toward a mouse model of diabetic nephropathy: is endothelial nitric oxide synthase the missing link? J Am Soc Nephrol, 2007. 18(2): p. 364-6.

109. Tesch, G.H. and T.J. Allen, Rodent models of streptozotocin-induced diabetic nephropathy. Nephrology (Carlton), 2007. 12(3): p. 261-6.

110. Elsner, M., et al., Relative importance of transport and alkylation for pancreatic beta-cell toxicity of streptozotocin. Diabetologia, 2000. 43(12): p. 1528-33.

111. Szkudelski, T., The mechanism of alloxan and streptozotocin action in B cells of the rat pancreas. Physiol Res, 2001. 50(6): p. 537-46.

112. Cockfield, S.M., et al., Multiple low dose streptozotocin induces systemic MHC expression in mice by triggering T cells to release IFN-gamma. J Immunol, 1989. 142(4): p. 1120-8.

113. Gurley, S.B., et al., Impact of genetic background on nephropathy in diabetic mice. Am J Physiol Renal Physiol, 2006. 290(1): p. F214-22.

114. Wolf, G., S. Chen, and F.N. Ziyadeh, From the periphery of the glomerular capillary wall toward the center of disease: podocyte injury comes of age in diabetic nephropathy. Diabetes, 2005. 54(6): p. 1626-34.

115. Kanetsuna, Y., et al., Deficiency of endothelial nitric-oxide synthase confers susceptibility to diabetic nephropathy in nephropathy-resistant inbred mice. Am J Pathol, 2007. 170(5): p. 1473-84.

116. Tesch, G.H. and D.J. Nikolic-Paterson, Recent insights into experimental mouse models of diabetic nephropathy. Nephron Exp Nephrol, 2006. 104(2): p. e57-62.

117. Hudkins, K.L., et al., BTBR Ob/Ob mutant mice model progressive diabetic nephropathy. J Am Soc Nephrol, 2010. 21(9): p. 1533-42.

83

118. Chen, H., et al., Evidence that the diabetes gene encodes the leptin receptor: identification of a mutation in the leptin receptor gene in db/db mice. Cell, 1996. 84(3): p. 491-5.

119. Tanaka, M., A.K. Hadjantonakis, and A. Nagy, Aggregation chimeras. Combining ES cells, diploid and tetraploid embryos. Methods Mol Biol, 2001. 158: p. 135-54.

120. Gawlik, A. and S.E. Quaggin, Deciphering the renal code: advances in conditional gene targeting. Physiology (Bethesda), 2004. 19: p. 245-52.

121. Gawlik, A. and S.E. Quaggin, Conditional gene targeting in the kidney. Curr Mol Med, 2005. 5(5): p. 527-36.

122. Shizuya, H., et al., Cloning and stable maintenance of 300-kilobase-pair fragments of human DNA in Escherichia coli using an F-factor-based vector. Proc Natl Acad Sci U S A, 1992. 89(18): p. 8794-7.

123. Sinn, P.L., D.R. Davis, and C.D. Sigmund, Highly regulated cell type-restricted expression of human renin in mice containing 140- or 160-kilobase pair P1 phage artificial chromosome transgenes. J Biol Chem, 1999. 274(50): p. 35785-93.

124. Belteki, G., et al., Conditional and inducible transgene expression in mice through the combinatorial use of Cre-mediated recombination and tetracycline induction. Nucleic Acids Res, 2005. 33(5): p. e51.

125. Buchholz, F., P.O. Angrand, and A.F. Stewart, Improved properties of FLP recombinase evolved by cycling mutagenesis. Nat Biotechnol, 1998. 16(7): p. 657-62.

126. Rodriguez, C.I., et al., High-efficiency deleter mice show that FLPe is an alternative to Cre-loxP. Nat Genet, 2000. 25(2): p. 139-40.

127. Thyagarajan, B., et al., Site-specific genomic integration in mammalian cells mediated by phage phiC31 integrase. Mol Cell Biol, 2001. 21(12): p. 3926-34.

128. Belteki, G., et al., Site-specific cassette exchange and germline transmission with mouse ES cells expressing phiC31 integrase. Nat Biotechnol, 2003. 21(3): p. 321-4.

129. Kohan, D.E., Progress in gene targeting: using mutant mice to study renal function and disease. Kidney Int, 2008. 74(4): p. 427-37.

130. Indra, A.K., et al., Temporally-controlled site-specific mutagenesis in the basal layer of the epidermis: comparison of the recombinase activity of the tamoxifen-inducible Cre-ER(T) and Cre-ER(T2) recombinases. Nucleic Acids Res, 1999. 27(22): p. 4324-7.

131. Lavoie, J.L., K.D. Lake-Bruse, and C.D. Sigmund, Increased blood pressure in transgenic mice expressing both human renin and angiotensinogen in the renal proximal tubule. Am. J. Physiol. Renal. Physiol, 2004. 286(5): p. F965-F971.

84

132. Sepulveda, A.R., et al., A 346-base pair region of the mouse gamma-glutamyl transpeptidase type II promoter contains sufficient cis-acting elements for kidney- restricted expression in transgenic mice. J. Biol. Chem, 1997. 272(18): p. 11959-11967.

133. Rubera, I., et al., Specific cre/lox recombination in the mouse proximal tubule. J. Am. Soc.Nephrol, 2004. 15(8): p. 2050-6.

134. Rankin, E.B., J.E. Tomaszewski, and V.H. Haase, Renal cyst development in mice with conditional inactivation of the von Hippel-Lindau tumor suppressor. Cancer Res, 2006. 66(5): p. 2576-83.

135. Nelson, R.D., et al., Expression of an AQP2 Cre recombinase transgene in kidney and male reproductive system of transgenic mice. Am. J. Physiol, 1998. 275(1 Pt 1): p. C216-26.

136. Srinivas, S., et al., Expression of green fluorescent protein in the ureteric bud of transgenic mice: a new tool for the analysis of ureteric bud morphogenesis. Dev. Genet, 1999. 24(3-4): p. 241-251.

137. Shao, X., S. Somlo, and P. Igarashi, Epithelial-specific Cre/lox recombination in the developing kidney and genitourinary tract. J. Am. Soc. Nephrol, 2002. 13(7): p. 1837-1846.

138. Zhu, X., et al., Isolation of mouse THP gene promoter and demonstration of its kidney- specific activity in transgenic mice. Am. J. Physiol. Renal. Physiol, 2002. 282(4): p. F608-F617.

139. Moeller, M.J., I.A. Kovari, and L.B. Holzman, Evaluation of a new tool for exploring podocyte biology: mouse Nphs1 5' flanking region drives LacZ expression in podocytes. J. Am. Soc. Nephrol, 2000. 11(12): p. 2306-2314.

140. Wong, M.A., S. Cui, and S.E. Quaggin, Identification and characterization of a glomerular-specific promoter from the human nephrin gene. Am. J. Physiol. Renal Physiology, 2000. 279(6): p. F1027-F1032.

141. Moeller, M.J., et al., Two gene fragments that direct podocyte-specific expression in transgenic mice. J. Am. Soc. Nephrol, 2002. 13(6): p. 1561-1567.

142. Sequeira Lopez, M.L., et al., Renin cells are precursors for multiple cell types that switch to the renin phenotype when homeostasis is threatened. Dev. Cell, 2004. 6(5): p. 719-28.

143. Humphreys, B.D., et al., Fate tracing reveals the pericyte and not epithelial origin of myofibroblasts in kidney fibrosis. Am J Pathol. 176(1): p. 85-97.

144. Kobayashi, A., et al., Six2 defines and regulates a multipotent self-renewing nephron progenitor population throughout mammalian kidney development. Cell Stem Cell, 2008. 3(2): p. 169-81.

85

145. He, G., et al., Inactivation of Six2 in mouse identifies a novel genetic mechanism controlling development and growth of the cranial base. Dev Biol, 2010. 344(2): p. 720-30.

146. Engleka, K.A., et al., Insertion of Cre into the Pax3 locus creates a new allele of Splotch and identifies unexpected Pax3 derivatives. Dev Biol, 2005. 280(2): p. 396-406.

147. Li, J., F. Chen, and J.A. Epstein, Neural crest expression of Cre recombinase directed by the proximal Pax3 promoter in transgenic mice. Genesis, 2000. 26(2): p. 162-4.

148. Ohyama, T. and A.K. Groves, Generation of Pax2-Cre mice by modification of a Pax2 bacterial artificial chromosome. Genesis, 2004. 38(4): p. 195-9.

149. Boyle, S., et al., Fate mapping using Cited1-CreERT2 mice demonstrates that the cap mesenchyme contains self-renewing progenitor cells and gives rise exclusively to nephronic epithelia. Dev Biol, 2008. 313(1): p. 234-45.

150. Ryu, B., et al., Comprehensive expression profiling of tumor cell lines identifies molecular signatures of melanoma progression. PLoS One, 2007. 2(7): p. e594.

151. Traykova-Brauch, M., et al., An efficient and versatile system for acute and chronic modulation of renal tubular function in transgenic mice. Nat Med, 2008. 14(9): p. 979-84.

152. Plachov, D., et al., Pax8, a murine paired box gene expressed in the developing excretory system and thyroid gland. Development, 1990. 110(2): p. 643-51.

153. Quaggin, S. and J.A. Kreidberg, Embryology of the Kidney, in Brenner & Rector's the kidney, B.M. Brenner and F.C. Rector, Editors. 2008, Saunders Elsevier: Philadelphia. p. 1-19.

154. Susztak, K., et al., Animal models of renal disease. Kidney Int, 2008. 73(5): p. 526-8.

155. Jones, N., et al., Nck proteins maintain the adult glomerular filtration barrier. J Am Soc Nephrol, 2009. 20(7): p. 1533-43.

156. Shigehara, T., et al., Inducible podocyte-specific gene expression in transgenic mice. J Am Soc Nephrol, 2003. 14(8): p. 1998-2003.

157. Bradford, M.M., A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem, 1976. 72: p. 248-54.

158. Husdan, H. and A. Rapoport, Estimation of creatinine by the Jaffe reaction. A comparison of three methods. Clin Chem, 1968. 14(3): p. 222-38.

159. Raij, L., S. Azar, and W. Keane, Mesangial immune injury, hypertension, and progressive glomerular damage in Dahl rats. Kidney Int, 1984. 26(2): p. 137-43.

86

160. Eikmans, M., et al., Renal mRNA levels as prognostic tools in kidney diseases. J Am Soc Nephrol, 2003. 14(4): p. 899-907.

161. Pinkse, G.G., et al., Integrin signaling via RGD peptides and anti-beta1 antibodies confers resistance to apoptosis in islets of Langerhans. Diabetes, 2006. 55(2): p. 312-7.

162. Schmittgen, T.D. and K.J. Livak, Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc, 2008. 3(6): p. 1101-8.

163. Inai, T., et al., Inhibition of vascular endothelial growth factor (VEGF) signaling in cancer causes loss of endothelial fenestrations, regression of tumor vessels, and appearance of basement membrane ghosts. Am J Pathol, 2004. 165(1): p. 35-52.

164. Tregouet, D.A., et al., G/T substitution in intron 1 of the UNC13B gene is associated with increased risk of nephropathy in patients with type 1 diabetes. Diabetes, 2008. 57(10): p. 2843-50.

165. Al-Kateb, H., et al., Multiple superoxide dismutase 1/splicing factor serine alanine 15 variants are associated with the development and progression of diabetic nephropathy: the Diabetes Control and Complications Trial/Epidemiology of Diabetes Interventions and Complications Genetics study. Diabetes, 2008. 57(1): p. 218-28.

166. Mollsten, A., et al., A functional polymorphism in the manganese superoxide dismutase gene and diabetic nephropathy. Diabetes, 2007. 56(1): p. 265-9.

167. Baggio, B., et al., Effects of cigarette smoking on glomerular structure and function in type 2 diabetic patients. J Am Soc Nephrol, 2002. 13(11): p. 2730-6.

168. Effect of intensive therapy on the development and progression of diabetic nephropathy in the Diabetes Control and Complications Trial. The Diabetes Control and Complications (DCCT) Research Group. Kidney Int, 1995. 47(6): p. 1703-20.

169. Mathews, M.K., et al., Vascular endothelial growth factor and vascular permeability changes in human diabetic retinopathy. Invest Ophthalmol Vis Sci, 1997. 38(13): p. 2729-41.

170. Waisbourd, M., M. Goldstein, and A. Loewenstein, Treatment of diabetic retinopathy with anti-VEGF drugs. Acta Ophthalmol.

171. Root, H.F., S. Mirsky, and J. Ditzel, Proliferative retinopathy in diabetes mellitus; review of eight hundred forty-seven cases. J Am Med Assoc, 1959. 169(9): p. 903-9.

172. Osterby, R., et al., Neovascularization at the vascular pole region in diabetic glomerulopathy. Nephrol Dial Transplant, 1999. 14(2): p. 348-52.

173. Fioretto, P. and M. Mauer, Diabetic nephropathy: diabetic nephropathy-challenges in pathologic classification. Nat Rev Nephrol, 2010. 6(9): p. 508-10.

174. Feigl, B., Age-related maculopathy - linking aetiology and pathophysiological changes to the ischaemia hypothesis. Prog Retin Eye Res, 2009. 28(1): p. 63-86.

87

175. Schmucker, C., et al., Intravitreal bevacizumab (Avastin) versus ranibizumab (Lucentis) for the treatment of age-related macular degeneration: a safety review. Br J Ophthalmol, 2010.

176. Nishijima, K., et al., Vascular endothelial growth factor-A is a survival factor for retinal neurons and a critical neuroprotectant during the adaptive response to ischemic injury. Am J Pathol, 2007. 171(1): p. 53-67.

177. Kosugi, T., et al., Soluble Flt-1 gene therapy ameliorates albuminuria but accelerates tubulointerstitial injury in diabetic mice. Am J Physiol Renal Physiol, 2010. 298(3): p. F609-16.

178. Stokes, M.B., M.C. Erazo, and V.D. D'Agati, Glomerular disease related to anti-VEGF therapy. Kidney Int, 2008. 74(11): p. 1487-91.

179. Rini, B.I., et al., Toxicity of sunitinib plus bevacizumab in renal cell carcinoma. J Clin Oncol, 2010. 28(17): p. e284-5; author reply e286-7.

180. Izzedine, H., et al., Thrombotic microangiopathy and anti-VEGF agents. Nephrol Dial Transplant, 2007. 22(5): p. 1481-2.

181. Frangie, C., et al., Renal thrombotic microangiopathy caused by anti-VEGF-antibody treatment for metastatic renal-cell carcinoma. Lancet Oncol, 2007. 8(2): p. 177-8.

182. Bollee, G., et al., Thrombotic microangiopathy secondary to VEGF pathway inhibition by sunitinib. Nephrol Dial Transplant, 2009. 24(2): p. 682-5.

183. Qi, Z., et al., Characterization of susceptibility of inbred mouse strains to diabetic nephropathy. Diabetes, 2005. 54(9): p. 2628-37.

184. Lim, H.S., et al., Plasma vascular endothelial growth factor, angiopoietin-1, and angiopoietin-2 in diabetes: implications for cardiovascular risk and effects of multifactorial intervention. Diabetes Care, 2004. 27(12): p. 2918-24.

185. Wraight, W.M. and J.D. Young, Renal effects of inhaled nitric oxide in humans. Br J Anaesth, 2001. 86(2): p. 267-9.

186. Coleman, H.R., et al., Age-related macular degeneration. Lancet, 2008. 372(9652): p. 1835-45.

187. Penn, J.S., et al., Vascular endothelial growth factor in eye disease. Prog Retin Eye Res, 2008. 27(4): p. 331-71.

188. Stanga, P.E., S.R. Boyd, and A.M. Hamilton, Ocular manifestations of diabetes mellitus. Curr Opin Ophthalmol, 1999. 10(6): p. 483-9.

189. Folk, J.C. and E.M. Stone, Ranibizumab therapy for neovascular age-related macular degeneration. N Engl J Med. 363(17): p. 1648-55.

88

190. Kim, J.H., et al., Blockade of angiotensin II attenuates VEGF-mediated blood-retinal barrier breakdown in diabetic retinopathy. J Cereb Blood Flow Metab, 2009. 29(3): p. 621-8.