Role of the SDF-1/CXCR4/eNOS Signaling Pathway in Chronic Kidney Disease

by

Li-Hao (Henry) Chen

A thesis submitted in conformity with the requirements for the degree of Master of Science

Institute of Medical Science University of Toronto

© Copyright by Li-Hao (Henry) Chen 2012

ii

Role of the SDF-1/CXCR4/eNOS Signaling Pathway in

Chronic Kidney Disease

Li-Hao (Henry) Chen

Master of Science

Institute of Medical Sciences

University of Toronto

2012

Abstract

Loss of the renal microvasculature is a common feature of almost all forms of chronic

kidney disease (CKD). Here we explored the role of the angiogenic chemokine stromal cell-

derived factor-1 (SDF-1) and its cognate receptor CXCR4 in experimental and human

CKD. CXCR4 was present on endothelial cells and podocytes, while SDF-1 was detectable

on podocytes, arteriolar smooth muscle cells, interstitial fibroblasts and occasional

endothelial cells. CXCR4 mRNA was elevated in the kidneys of rats with CKD and chronic

antagonism of CXCR4 accelerated renal decline and capillary loss. Acute SDF-1 infusion

activated glomerular endothelial nitric oxide synthase (eNOS) in vivo, while functional

response to SDF-1 was impaired in glomerular endothelial cells derived from eNOS-/-

mice.

Finally, CXCR4 mRNA was also found to be increased in biopsies of patients with

secondary focal segmental glomerulosclerosis. These observations indicate that local eNOS-

dependent SDF-1/CXCR4 signaling exerts a compensatory reno-protective effect in the

setting of CKD.

iii

Acknowledgments and Contributions

First and foremost, I offer my sincerest gratitude to my supervisor, Dr. Andrew Advani who has

guided me throughout my Master’s degree with his patience and knowledge. I have benefited

greatly from his advice ranging from those that are specific to the direction of the project, to ones

transferrable to any career. He has been a great mentor and I am truly indebted to him for all the

time and effort that he has set aside for me over the past two years.

I would also like to thank Dr. Philip Marsden and Dr. James Scholey for their valuable input and

constructive comments into my projects and thesis. I am very grateful for their guidance as my

Project Advisory Committee members.

This thesis would have not been possible without the tremendous support from the wonderful

technicians. I would like to thank every one of them for their incredible patience with me as I

learned the procedures necessary for all the experiments from them. Many thanks to Bailey Stead

and Bridgit Bowskill for always being such a pleasure to work with in the vivarium. Their

positive attitudes and encouragement are always much appreciated day in and day out. In

particular, I would also like to thank Bailey for teaching me the animal handling skills over the

first few months when I started my Master’s program. Dr. Golam Kabir is an excellent teacher

and is always happy to share with me his knowledge on anatomy and physiology relevant to the

surgical procedure he is performing, even during subtotal nephrectomy surgeries, when great

concentration is needed to avoid damaging the tiny blood vessels. Kabir’s sense of humour

always keeps the operating room a fun place to be. I would like to thank Suzanne Advani for

teaching me the histological techniques for my projects, complete with all the helpful tips on

obtaining that perfect image to meet Andrew’s standard of a worthy publication figure. Lastly,

Kerri Thai never fails to amaze me with the variety of wet bench procedures that she performs

every time I see her. I am very grateful for her patience and support. The quality of the results

that she obtains is already outstanding on top of her speed and efficiency.

iv

I would like to thank Yanling Zhang and Darren Yuen for their time in teaching me some of the

techniques in this project, including FMA and angiogenesis assay analysis. I am also grateful for

their advice and encouragements throughout my Master’s program.

I would like to thank Dr. Richard Gilbert and Dr. Kim Connelly for their helpful input and advice

for all of my projects.

It is a pleasure to thank our collaborators, Dr. Manish Sood and Dr. Ian Gibson, for providing us

with valuable samples to complete the human correlative studies.

Many thanks to CIHR, the Banting and Best Diabetes Centre and the Faculty of Medicine at U of

T for their generous financial support.

Special thanks to my suitemate Jiayi Hu. It is rare for a day to pass between us without laughing

over our jokes, albeit quite lame most of the time. I have already stopped counting the number of

bowls of congee and pho noodles that we have consumed late in the evening, while we chatted

about whatever that comes to our minds. His suggestions have been very helpful in improving

my PowerPoint presentations.

A great big “Gan-En” to all of the volunteers and staff of the Tzu Chi Foundation in Toronto.

Last and certainly not least, I would like to express my deepest gratitude to my family for their

continuous and unequivocal support and care throughout. I am particularly grateful for their

heartwarming wishes for my success and health every time I call them over Skype. Special

thanks to my sister, Jean, for “willingly” volunteering at the lab to label hundreds of Eppendorf

tubes and sectioning quite a few tissues.

v

Table of Contents

ABSTRACT _____________________________________________________ ii

ACKNOWLEDGEMENTS AND CONTRIBUTIONS ______________________ iii

TABLE OF CONTENTS ___________________________________________ v

LIST OF ABBREVIATIONS ________________________________________ ix

LIST OF TABLES _______________________________________________ xii

LIST OF FIGURES ______________________________________________ xiii

LIST OF SUPPLEMENTARY FIGURES ______________________________ xiv

LIST OF APPENDICIES __________________________________________ xv

CHAPTER 1. LITERATURE REVIEW ________________________________ 1

1. Chronic Kidney Disease: Scope of the Problem ___________________ 1

2. Renal Vasculature and Rarefaction in CKD _______________________ 2

3. Mediators of Angiogenesis in Development, Adult Homeostasis and Disease ______________________________________________________ 4

4. Stromal Cell-Derived Factor-1 (SDF-1) and CXCR4 ________________ 6

4.1. General Overview _______________________________________________________ 7

4.2. The SDF-1/CXCR4 – PI3K/AKT/eNOS Intracellular Signaling Pathway _____________ 9

4.3. Regulation of Expression and Signaling ____________________________________ 14

4.4. CXCR7 and Ubiquitin: Alternative Receptor and Ligand for SDF-1 and CXCR4 _____ 15

4.5. Role of the SDF-1/CXCR4 Axis in Renal Vasculature Development _______________ 17

5. SDF-1/CXCR4 in Kidney Diseases _____________________________ 21

5.1. Verotoxin (Shiga-like Toxin) ______________________________________________ 21

5.2. Rapidly Progressive Glomerulonephritis (RPGN) _____________________________ 22

5.3. Diabetic Complications __________________________________________________ 23

5.4. Renal Cell Carcinoma __________________________________________________ 24

5.5. Inflammation __________________________________________________________ 26

5.6. Acute Renal Injury _____________________________________________________ 26

5.7. Human Immunodeficiency Virus (HIV) ______________________________________ 28

5.8. Hypertensive Nephropathy _______________________________________________ 28

5.9. Systemic Lupus Erythematosus (SLE) ______________________________________ 29

vi

5.10. Transplantation _______________________________________________________ 30

6. The Subtotally Nephrectomized Rat Model of CKD _______________ 31

7. The CXCR4 Antagonist, AMD3100 _____________________________ 33

CHAPTER 2. HYPOTHESIS AND RESEARCH AIMS ___________________ 36

1. Hypothesis ________________________________________________ 36

2. Research Aims _____________________________________________ 37

CHAPTER 3. MATERIALS AND METHODS __________________________ 38

1. Human Studies _____________________________________________ 38

2. Animals ___________________________________________________ 38

2.1. General ______________________________________________________________ 38

2.2. Subtotal Nephrectomy and Sham Surgery ___________________________________ 39

2.3. SDF-1/CXCR4 Expression Study __________________________________________ 39

2.4. Confirming Efficacy of AMD3100 __________________________________________ 40

2.5. Chronic CXCR4 Inhibition Study __________________________________________ 40

2.5.1. Glomerular Filtration Rate Measurement _______________________________ 41

2.5.2. Metabolic Caging and Urine Protein Excretion Measurement _______________ 41

2.5.3. Systolic Blood Pressure Measurement _________________________________ 42

2.5.4. Fluorescent Microangiography (FMA) __________________________________ 42

2.6. Acute in vivo SDF-1 Infusion Study ________________________________________ 43

2.6.1. SDF-1 Infusion ____________________________________________________ 43

2.6.2. Glomerular Isolation _______________________________________________ 44

2.7. Angiotensin Converting Enzyme (ACE) Inhibition Study ________________________ 45

3. Histology __________________________________________________ 45

3.1. Tissue Sectioning ______________________________________________________ 46

3.2. Immunohistochemistry __________________________________________________ 46

3.3. Periodic Acid-Schiff (PAS) Stain __________________________________________ 48

3.4. Glomerulosclerosis Index (GSI) ___________________________________________ 48

3.5. Immunohistochemistry Analysis ___________________________________________ 49

4. Cell Culture ________________________________________________ 50

4.1. Cell Lines Used _______________________________________________________ 50

vii

4.1.1 Renal Glomerular Endothelial Cell Isolation ______________________________ 50

4.2. Transforming Growth Factor-β (TGF-β) Experiments __________________________ 51

4.3. SDF-1/CXCR4/PI3K/eNOS Signaling ______________________________________ 51

4.4. Proliferation Assay _____________________________________________________ 52

4.5. Transwell Migration Assay _______________________________________________ 52

4.6. Matrigel Angiogenesis __________________________________________________ 53

5. Immunoblotting ____________________________________________ 54

5.1. Protein Concentration Determination _______________________________________ 54

5.2. Gel Electrophoresis ____________________________________________________ 54

5.3. Transfer to Nitrocellulose Membranes ______________________________________ 55

5.4. Detection ____________________________________________________________ 55

6. Real-time PCR _____________________________________________ 57

9. Statistics __________________________________________________ 58

CHAPTER 4. RESULTS __________________________________________ 59

1. Localization of CXCR4 and SDF-1 in adult human kidney tissue ____ 59

2. CXCR4 and SDF-1 expression in SNx rats_______________________ 60

3. TGF-β decreases SDF-1 mRNA in cultured renal fibroblasts ________ 61

4. Chronic CXCR4 blockade accelerates renal decline and capillary loss in experimental CKD __________________________________________ 62

4.1. Chronic AMD3100 administration exacerbates renal function decline in SNx rats ____ 62

4.2. Chronic AMD3100 administration exacerbates glomerulosclerosis and tubulointerstitial fibrosis in SNx rats ___________________________________________ 64

4.3. Chronic AMD3100 administration decreases density of the glomerular and peritubular capillaries in SNx rats _____________________________________________ 66

4.4. Chronic AMD3100 decreases glomerular capillary tuft volume in SNx rats _________ 68

4.5. Chronic AMD3100 administration does not affect either WT1 or nephrin expression in SNx rats _______________________________________________________________ 69

5. SDF-1 mediates local CXCR4 signaling and regulates glomerular endothelial function through eNOS dependent mechanisms _________ 71

5.1. Acute SDF-1 infusion stimulates intra-glomerular CXCR4 signaling and eNOS phosphorylation ___________________________________________________________ 71

5.2. SDF-1/CXCR4 activates eNOS through phospho-inositide 3-kinase (PI3K) _________ 72

viii

5.3. SDF-1-induced glomerular endothelial proliferation is attenuated in eNOS deficient cells ____________________________________________________________________ 73

5.4. SDF-1-induced glomerular endothelial migration is eNOS-dependent _____________ 74

5.5. SDF-1-induced glomerular endothelial tube formation is reduced in eNOS deficient cells ____________________________________________________________________ 75

6. CXCR4 and SDF-1 are both upregulated in kidneys of human FSGS patients _____________________________________________________ 76

6.1. Clinical characteristics of patients with secondary FSGS _______________________ 76

6.2. CXCR4 and SDF-1 mRNA are both increased in the kidneys of patients with secondary FSGS __________________________________________________________ 79

6.3 ACE inhibition increases SDF-1 expression in SNx rats _________________________ 79

CHAPTER 5. DISCUSSION _______________________________________ 81

1. General Overview ___________________________________________ 81

2. Distribution of SDF-1 and CXCR4 in the Adult Human Kidney ______ 82

3. Expression of SDF-1 and CXCR4 in Experimental CKD ____________ 84

4. Chronic CXCR4 Antagonism in SNx Rats _______________________ 85

5. Local SDF-1/CXCR4 Effects and the Role of eNOS ________________ 92

6. Expression of SDF-1 and CXCR4 in Human CKD _________________ 95

CHAPTER 6. CONCLUSION ______________________________________ 98

CHAPTER 7. FUTURE DIRECTIONS _______________________________ 99

REFERENCES ________________________________________________ 103

SUPPLEMENTARY FIGURES ____________________________________ 121

1. The SDF-1/CXCR4/PI3K/eNOS Intracellular Signaling Pathway _____ 121

2. Flow diagram of SDF-1/CXCR4 Expression Study _______________ 122

3. Flow diagram of Chronic CXCR4 Inhibition Study _______________ 122

4. Flow diagram of Acute In Vivo SDF-1 Infusion Study _____________ 123

5. Flow diagram of Angiotensin Converting Enzyme (ACE) Inhibition

Study ____________________________________________________ 124

6. Concentration of circulating white blood cells (WBC) after AMD3100

Administration ____________________________________________ 125

APPENDICIES ________________________________________________ 126

ix

List of Abbreviations

ACR: albumin-to-creatinine ratio

ADMA: asymmetric dimethylarginine

CC-RCC: clear cell renal cell carcinoma

CKD: chronic kidney disease

CXCR4: CXC chemokine receptor 4

CXCR7: CXC chemokine receptor 7

DAG: diacylglycerol

DPP-IV: dipeptidylpeptidase IV (CD26)

eGFR: estimated glomerular filtration rate

ELR: glutamic acid-leucine-arginine

eNOS: endothelial nitric oxide synthase

ESRD: end-stage renal disease

FMA: fluorescent microangiography

FSGS: focal and segmental glomerulosclerosis

GEF: guanine nucleotide exchange factor

GRK: G-protein receptor kinase

Hif-1α: hypoxia-inducible factor-1α

HIV: human immunodeficiency virus

HSC: haematopoietic stem cell

HUS: hemolytic uremic syndrome

HUVEC: human umbilical vascular endothelial cell

ICAM-2: intracellular adhesion molecule-2

IP3: inositol triphosphate

JAK: janus kinase

x

KDIGO: Kidney Disease Improving Global Outcomes

KDOQI: Kidney Disease Outcomes Quality Initiative

L-NAME: NG-nitro-L-arginine methyl ester

MAPK: mitogen-activated protein kinase

MMP: matrix metalloproteinase

mTOR: mammalian target of rapamycin

mTORC1/mTORC2: mTOR complex 1/mTOR complex 2

NBF: neutral buffered formalin

NO: nitric oxide

NOS: nitric oxide synthase

PDK1: phosphoinositide-dependent protein kinase 1

PECAM-1: platelet endothelial cell adhesion molecule-1

PI3K: phosphoinositide-3-kinase

PIP2: phosphotidylinositol 4,5-bisphosphate

PRAS40: proline-rich AKT substrate 40kDa

RAS: renin-angiotensin system

RCC: renal cell carcinoma

REIN: Ramipril Efficacy in Nephropathy

RGEC: renal glomerular endothelial cell

RHEB: Ras homolog enriched in brain

RMP: renal multipotent progenitor

RPGN: rapidly progressive glomerulonephritis

s.c.: subcutaneous

SBP: systolic blood pressure

SDF-1: stromal cell-derived factor-1

SLE: systemic lupus erythematosus

xi

STAT: signal transducer and activator of transcription

Stx: Shiga-like toxin

TGF-β: transforming growth factor-β

TSC1/2 complex: tuberous sclerosis complex

VCAM-1: vascular cell adhesion molecule-1

VE-cadherin: vascular endothelial-cadherin (CD144)

VEGF/VEGFR-2: vascular endothelial growth factor/vascular endothelial growth factor receptor-2

vHL: von Hippel-Lindau tumor suppressor protein

vWF: von Willebrand factor

WBC: white blood cell

xii

List of Tables

Table 1. Functional characteristics of sham and subtotal nephrectomy (SNx) rats

treated with vehicle or AMD3100.

Table 2. Clinical characteristics of patients with secondary focal segmental

glomerulosclerosis (FSGS).

xiii

List of Figures

Figure 1. Localization of CXCR4 and SDF-1 in adult human kidney tissue.

Figure 2. CXCR4 and SDF-1 expression in rat kidneys.

Figure 3. TGF-β expression and effects on fibroblast SDF-1 mRNA.

Figure 4. Glomerulosclerosis.

Figure 5. Tubulointerstitial fibrosis.

Figure 6. Renal vasculature.

Figure 7. Fluorescent microangiography (FMA).

Figure 8. WT1 and nephrin expression.

Figure 9. Acute SDF-1 infusion activates glomerular eNOS.

Figure 10. SDF-1-induces CXCR4 signaling and eNOS activation through PI3K.

Figure 11. Effect of SDF-1 on glomerular endothelial cell proliferation.

Figure 12. Effect of SDF-1 on glomerular endothelial cell migration.

Figure 13. Effect of SDF-1 on glomerular endothelial cell tube formation.

Figure 14. CXCR4 and SDF-1 expression in human kidneys.

Figure 15. Effect of ACE inhibition on CXCR4 and SDF-1 expression.

xiv

List of Supplementary Figures

Supplementary Figure 1. The SDF-1/CXCR4/PI3K/AKT/eNOS Intracellular Signaling

Pathway

Supplementary Figure 2. Flow Diagram of SDF-1/CXCR4 Expression Study.

Supplementary Figure 3. Flow Diagram of Chronic CXCR4 Inhibition Study.

Supplementary Figure 4. Flow Diagram of Acute In Vivo SDF-1 Infusion Study.

Supplementary Figure 5. Flow Diagram of Angiotensin Converting Enzyme (ACE)

Inhibition Study.

Supplementary Figure 6. Concentration of Circulating White Blood Cells (WBC) After

AMD3100 Administration.

xv

List of Appendices

Recipes for compounds

5% Blocking Solution

5% FITC-Inulin

500mM HEPES Buffer

Agarose-fluorescent microbead mixture

Citric acid buffer

Sample buffer

Running Buffer (10×)

TBS (10×)

Transfer Buffer

1

Chapter 1 Literature Review

1 Chronic Kidney Disease: Scope of the Problem

Approximately 2.6 million Canadians are affected by chronic kidney diseases (CKDs) [1] with

over 39,000 individuals receiving renal replacement therapies for end-stage renal disease

(ESRD) [2], a number that has tripled over the last 20 years [1]. This is comparable with the US,

where more than 10% of the population over 20 years old has CKD [3]. Once CKD has

progressed to ESRD, patients require treatment with renal replacement therapies of either

dialysis or a kidney transplant. However, mortality in these patients is high, with an overall five

year survival rate of less than 45% for patients on dialysis across Canada [2]. In addition, these

patients suffer from considerable morbidity [4-6], with reports that elderly ESRD patients spend

an average of 20% of days in hospitals [7].

The economic impact associated with clinical management of CKD is considerable. In 2009,

costs for Medicare patients with CKD reached $34 billion and accounted for nearly 16% of total

Medicare dollars in the US [8]. In Canada, the cost of dialysis per quality-adjusted life year

gained has been estimated at over $83,000 [9]. Moreover, with the baby boomers approaching

retirement age, the elderly population is constituting the fastest growing subset of the dialysis

population [3].

CKD is a heterogeneous group of renal disorders that all result in progressive renal decline and

eventual ESRD. Diabetes and hypertension are the two leading causes of ESRD in Canada,

2

accounting for approximately 35% and 18% of all cases, respectively [1, 2]. According to

guidelines introduced by the Kidney Disease Outcomes Quality Initiative (KDOQI) in 2002 and

amended by the Kidney Disease Improving Global Outcomes (KDIGO) in 2004, CKD is

clinically defined by the presence of kidney damage or decreased kidney function for three or

more months, irrespective of the cause [10, 11]. Kidney damage and function may be evaluated

by a variety of ways. Laboratory tests for albumin-to-creatinine ratio (ACR) [12] and estimates

of the glomerular filtration rate (eGFR) based on serum creatinine concentrations are common

[13]. Threshold values of ACR greater than or equal to 2.0 mg/mmol for men and 2.8 mg/mmol

for women or an eGFR of less than 60 mL/min/1.73m2 are considered indicative of renal injury

or compromised renal function. Under some circumstances, diagnosis and underlying etiology

may be determined through histopathological analysis of renal biopsies. Irrespective of their

underlying causes, common pathological features of CKD include tissue fibrosis and capillary

loss.

2 Renal Vasculature and Rarefaction in CKD

Changes in the architecture and loss of the renal microvasculature are major histopathological

features of almost all forms of CKD [14]. The negative impacts of renal microvasculature loss

may be explained by the large metabolic needs of the kidney. The kidney is only second to the

heart in terms of oxygen consumption and is particularly susceptible to hypoxic injury [15].

Much of the metabolic demand is driven by the active transport of sodium across the tubules. In

humans, despite having close to 180 liters of filtrate passing from the blood into the tubules

3

through the glomerular filtration barrier, tubules have an incredible efficiency of reabsorbing

over 99% of the renal filtrate back into the circulation [15].

Given the large demand for oxygen, 20% of the cardiac output is diverted to the kidney. In fact,

the entire blood volume is filtered through the kidney approximately every 30 minutes.

Consequently, there are apparent pathological implications when the supply of oxygen cannot

meet the demands of the kidney. It is therefore not surprising that the magnitude of capillary

rarefaction has been noted to be inversely correlated with renal function [14].

A common mechanism for progression of different types of renal disease has been suggested to

be chronic glomerular and tubulointerstitial compartment hypoxia [16, 17]. The glomerular

capillary tuft is a complex microvasculature structure vulnerable to the injurious effects of

shifting hemodynamic, neurohormonal, metabolic and peptidic changes that may occur within

the microenvironment. In the tubulointerstitial compartment, hypoxia instigates tubular atrophy

and interstitial fibrosis [17-20]. Tubular epithelial cells activate a profibrogenic response of

extracellular matrix accumulation while interstitial fibroblasts and renal microvascular

endothelial cells increase matrix synthesis and decrease expression of matrix metalloproteinases

[21, 22]. In light of the pivotal role of the glomerular and tubulointerstitial capillaries in

regulating renal health, it has recently been proposed that progression of CKD may not only be

slowed, but may also be reversed through remodeling and regeneration of the microvasculature

[12, 23].

4

3 Mediators of Angiogenesis in Development, Adult

Homeostasis and Disease

Formation, maintenance, and destruction of blood vessels involve a large number of biological

factors. Some of these factors promote vessel growth while others result in rarefaction. The

overall effect is like a see-saw, in which the balance of agonists and antagonists determines the

outcome for blood vessels. During homeostasis and normal turnover of blood vessels, the see-

saw is balanced equally by the actions of agonists and antagonists. CKDs may be characterized

by pathological shifts in the balance of biological factors that favor the rarefaction of blood

vessels.

A variety of angiogenic factors have been characterized that counteract blood vessel rarefaction

and promote regeneration of lost microvasculature in the kidney. An example of a candidate

endogenous pathway for treatment of CKD is the vascular endothelial growth factor

(VEGF)/VEGF receptor-2 (VEGFR-2) pathway, with VEGF-A being the most widely studied

isoform in the family. VEGF promotes endothelial cell survival, proliferation and migration [24].

It is particularly active in ontogeny as a critical systemic mediator of vasculogenesis and

angiogenesis [25]. Knockout of VEGFR-2 in murine models demonstrated that this pathway is

essential for the formation of functional blood vessels, with deletion of VEGFR-2 resulting in

embryonic lethality [26, 27]. The dose-dependent effect of VEGF can also be observed on a

systemic scale, as VEGF heterozygosity is also embryonically lethal [28, 29].

Studies of VEGF with specific focus on the kidney highlight its importance in renal vascular

development. Podocyte-specific haplo-insufficient and null phenotypes of VEGF-A result in

5

small avascular glomeruli containing fully differentiated podocytes, but lacking endothelial cells

[30]. In contrast, VEGF-A overexpression in podocytes leads to end-stage renal failure due to a

collapsing glomerulopathy, reminiscent of human immunodeficiency virus (HIV)-associated

nephropathy and demonstrating that tight regulation and “dose” of VEGF-A signaling is critical

in the establishment and maintenance of vascular beds [30].

Many of the angiogenic factors that play important roles in normal development are recapitulated

during adulthood. Podocytes continue to express VEGF-A in the mature glomerulus [31].

Endothelial cells adjacent to the podocytes across the glomerular basement membrane express

the cognate receptor VEGFR-2, suggesting that VEGF/VEGFR-2 signaling plays a homeostatic

role in the adult kidney. Podocyte-derived VEGF maintains the filtration barrier through

survival, proliferation and/or differentiation cues given to the adjacent specialized endothelia

[30].

VEGF is also important in adult diseases that are characterized by disruption of vascular

homeostasis. In a rodent model of progressive kidney disease, renal VEGF expression has been

shown to be reduced [32] and administration of exogenous VEGF preserved both capillary

density and renal function [33]. Similarly, in animal models of thrombotic microangiopathy,

characterized by renal endothelial and microvascular injury and loss, VEGF administration

accelerated renal recovery, possibly through preserving eNOS expression and function [34-36].

These examples demonstrate how vascular homeostasis can be restored in disease states that

favor vascular rarefaction. An opposite effect, however, may also occur where antagonism of

angiogenic factors may accelerate capillary loss and renal function decline. For instance,

administration of a small molecule VEGFR-2 antagonist exacerbated renal microvascular loss

6

and renal function decline in a rat model of renin angiotensin system (RAS) dependent

hypertension [37].

Another example of an angiogenic modulator that is important in both ontogeny and adulthood is

the angiopoietin-1/Tek signaling pathway. Angiopoietin-1 acts as a regulator of VEGF-mediated

angiogenesis and its action is critical for regulating both the number and diameter of developing

blood vessels [38, 39]. In the kidney, angiopoietin-1 is produced by podocytes [40]. An

angiopoietin-1 null genotype is embryonically lethal and exhibits pathological phenotypes with

defective glomerular capillaries, disrupted glomerular basement membrane and reduced

mesangial cell numbers [38]. This demonstrates that during a period of intense vasculogenesis

and angiogenesis, regulation is also needed for proper vascular development. Although

angiopoietin-1 appears dispensable in adult quiescent vessels, it functions as a protective factor

in response to pathological injury of the microvasculature [38]. For instance, in mature

streptozocin-diabetic mice, an animal model of Type I diabetes, angiopoietin-1 deletion

exacerbated renal decline, mesangial expansion and glomerulosclerosis [38].

4 Stromal Cell-Derived Factor-1 (SDF-1) and CXCR4

VEGF and angiopoietin-1 are angiogenic factors that demonstrate the importance of maintaining

a balance of angiogenic agonists and antagonists in vascular homeostasis. Modulating this

balance has important consequences in determining the outcome of diseases that are

characterized by vascular overgrowth or rarefaction. Recently, another angiogenic system has

7

been identified that plays an essential role in renal vascular development, that is the stromal-cell

derived factor-1α (SDF-1)/CXCR4 chemokine signaling axis.

4.1 General Overview

Chemokines are small (8-10 kDa), potent peptide mediators that were initially described to

control cell migration, particularly on leukocytes that express the cognate chemokine receptors.

Chemokines are generally classified in one of four categories based on the distance between the

first two cysteine residues: CC, CXC, CX3C and C-type [41]. SDF-1 belongs to the CXC

chemokine family because the first two cysteine residues in the primary amino acid sequence are

separated by a single, random intervening amino acid residue. SDF-1 may also be termed

CXCL12 or pre-B-cell growth-stimulating factor, for its role in B-cell lymphopoiesis [42, 43].

CXC chemokines are further divided into two categories based on the presence of the ELR

(glutamic acid-leucine-arginine) amino acid motif (ELR+), or lack thereof (ELR

-). Contrary to

other ELR- CXC chemokines, SDF-1 possesses angiogenic activities [44], mediated through

interactions with its cognate receptor CXCR4, which is the most prevalent chemokine receptor

found on the surface of endothelial cells [45-47].

At least six different variants of SDF-1 exist in humans arising from a single gene through

alternative splicing [42, 48, 49]. All six isoforms are functional and can stimulate cell migration

in a CXCR4-dependent manner [48]. The most common isoforms in humans are SDF-1α and

SDF-1β, with the latter having four additional amino residues at the carboxy-terminus [50, 51].

One distinct difference is that SDF-1β tends to be more resistant to blood-dependent degradation

8

than SDF-1α [48]. In the adult, SDF-1 is constitutively expressed by many organs, including the

kidney, heart, liver, spleen, lung, skin and bone marrow [52]. The cell types that constitutively

express SDF-1 include endothelial cells [53], dendritic cells [53] and bone marrow-derived

stromal cells [54].

Chemokine receptors all belong to a family of G-protein coupled receptors with seven

transmembrane domains. As a single polypeptide chain, the receptors have extracellular and

intracellular domains that allow them to bind to extracellular ligands and initiate intracellular

signaling cascades. Two groups independently identified SDF-1α as the ligand for CXCR4 [55,

56]. CXCR4 is present on the surface of multipotent stem cells, haematopoietic cells, endothelial

progenitor cells and smooth muscle progenitors, all of which have angiogenic properties [57-61].

The SDF-1/CXCR4 signaling pathway was originally defined for its role in retention and

maintenance of the hematopoietic stem cell niche [62, 63] and B-cell lymphopoiesis [42, 43].

SDF-1 is also considered a homeostatic chemokine because it maintains hematopoietic stem cell

(HSC) quiescence, regulates hematopoietic cell trafficking and secondary lymphoid tissue

architecture [61]. Endothelial cells themselves also selectively express CXCR4 on their surfaces

[64, 65] and SDF-1 binding has been shown to induce endothelial cell migration [46]. CXCR4 is

also found on the surface of a variety of tissue-committed progenitor cells in the body [66-74],

suggesting that tissues with elevated expression of SDF-1 are targets for recruitment of these

cells [75, 76]. In other cell types, SDF-1 signaling through CXCR4 also promotes survival [77]

as well as cellular proliferation [78], although these effects appear to be cell-type dependent [79,

80].

9

4.2 The SDF-1/CXCR4 – PI3K/AKT/eNOS Intracellular Signaling

Pathway

The signaling cascades induced by SDF-1/CXCR4 binding are generally well characterized. A

diagram illustrating all of the pathways discussed in this section of the thesis is provided

(Supplementary Figure 1). Following binding of SDF-1, CXCR4 dimerizes and becomes

phosphorylated by Janus kinase-2 and -3 (JAK2 and JAK3) [81]. Recruitment and activation of a

family of transcription factors known as Signal Transducer and Activator of Transcription

(STAT) follows CXCR4 phosphorylation and is required for directed chemotaxis, partly through

recruitment of focal adhesion proteins, in a number of cell types of haematopoietic origin [82].

This phosphorylation also induces conformational changes that allow it to act as a guanine

nucleotide exchange factor (GEF) on an associated G-protein and exchange its bound GDP for a

GTP [81, 83]. The GTP-bound G-protein then dissociates into 2 parts: Gα subunit and Gβγ

subunit. The Gβγ subunit can directly activate the phosphoinositide-3-kinase (PI3K) pathway,

which can trigger phospholipase C activation and formation of phospholipids such as inositol

triphosphate (IP3) [84]. PI3K also activates the serine/threonine-specific protein kinase, Akt

which is discussed below [85]. The actions of the Gα subunit are more complicated, since there

are many subtypes that may mediate opposing cascades [86, 87].

Most chemokine receptors are primarily Gαi-coupled receptors, including CXCR4. Gαi inhibits

adenyl cyclase [88]. Gαq acts via phospholipase C (ex. PLCβ) to activate phosphotidylinositol-

specific phospholipases, which hydrolyze phosphotidylinositol 4,5-bisphosphate (PIP2) to

generate two second messengers: inositol triphosphate (IP3) and diacylglycerol (DAG) [88]. IP3

and DAG increase intracellular concentrations of free Ca2+

and activate a number of protein

10

kinases, including PKC. This increase in Ca2+

can be used as a measurement of receptor activity.

Inhibition of adenyl cyclase may also be important in chemotaxis, proliferation and survival

signaling [89]. However, there have been studies that showed CXCR4 also couples with Gαo,

Gαq, Gαs and Gα12/13 subunits in different cell types [83, 90, 91], suggesting that effects may be

cell type-dependent. Both Gαi and Gαq stimulate mitogen-activated protein kinase (MAPK)

activation, although CXCR4 can also signal through MAPK independent of G-proteins to

promote survival [78, 92, 93]. Gα12/13 associates with GTPases Rho and Ras and may be

important in neoplastic transformation of normal cells [94, 95].

As mentioned previously, the Gβγ subunit directly activates PI3K and generates phospholipase

products. These phospholipase products recruit and directly bind to two cellular elements: a

serine/threonine protein kinase Akt and phosphoinositide-dependent protein kinase 1 (PDK1)

[96-98]. The colocalization at the plasma membrane allows Akt to be phosphorylated by PDK1

at the threonine 308 residue and become partially activated [97]. Complete activation of Akt

occurs upon further phosphorylation at the serine 473 residue by the mammalian target of

rapamycin (mTOR) complex 2 (mTORC2), which is discussed below. One of the key

consequences of Akt activation is induction of chemotaxis in various cell types. In T

lymphocytes, SDF-1/CXCR4 has been shown to mediate chemotaxis by activating Akt [99] to

promote rearrangement of the actin cytoskeleton [55, 100]. This pathway has also been shown to

direct endothelial cell migration [46, 100]. In a similar fashion, VEGF also stimulates

actin/myosin reorganization and migration of endothelial cells via Akt [101].

In several cell types, including endothelial cells, SDF-1/CXR4/Akt activation also promotes

survival [77, 102]. Studies have demonstrated that expression of constitutively active Akt

11

inhibits apoptosis through a variety of mechanisms such as UV irradiation, matrix detachment,

cell cycle discordance and DNA damage [103]. Conversely, expression of dominant-negative

Akt has resulted in decreased cell survival [103]. The mechanism of action is through Akt

interaction and inhibition of cellular apoptosis machineries. Bcl-2 and its family of structurally

related proteins regulate cell death in mammalian cells [104, 105]. Some are categorized as pro-

survival proteins such as Bcl-2 and Bcl-XL, while others are categorized as pro-apoptosis

proteins such as Bax and Bad. Activated Akt can inactivate Bad through phosphorylation [106,

107], thus promoting survival. Additionally, Akt can also inactivate caspase-9 and glycogen

synthase kinase-3 [108], both of which are involved in pathways leading to apoptosis [109]. Such

pro-survival pathways may be important in slowing the rarefaction of the renal vasculature in

CKD.

One of the candidate effectors that may mediate the downstream effects of SDF-1/CXCR4

signaling (such as proliferation, angiogenesis and chemotaxis) is the mTOR protein [110-113].

mTOR is a serine/threonine protein kinase of the PI3K protein family that responds to a variety

of growth factors and nutrients and regulates cell growth by controlling mRNA translation,

ribosome biogenesis, autophagy and metabolism [114]. mTOR forms two types of complexes:

mTORC1 (RAPTOR complex) and mTORC2 (RICTOR complex). mTORC1 is activated by Akt

in one of two ways, whereby phosphorylation of the PRAS40 subunit (proline-rich Akt substrate

40kDA), releases its inhibition on mTORC1 [114]. Alternatively, Akt can also phosphorylate

tuberous sclerosis complex-1 and -2 (TSC1/2), which releases its inhibition on Ras homolog

enriched in brain protein (RHEB), a direct agonist of mTORC1 activities [114]. Downstream

effectors phosphorylated by mTORC1 are S6K1 and 4E-BP1, both regulators of mRNA

12

translation that mediate increased expression of genes important in proliferation and

angiogenesis, such as hypoxia-inducible factor 1-α (Hif-1α) [115]. Hypoxia and other factors

prominent in nutrient and oxygen poor environments inhibit mTORC1 by promoting TSC1/2

activation [114]. On the other hand, mTORC2 phosphorylates Akt at Ser473, which

synergistically promotes its activity in addition to PDK1 phosphorylation at Thr308 [114].

Finally, it has been suggested that further Akt phosphorylation allows activation of more

downstream effectors and that mTOR functions both upstream and downstream of Akt [114].

Activation of Akt may also lead to downstream activation of endothelial nitric oxide synthase

(eNOS). SDF-1 has been shown to enhance endothelial migration through eNOS-dependent

nitrosylation of MAP-kinase phosphatase 7 (MKP7) [116], while endothelial progenitor

apoptosis is reduced by SDF-1 through PI3K/Akt/eNOS activation [102]. Akt can activate eNOS

by phosphorylating serine residues at the 1177 position [117] or the 1179 position [118]. Nitric

oxide (NO) is a potent vasodilator that is synthesized by a family of nitric oxide synthase (NOS)

enzymes. Along the vascular walls, NO is produced by eNOS in response to changes in flow or

distending hydrostatic pressures [119, 120]. The promoter for eNOS in mice was cloned in 1998

and has been widely studied [121]. Not only does eNOS play important roles in regulation of

systemic blood pressure and vascular remodeling [122], but it also appears to play important

roles during development. Mice with eNOS deficiency are susceptible to focal renal injury

marked by atubular glomeruli and a focal degenerated and hyalinized glomerular tuft vasculature

[123]. In early postnatal mouse proximal tubules, nonvascular expression of eNOS was

confirmed to persist as late as 21 days of age, suggesting that eNOS may play a role in tubule

13

maturation, since deficiencies led to scarring and disconnection of tubules with their associated

parent glomeruli [123].

eNOS is an important determinant of susceptibility to CKD progression. The C57BL/6 strain of

mouse, which is normally resistant to CKD induced by renal mass ablation, develops renal

decline and damage when all NOS isoforms are pharmacologically inhibited [124]. Similarly,

renal mass ablation in eNOS knockout C57BL/6 mice results in exacerbated renal decline that is

characterized histologically by decreased renal capillary density [125, 126]. Conversely, dietary

supplementation of the NO precursor arginine protects renal function in different murine CKD

models [126, 127]. Consistent with this paradigm, it has been proposed that the overall

production of NO is decreased in CKD due to a variety of reasons, including decreased substrate

production by the kidney and increased circulating levels of endogenous NOS inhibitors [128].

CKD patients have elevated circulating levels of asymmetric dimethylarginine (ADMA) [129,

130], an endogenous inhibitor of NOS that acts by both reducing eNOS phosphorylation [131]

and competing for interaction with NOS isoforms [132]. The exact molecular mechanisms

contributing to the reno-protective effect of eNOS in CKD have not been elucidated. However,

eNOS activation promotes angiogenesis and thus the reno-protective effects of the enzyme may

occur through preservation of the renal vasculature [133]. Consistent with such a role, both

eNOS deficiency [123, 134, 135] and hyperactivity [136] contribute to a variety of renal

pathologies, highlighting the importance of balanced angiogenic signals in maintaining kidney

health. In animal models of early experimental diabetes, where excessive angiogenesis is

detrimental to renal function, inhibition of eNOS activity through VEGF inhibition has been

14

beneficial [137]. Increased eNOS expression has also been described within the tumour

vasculature of elderly patients with renal cell carcinoma [138].

4.3 Regulation of Expression and Signaling

At the transcription level, both SDF-1 and CXCR4 are regulated by the von Hippel-Lindau

(vHL) tumor suppressor protein [139], which directs ubiquitin-mediated degradation of Hif-1α.

In the presence of hypoxia, vHL expression is suppressed, allowing Hif-1α to stabilize and form

a heterodimer with the constitutively expressed β subunit. The hypoxia-inducible factor-1

complex is a transcription factor that can bind to both SDF-1 and CXCR4 promoters [140, 141],

augmenting expression of both genes. In vitro experiments have shown that hypoxia increases

the expression of SDF-1 in renal tubular epithelial cells [142] and endothelial cells [141] while

bone marrow-derived endothelial progenitor cells show increased expression of CXCR4 [142].

Glucose may also play a role in this regulation, due to the presence of a carbohydrate response

element binding protein that has been described to activate Hif-1α in glomerular mesangial cells

[143]. CXCR4 is further regulated by NF-κB [140]. Both mRNA transcript stabilization and

post-transcriptional regulation may also play a role in regulating SDF-1 and CXCR4 expression

[144].

Once translated, SDF-1 and CXCR4 are susceptible to degradation. SDF-1 may be cleaved by

cathepsin G [145], matrix metalloproteinase [146] and dipeptidylpeptidase IV (DPP-IV, or

CD26) [147]. Its activity may also be attenuated by the scavenger receptor, CXCR7 [148], which

is discussed below. Activated CXCR4 on the cell membrane is regulated through

15

phosphorylation at serine sites by G-protein receptor kinase (GRK) [89, 149] and rapidly

undergoes dynamin and arrestin dependent internalization into clathrin-coated pits [149-151].

This internalization also depends on interaction with ferritin [152], 73-kDa heat shock cognate

protein [153], plectin [154], and myosin IIA [155]. Internalization appears to be independent of

G protein signaling [156]. Finally, the activity of downstream CXCR4 signaling cascades may be

enhanced upon incorporation of the receptor into lipid rafts [157] and intracellular signaling may

also be modulated by regulators of G-protein signaling proteins [158, 159].

4.4 CXCR7 and Ubiquitin: Alternative Receptor and Ligand for

SDF-1 and CXCR4

For many years, the relationship between SDF-1 and CXCR4 was thought of as exclusive.

Indeed, the overwhelming majority of biological effects of SDF-1 are mediated by CXCR4.

However, it has recently been suggested that in fact this relationship is not monogamous.

CXCR7 (RDC1) is now recognized as an alternative receptor for SDF-1 which may also serve

important biological roles [160]. CXCR7 is expressed on the surface of renal multipotent

progenitors (RMPs) present in Bowman’s capsule [161, 162]. During mouse embryonic

development, CXCR7 is mostly expressed in renal tubules [163]. Mice lacking CXCR7 die at

birth due to cardiac ventricular septal defects and semilunar heart valve malformation [164].

SDF-1 stimulates CXCR7 internalization and signaling to promote survival, proliferation and

adhesion without affecting Ca2+

mobilization or cell migration [165-167]. CXCR7-transfection

has also been shown to confer a survival advantage for human umbilical vein endothelial cells

(HUVECs) [165]. It has been recently found that SDF-1 binding also stimulates CXCR7

16

heterodimerization with CXCR4 and that decreasing CXCR7 mRNA may actually lead to

increased chemotaxis toward SDF-1 [168], suggesting that CXCR7 may be a regulator of the

SDF-1/CXCR4 signaling axis. Consistent with this postulate, CXCR7 continuously cycles

between plasma membrane-bound and secreted forms, which would suggest a role as a decoy or

scavenger receptor [148]. Thus CXCR7 appears to play both activating and regulatory roles in

intra-cellular signaling.

Ubiquitin is a constitutively expressed protein in all eukaryotic cells [169] that has been recently

identified as an agonist of CXCR4 [169]. However, most of the research on ubiquitin has been

focused on its intracellular roles in directing protein degradation. Once activated through ATP-

dependent pathways, ubiquitin can be ligated into a chain on misfolded or damaged proteins by

various ubiquitin-carrier proteins [170]. The labeled ubiquitin-protein complex is a target for

degradation by proteasomes. Thus, this system serves as an effective cellular tool that protects

cells against accumulation of non-functional or toxic proteins. However, ubiquitin is also found

as a natural constituent of plasma at low concentrations that enters circulation from normal

physiological turnover of cells and following a range of pathological conditions. Some examples

include cellular trauma, kidney failure, infections and allergic, autoimmune and

neurodegenerative diseases [171]. In addition, ubiquitin can be actively released from various

cells including ventricular myocytes [172], leptomeningeal cells [173] and adrenal chromaffin

cells [174, 175]. Nonetheless, relatively few studies have been conducted that investigated its

extracellular effects.

Recently, Saini and colleagues demonstrated the effects of extracellular ubiquitin-CXCR4

binding [176]. SDF-1 and ubiquitin mediated CXCR4 signaling result in many common

17

intracellular signaling events, including induction of intracellular Ca2+

flux and reduction of

cAMP levels via Gαi/o protein activation. The two CXCR4 ligands also induce many CXCR4-

mediated physiological effects, including suppression of inflammatory responses [177-179] and

reduction of apoptosis via PI3K activation [102, 172]. Although SDF-1 and ubiquitin competed

for interaction with CXCR4 when added to the same system, ubiquitin does not interact with

CXCR7 [180]. This difference may be attributed to differences in their ligand-receptor

interactions. Unlike SDF-1, ubiquitin does not interact with the N-terminus of CXCR4 [180]

which may explain why phosphorylation of several downstream signaling factors, including Akt,

are more transient via stimulation by ubiquitin relative to SDF-1 [180]. These differences may

have important implications on the development of therapeutic compounds that exploit CXCR4

signaling.

4.5 Role of the SDF-1/CXCR4 Axis in Renal Vasculature

Development

Abundant expression of SDF-1 and CXCR4 occurs in the embryonic kidney of mice [181], rats

[163] and humans [182] suggesting an important role for this axis in renal development.

Consistent with this role, SDF-1/CXCR4 signaling has recently been shown to be essential for

normal development of the embryonic renal vasculature [163].

Nephrogenesis, or the embryonic development of the kidney, is a highly coordinated process that

requires expression of different ligands and receptors that are restricted both spatially and

temporally. The mammalian nephrogenesis process can be categorized into three distinct phases,

18

each marked by the formation of a more complex pair of kidneys: pronephros, mesonephros and

metanephros. Development of the renal vasculature occurs in the metanephros, which persists as

the definitive adult kidney. Metanephros development begins with the ureteric bud that stems

from the Wolffian duct invading a section of the mesenchyme known as the nephrogenic

blastema. This region receives stimulatory cues from the ureteric bud and undergoes a

mesenchymal-to-epithelial transition that forms the renal vesicle. The renal vesicle then

lengthens to become an S-shaped body and the section furthest from the ureteric bud forms a

vascular cleft. Cells that line the vascular cleft, which later mature to podocytes, recruit

endothelial cells from the nephrogenic blastema to form the functional renal vasculature. By this

stage, there is a divergent expression pattern of SDF-1 and CXCR4 in the developing kidney

[163]. Presence of both ligand and receptor in the developing kidney suggest that this pathway

actively drives nephrogenesis. In the early metanephros stage, CXCR4 is expressed in both the

ureteric bud and metanephric mesenchyme [183]. Later, CXCR4 expression switches from the

ureteric bud to the cap mesenchyme and later remains in the glomerular endothelial cells and the

afferent arterioles [163]. On the other hand, SDF-1 expression is present in comma- and S-

shaped bodies, as well as in the mesangium, blood vessels and collecting ducts [182].

Takabatake and colleagues used systemic and conditional knockout mouse models to elucidate

the functional roles of the SDF-1/CXCR4 pathway in the developing kidney. In the primitive

glomerulus, the investigators first observed that SDF-1 was prominently expressed by podocytes

while adjacent, recruited endothelial cells expressed CXCR4, suggesting the presence of

paracrine signaling from the podocytes to the developing nephrons and endothelial cells [163].

Systemic deficiency of either gene is not only embryonically lethal [42, 163], but also resulted in

19

the defective formation of blood vessels, characterized histologically by ballooning of the

developing glomerular tuft and disorganized patterning of the renal vasculature [163]. Moreover,

endothelial-specific CXCR4 knockout mice exhibited identical phenotypes as systemic CXCR4

knockout mice with regards to glomerular capillary development [163]. Mortality was high in

these mice and in the few that survived to three days after birth, glomerular endothelial cells

tended to detach from the glomerular basement membrane [163]. Indeed, the endothelial cells

that made up the glomerular capillaries in endothelial specific CXCR4 knockout mice were

likely to be dysfunctional, since they had fewer fenestrations [163]. Other renal cell types were

also affected. Some interlobular arteries expressed both SDF-1 and CXCR4 at the same time,

suggesting the presence of an autocrine signaling event that promotes angiogenic sprouting

[163]. In a separate study, in vitro inactivation of CXCR4 in embryonic kidney explants resulted

in blunted auto-branching of the ureteric bud and defective glomerulus formation and

mesenchymal tubulogenesis [183]. In tubular cells, SDF-1 knockdown resulted in cyst formation

[183].

Observations from animals with systemic knockout of either SDF-1 or CXCR4 further support

the importance of this pathway in vascular development. Embryonic vascularization of the

gastrointestinal tract also depends on the SDF-1/CXCR4 pathway [184]. Tachibana and

colleagues showed that in wildtype mice, CXCR4 positive endothelial cells of the mesentery

were located alongside SDF-1 positive mesenchymal cells [184]. This is analogous to the close

apposition of the SDF-1 expressing podocytes and CXCR4 expressing endothelial cells in the

embryonic kidney as observed by Takabatake and colleagues [163]. In the CXCR4 knockout

mouse embryo, despite the presence of major blood vessels including the superior mesenteric

20

artery, aberrant and fewer branching from the larger mesenteric vessels has been observed [184].

In a more recent study by Ara and colleagues, SDF-1 has been found to act on arterial

endothelial cells of the superior mesenteric artery to increase CXCR4 expression and mediate

formation of interconnecting vessels between the larger artery and the neighboring primary

capillary plexus surrounding the primitive gut [57]. These studies demonstrate that CXCR4 is

responsible for normal mesenteric vascular branching and remodeling. Expression of SDF-1 and

CXCR4 has also been reported in the brain [54, 185] and heart [54, 186], where it mediates

processes such as granule neural precursor cell migration [187] and cardiac ventricular septal

development [186]. However, no vascularization defects were observed in the developing brain

or heart in the absence of either gene [57], illustrating the tissue-specific effects of this system.

Mice heterozygous for either SDF-1 or CXCR4 displayed severe and identical defects, including

impaired B-lymphopoiesis and myelopoiesis, derailed cerebellar neuron migration and

pulomonary collapse, suggesting that the dose of either gene is important in development.

Nonetheless, these heterozygous mice remained viable and fertile [188].

Despite its importance in renal vascular development, the roles that the SDF-1/CXCR4 pathway

may play in the normal adult kidney and in CKD have not yet been described. In the study by

Takabatake et al, after birth, all of the podocytes and glomerular endothelial cells expressed

SDF-1 and CXCR4, respectively [163]. Like the SDF-1/CXCR4 pathway, there are other

mediators of angiogenesis that exist in the kidney throughout development and adulthood, where

the ligand and receptor are expressed on either side of the glomerular filtration barrier mediating

paracrine crosstalk. Podocytes produce a number of angiogenic growth factors during glomerular

development including SDF-1, VEGF, angiopoietin-1 and ephrinB2, whereas adjacent

21

endothelial cells express their cognate receptors [30, 189-193]. The topological relationship of

SDF-1 and CXCR4 in the adult glomerulus suggests a similar role for this pathway. However,

this has not yet been confirmed.

5 SDF-1/CXCR4 in Kidney Diseases

Pathways important in ontogeny are often recapitulated in adult diseases. In comparison to

another angiogenic factor, VEGF, however, relatively little is known about the role of SDF-

1/CXCR4 in maintaining the adult renal microvasculature. That being said, previous studies have

revealed a role for SDF-1/CXCR4 signaling in a diverse range of conditions, including hemolytic

uremic syndrome due to verotoxin, rapidly progressive glomerulonephritis, diabetic nephropathy,

renal cell carcinoma, inflammation, acute renal injury, HIV infection, hypertensive nephropathy,

systemic lupus erythematosus and renal allograft rejection. The disparate results observed

highlight the contextual nature of this pathway, as described for similar angiogenic systems.

5.1 Verotoxin (Shiga-like Toxin)

The pathogenesis of some forms of hemolytic uremic syndrome (HUS) is associated with a

potent protein exotoxin produced by several strains of Escherichia coli (E. coli) known as Shiga-

like toxins (Stx) or verotoxins. Recent work by Petruzziello-Pellegrini and colleagues

demonstrated that even low levels of Stx enhanced the expression of SDF-1, CXCR4 and

CXCR7 in endothelial cells [144]. This resulted in profound phenotypic changes in endothelial

22

cells with minimal effects on new protein synthesis [194], suggesting that Stx is highly specific

at modulating expression of only certain genes. Additionally, significant increase in secreted

SDF-1 was detected in circulation following treatment of mice with Stx, which may have been a

result of increased expression of the scavenger receptor, CXCR7 [144]. Inhibition of CXCR4

following Stx administration to mice was associated with decreased mortality and modest

improvements of renal function, possibly mediated by decreased vessel permeability.

5.2 Rapidly Progressive Glomerulonephritis (RPGN)

Rapidly progressive glomerulonephritis (RPGN) is a clinical syndrome manifested by acute renal

failure and characterized by extensive fibrocellular and fibrous crescent formation in the

glomerulus [195]. In 2006, Ding and colleagues were able to recapitulate RPGN in a transgenic

rodent model that selectively expressed CXCR4 within podocytes [181]. Selective deletion of the

vHL gene in mouse podocytes resulted in the stabilization of Hif-1α and Hif-2α and led to de

novo CXCR4 expression and enhanced SDF-1 expression, both of which are hypoxia-inducible

genes [181]. Prominent histopathologies included hyperproliferation of podocytes and initiation

of other clinical features of pauci-immune RPGN with few or no immune deposits [181].

Interestingly, the proliferative switch of podocytes, which typically represent terminally

differentiated cells, was turned back on with the expression of CXCR4. Further evidence for the

importance of this pathway in the pathogenesis of RPGN was provided by i) the demonstration

that treatment with a CXCR4 specific blocking antibody delayed the onset and severity of renal

injury in mice and ii) glomerular CXCR4 expression was increased in biopsies from patients

with pauci-immune RPGN [181]. This study highlights that while CXCR4 is important in

23

endothelial cell homeostasis, its aberrant expression in podocytes may also contribute to renal

pathophysiology.

5.3 Diabetic Complications

The presence of a carbohydrate response element binding protein may be responsible for

increased expression of SDF-1 and CXCR4 in diabetes. For example, Jie et al demonstrated the

upregulation of both ligand and receptor in the tunica media of thoracic aortas in streptozotocin-

induced hyperglycaemic rats [196]. Hyperglycaemia also increased activation of the SDF-

1/CXCR4/PI3K/Akt pathway, leading to vascular smooth muscle cell proliferation and

chemotaxis and resulting in promotion of atherosclerosis [197]. In db/db uninephrectomised

mice, a rodent model of type 2 diabetic nephropathy, SDF-1 inhibition by NOX-A12, a

ribonucleuotide inhibitor of SDF-1 expression, attenuated glomerulosclerosis, podocyte loss and

albuminuria [189]. Another major diabetic complication is diabetic retinopathy where there is

excessive capillary growth in the retina [198]. Retinal neovascularization occurs in up to 20% of

patients with diabetes [199]. In this context, intravitreal SDF-1 injection accelerated retinal

vascular development in a rodent model of proliferative retinopathy [200]. In contrast, CXCR4

inhibition resulted in reduced retinal angiogenesis in mice [201].

When assessing results obtained from rodent models of experimental diabetes, the stage of

disease must be taken into account. Neo-angiogenesis of the renal vasculature is a classic feature

of early diabetes associated with increases of angiogenic factors in the kidney such as VEGF

[202-204]. VEGF inhibition has also been shown to attenuate the early features of nephropathy

24

in diabetic rodents [137, 205, 206]. In contrast, both administration of VEGF antagonists and

high circulating levels of endogenous VEGF inhibitors may be detrimental in diabetic

nephropathy patients [207-212]. Similarly VEGF expression has been noted to be decreased in

the SNx model [32]. These observations highlight the existence of a biphasic angiogenic

response in diabetes associated kidney disease, which may be associated with an early increase

in angiogenic factor expression and endothelial proliferation, followed by progressive capillary

loss.

5.4 Renal Cell Carcinoma

Consistent with its role in promoting vessel growth, the SDF-1/CXCR4 pathway has also been

implicated in the progression of renal malignancies. In Canada, renal cell carcinoma (RCC) is the

9th

most common newly diagnosed cancer and 13th

leading cause of cancer-related death, with

clear cell renal cell carcinoma (CC-RCC) representing 85% of all kidney neoplasms [213]. CC-

RCC typically arises from the proximal tubular cells [214]. One of main reasons why CC-RCC

has such a high mortality is the high propensity for metastasis. Initially, 25% of patients present

with distant metastases at diagnosis while 30% of patients eventually develop metastasis during

the course of the disease [215, 216]. Multiple reports have suggested that the SDF-1/CXCR4

pathway is involved in the mechanism of metastasis. RCCs in general express high levels of

CXCR4 compared to normal renal tissue [217, 218], while both CXCR4 and SDF-1β expression

have been described as independent predictors of poor prognosis in RCC [216, 219-222].

25

Signaling through CXCR4 provides a variety of survival benefits for many cancer cell types

through activating invasion and metastasis, resisting cell death, sustaining proliferative signaling

and inducing angiogenesis [223]. SDF-1 also stimulates survival and proliferation in RCC [224].

Sustained proliferation significantly increases metabolic demands and in order to obtain more

oxygen and nutrients, cancer cells increase expression of various angiogenic factors. The SDF-

1/CXCR4 axis also promotes VEGF and IL-8-mediated tumor angiogenesis [225, 226].

The molecular mechanism for CXCR4 upregulation in CC-RCC is likely to be loss of function of

the vHL gene product. As discussed previously, this results in Hif-1α stabilization and

subsequently promotes CXCR4 expression. It has been estimated that approximately 70% of CC-

RCC has inactivated vHL [227, 228]. Additionally, both Hif-1α and Hif-2α are upregulated in

RCC [229-231]. Restoring vHL function in vHL-null CC-RCC cell lines reduced SDF-1/CXCR4

and matrix metalloproteinase (MMP) expression [232, 233]. MMP breaks down connective

tissues and is a key factor in mediating invasion and metastasis in CC-RCC [232].

RCC cells, which commonly display enhanced expression of CXCR4 [217, 218], exhibit organ-

specific metastasis and chemo-attraction toward tissues that express high levels of SDF-1 [61,

234] including regional lymph nodes, lung, liver and bone marrow [222]. Moreover, CXCR4

activation induces β-integrin expression, which binds to vascular cell adhesion molecule-1

(VCAM-1) on endothelial cells and promotes binding of the metastatic cancer cell to the target

tissue [235]. Additionally, sustained SDF-1 signaling results in CXCR4 nuclear translocation

that induces significantly more invasion in vivo and has been shown only in human metastatic

RCC lesions when compared to primary RCC [236]. Given the role of SDF-1/CXCR4 signaling

26

in promoting cancer cell survival and migration, therapeutic strategies have been developed that

antagonize this pathway [237, 238].

5.5 Inflammation

Differential chemokine regulation over the course of an inflammatory response plays important

roles in mediating trafficking of different immune cells. In a similar sense, during renal

development, SDF-1 and CXCR4 are expressed in a spatially and temporally restricted fashion

on podocytes and endothelial cells to direct proper morphogenesis of the capillary tuft in the

glomeruli [163, 182]. Despite its crucial role in renal development, SDF-1/CXCR4 may also be

involved in pathological situations during inflammation by promoting the recruitment of CXCR4

expressing cells. SDF-1 lacks the ELR amino acid motif, which is a common feature of

chemokines that act primarily on lymphocytes instead of neutrophils [239-241]. Lymphocytes

are typically recruited during late stages of inflammation, when pathological angiogenesis

typically occurs [242]. Consequently, inhibition of CXCR4 in chronic inflammation may be

beneficial. For instance, in the context of mineralocorticoid-induced cardiorenal fibrosis with

associated lymphocytic inflammatory pathology, CXCR4 blockade has been shown to reduce

hypertension and fibrosis [243].

5.6 Acute Renal Injury

Studies in acute kidney injury models highlight the potential for bone marrow-derived

hematopoietic stem cell (HSC) involvement in renal repair. These stem cells are highly plastic

and can differentiate into mature, non-HSCs of various organs, including the kidney [244]. Since

27

the number of HSCs increases following acute ischaemic kidney injury [245, 246], it is tempting

to speculate that these HSCs would contribute to repair. Experimental animal models of acute

kidney injury are induced by prolonged clamping of renal pedicles. In these models, SDF-1 has

been shown to be increased in post-ischaemic kidneys and plasma, but reduced in bone marrow

[247]. This has been associated with preferential migration of HSCs to the corticomedullary

region of the kidney, the part most affected by ischemic reperfusion injury [245, 248]. In human

patients with acute tubular necrosis, renal recruitment of cells expressing CD45, a

panhaematopoietic marker, appears to be driven by the SDF-1/CXCR4 axis [249].

Despite correlation of SDF-1 expression with HSC recruitment, interventional studies suggest

HSC recruitment in acute kidney injury may not be dependent on SDF-1/CXCR4 signaling. In

one study, although SDF-1 inhibition with antisense oligonucleotide treatment in acute kidney

injury models resulted in increased tubular injury and decreased renal function, no difference in

mobilization or retention of CXCR4-positive haematopoietic stem or progenitor cells was

observed [167]. Moreover, preferential HSC migration to the ischaemic damaged kidney was not

altered by local SDF-1 administration, endogenous SDF-1 neutralization or HSC-associated

CXCR4 neutralization [248], suggesting additional pathways are likely to mediate renal

recruitment of HSCs following acute renal injury. The role that HSCs may play in acute renal

injury remains controversial. Similarly, in a rodent model of CKD, Yuen et al showed that the

beneficial effects of exogenously administered bone marrow cells were not dependent on their

incorporation into renal tissue [250].

28

5.7 Human Immunodeficiency Virus (HIV)

CXCR4 has received considerable attention in the past decade because the human

immunodeficiency virus (HIV) expresses a trimeric viral protein envelope that binds to the

receptor [251-253]. Entry of HIV type 1 into T-cells requires binding to both cluster of

differentiation 4 (CD4) glycoprotein and a coreceptor [252]. The coreceptor can either be

CXCR4 for most naïve T-cell populations or CCR5 for most activated, memory subsets [254,

255]. The fact that most often, the CCR5 variants are the prevalent type during the acute phase of

infection [256, 257] suggests that the CXCR4 variant emerges in later stages of HIV infection as

patients become more symptomatic and exhibit a significant decrease in CD4+ T cell counts

[258]. Due to its similarity to CXCR4, CXCR7 can also serve as a coreceptor for certain types of

HIV [259]. Because CXCR4 is a common receptor for both SDF-1 and HIV-1, SDF-1 may be

used as a competitive inhibitor for some lymphocyte-trophic strains of HIV, thus blocking HIV

entry and serving as a potential therapy [55]. However, clinical trials of this approach have

proven unsuccessful at significantly reducing viral load [260]. Renal diseases are relatively

common in patients with HIV and are often presented clinically with a form of focal segmental

glomerulosclerosis (FSGS), but the pathomechanisms by which these changes occur are still not

clear.

5.8 Hypertensive Nephropathy

Hypertensive nephropathy, also known as nephrosclerosis, is the second most common cause of

ESRD in Canada [1, 2]. In this condition, luminal narrowing of the afferent arterioles results in

29

subsequent glomerular hypoxia [261, 262]. Neusser and colleagues recently showed that

glomerular CXCR4 mRNA and podocyte CXCR4 protein were both increased in patients with

nephrosclerosis relative to control tissue [263]. It is worth noting once again that both SDF-1 and

CXCR4 are hypoxia responsive genes, with promoters that are targets of Hif-1. Not

surprisingly, increases in CXCR4 mRNA and protein were also associated with nuclear

localization of Hif-1α, which suggests that hypoxia contributes to glomerular damage in

nephrosclerosis [263]. However, upregulation of CXCR4 in nephrosclerosis may also be a

physiological response to counter hypoxia by promoting angiogenesis.

5.9 Systemic Lupus Erythematosus (SLE)

Systemic lupus erythematosus (SLE) is an autoimmune connective-tissue disorder that involves

the production of pathogenic antinuclear autoantibodies against multiple organ systems,

including the skin, brain, kidney, lungs and heart [264, 265]. Since CXCR4 has the ability to

stimulate migration of multiple leukocyte subsets and B cell production and myelopoeisis [42,

186], inhibitors of SDF-1 or CXCR4 represent a plausible treatment of SLE. Moreover, both the

kidney and skin are major organs of increased SDF-1 and CXCR4 expression in SLE patients

[266]. Analogous to RCC, this suggests that these organs are favoured targets for circulating

inflammatory cells.

Animal models of SLE demonstrate augmented levels of SDF-1 and/or CXCR4. In lupus-prone

murine models, CXCR4 expression was increased in many inflammatory cells including naïve B

cells, plasma cells, monocytes, neutrophils [267], while SDF-1 was increased in the glomeruli

30

and renal tubules [267, 268]. However, conflicting reports in human patients have shown

circulating leukocytes to have increased [269], decreased [270, 271] or no change [272] in

CXCR4 expression. Nonetheless, antagonists against the SDF-1/CXCR4 signaling axis have

shown promise in murine models, due to significant amelioration of tubulointerstitial disease and

crescent formation [267] with relatively low toxicities of several CXCR4 antagonists such as

CTCE-9908 [267], AMD070 [273] and AMD3100 [274].

5.10 Transplantation

Rejection of allografts and donor organs involves recognition and subsequent mounting of

inflammatory responses by the recipient. SDF-1 may mediate this process in many cases of

transplantation. Higher mortality has been observed in liver allograft recipients with higher gene

frequency of the SDF-1-3’ allele [275]. SDF-1 expression is elevated in acute and chronic

rejection of both heart transplantation in response to ischemic injury [276] and renal allograft

rejection [176]. In disease settings that extensively involve inflammatory mechanisms, inhibition

of the SDF-1/CXCR4 signaling axis appears to be beneficial. For instance, infusion of anti-SDF-

1 antibody retarded the progress of chronic allograft nephropathy in rats, perhaps by impeding

attraction of CXCR4-positive immune cells [277].

Maintenance of vascular homeostasis is much like balancing a see-saw. Different diseases

involving the vasculature may be caused by a shift in balance toward the promotion or inhibition

of angiogenesis. Since the SDF-1/CXCR4 pathway promotes angiogenesis, its inhibition may be

31

beneficial in conditions characterized by pathological angiogenesis, such as early experimental

diabetic nephropathy, diabetic retinopathy and renal cell carcinoma. SDF-1/CXCR4 stimulation

may also be detrimental in conditions characterized by the recruitment of CXCR4 expressing

inflammatory cells such as SLE, inflammation and allograft rejection. On the other hand, in

acute renal injury and hypertensive nephropathy, augmentation of this pathway may be

beneficial by promoting repair through increased vessel growth and survival. Since CKD is

characterized by renal vascular rarefaction and since the SDF-1/CXCR4 axis plays a

fundamental role in renal vascular development, augmenting local SDF-1/CXCR4 signaling may

promote vascular survival while its inhibition may exacerbate renal damage.

6 The Subtotally Nephrectomized Rat Model of CKD

A number of established rodent models reflect the diverse elements of human CKD. Perhaps the

most widely studied of these, however, is the subtotally nephrectomized (SNx) rat, a well-

characterized model of progressive proteinuric disease mediated by the compensatory response

to rising intraglomerular pressures within the remnant kidney [278, 279]. In this model,

following the removal of one kidney, there are at least 2 ways of completing the subtotal

nephrectomy procedure i) ligation of two of the three or four main arteriolar branches at the

contralateral kidney, or ii) polectomy of the remaining kidney ie the surgical ligation of the renal

poles [280]. The former method that leaves infarcted tissue in place appears to induce relatively

more intense hypertension systemically, possibly due to marked upregulation of renin in the peri-

infarct zones [13, 281].

32

Initially, reduction of 5/6 of the renal mass and nephron number results in a compensatory

increase in proliferation of glomerular and peritubular endothelial cells for 1-2 weeks [32, 282].

Loss of nephron numbers also means loss of overall glomerular filtration rate (GFR).

Consequently, preglomerular and postglomerular arterioles appear to initiate adaptive responses

to reduce arteriolar resistances that lead to increases in glomerular capillary flow rate and mean

glomerular capillary hydraulic pressure such that hyperfiltration in the remaining glomeruli

occurs [283]. At first, this change is beneficial, as it minimizes the reduction in GFR that would

otherwise take place [13]. However, this also results in a rise of glomerular capillary pressure

[283-285] that appears to damage the endogenous glomerular cell populations similar to the

manner that systemic hypertension damages arterial vessels. In fact, all three glomerular cell

types show abnormalities in the SNx model [13]. Endothelial cells show lifting, membranous

whorls and microvillus formation; epithelial cells show protein droplet and microvilli formation

and foot process fusion; mesangial cells are hyperactive and are responsible for mesangial

thickening [13].

The pathophysiological responses to renal mass ablation lead to progressive proteinuria and renal

insufficiency alongside mesangial expansion, segmental glomerulosclerosis and tubulointerstitial

fibrosis [281, 286, 287]. One of the key histological changes in these animals is the significant

renal capillary rarefaction that accompanies the advancing renal disease [32, 202, 288, 289].

Thus the SNx rat represents an excellent model to study the role of angiogenic systems in CKD.

For instance, in 2003, Kelly et al showed that VEGF expression was reduced in SNx rats and

suggested that this reduction may contribute to glomerular endothelial cell loss [290].

Furthermore, blockade of the renin-angiotensin system, the current mainstay of treatment for

33

CKD, normalized both VEGF mRNA and glomerular endothelial density [290]. These studies

associate loss of angiogenic factors, such as VEGF, with impaired angiogenesis and progressive

renal decline. Preservation of renal vasculature in this model may provide clues to novel

therapeutic strategies for CKD patients.

The SNx model bears pathophysiological similarity to the kidney injury that is observed in

patients with secondary focal segmental glomerulosclerosis (FSGS) [291]. FSGS is the most

common cause of ESRD due to a primary glomerular disease in North America. Primary FSGS

arises directly due to dysfunction in components of the glomerulus, while secondary FSGS arises

from damage mediated by non-glomerular sources, such as diabetes, hypertension and obesity

[292]. FSGS is considered to account for over 35% of cases of idiopathic nephrotic syndrome

[293-296]. Common histopathological features between the kidneys of SNx rats and patients

with secondary FSGS include renal microvasculature loss and interstitial fibrosis [297].

Similarly, patients who have lost more than 50% of the renal mass may also exhibit

hypertension, glomerulosclerosis, proteinuria and renal insufficiency, analogous to the changes

observed in the SNx model [298-302].

7 The CXCR4 Antagonist, AMD3100

Many studies aimed at defining the role of SDF-1/CXCR4 in (patho)physiology have utilized the

small molecule, AMD3100 (Plerixafor or Mobozil™), a specific, tight binding yet slowly

reversible antagonist of CXCR4 [303]. AMD3100 is a non-peptide molecule with two 1,4,8,11-

tetraazacyclotetradecane (cyclam) moieties connected by a conformationally constraining linker.

34

The bicyclam rings form a chelate complex with bivalent metal ions, particularly with zinc (II)

[304]. The potency and specificity of AMD3100 is confirmed by its half maximal inhibitory

concentration (IC50) for calcium flux of 572±190nM vs. >100µM for CCR1, CCR2b, CXCR3,

CCR4, CCR5 and CCR7 [303]. Initially, this compound was found to have anti-HIV attributes

even before the molecular mechanisms of inhibition were fully realized [305]. AMD3100 binds

to the CXCR4 receptor through three primary acid residues: Asp171

(AspIV:20), Asp262

(AspVI:23) and Glu288

(GluVII:06) in an irreversible or very slowly reversible manner [306-

308]. The bicyclam rings interact with Asp171

and Asp262

while the addition of zinc (II) increases

the affinity of AMD3100 to CXCR4 through interaction with Asp262

[304, 306].

Although AMD3100 is no longer being developed as an anti-HIV agent, it remains available for

other clinical uses. In December 2008, the FDA granted approval for AMD3100 to enhance HSC

mobilization into the peripheral bloodstream before autologous transplantation, indicated for the

treatment of multiple myeloma or non-Hodgkin’s lymphoma [309]. AMD3100 has also been

employed to study the effects on endothelial cells. Sameermahmood and colleagues, for

example, demonstrated that AMD31000 mitigated SDF-1-induced migratory effects in cultured

human retinal endothelial cells and inhibited Akt and eNOS phosphorylation and activation in a

dose-dependent manner [100]. Consistent with the angiogenic properties of the SDF-1/CXCR4

signaling pathway, in vitro AMD3100 administration has been found to attenuate tube formation

in HUVECs [310]. In vivo, AMD3100 has been shown to attenuate angiogenesis in murine

models of asthma [311] and pathological vascular development in the retina [201].

35

Administration of the CXCR4 antagonist, AMD3100, to SNx rats (characterized by renal

capillary rarefaction [288]) may be a useful means to establish a role for this axis in the CKD

setting.

36

Chapter 2 Hypothesis and Research Aims

1 Hypothesis

Almost regardless of their aetiology, CKDs are characterized by renal capillary rarefaction.

Previous experience in the study of angiogenic systems has revealed that pro-angiogenic

pathways, essential for renal vascular development, are often recapitulated in the disease setting.

Although the SDF-1/CXCR4 pathway has recently been defined as a novel mediator of renal

vascular development, its role in adult renal vasculature homeostasis and in CKD has not yet

been established. Accordingly, we hypothesize that the SDF-1/CXCR4 pathway will be

altered in CKD and that antagonism of this pathway will accelerate renal decline through

augmentation of capillary loss. Furthermore, given the previously described role of eNOS as a

downstream mediator of SDF-1/CXCR4 signaling and given the known role of eNOS in

maintaining renal homeostasis, we further hypothesize that the SDF-1/CXCR4 pathway

regulates renal endothelial function through eNOS-dependent mechanisms.

37

2 Research Aims

1) To precisely define the sites of expression of SDF-1 and CXCR4 in the adult kidney.

2) To determine the expression of SDF-1 and CXCR4 in the kidneys of SNx rats.

3) To evaluate the effect of chronic CXCR4 antagonism on renal structure and function in

SNx rats.

4) To determine the effect of chronic CXCR4 antagonism on microvascular integrity in SNx

rats.

5) To elucidate whether the SDF-1/CXCR4 axis induces local signaling through eNOS

activation in the adult kidney.

6) To define the role of SDF-1/CXCR4/eNOS in regulating endothelial migration,

proliferation and tube formation.

7) To determine whether the SDF-1/CXCR4 pathway is also dysregulated in the kidneys of

patients with secondary FSGS.

In the following chapters, descriptions of the Materials and Methods, Results, Discussion and

Conclusion have been written in detail. A condensed version has been submitted as a manuscript

and is under review.

38

Chapter 3 Materials and Methods

1 Human Studies

Localization of CXCR4 and SDF-1 was determined in kidney sections from patients who had

undergone nephrectomy for tumor, with normal kidney tissue removed from the opposite pole, as

previously described [312]. For gene expression studies, archival formalin-fixed paraffin-

embedded kidney tissues were obtained from patients with either clinically correlated secondary

FSGS or time zero live kidney donors.

All patients gave informed consent and the study was performed in accordance with the

Declaration of Helsinki. The studies were approved by the Institutional Research Board of the

Health Sciences Centre, University of Manitoba.

2 Animals

2.1 General

With the exception of the ACE inhibitor studies described in Section 2.7 below, all animal

experiments were conducted in female Fischer 344 rats (F344, Charles River, Montreal, Quebec)

aged 8 weeks. AMD3100 (Cayman Chemical, Ann Arbor, MI) was dissolved in PBS at room

39

temperature before subcutaneous (s.c.) administration. Recombinant SDF-1 (PeproTech, Rocky

Hill, NJ) was diluted in PBS at room temperature before infusion. AMD3100 and recombinant

SDF-1 were stored in dry powder form at -20°C.

All experimental procedures adhered to the guidelines of the Canadian Council on Animal Care

and were approved by St. Michael’s Hospital Animal Care Committee.

2.2 Subtotal Nephrectomy and Sham Surgery

Female F344 rats, aged 8 weeks were anesthetized in a supine position with 2.5% inhaled

isoflurane and the abdomen was opened through a midline incision extending from the xiphoid

process to the symphysis pubis. After ligation of the right renal pedicle, the right kidney was

removed via subcapsular nephrectomy. The left kidney was harnessed to the ventral position in

order to dissect the left renal artery and reveal the branches. Infarction of approximately two

thirds of the left kidney was achieved via selective ligation of two out of the three or four

branches of the left renal artery with silk sutures. Sham surgery consisted of laparotomy and

manipulation of both kidneys before wound closure. The abdominal wounds were closed with

vicryl sutures and the skin wound was closed with surgical staples.

2.3 SDF-1/CXCR4 Expression Study

A flow diagram illustrating this study design is available (Supplementary Figure 2). Localization

and expression of CXCR4, SDF-1 and TGF-ß mRNA were determined in the kidneys of sham

40

(n=6) and SNx (n=8) rats at eight weeks post-surgery as previously described [288]. At sacrifice,

kidney tissue was collected and flash frozen in liquid nitrogen and stored at -80oC for subsequent

biological molecular analysis.

2.4 Confirming Efficacy of AMD3100

To confirm efficacy of AMD3100 at 1mg/kg/day dosing, a separate group of female F344 rats

(n=5) received a single injection of AMD3100 via a subcutaneous (s.c.) route, with white blood

cell count determined by a LH 700 series Coulter counter (Beckman Coulter, Brea, CA) at

baseline (0 h) and 4 h post-dose.

2.5 Chronic CXCR4 Inhibition Study

A flow diagram illustrating this study design is available (Supplementary Figure 3). For the

study of chronic CXCR4 antagonism, female F344 rats aged eight weeks underwent sham or

subtotal nephrectomy surgery. Two days later animals were further randomized to receive either

vehicle (PBS) or AMD3100 at a dose of 1mg/kg/day s.c. (sham, PBS n=18, AMD3100 n=12;

SNx, PBS n=14, AMD3100 n=15). After 8 weeks, assessments were made of GFR, urine protein

excretion and systolic blood pressure (SBP) as outlined below. At sacrifice, kidney tissue was

collected and either fixed in 10% neutral buffered formalin (NBF) before embedding in paraffin

for subsequent histological processing, flash frozen in liquid nitrogen and stored at -80oC for

41

subsequent molecular biological analysis, or perfused for fluorescent microangiography (FMA)

as outlined below.

2.5.1 Glomerular Filtration Rate Measurement

GFR was determined by FITC-inulin clearance, using an adaptation of the protocol

recommended by the Animal Models of Diabetes Complications Consortium (AMDCC)

available at: http://www.diacomp.org/shared/showFile.aspx?doctypeid=3&docid=28.

5% FITC-inulin (Appendix) was delivered to the tail-vein at a dose of 3.74ml/kg. A small

amount of Vaseline was applied to the tail to facilitate collection of blood. Approximately 20μL

of blood was collected in a heparinized tube at 3, 7, 10, 35, 55 and 75 min post injection of

FITC-inulin. Plasma was isolated after centrifugation in a mini-centrifuge for two min. In a 96-

well plate, 10μL of plasma was added to 90μL of 500mM HEPES buffer (Appendix) in each

well. Fluorescence was determined using SpectraMax M5e (Molecular Devices, Sunnyvale, CA)

with 485nm excitation and read at 538nm emission.

2.5.2 Metabolic Caging and Urine Protein Excretion Measurement

Rats were housed individually in metabolic cages for 24 h with free access to reverse osmosis

water and standard rat diet. Urine protein concentration was determined with the benzethonium

chloride method on an Olympus analyzer.

42

2.5.3 Systolic Blood Pressure Measurement

Systolic blood pressure was determined at sacrifice using a 2F micro-manometer (Model SPR-

838 Millar Instruments, Houston, TX) and analyzed using Chart Software v5.6 (AD Instruments,

NSW, Australia).

2.5.4 Fluorescent Microangiography (FMA)

FMA was performed as previously described [288]. Rats (3/group) were anesthetized with 2%

isoflurane in a supine position. The abdomen was opened through a midline incision extending

from the xiphoid process to the symphysis pubis and the abdominal aorta dissected from the

level of the superior mesenteric artery to its bifurcation. The abdominal aorta was then ligated

proximal to the renal artery and distally at the level of the aortic bifurcation. Heparinized saline

(1ml, 100U/ml heparin, 0.9% NaCl), followed by 1ml of 3% KCl was delivered via a 30G

needle. Immediately after heparinization, the kidney was perfused, at systolic pressure, with

100ml of 0.9% saline using an 18G angiocath with perfusion-exsanguination facilitated by

severance of the external jugular vein. The pre-warmed (40oC) agarose-fluorescent microbead

mixture (Appendix) was then delivered via the angiocath. To ensure the fluorescent beads were

fixed in the renal vasculature, the rat was cooled on ice for 10 min immediately following

infusion. The kidney was removed and immersion fixed in 10% NBF for 48 h at 4oC. Tissues

were kept in the dark to prevent photobleaching. After fixation, 200µm thick kidney cross-

sections were obtained using a vibrating-blade microtome (VT100SR, Leica, Nussloch,

Germany) with a cutting speed of 0.025mm/s and vibration frequency of 100 Hz. To clear the

43

tissue and decrease light scattering, sections were washed in PBS overnight and incubated in

serial concentrations of water soluble embedding medium (2,2’-thiodiethanol [TDE, Sigma]) at

25%, 50% and 75% TDE for 10 min each before mounting in 95% TDE. Serial images were

collected with a confocal microscope (Leica TCS SL, Leica, Richmond Hill, ON; St. Michael’s

Hospital Bioimaging Facility) across the z-stack (0.8141µm steps) and the fluorescent

microspheres were viewed with an argon laser (excitation 488nm, emission 515nm). Six

glomeruli were evaluated from each animal. Glomerular capillary volume was calculated by

pixel counting using ImageJ version 1.39 (National Institutes of Health, Bethesda, MD).

Capillary volume was determined as the product of the positive pixel area in each profile and the

distance between each optical image (0.8141µm). Three dimensional reconstructions were

generated using Neurolucida (MBF Bioscience, Williston, VT).

2.6 Acute in vivo SDF-1 Infusion Study

A flow diagram illustrating this study design is available (Supplementary Figure 4). In this study,

recombinant rat SDF-1 was delivered to the kidneys of 8 week old female F344 rats with or

without pre-treatment with AMD3100. Glomeruli were isolated through a differential sieving

technique and blotted for protein. This study is described, in detail, below.

2.6.1 SDF-1 Infusion

Rats (n=6/group) were randomized to receive either vehicle (PBS) or AMD3100 (1mg/kg) s.c. 4

h before delivery of recombinant SDF-1 via the abdominal aorta. For local SDF-1 delivery, rats

44

were anesthetized in a supine position with 2.5% inhaled isoflurane and kept on a TOPO™ Dual

Mode ventilator (Kent Scientific, Torrington, CT) for the entire duration. The abdomen was

opened through a midline incision extending from the xiphoid process to the symphysis pubis

and the abdominal aorta dissected from the level of the superior mesenteric artery to its

bifurcation. In order to direct the initial full dose of either vehicle (PBS) or SDF-1 to one of the

two kidneys, the right kidney was removed via subcapsular nephrectomy and the descending

aorta was ligated distal and transiently ligated proximal to the renal artery. Either vehicle (PBS)

or SDF-1 (10μg/kg [313]) was delivered in a 1ml volume to the descending aorta at the level of

the renal arteries via an 18G angiocath. Following delivery, circulation into the left kidney was

restored for 30 min by releasing the ligation on the descending aorta proximal to the renal artery.

The left kidney was then flushed with heparin (100U), followed by 1ml of PBS with perfusion-

exsanguination facilitated by severance of the external jugular vein. The left kidney was removed

and immediately immersed in ice cold PBS.

2.6.2 Glomerular Isolation

Glomeruli were isolated from the excised kidney by differential sieving as described by

Burlingtron and Cronkite [314]. Briefly, the freshly excised kidney was diced with a scalpel in a

Petri dish with cold PBS on ice. The diced kidney were pressed with a sterile rubber spatula

through a stainless steel screen 250μm pore size and rinsed with ice cold PBS through successive

screens of 150μm and 75μm pore sizes. Glomeruli were collected from the 75μm pore size

screen and centrifuged in a Sorvall Legend RT+ centrifuge (Thermo Scientific, Waltham, MA)

for 5 min at 4°C, 3000 RPM (approximately 1300 RCF). The precipitate was transferred into a

45

1.5mL centrifuge tube and further centrifuged in an Eppendorf Refrigerated Microcentrifuge

5415R (Eppendorf, Hamburg, Germany) for 2 min at 4°C, 800 RCF. The supernatant was

removed and the precipitate was resuspended and digested in 200μL of lysis buffer (Cell

Signaling Technology, Danvers, MA) on ice for 15 min. The digest was centrifuged in the

Eppendorf Refrigerated Microcentrifuge 5415R for 15 min at 4°C, 1.61×104 RCF and the

supernatant containing the lysate was collected and assayed for protein content before

proceeding with the Western blot analysis as outlined below.

2.7 Angiotensin Converting Enzyme (ACE) Inhibition Study

A flow diagram illustrating this study design is available (Supplementary Figure 5). To

determine the effect of ACE inhibition on renal SDF-1 expression, real-time PCR was performed

on kidney tissue from cohorts of sham and SNx rats, previously reported [290], that had been

treated with either vehicle (sham n=8, SNx n=7) or the ACE inhibitor perindopril (8mg/L/day in

drinking water for 12 weeks, SNx n=8).

3 Histology

46

3.1 Tissue Sectioning

Formalin fixed kidney tissue embedded in paraffin wax was placed on ice for 30 min before

sectioning on a Leica RM2125RT rotary microtome (Leica Microsystems GmbH, Wetzlar,

Germany). The blade on the microtome was set at an angle of 3°. Sections were cut at 3μm,

collected with forceps and allowed to spread over a warm water bath for 30s set at 37°C.

Sectioned tissues were mounted on positively charged microscope slides (Globe Scientific Inc.,

Paramus, NJ) and dried for 48 h in an incubator at 37°C.

3.2 Immunohistochemistry

Immunohistochemistry was performed on sectioned formalin fixed paraffin embedded kidney

tissues over a period of two days as previously described [37, 312, 315]. On the first day,

sections were dewaxed by three successive incubations in xylene. The sections were then

progressively rehydrated in two incubations in 100% ethanol and one incubation in 70% ethanol

for 3 min each, followed by in two incubations in distilled H2O and one incubation in PBS at 5

min each. Antigen retrieval was performed by incubating the sections in citric acid buffer

(Appendix) while heating in a microwave at high power for 10 min. The sections were allowed

to cool for 20 min before washing once in PBS for 5 min. To block endogenous peroxidase

activity, the sections were incubated in 3% H2O2 for 5-10 min before washing twice in PBS for 5

min each.

Subsequent procedures involved incubation in a very small volume of solution. Therefore, a wax

pen was used to trace around each section on the slide to prevent the solution from spreading out

47

and to ensure maximum exposure of the sectioned tissues to the solutions. The sections were

blocked with approximately 1-2 drops of serum-free protein block solution (Dako, Burlington,

Ontario), straight from the bottle and incubated for 60 min. The blocking solution was washed

off three times with PBS with 5 min between each wash. Primary antibodies (100μL) were added

to the sections in the following concentrations: SDF-1 1:25 (R&D Systems, Minneapolis, MN),

CXCR4 1:50 (Abcam, Cambridge, MA), collagen IV 1:100 (Southern Biotech, Birmingham,

AL), JG-12 1:1000 (Bender MedSystems GmbH, Vienna, Austria), WT1 1:1000 (Santa Cruz

Biotechnology, Santa Cruz, CA) and nephrin 1:500 (R&D Systems, Minneapolis, MN).

Incubation with PBS instead of primary antiserum served as the negative control. Slides with

either primary antibody or PBS were incubated overnight at 4°C.

On the second day, tissues were washed three times with PBS, with 5 min between each wash.

Tissues were incubated with 1-2 drops of the appropriate HRP-conjugated secondary antibodies

straight from the bottle for 60 min at room temperature: anti-mouse (DakoCytomation,

Carpinteria, CA) and anti-goat (DakoCytomation). The secondary antibodies were washed off

with PBS twice, with 5 min between each wash. Sections were labeled with Liquid

Diaminobenzidine and Substrate Chromogen System (DakoCytomation) before counterstaining

in Mayer’s haematoxylin for 20s and washing off the excess haematoxylin under running tap

water for 3-10 min. Tissues were quickly incubated in Scott’s Tap Water for 15s and immersed

in distilled H2O for 5 min. Finally, the tissues were progressively dehydrated in one incubation in

70% ethanol, three consecutive incubations in 100% ethanol and three consecutive incubations in

xylene for 3 min each before applying the coverslip to the slides.

48

3.3 Periodic Acid-Schiff (PAS) Stain

PAS staining was performed on sectioned formalin fixed paraffin embedded kidney tissues over

a period of 2 h as previously described [37, 250]. Sections were dewaxed by three successive

incubations in xylene. The sections were then progressively rehydrated in two incubations in

100% ethanol and one incubation in 70% ethanol at 3 min each, followed by three incubations in

distilled H2O at 5 min each. The sections were oxidized by incubating in 2-4 drops of periodic

acid for 30 min at room temperature, with the periodic acid pre-warmed to room temperature.

The periodic acid was washed off in three incubations in distilled H2O at 5 min each. Schiff

Reagent pre-warmed to temperature (2-4 drops) was applied to the tissue and incubated for 30

min at room temperature. The Schiff Reagent was washed off under warm tap water for 10 min

before briefly dipping twice in Mayer’s haematoxylin and washing off the excess haematoxylin

under running tap water for 5 min. Sections were quickly dipped in Scott’s Tap Water once and

washed under running tap water for 2 min. Finally, the tissues were progressively dehydrated in

one incubation in 70% ethanol and two consecutive incubations in 100% ethanol at 1 min each,

followed by three consecutive incubations in xylene for 3 min each before applying the coverslip

to the slides.

3.4 Glomerulosclerosis Index (GSI)

A minimum of 24 glomeruli were examined in PAS-stained kidney sections from each rat. The

degree of sclerosis was subjectively graded on a scale of 0 to 4 as previously described [37]:

grade 0, normal; grade 1, sclerotic area up to 25% (minimal); grade 2, sclerotic area 25% to 50%

49

(moderate); grade 3, sclerotic area 50% to 75% (moderate to severe); and grade 4, sclerotic area

75% to 100% (severe). Glomerulosclerosis was defined as basement membrane and Bowman’s

capsule thickening, mesangial hypertrophy and capillary occlusion. A glomerulosclerosis index

(GSI) was then calculated using the formula:

GSI

Where Fi is the percentage of glomeruli in the rat kidney with a given score (i).

3.5 Immunohistochemistry Analysis

Kidney sections were scanned with the Aperio ScanScope System (Aperio Technologies Inc.,

Vista, CA) and analyzed using ImageScope (Aperio) in a masked manner. Estimation of

glomerular endothelial (JG-12) and nephrin immunostaining was determined as the proportional

area of JG-12 or nephrin immunostaining in 30 glomerular profiles from each rat kidney section

as previously described [37, 288]. Average podocyte number per glomerular profile was

determined as the number of WT1 positively immunostained nuclei in 30 glomerular profiles

from each rat kidney section. For estimation of tubulointerstitial collagen IV or tubulointerstitial

capillary endothelium, the proportional area of collagen IV or endothelial (JG-12)

immunostaining (excluding glomeruli), respectively, was determined in 10 randomly selected

cortical fields (×100 magnification).

50

4 Cell Culture

4.1 Cell Lines Used

In vitro experiments were conducted in NRK-49F renal fibroblasts at passage 10-15 (ATCC,

Manassas, VA) [316], human umbilical vein endothelial cells (HUVECs) at passage 5 [37, 317]

and C57BL/6 and eNOS-/-

mouse renal glomerular endothethelial cells (RGECs) at passage 3

(Cell Biologics, Chicago, IL). Isolation of the renal glomerular endothelial cells is outlined in the

next subsection, RGEC Isolation. Incubation chambers were set at 37°C and 5% CO2. Cell

culture media used were DMEM (Wisent, St.Bruno, Quebec) for NRK-49F renal fibroblasts,

EBM-2 (Lonza, Basel, Switzerland) for HUVECs and Mouse Endothelial Cell Medium (Cell

Biologics, Chicago, IL) for RGECs. Each experiment was performed in triplicate with the

exception of transwell migration which was performed in duplicate.

4.1.1 Renal Glomerular Endothelial Cell Isolation

RGECs were purchased from Cell Biologics and were obtained from wildtype and eNOS-/- mice

by a two-step magnetic bead procedure. The following method was summarized by

representatives from Cell Biologics and was not performed by the author of this thesis. Briefly,

anesthetized C57BL/6 or eNOS-/-

mice were perfused with Dynabeads diluted in phosphate-

buffered saline through the heart. The kidneys were removed, minced, and digested in

collagenase-A. Glomeruli-containing Dynabeads were gathered by a magnetic particle

51

concentrator and washed with Hank’s Balanced Salt Solution (HBSS). The tissues isolated by

magnetic beads were cultured on a gelatin coated culture dish. The cells were then harvested and

incubated with anti-intracellular adhesion molecule-2 (ICAM-2) antibody-conjugated

Dynabeads. After the incubation period, the cell suspension was attached to a magnetic column

and the unbound cells were aspirated. Cells bound to the anti-ICAM-2 antibody-conjugated

Dynabeads were washed once with HBSS and digested with trypsin. The cells released from the

magnetic beads were separated, washed, and suspended in Cell Biologics cell growth medium.

Endothelial cells were characterized by their cobblestone morphology and vascular-endothelial-

cadherin (VE-cadherin) or von Willebrand Factor (vWF) expression using fluorescent antibodies

and Dil-Ac-LDL uptake.

4.2 Transforming Growth Factor-ß (TGF-β) Experiments

To determine the effect of transforming growth factor ß (TGF-ß)-mediated fibroblast activation

on SDF-1 expression, NRK-49F cells were treated with either vehicle (0.1% DMSO) or 10ng/ml

of recombinant rat TGF-β (R&D Systems) for 24 h before collecting and lysing for real-time

PCR.

4.3 SDF-1/CXCR4/PI3K /eNOS Signaling

HUVECs were pre-incubated with 20µM LY294004 (LC Laboratories, Woburn, MA), 1µM

AMD3100 or vehicle (0.1% DMSO) for 30 min before the addition of recombinant human SDF-

52

1 (100ng/ml) (R&D Systems) or vehicle, (1% BSA) for 30 min. Cells (5×105 for each

experiment) were collected and lysed for immunoblotting.

4.4 Proliferation Assay

Cell proliferation was determined by MTT assay (ATCC, Manassas), as previously described

[316]. C57BL/6 and eNOS-/-

RGECs were plated (105 cells per assay) and serum starved

overnight before supplementation of the culture media with recombinant mouse SDF-1

(100ng/ml) (R&D Systems) or vehicle (1% BSA) for 24 h. Yellow tetrazolium MTT (3-(4, 5-

dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide, 10μl) was added and incubated for 2 h.

MTT is reduced into purple formazan by mitochondrial reductase that is active in viable cells.

Detergent reagent (100μL) included in the kit was added to lyse the cells and solubilize the

formazan. The plate was incubated at room temperature in the dark for 2 h before measuring the

absorbance by SpectraMax M5e at 570nm. Optical density was normalized to respective vehicle-

treated controls.

4.5 Transwell Migration Assay

Transwell migration of C57BL/6 and eNOS-/-

RGECs was determined using a 24 well

ThinCert™ cell culture insert (8μm pore size) (Greiner Bio-One, Frickenhausen, Germany).

Cells were plated and serum starved in serum free medium, EBM-2 MV (Lonza, Basel,

Switzerland) overnight before trypsinization. EBM-2 was added to deactivate the trypsin.

53

RGECs were added to the upper chamber (Boyden chamber insert) at 2.5105/well, with

recombinant mouse SDF-1 (100ng/ml) (or vehicle, 1% BSA) added to the lower chamber

(Boyden companion plate). Each Boyden companion plate required 500μL of EBM-2 and each

Boyden chamber insert required 250μL of EBM-2. After 24 h of incubation, the Boyden

chamber insert was removed and non-migrating cells in the inside of the insert that did not

migrate were gently scraped off with a cotton swab. Using another cotton swab, but dipped in

EBM-2, the inside of the insert was washed. Cells were fixed and stained with Kwik-Diff reagent

kit (Thermo Scientific, Waltham, MA), in which the outer surface of the insert was dipped into

the three solutions for 30s each. The inserts were next rinsed by swirling in a beaker of distilled

water. The inserts were then covered by a box and dried overnight on the bench. The next day, a

scalpel was used to extract the membrane. The membrane was placed with the outer surface that

contains the cells facing down on a microscope slide with a drop of immersion oil already in

place. Another drop of immersion oil was added and the membrane was covered with a cover

slip. Nail polish was used to seal the cover slip on the slide. Cells were counted in three non-

overlapping fields at ×160 magnification.

4.6 Matrigel Angiogenesis

C57BL/6 and eNOS-/-

RGECs were plated (2.5×104 per experiment) on LDEV-Free Basement

Membrane Matrix (BD Biosciences, Franklin Lakes, NJ) and incubated in the presence of

recombinant mouse SDF-1 (100ng/ml) or vehicle (1% BSA) for 6 h. Images were taken from a

Nikon Eclipse TS100 microscope (Nikon Instruments Inc., Melville, NY) [37]. Images were

analyzed for tube formation using ImageJ version 1.39 (National Institutes of Health). The

54

segmented line tool was used to outline the tubes in the image and the measure tool was used to

obtain the length. To avoid measuring the same tube twice, the backspace key was used

following every measurement to highlight the tubes that had already been measured. The sum of

all measurements for each image was taken to be the total tube length for each experiment.

5 Immunoblotting

5.1 Protein Concentration Determination

Tissue and cell protein concentrations were determined using a Bio-Rad DC Protein Assay (Bio-

Rad, Hercules, CA) as previously described. In a clear, F-bottom, 96-well cell culture plate

(Greiner Bio-One, Frickenhausen, Germany), 5μL of protein sample was added with 225μL of

Bio-Rad DC Protein Assay Buffer (Bio-Rad), which includes 25μL of Reagent A and 20μL of

Reagent B. Due to high protein concentration of the tissue lysates, sample from tissues were

initially diluted 1:5. Protein concentration was assayed using SpectraMax M5e.

5.2 Gel Electrophoresis

Immunoblotting was performed as previously described [317]. First, 5μl of loading dye (Cell

Signaling) was mixed with 20μg of protein sample and topped up to 25μl of total volume with

sample buffer (Appendix). The sample was then heated for 5 min at 95°C in a heating block. The

55

samples were centrifuged and loaded into the individual wells of pre-cast 4-20% tris-glycine gel

(Life Technologies, Burlington, Ontario). A protein ladder (5μL, 50bp, Cell Signaling) was also

loaded to confirm the final protein. Samples were ran in 1× running buffer (Appendix) at 100

volts for 30 min, then 120 volts for another 60 min.

5.3 Transfer to Nitrocellulose Membrane

Two pieces of sponge, three pieces of filter paper and one piece of nitrocellulose membrane were

soaked in ice cold transfer buffer (Appendix). The tris-glycine gel was removed from the plastic

holders and placed in transfer buffer. Materials for transfer were placed in the transfer cassette in

the following order: i) one piece of sponge, ii) two pieces of blotting paper, iii) tris-glycine gel,

iv) nitrocellulose membrane, v) one piece of blotting paper, and vi) one piece of sponge. The

transfer cassette was closed and the samples were transferred at 100 volts for 120 min. At the end

of the transfer, the tris-glycine gel was discarded and the nitrocellulose membrane was washed

gently with distilled H2O before storing in tris-buffered saline (TBS) until ready to proceed to

detection.

5.4 Detection

The nitrocellulose membrane was rinsed with 1% tween-TBS (T-TBS) for 5 min. Then, the

nitrocellulose was blocked in 5% blocking solution (Appendix) for 1 h on a VWR Signature™

Rocking Platform Shaker (VWR International, Radnor, PA) at 30 RPM. After blocking, the

56

nitrocellulose membrane was washed three times with T-TBS for 5 min each before the addition

of primary antibodies in the following concentrations: phospho-eNOS Ser1177 1:1000 (Cell

Signaling), total eNOS 1:1000 (Cell Signaling). Incubation with primary antibodies continued

overnight at 4°C.

The next day, the primary antibody was removed and the nitrocellulose membrane was washed

once with T-TBS and twice with TBS, 5 min each. The nitrocellulose membrane was incubated

for 1 h at room temperature with the following horseradish peroxidase-conjugated secondary

antibodies at concentrations of 1:5000: goat anti-rabbit (Bio-Rad, Hercules, CA) and goat anti-

mouse (Bio-Rad). After incubation, the secondary antibody was removed and the nitrocellulose

was washed three times with TBS, 5 min each. Proteins were detected by

electrochemiluminescence system (Amersham, Buckinghamshire, UK) as follows. The

nitrocellulose was soaked in the detection solution for 2 min and placed between two

transparency films. In the dark room, one piece of film was placed over the membranes and

exposed for approximately 120s. Densitometry was performed using ImageJ version 1.39. To

reprobe the same nitrocellulose membrane, the antibodies were stripped using Restore™

Western Blot Stripping Buffer (Thermo Scientific, Rockford, IL) with 1% SDS and 25mM

glycine at pH=2. After 1 h of incubation, the stripping buffer was washed off with TBS before

reprobing.

57

6 Real-time PCR

Gene expression was determined in frozen rat kidney tissue, cultured cell extracts and archival

human biopsy tissue as previously described [312]. Frozen rat kidney tissue, stored at -80oC, was

homogenized (Polytron, Kinematica GmbH, Littau, Switzerland) and total RNA was isolated

using TRIzol reagent (Life Technologies, Grand Island, NY). Total RNA (4µg) was treated with

RQ1 DNAse (1U/µl) (Promega) to remove genomic DNA. For in vitro experiments, RNA

isolation and DNase treatment of cultured cell extracts were performed using RNAspin Mini (GE

Healthcare, Buckinghamshire, UK). DNase treated RNA (4µg) was reverse-transcribed in a final

volume of 25µl using 0.5µl of High Capacity cDNA Reverse Transcriptase (Applied Biosystems,

Foster City, CA) in the manufacturer’s buffer containing 1mmol/L dNTPs, 0.5µl RNase inhibitor

(Applied Biosystems) and 2µg random hexamers (Amersham). Total RNA was extracted from

human tissue using a Paradise Plus Reagent System (Arcturus, Mountain View, CA).

Measurement of gene expression was performed using SYBR green on an ABI Prism 7900HT

Fast PCR System (Applied Biosystems, Foster City, CA). Sequence specific primers were

designed by Primer Express® Software version 2.0 (Applied Biosystems), with original target

sequences obtained from GenBank. Final primer sequences were double checked on BLASTN

for specificity. All sequence specific primers were obtained from ACGT Corp. (Toronto,

Ontario). Primer sequences were: rat CXCR4, forward ATCATCTCCAAGCTGTCACACTCC,

reverse GTGATGGAGATCCACTTGTGCAC; rat SDF-1, forward

GCTCTGCATCAGTGACGGTAAG, reverse TGGCGACATGGCTCTCAAA; rat RPL13a,

forward GATGAACACCAACCCGTCTC, reverse CACCATCCGCTTTTTCTTGT; rat 18S,

forward ATGTGGTGTTGAGGAAAGCAGAC, reverse

58

GGATCTTGTATTGTCGTGGGTTCTG; rat TGF-ß, forward CACCCGCGTGCTAATGGT,

reverse TGTGTGATGTCTTTGGTTTTGTCA; human CXCR4, forward

TGACGGACAAGTACAGGCTGC, reverse CCAGAAGGGAAGCGTGATGA; human SDF-1,

forward AATTCTCAACACTCCAAACTGTGC, reverse TGCACACTTGTCTGTTGTTGTTC;

human RPL32, forward CAACATTGGTTATGGAAGCAACA, reverse

TGACGTTGTGGACCAGGAACT. Experiments were performed in triplicate and data analysis

was performed using Applied Biosystems Comparative CT method.

7 Statistics

Data are expressed as means ± SEM except numerical proteinuria data which are presented as

geometric mean / tolerance factor. Geometric mean is defined the antilog of the arithmetic

mean of the logarithms of the individual values. Tolerance factor is defined as the antilog of the

standard error of the mean of the log of the individual values. Statistical significance was

determined by one-way ANOVA with a Newman-Keuls post-hoc comparison or Student’s t-test

where appropriate. All statistical analyses were performed using GraphPad Prism 5 for Mac OS

X (GraphPad Software Inc., San Diego, CA). A p<0.05 was considered statistically significant.

59

Chapter 4 Results

1 Localization of CXCR4 and SDF-1 in adult human

kidney tissue

Immunostaining of adult human kidney tissue confirmed the presence of CXCR4 protein within

endothelial cells of the glomerular and peritubular capillaries as well as within podocytes (Figure

1A-C). SDF-1, by contrast, was present within podocytes, arteriolar smooth muscle and

endothelial cells, epithelial cells of Bowman’s capsule, interstitial fibroblasts and scattered distal

tubular cells, with only weak, focal immunostaining within renal glomerular endothelial cells

(Figure 1D-F).

60

Figure 1. Localization of CXCR4 (A-C) and SDF-1 (D-F) in adult human kidney tissue. (A and D) Original

magnification ×160. (B,C and F) Original magnification ×400. CXCR4 immunostaining is evident in a

discontinuous pattern of staining in endothelial cells of the glomerular (B) and peritibular (C) capillaries

(arrows) as well as in podocytes. SDF-1 is detectable in podocytes, epithelial cells of Bowman’s capsule,

arteriolar smooth muscle cells, occasional endothelial cells, scattered distal tubular cells and interstitial

fibroblasts. Immunopositive cells are labeled with red text as follows: P = podocyte; E = endothelial cell,

M = smooth muscle cell; B = epithelial cell of Bowman’s capsule; D = distal tubular cell; F = interstitial

fibroblast.

2 CXCR4 and SDF-1 expression in SNx rats

Having identified presence of both SDF-1 and CXCR4 protein in the kidney, we next sought to

determine whether the expression of either ligand or receptor was altered in the setting of

experimental CKD. Gene expression was therefore determined in whole kidney homogenates of

sham-operated and SNx rats, the latter representing an established model of proteinuric kidney

disease characterized by compensatory capillary growth followed by progressive microvascular

rarefaction [32]. In these experiments, we observed an approximate two-fold increase in CXCR4

61

mRNA (Figures 2 A) in the kidneys of SNx rats in comparison to sham-operated animals. By

way of contrast, SDF-1 mRNA was actually reduced in SNx kidneys (Figure 2 B).

Figure 2. CXCR4 and SDF-1 expression in rat whole kidney homogenates. Real-time PCR results for (A)

CXCR4 mRNA and (B) SDF-1 mRNA in sham-operated (Sham, n=6) and subtotally-nephrectomized

(SNx, n=8) rats. *p<0.001,

†p<0.05.

3 TGF-β decreases SDF-1 mRNA in cultured renal

fibroblasts

In exploring potential mechanisms that may mediate the downregulation of SDF-1 in SNx

kidneys we considered its prominent presence within interstitial fibroblasts and the known

upregulation of the pro-fibrotic growth factor TGF-ß in this model (Figure 3 A). To elucidate

whether SDF-1 expression is under the regulatory control of TGF-ß, NRK-49F renal fibroblasts

were exposed to TGF-ß for 24 h before quantitation of SDF-1 mRNA. Recombinant TGF-ß

treatment resulted in an approximate 60% reduction in SDF-1 mRNA (Figure 3 B).

62

Figure 3. TGF-β expression and effects on fibroblast SDF-1 mRNA. Real-time PCR results for (A) TGF-β

in sham-operated (Sham, n=6) and subtotally nephrectomized (SNx, n=8) rats and (B) SDF-1 in cultured

NRK-49F cells treated with vehicle (PBS) or recombinant rat TGF-β for 24 h. *p<0.01,

†p<0.001.

4 Chronic CXCR4 blockade accelerates renal decline

and capillary loss in experimental CKD

4.1 Chronic AMD3100 administration exacerbates renal function

decline in SNx rats

Having identified an increase in CXCR4 mRNA in the kidneys of SNx rats, we next sought to

determine whether this upregulation was detrimental or alternatively renoprotective. Sham and

SNx rats were therefore randomized to receive either vehicle (PBS) or the CXCR4 antagonist

AMD3100 (1mg/kg/day s.c.) for eight weeks. In initial experiments, a single s.c. injection of

AMD3100 at a dose of 1mg/kg induced an approximate two-fold increase in circulating white

blood cell (WBC) count after 4 h (Supplementary Figure 5), confirming the efficacy of the small

molecule in antagonizing CXCR4 in rats and at this dose. At the end of the study period,

63

assessments were made of renal function (Table 1) and structure in sham and SNx rats treated

with AMD3100 for eight weeks. SNx surgery resulted in small, but significant changes in body

weight and kidney weight (Table 1). In addition, pathophysiological changes indicative of

declining renal function were observed with increased systolic blood pressure (SBP) and urine

protein excretion and decreased GFR (Table 1). Chronic AMD3100 administration in SNx rats

exacerbated renal decline without affecting body weight or kidney weight, as shown by further

decreased GFR and increased urine protein excretion and systolic blood pressure compared to

SNx rats (Table 1). No changes in any of these functional characteristics were observed when

AMD3100 was chronically administered to sham operated animals (Table 1).

64

Table 1. Functional characteristics of sham and subtotal nephrectomy (SNx) rats treated

with vehicle (PBS) or AMD3100.

Body

weight

(g)

Left kidney

weight (g)

Left kidney

weight / body

weight (%)

SBP

(mmHg)

GFR

(ml/min/kg)

Urine protein

excretion (mg/day)

Sham +

vehicle

1863 0.560.01 0.3000.005 1132 5.360.25 1.71/1.12

Sham +

AMD3100

1855 0.540.02 0.2960.005 1123 5.290.28 2.37/1.08

SNx +

vehicle

1723*† 0.670.04

ठ0.4000.031

§¶ 1457

ठ3.220.32

ठ20.42/1.52

‡§

SNx +

AMD3100

1803 0.670.03‡§

0.3780.016†‡

1655‡§||

1.730.10‡§

** 50.70/1.26‡§||

*p<0.05 vs. sham + vehicle,

†p<0.05 vs. sham + AMD3100,

‡p<0.01 vs. sham + vehicle,

§p<0.01 vs. sham

+ AMD3100, ¶p<0.001 vs. sham + vehicle,

||p<0.05 vs. SNx + vehicle,

**p<0.01 vs. SNx + vehicle

4.2 Chronic AMD3100 administration exacerbates

glomerulosclerosis and tubulointerstitial fibrosis in SNx rats

To evaluate whether renal decline was associated with renal structural damage, we measured the

extent of sclerosis in the glomerulus and the accumulation of collagen IV in the

tubulointerstitium. Collagen IV is a major constituent of the basement membrane and its

65

increased deposition in CKD is a reflection of pathological renal fibrosis. Sclerosis of the

glomerulus was estimated from PAS-stained sections and expressed in terms of a semi-

quantitative glomerulosclerosis index (GSI) (Figure 4). Fibrosis of the tubulointerstitium was

determined as the magnitude of cortical tubulointerstitial collagen IV immunostaining (Figure 5).

No significant histopathological changes in either the glomeruli (Figure 4 A and B) or

tubulointerstitium (Figures 5 A and B) were observed when AMD3100 was administered to

sham operated animals. Subtotal nephrectomy significantly increased both glomerulosclerosis

(Figure 4 C) and collagen IV deposition in the tubulointerstitium (Figure 5 C). Moreover,

administration of AMD3100 further increased both GSI (Figure 4 D) and collagen IV deposition

in the tubulointerstitium (Figures 5 D) in the kidneys of SNx rats.

Figure 4. Glomerulosclerosis. Effect of chronic CXCR4 antagonism with AMD3100 on glomerulosclerosis

in sham-operated (Sham) and subtotally-nephrectomized (SNx) rats. (A-D) Representative

photomicrographs of periodic acid-Schiff (PAS) stained kidney sections from (A) sham + vehicle (B) sham

+ AMD3100, (C) SNx + vehicle, (D) SNx + AMD3100. Original magnification ×400. (E) Glomerulosclerosis

index (GSI). AU=arbitrary units. *p<0.001 vs. sham + vehicle,

†p<0.05 vs. SNx + vehicle.

66

Figure 5. Tubulointerstitial fibrosis. Effect of chronic CXCR4 antagonism with AMD3100 on

tubulointerstitial fibrosis in sham-operated (Sham) and subtotally-nephrectomized (SNx) rats. (A-D)

Representative photomicrographs of kidney sections stained for collagen IV from (A) sham + vehicle, (B)

sham + AMD3100, (C) SNx + vehicle, (D) SNx + AMD3100. Original magnification ×160. (E) Proportional

area immunopositive for tubulointerstitial collagen IV. *p<0.05 vs. sham + vehicle,

†p<0.05 vs. SNx +

vehicle.

4.3 Chronic AMD3100 administration decreases density of the

glomerular and peritubular capillaries in SNx rats

To determine the effect of chronic CXCR4 antagonism on renal microvascular integrity in

experimental CKD, formalin-fixed kidney sections were immunostained with the monoclonal

antibody JG-12 which recognizes rat kidney endothelial cells [288]. JG-12 is an antibody

specific for a vascular endothelium marker aminopeptidase P and does not react with lymphatic

endothelium [34, 318]. Glomerular (Figure 6 A-E) and peritubular (Figure 6 F-J) capillary

densities were evaluated independently and assessed as proportional area of positively JG-12

immunostained area. No changes in glomerular capillary density were observed in sham-

operated rats following chronic administration of AMD3100 (Figures 6 A and B). Glomerular

capillary density was decreased by renal mass ablation (Figures 6 C). AMD3100 administration

67

further augmented the glomerular capillary density decline in SNx rats (Figure 6 D). Consistent

with glomerular capillary density, peritubular capillary immunostaining was similarly unaffected

in sham-operated rats with AMD3100 administration (Figure 6 F and G). Renal mass ablation

also resulted in loss of peritubular capillary density (Figure 6 H), which was also exacerbated

with the administration of AMD3100 (Figure 6 I).

Figure 6. Renal vasculature. Effect of chronic CXCR4 antagonism with AMD3100 on glomerular and

peritubular capillary density in sham-operated (Sham) and subtotally nephrectomized (SNx) rats. (A-D)

Glomerular endothelial (JG-12) immunostaining of kidney sections from (A) sham + vehicle, (B) sham +

AMD3100, (C) SNx + vehicle, (D) SNx + AMD3100. Original magnification ×400. Original magnification

×400. (E) Quantitation of glomerular JG-12. (F-I) Peritubular JG-12 immunostaining of kidney sections

from (F) sham + vehicle, (G) sham + AMD3100, (H) SNx + vehicle, (I) SNx + AMD3100. Original

magnification ×160. *p<0.001 vs. sham,

†p<0.05 vs. SNx + vehicle,

‡p<0.01 vs. sham + vehicle,

§p<0.01

vs. SNx + vehicle.

68

4.4 Chronic AMD3100 administration decreases glomerular

capillary tuft volume in SNx rats

Glomerular capillaries were also visualized by the novel method of FMA, performed as

previously described [288]. Briefly, low-melting point agarose with fluorescent beads were

infused into the glomeruli, thus creating a three-dimensional cast of the capillary lumen that

could be visualized by confocal microscopy (Figures 7 A-D). This technique allowed for

quantification of the glomerular capillary tuft volume (Figure 7 E). No changes in glomerular

capillary tuft volume were observed in sham operated rats that were treated with AMD3100

(Figures 7 A and B). Contrary to the glomerular capillary density decrease, glomerular capillary

tuft volume was approximately doubled in SNx rats (Figure 7 C), reflecting the compensatory

hypertrophic response following renal mass ablation. This prominent expansion in volume

following renal mass ablation was reduced with the administration of AMD3100 (Figure 7 D).

69

Figure 7. Fluorescent microangiography (FMA). Effect of chronic CXCR4 antagonism with AMD3100 on

glomerular capillary volumes in sham-operated (Sham) and subtotally nephrectomized (SNx) rats.

Representative fluorescent microangiography (FMA) images from (A) sham + vehicle (B) sham +

AMD3100, (C) SNx + vehicle, (D) SNx + AMD3100. (E) Glomerular capillary volume determined by FMA.

White bars represent length of 100μm. *p<0.01 vs. sham + vehicle,

†p<0.01 vs. SNx + vehicle.

4.5 Chronic AMD3100 administration does not affect either WT1

or nephrin expression in SNx rats

Since CXCR4 is also expressed in podocytes, the effect of chronic AMD3100 administration on

two podocyte markers (WT1 and nephrin) was also assessed. Podocyte number was estimated

based on the mean number of nuclei per glomerulus immunostained for Wilms tumor protein

(WT1) (Figures 8 A-D), a transcription factor of the zinc finger motif that is detected in

podocytes throughout adulthood [319]. Glomerular nephrin immunostaining was also determined

(Figures 8 F-I). Nephrin is a transmembrane protein essential for function of the slit diaphragm

on podocytes [320-322]. Neither SNx nor chronic AMD3100 administration changed the number

70

of nuclei per glomerulus immunostained for WT1 (Figure 8 E) or the proportional area of the

glomerulus immunostained for nephrin (Figure 8 J).

Figure 8. WT1 and nephrin expression. Effect of chronic CXCR4 antagonism with AMD3100 on podocyte

marker WT1 and podocyte slit diaphragm protein nephrin expression in sham-operated (Sham) and

subtotally-nephrectomized (SNx) rats. (A-D) Representative photomicrographs of kidney sections

immunostained for WT1 from (A) sham + vehicle, (B) sham + AMD3100, (C) SNx + vehicle, (D) SNx +

AMD3100. Original magnification ×400. (E) Quantitation of WT1 positive nuclei per glomerulus. (F-I)

Representative photomicrographs of kidney sections immunostained for nephrin from (F) sham + vehicle,

(G) sham + AMD3100, (H) SNx + vehicle, (I) SNx + AMD3100. Original magnification ×400. (J)

Quantitation of proportional area of nephrin immunostaining per glomerulus.

In summary, chronic antagonism of CXCR4 resulted in accelerated rarefaction of the renal

glomerular and peritubular capillaries that was accompanied by a decline in GFR and increase in

71

urine protein excretion and SBP together with enhanced glomerulosclerosis and deposition of

collagenous matrix in the tubulointerstitium.

5 SDF-1 mediates local CXCR4 signaling and regulates

glomerular endothelial function through eNOS

dependent mechanisms

5.1 Acute SDF-1 infusion stimulates intra-glomerular CXCR4

signaling and eNOS phosphorylation

Having demonstrated an upregulation of CXCR4 in the kidneys of rats with CKD and an

augmentation of capillary loss and renal decline through CXCR4 antagonism, we next sought to

determine whether the SDF-1/CXCR4 axis may mediate local effects on the adult glomerular

endothelium. To evaluate local SDF-1/CXCR4 in vivo, recombinant SDF-1 was infused to the

kidneys of normal rats before immunoblotting for the downstream signaling effector, eNOS.

AMD3100 (1mg/kg s.c.) or vehicle (PBS) were administered to normal rats 4 h before delivery

of recombinant SDF-1 via the abdominal aorta. Immunoblotting of glomeruli, isolated by

differential sieving 30 min later, revealed that acute SDF-1 delivery induced an increase in

phosphorylation of eNOS at the Ser1177 residue (Figure 9), an activating phosphorylation site of

eNOS [118]. This phosphorylation was effectively antagonized by pre-treatment with

AMD3100. No change in eNOS phosphorylation was observed in rats that received vehicle

infusion after pre-treatment with AMD3100.

72

Figure 9. Acute SDF-1 infusion activates glomerular eNOS. Effect of acute SDF-1 infusion on activating

phosphorylation of eNOS at the site Ser1177 in sieved rat glomeruli following pre-treatment with PBS or

the CXCR4 antagonist AMD3100 (n=6 per group). AU=arbitrary units. *p<0.05 vs. all other groups.

5.2 SDF-1/CXCR4 activates eNOS through phospho-inositide 3-

kinase (PI3K)

To further elucidate SDF-1/CXCR4 signaling mechanisms, we sought to determine whether

eNOS activation was dependent upon an intermediate intra-cellular signaling effector. In

cultured HUVECs, administration of recombinant SDF-1 induced phosphorylation of eNOS at

the activation site Ser1177 (Figure 10). Meanwhile, pretreatment of HUVECs with either the

phospho-inositide 3-kinase (PI3K) inhibitor LY294004 or AMD3100 prevented eNOS

phosphorylation at the Ser1177 site, indicating that eNOS phosphorylation occurs through an

SDF-1/CXCR4/PI3K-dependent pathway.

73

Figure 10. SDF-1-induced CXCR4 signaling and eNOS activation through PI3-kinase. Effect of SDF-1,

the PI3K inhibitor LY294002 and the CXCR4 inhibitor, AMD3100, on phosphorylation of eNOS at the

activation site Ser1177 in human umbilical vein endothelial cells (HUVECs). AU=arbitrary units. *p<0.05

vs. all other groups.

5.3 SDF-1-induced glomerular endothelial proliferation is

attenuated in eNOS deficient cells

Since SDF-1/CXCR4 signaling resulted in endothelial eNOS activation both in vivo and in vitro,

we next focused on the functional response to SDF-1 in glomerular endothelial cells and the role

that eNOS may play in mediating these effects. For these experiments, we used renal glomerular

endothelial cells (RGECs) derived from either wildtype (C57BL/6) or eNOS knockout (eNOS-/-

)

mice. Endothelial proliferation was measured with an MTT colorimetric assay. Under basal

conditions, there was no difference in endothelial cell proliferation between C57BL/6 and eNOS-

74

/- RGECs (p=0.22). However, while SDF-1 induced an approximate 6-fold increase in

proliferation of C57BL/6 RGECs, proliferation was reduced in eNOS-/-

RGECs (Figure 11),

although was still increased approximately 4-fold in comparison to basal conditions.

Figure 11. Effect of SDF-1 on glomerular endothelial proliferation. Renal glomerular endothelial cells

(RGECs) were isolated from C57BL/6 and eNOS-/-

mice. RGEC proliferation determined by MTT assay.

AU=arbitrary units. *p<0.001 vs. C57BL/6 + control,

†p<0.01 vs. eNOS

-/- + SDF-1,

‡p<0.001 vs. eNOS

-/- +

control.

5.4 SDF-1-induced glomerular endothelial migration is eNOS-

dependent

To determine the role of eNOS in regulating SDF-1 mediated endothelial chemotaxis, we

performed a cell migration assay. Under basal conditions, there was no difference in endothelial

cell migration between C57BL/6 and eNOS-/-

mice. Recombinant SDF-1 administration induced

an increase in RGEC migration that was completely attenuated in eNOS deficient cells when

compared to wildtype (Figure 12).

75

Figure 12. Effect of SDF-1 on glomerular endothelial migration. Renal glomerular endothelial cells

(RGECs) were isolated from C57BL/6 and eNOS-/-

mice. RGEC migration determined by transwell

migration assay. *p<0.01 vs. eNOS

-/- + SDF-1,

†p<0.01 vs. C57BL/6 + control.

5.5 SDF-1-induced glomerular endothelial tube formation is

reduced in eNOS deficient cells

Finally, the role of SDF-1/CXCR4 in regulating endothelial tube formation was observed in a

matrigel angiogenesis assay. Under basal conditions, there was no difference in glomerular

endothelial cell tube formation between C57BL/6 and eNOS-/-

mice (Figures 13 A, C and E).

Recombinant SDF-1 administration induced an increase in tube formation in RGECs that was

impaired in eNOS deficient cells when compared to wildtype (Figures 13 B, D and E).

In summary, our in vitro experiments demonstrate the relative importance of eNOS in mediating

various functional effects of RGECs following SDF-1 stimulation. While eNOS appears essential

for migration, it is important but not essential for proliferation and tube formation. Furthermore,

these experiments support the notion that the low SDF-1 levels in SNx rats may be harmful

because of low eNOS functional effects.

76

Figure 13. Effect of SDF-1 on tube formation. Renal glomerular endothelial cells (RGECs) were isolated

from C57BL/6 and eNOS-/-

mice. RGEC tube formation determined by matrigel angiogenesis. (A-D)

Representative photomicrographs of matrigel angiogenesis from (A) C57BL/6 + control, (B) C57BL/6 +

SDF-1, (C) eNOS-/-

+ control, (D) eNOS-/-

+ SDF-1. Original magnification ×40. (E) Total endothelial tube

length. *p<0.001 vs. C57BL/6 + control,

†p<0.01 vs. eNOS

-/- + SDF-1,

‡p<0.05 vs. eNOS

-/- + control.

6 CXCR4 and SDF-1 mRNA are both increased in the

kidneys of patients with secondary FSGS

6.1 Clinical characteristics of patients with secondary FSGS

Having demonstrated the apparent reno-protective upregulation of CXCR4 in our experimental

CKD model, we sought to determine whether the SDF-1/CXCR4 system was also dysregulated

in human disease. For these experiments, we examined biopsy tissue derived from patients with

secondary FSGS, a condition that bears pathophysiological similarity to the kidney injury that

follows experimental renal mass ablation [291]. Sufficient archival formalin-fixed paraffin-

embedded biopsy tissue was available to determine CXCR4 and SDF-1 mRNA and protein

expression in six samples from patients with biopsy-proven and clinically correlated obesity-

77

related secondary FSGS compared with ten samples from time-zero live kidney donors. The

clinical characteristics of patients with FSGS are shown in Table 2. All patients were

hypertensive with an elevated urine protein excretion and two subjects had concomitant diabetes

mellitus. All kidney donors were normotensive, with normal renal function and none of the

donors had diabetes.

78

AC

EI =

An

gio

tensin

Convertin

g E

nzym

e In

hib

itor; A

RB

= A

ng

iote

nsin

Recep

tor B

locker; O

D =

Once

Daily

Tab

le 2

. Clin

ical c

ha

racte

ristic

s o

f patie

nts

with

se

co

nd

ary

focal a

nd

seg

me

nta

l glo

me

rulo

sc

lero

sis

(FS

GS

).

79

6.2 CXCR4 and SDF-1 mRNA are both increased in the kidneys

of patients with secondary FSGS

To determine the expression of CXCR4 and SDF-1, real-time PCR was performed. CXCR4

mRNA was increased approximately 5-fold in the kidneys of patients with FSGS relative to

controls (Figure 14 A), consistent with the observations in SNx rats. However, whereas SDF-1

was decreased in SNx rats, SDF-1 mRNA was actually increased in patients with FSGS (Figure

14 B).

Figure 14. CXCR4 and SDF-1 expression in human kidneys. Real-time PCR results for (A) CXCR4

mRNA and (B) SDF-1 mRNA in kidney biopsies taken from time-zero live kidney donors (Control) and

biopsy-proven and clinically correlated obesity-related secondary focal and segmental glomerulosclerosis

(FSGS). *p<0.001,

†p<0.05.

6.3 ACE inhibition increases SDF-1 expression in SNx rats

Although CXCR4 was consistently upregulated in experimental and human CKD, SDF-1

expression appeared, at first glance, to be discordant, with a decrease in SDF-1 mRNA in the

kidneys of SNx rats and an increase in the biopsies of patients with FSGS. In considering

80

potential explanations for this discordance, we noted that five out of six patients were treated

with ACE inhibitors. To determine whether SDF-1 expression may be altered with renin-

angiotensin system blockade, we measured mRNA levels in a separate cohort of SNx rats,

previously described [290], that had been treated with the ACE inhibitor perindopril. These

experiments showed that the increase in CXCR4 mRNA in SNx rats was attenuated with ACE

inhibition (Figure 15 A). In contrast, while SDF-1 mRNA was reduced after SNx surgery, it was

notably increased in SNx rats treated with perindopril, such that mRNA levels were greater than

those of sham rats (Figure 15 B), analogous to the changes in gene expression observed in

human biopsies.

Figure 15. Effect of ACE inhibition on CXCR4 and SDF-1 expression. Real-time PCR results for (A)

CXCR4 mRNA and (B) SDF-1 mRNA, in kidney tissue from sham-operated (Sham, n=8) and subtotally

nephrectomized (SNx) rats treated with vehicle (drinking water, n=6) or the ACE inhibitor perindopril

(n=8). *p<0.001 vs. sham,

† p<0.05 vs. all other groups.

81

Chapter 5 Discussion

1 General Overview

Renal vascular homeostasis depends upon a balance of factors that either promote or antagonize

the growth and maintenance of endothelial cells within the specialized glomerular and

peritubular capillaries. During embryonic development this balance is tilted heavily in favour of

intensive growth of new vessels. Re-activation of ontogenetic processes is a defensive strategy

commonly employed within cells, tissues and organisms in response to a variety of injurious

insults [323]. While the SDF-1/CXCR4 signaling pathway is recognized for its role in renal

vascular development, the present study reveals that the same system also has a pivotal function

in mediating the response to chronic ischaemia in the adult kidney. Almost regardless of the

underlying aetiology, obliteration of the renal microvessels is a common histopathological

feature of almost all forms of CKD. Upregulation of CXCR4 in both experimental and human

CKD may be an attempt to restore the homeostatic balance and prevent excessive endothelial

loss. Consistent with this postulate, chronic antagonism of CXCR4 accelerated renal function

decline in SNx rats, associated with augmented matrix deposition and enhanced rarefaction of

both the glomerular and peritubular capillaries. Furthermore, the topological relationship

between ligand-expressing renal cells (podocytes and fibroblasts) and receptor expressing

endothelial cells suggests the capacity for the SDF-1/CXCR4 pathway to mediate local effects in

the adult kidney. Accordingly, infusion of recombinant SDF-1 into the kidneys of adult rats

induced CXCR4-dependent intraglomerular signaling through activation of the downstream

82

effector, eNOS. In vitro, a variety of functional responses could be induced by the addition of

SDF-1 to cultured renal glomerular endothelial cells and these responses were abrogated (or

attenuated) in endothelial cells deficient in eNOS. Collectively, these observations indicate that

local SDF-1/CXCR4/eNOS signaling plays an important role in preserving microvascular

homeostasis in the adult kidney, especially in the setting of chronic ischaemia. Therapeutic

strategies that augment SDF-1/CXCR4/eNOS signaling may therefore represent a novel

approach to slow the decline of kidney function in patients with CKD.

2 Distribution of SDF-1 and CXCR4 in the Adult Human

Kidney

Immunostaining of adult human kidney tissue revealed prominent presence of both SDF-1 and

CXCR4 within the renal glomerulus, with both receptor and ligand being present in podocytes

and to a lesser extent in endothelial cells. Outside of the glomerulus, CXCR4 was also

recognized on the surface of the endothelial cells of the peritubular capillaries while SDF-1

exhibited a more widespread, albeit site-specific distribution, including notable representation

within distal tubular cells and interstitial fibroblasts. The presence of both SDF-1 and CXCR4 in

both podocytes and endothelial cells and SDF-1 in distal tubular cells has been previously

described [144, 181, 189, 263]. Our experiments extend these previous observations and also

now demonstrate specific immunostaining for CXCR4 in both glomerular and peritubular

endothelial cells as well as SDF-1 expression within glomerular parietal epithelial cells and

interstitial fibroblasts.

83

The presence of both receptor and ligand within the glomerulus suggests the capacity for

paracrine (or autocrine) intraglomerular effects. The glomerular filtration barrier represents the

first point at which the blood is filtered and is vulnerable to a variety of haemodynamic and

metabolic insults. To counteract these potentially deleterious effects, a variety of signaling

networks exist to facilitate communication between the differing glomerular cell types both

across the filtration barrier and within sub-segmental compartments. Such evolutionarily

conserved pathways [324] may be important for both renal vascular development [30] and

normal adult glomerular homeostasis [31] and may also be recapitulated during the disease

process [37]. A local role for SDF-1/CXCR4 in maintaining glomerular homeostasis would be

analogous to the actions of alternative angiogenic systems such as those mediated by VEGF [30]

and/or angiopoietin-1 [38], that are essential for renal vascular development and that are re-

activated in response to renal injury. For example, in the adult, VEGF is primarily expressed on

podocytes and travels contrary to urinary flow, signaling through its cognate receptor, VEGFR-2,

on the surface of endothelial cells [37]. Extra-glomerular expression of SDF-1 and CXCR4 also

suggests that this pathway may exert paracrine (or autocrine) effects in other renal cells [163].

SDF-1 is also expressed in distal tubular cells and fibroblasts, both of which are in close

apposition with the CXCR4 expressing endothelial cells of peritubular capillaries.

84

3 Expression of SDF-1 and CXCR4 in Experimental

CKD

Having localized SDF-1 and CXCR4 in the adult kidney, we next sought to determine whether

the expression of either receptor or ligand was altered in the setting of CKD. For these and

subsequent interventional studies, we studied the SNx rat, a well established model that develops

progressive renal injury as a consequence of the maladaptive response to renal mass ablation.

Using real-time PCR of mRNA extracted from whole kidney homogenates, we identified that

CXCR4 expression was increased more than two-fold in SNx kidneys, whereas SDF-1 mRNA

was reduced by approximately 50%. Since these experiments were performed in whole kidney

homogenates it is not possible to discern which nephron segment(s) were responsible for the

changes in gene expression identified, neither do the experiments confirm that the changes in

gene expression were also reflected at the protein level. Nevertheless, the downregulation of

ligand and upregulation of receptor raise the intriguing possibility that dysregulation of the SDF-

1/CXCR4 pathway in SNx kidneys may not only be a consequence of renal injury but may

actually contribute to it. In these circumstances, decreased SDF-1 expression may contribute to

the capillary rarefaction that is a feature of the progressive injury in this model [288], while

CXCR4 upregulation may represent a compensatory response.

Since CXCR4 is under the regulatory control of the hypoxia responsive element Hif-1 [139],

decreased oxygen tensions in the chronically ischaemic kidney represent a plausible explanation

for the upregulation of the receptor in SNx kidneys. Reduced SDF-1 expression, in the kidneys

of SNx rats, however, was initially unexpected. TGF-ß is a profibrotic cytokine that is

upregulated in the kidneys of SNx rats and in patients with CKD and that is also fundamentally

85

linked to the progression of renal decline [325-329]. TGF-β has also been found to be regulated

by Hif-1α in human renal fibroblasts [330]. Since SDF-1 was abundantly expressed by

fibroblasts, a cell-type well recognized for their phenotypic response to TGF-ß, we speculated

that SDF-1 may itself be under the regulatory control of this cytokine. Consistent with this

hypothesis, TGF-ß was upregulated in the kidneys of SNx rats and its administration to cultured

renal fibroblasts decreased SDF-1 mRNA. While the mechanisms by which TGF-ß regulates

SDF-1 mRNA have not been defined, transcriptional repression in response to the cytokine has

been described in a number of cell types [331-334]. This downregulation of SDF-1 by TGF-ß is

analogous to changes previously described in oral fibroblasts [335].

A limitation in this part of the experiment is the lack of correlative protein data that accompanies

the mRNA expression data. It is not uncommon for changes and trends in mRNA and protein

levels to differ dramatically. Nonetheless, studies in rodent kidneys have shown a close

correlation between mRNA and protein levels of SDF-1 and CXCR4 [233, 234, 247].

4 Chronic CXCR4 Antagonism in SNx Rats

Whereas some angiogenic systems are important for both normal vascular homeostasis and

response to injury, others may be dispensable under normal conditions. For instance,

VEGF/VEGFR-2 is essential for normal adult vascular homeostasis [336], while the actions of

angiopoietin-1 and its receptor Tek are dispensable in quiescent vessels but are highly involved

in modulating the vascular response to injury [38]. To determine the role of SDF-1/CXCR4 in

86

normal kidneys and in CKD we administered AMD3100, a small molecule antagonist of

CXCR4, to sham-operated and SNx rats over a period of eight weeks.

At a dose of 1mg/kg/day, AMD3100 was well tolerated in the rats used in our experiments. In

safety studies with rats, the maximum levels without observable adverse effects such as sedation,

spasms, and dyspnea was 600mg/kg [337]. Indeed, AMD3100 is already widely used in

combination with granulocyte colony-stimulating factor (G-CSF) to enhance HSC mobilization

into the peripheral bloodstream before autologous transplantation, indicated for the treatment for

multiple myeloma or non-Hodgkin’s lymphoma [309, 338-340]. Similarly, we have also

confirmed efficacy of AMD3100 to mobilize white blood cells into the blood stream in our rats

at this dose. However, we cannot exclude the effects of CXCR7, another receptor of SDF-1, in

our experiments. AMD3100 has been shown to act as an allosteric agonist to CXCR7, albeit this

has only been demonstrated in vitro. While the role of CXCR7 in kidney homeostasis and CKD

progression has not been elucidated, recent evidence has implicated a role as a decoy or

scavenger receptor against SDF-1 [148, 168]. Thus, CXCR7 stimulation by AMD3100 may

actually account for part of its efficacy in ameliorating SDF-1 interaction with CXCR4.

Among sham-operated rats with normal renal function, chronic CXCR4 antagonism had no

significant effect on any of the parameters of renal function or structure assessed. This would

suggest that the SDF-1/CXCR4 pathway is analogous to the angiopoietin-1/Tek pathway, which

plays important roles during development and in response to injury, but not during quiescence.

Among SNx rats, those treated with AMD3100 exhibited an augmented decline in renal function

in comparison to their vehicle-treated counterparts, with enhanced proteinuria and hypertension

and a greater decline in GFR. Among these parameters, the rise in SBP may reflect either cause

87

or consequence of renal decline [341]. Since AMD3100 did not affect SBP in sham rats, it seems

most likely that the increase seen with AMD3100 in SNx rats is indicative of a consequence of

declining renal function. Nevertheless, as described below, a number of the effects of SDF-

1/CXCR4 are mediated through eNOS, the most abundant NOS isoform responsible for NO

generation within the micro- and macrovasculature and an important regulator of systemic

vascular resistance [119]. Thus an alternative, but not necessarily contradictory, explanation for

the rise in SBP in SNx rats treated with AMD3100 would be antagonism of NO production.

Consistent with the deterioration in renal function, administration of AMD3100 to SNx rats was

also associated with a worsening of tissue fibrosis, indicated by enhanced glomerulosclerosis and

increased deposition of collagen IV within the tubulointerstitium. Of note, while proteinuria was

markedly increased in SNx rats treated with AMD3100, in comparison to vehicle-treated

animals, the increase in glomerulosclerosis index was relatively small. This may reflect

methodological issues or alternatively offer insights into the pathogenesis of the renal injury. In

the case of the former, glomerulosclerosis was assessed in non-perfused kidneys which would

introduce a degree of variability in the confidence in defining capillary obliteration and

mesangial expansion. In the case of the latter, it is possible that disruption in SDF-1/CXCR4

signaling may play a greater role in communication between endothelial cells and podocytes, a

major regulator of filtration barrier permselectivity [342], in comparison with communication

with mesangial cells, the principal cells responsible for matrix deposition within the glomerulus.

Although mesangial cells express neither SDF-1 nor CXCR4, they still possess other signaling

pathways that allow them to communicate with nearby cells [343, 344]. Thus mesangial cells

may be indirectly affected by chronic CXCR4 antagonism.

88

To determine the role of SDF-1/CXCR4 in maintaining capillary integrity in the normal adult

kidney and in the setting of CKD, we employed two complementary techniques for delineating

the renal microvasculature: i) conventional immunostaining of formalin-fixed kidney sections

and ii) the novel technique for FMA [288]. For conventional light microscopic analysis, we used

the monoclonal antibody, JG-12, that labels endothelial cells of capillaries but not lymphatics in

rat kidney [318]. Using this method, combined with computer-assisted image analysis, conducted

in a masked manner, we observed a reduction in the density of both the glomerular and

peritubular capillaries in SNx rats that was augmented by AMD3100 administration. While it is

plausible that this enhanced obliteration of the renal microvessels reflects the consequences of

increased matrix deposition, increasing evidence from both experimental and clinical studies

suggests that, through predisposing to regional hypoxic insult, the former may also contribute to

the latter [16, 17, 37, 345]. The immunohistological method employed in the present studies

relies on the assumption that expression of the antigen (aminopeptidase P) is evenly distributed

in the glomerular endothelial cells and remains constant over time and with disease. However,

changes in aminopeptidase P expression have been described under certain pathological

conditions, such as lung adenocarcinoma [346]. Furthermore, complexities in the shape of the

renal glomerular microvasculature and changes following SNx render accurate absolute

determination of the glomerular tuft volume virtually impossible. To circumvent the theoretical

confounding effect of altered antigen expression and the limitations imposed by conventional

light microscopy of two-dimensional kidney sections [12], we also employed the novel technique

of FMA. By combining highly fluorescent microspheres suspended in low melting point agarose

together with the optical sectioning capabilities of modern confocal microscopy, this method

enables the rapid generation of three-dimensional “virtual casts” of the renal microvessels [288].

89

Using this approach, we observed an expected increase in glomerular capillary volume in SNx

rats, likely due to the compensatory hypertrophic response to renal mass reduction. Moreover,

this increase in glomerular capillary volume was reduced in SNx rats treated with AMD3100.

It is not possible to define whether the reduction in capillary volume with AMD3100 was due to

capillary loss or whether this reflects a reduced compensatory hypertrophic response because the

animals were treated with AMD3100 immediately following the SNx surgery. Additional time

course experiments with AMD3100 administration at later times following SNx surgery would

be needed to further elucidate this. Nevertheless, increased loss of the renal microvasculature in

SNx rats that received AMD3100, associated with augmented renal decline and progressive renal

fibrosis is consistent with the changes previously described in other organs such as exacerbation

of cardiac dysfunction with chronic AMD3100 administration in the post-myocardial infarction

setting [347]. While the exacerbated phenotype of the rats is consistent with a further reduction

in CXCR4 activity, we cannot rule out off target effects of the antagonist. To provide further

evidence of injury to glomerular endothelial cells in the SNx rats, a plausible experiment may

involve evidence of increases in circulating endothelial microparticles, which has been found to

be increased in models of endothelial injury [348]. Another limitation with this experiment

involves the assumption of equal steady state levels of circulating AMD3100 levels in all four

treatment groups. According to pharmacokinetic tests, 70% of AMD3100 is excreted via renal

clearance in a 24h period [337]. Since there are significant differences in GFR across the four

groups, further experiments are needed to determine whether the effects we have observed were

due to differences in steady state levels of circulating AMD3100.

90

Details on how the traditional method of immunohistochemistry for endothelial markers and the

novel approach of FMA complement each other and specific limitations associated with each

method have been described [288]. Limitations of FMA include possible clumping of the

fluorescent beads, coagulation of vessels and premature solidification of the agarose solution.

These limitations may interfere with the optimal perfusion of the renal vasculature. However,

these limitations were minimized by reducing the size of fluorescent beads, heparinization of the

kidney prior to the agarose infusion and pre-warming of the agarose solution to just above 40°C

followed by immediate cooling of the kidney on ice after infusion. Despite the limitations,

glomerular volume values of sham-operated rats determined by FMA are consistent with values

determined by gold standard morphometric techniques following transmission electron

microscopy.

In contrast to the marked changes in glomerular and peritubular capillary integrity in SNx rats

treated with AMD3100, two podocyte markers were unaffected. CXCR4 has been shown to play

a pathological role when overexpressed on the surface of podocytes, resulting in

hyperproliferaton and the initiation of necrotizing crescentic glomerulonephritis [181]. The fact

that we did not observe an effect of CXCR4 antagonism on podocytes in SNx rats may reflect

either methodological limitations or may indicate the contextual role for the system. With respect

to methodological limitations, as outlined below, our assessment of podocyte number involved

immunohistochemical staining of two-dimensional kidney sections as opposed to gold standard

transmission electron microscopy methods. To determine the effect of SNx and chronic CXCR4

antagonism on podocyte number, we immunostained for WT1, using a method that has

previously been described to correlate closely with podocyte number determined on transmission

91

electron micrographs using the Weibel-Gomez method [37, 349]. The Weibel-Gomez method

obtains a single profile through each glomerulus, from which an estimation of numerical density

of the podocyte nuclei is taken and multiplied by the mean glomerular volume. The drawbacks to

this method are the assumptions made about the consistency of shape and size of podocyte nuclei

over the course of a disease. An alternative method called the disector/fractionator method takes

several profiles through each glomerulus from which the total number of podocyte nuclei is

obtained and multiplied by the inverse of the sampling fraction. The Weibel-Gomez method has

been considered to have more bias than the gold standard disector/fractionator approach.

However, the latter is laborious and a previous study has described a close correlation between

the two techniques [350].

Regarding the disease context specific role for the SDF-1/CXCR4 pathway, this is well

established in other angiogenic systems within the kidney. For instance, the VEGF/VEGFR-2

system is generally considered reno-protective in the setting of chronic ischaemia [32, 33], yet it

is believed to contribute to the pathogenesis of early experimental diabetic nephropathy [137,

206, 351]. An alternative explanation for the role of podocyte-derived CXCR4 may be that the

receptor regulates paracrine signaling to endothelial cells by “mopping up” excess SDF-1,

analogous to uptake of neurotransmitters by presynaptic neurons to terminate signaling at the

neural synapses [352].

92

5 Local SDF-1/CXCR4 Effects and the Role of eNOS

The interaction between SDF-1 and CXCR4 is well known for its role in the maintenance of the

HSC niche. It has also been implicated in mediating homeostasis of other organs, including the

central nervous system [353] and intestinal mucosa [354]. Accordingly, we cannot exclude

systemic effects as underlying causes for the (patho)physiological changes observed with chronic

AMD3100 administration. To confirm the capacity for SDF-1/CXCR4 to mediate local paracrine

effects, we therefore conducted an additional in vivo study whereby recombinant SDF-1 was

infused directly to the kidney. Since CXCR4 is present on the surface of both endothelial cells

and podocytes, to evaluate the role of the receptor in regulating glomerular endothelial signaling,

we elected to study the activation of the downstream regulator, eNOS, which is not expressed by

podocytes [355]. The notion that podocyte CXCR4 signaling might contribute to injury to the

glomerular filtration barrier is interesting, despite these cells lacking expression of eNOS.

However, not all effects of CXCR4 are mediated by eNOS, as the deficiency of eNOS only

partially attenuated proliferative and tube formation responses to SDF-1 stimulation in RGECs.

eNOS activity is regulated by the phosphorylation of the enzyme at multiple sites. The best

characterized of these are the activation site Ser1177 and the inhibitory site Thr495 [118]. In our

experiments, SDF-1-induced glomerular Ser1177 phosphorylation was antagonized by pre-

treatment with AMD3100, supporting the supposition that the system may exert local effects on

glomerular endothelial function. An alternative pharmacological strategy to explore the role of

local SDF-1/CXCR4 in the kidney while limiting its effects in other organs would be to deliver

AMD3100 directly to the kidney via osmotic minipump.

93

To further support the role of SDF-1/CXCR4/eNOS in regulating endothelial function, especially

that of the glomerular endothelium, we conducted additional experiments in cultured cells. Upon

ligand-binding, CXCR4 activation may promote signaling through a range of pathways including

those mediated by intracellular calcium release, PI3K/Akt and MAP kinases ERK1/2. Of

particular note, the PI3K /Akt pathway is a recognized activator of eNOS, previously implicated

in SDF-1 induced endothelial migration [100, 116]. Consistent with these known effects,

treatment of HUVECs with SDF-1 induced eNOS Ser1177 phosphorylation that was effectively

antagonized by either PI3K or CXCR4 inhibition. Although the SDF-1/CXCR4 pathway has

been attributed as a potent mediator of both non-renal endothelial progenitor and mature

endothelial cell migration [100, 356], the endothelial cells that we have used for our in vitro

functional studies represent a unique resource of cells that best reflect the phenotypes of in situ

renal glomerular endothelial cells. In the present study, SDF-1 induced renal glomerular

endothelial cell tube formation, proliferation and migration indicating that the angiogenic

chemokine does exert important effects on glomerular endothelial cell function, analogous to

those seen in other CXCR4 expressing cells [77, 102, 188]. Moreover, each of these responses

was attenuated in eNOS deficient RGECs, indicating the importance of this downstream effector

in mediating these effects. Intriguingly, however, the responses to SDF-1 in eNOS deficient

RGECs were not consistent across each of the functional assays. Thus while glomerular

endothelial migration was abrogated in eNOS-/-

cells, proliferation and tube formation, although

attenuated, continued to occur. These observations highlight that, while it is important, eNOS is

not the sole regulator of the glomerular endothelial response to SDF-1.

94

One major limitation to the study of endothelial cells is the fact that they have such a wide

variety of phenotypes in different vasculatures around the body. Endothelial cells show marked

differences in cellular marker expression and morphology in presence and absence of shear stress

[357-359]. Consequently, they are difficult to maintain in culture without altering their

phenotype. The present study represents the first to describe the role of SDF-1/CXCR4 in renal

glomerular endothelial cells and the first to examine the response to SDF-1 in the context of

genetic eNOS knockout. Since these are primary cells isolated through a double magnetic bead

procedure, the experiments may be limited by the phenotype of the cells. Nevertheless, the

RGECs employed in our in vitro experiments maintain several key phenotypes of their in situ

counterparts such as a “cobblestone” morphology, VE-cadherin (CD144) expression at cell-cell

junctions, platelet endothelial cell adhesion molecule-1 (PECAM-1) expression and vWL

expression. Moreover, in comparison to pharmacological blockade or small interference RNA

technology, absolute eNOS deficiency may offer a distinct phenotype, providing an additional

advantage over alternative conventional approaches.

One of the alternative candidate downstream effectors of SDF-1/CXCR4 signaling that may also

mediate proliferation and tube formation is mTOR. Of the two types of complex, mTORC1

activation leads to increased expression of Hif-1α, which regulates SDF-1 and CXCR4

expression [141]. This suggests that SDF-1/CXCR4 signaling may promote proliferation and

tube formation not only through eNOS activation, but also downstream effectors of mTORC1,

such as increased Hif-1α translation. On the other hand, mTORC2 regulates the organization of

the actin cytoskeleton through GTPases Rho and Rac [360, 361]. Rearrangement of the actin

cytoskeleton is one of the key features of cell migration and metastasis. In podocytes, Rho

95

GTPases play important roles in maintaining the integrity of interdigitating foot processes, which

is essential for their function independent of slit diaphragm proteins such as nephrin [362].

However, the amelioration of migration in eNOS-/-

cells suggests that eNOS may play a more

prominent role than mTORC2 in this regard. Although the mTOR pathway was not explored in

this study, it may be elucidated in future projects, as discussed in the section Future Direction.

6 Expression of SDF-1 and CXCR4 in Human CKD

In an attempt to translate our findings to the clinic, we also examined the expression of SDF-1

and CXCR4 in biopsies from patients with secondary FSGS, a condition that, like experimental

renal mass ablation, is characterized by a maladaptive response to hemodynamic stresses [285].

For these experiments, we took advantage of recent advances in molecular biology that facilitate

the recovery of mRNA from archival formalin-fixed paraffin embedded kidney tissue, as

previously described [312]. Consistent with changes observed in SNx rats, CXCR4 was also

increased in the biopsies of patients with secondary FSGS. By contrast, SDF-1 mRNA was also

increased in FSGS biopsies. There are a number of limitations to these human biopsy studies

including the small number of patients, the wide age range of the patients, the magnitude of renal

injury and the concurrent use of medication. Patients ranged in age from 13 to 55 years of age

and serum creatinine varied from 53µmol/L to 300µmol/L. Despite the variability in the clinical

characteristics of the patients, CXCR4 was consistently elevated. Five of six of the patients were

also treated with ACE inhibitors. Previously, renin-angiotensin system (RAS)-blockade with

either an ACE inhibitor or an angiotensin II type 1 receptor blocker has been shown to reduce the

96

expression of TGF-ß in SNx rats [325]. Accordingly, we speculated that the variance in SDF-1

transcript between SNx rats and biopsies of patients with FSGS may be related to the widespread

use of ACE inhibitors among the patients. Consistent with this hypothesis, SDF-1 mRNA was

not only normalized in SNx rats treated with the ACE inhibitor perindopril, but transcript levels

were actually increased compared to sham rats, analogous to the changes seen in patients.

Whether this is a direct effect of RAS-blockade or a consequence of attenuation of renal injury

remains to be determined. Moreover, if a larger sample size of patients were available, I could

test the relationship of the levels of ACR and eGFR with SDF-1/CXCR4 expression and

correlation with ACE inhibitor treatments.

Although the SDF-1/CXCR4 interaction was originally considered an unusually monogamous

relationship, more recent evidence suggests that this is not the case. For instance, CXCR4 also

acts as a receptor for the HIV envelope receptor glycoprotein gp120 [252] and for the small

protein ubiquitin [169], while SDF-1 may also bind to CXCR7. The renal actions of CXCR7 are

complex with reports that the receptor signals in renal multipotent progenitors (RMPs) [161]

while also functioning as a scavenger protein for SDF-1 [148]. Similarly, under some alternative

conditions renal SDF-1/CXCR4 may play a potentially detrimental role through promoting

podocyte proliferation [181], inflammatory cell recruitment [243] or, in the case of Shiga-toxin

induced injury, endothelial phenotypic switch [144]. Thus, as with other angiogenic mediators

within the kidney [37, 38], the role of renal SDF-1/CXCR4 is likely to be contextual according to

stage of development and the underlying injurious insult. To help identify whether factors

involved in promotion or inhibition of angiogenesis are therapeutic or detrimental, it is important

to identify whether a disease is characterized by a shift in balance toward promoting or inhibiting

97

angiogenesis. Promoting the angiogenic SDF-1/CXCR4 pathway may be detrimental in diseases

that already rely on pathological angiogenesis, such as diabetic retinopathy or renal cell

carcinoma. However, in the context of chronic renal ischemia, characterized by capillary

rarefaction, the collective in vitro, acute and chronic in vivo and human correlative studies herein

described indicate a reno-protective function for the SDF-1/CXCR4 pathway in CKD.

98

Chapter 6 Conclusion

Angiogenic systems play an important role in the maintenance of the renal microvasculature,

especially in response to pathological insult. The SDF-1/CXCR4 signaling pathway plays a

fundamental role in renal vascular development and upregulation of the receptor is a feature of

both experimental and human CKD. Chronic antagonism of CXCR4 accelerates decline in renal

function and deposition of matrix within the kidneys of rats with CKD that occurs as a

consequence of renal mass ablation. Evidence that these effects occur through local mechanisms

is provided by the observations that SDF-1 may induce activation of the downstream effector,

eNOS both in the glomeruli of normal rats and in cultured endothelial cells, the latter being

antagonized by the pharmacological inhibition of the intermediate signaler PI3. Moreover, a

range of functional responses of glomerular endothelial cells may be induced by SDF-1 in an

eNOS-dependent manner. These studies define a renoprotective role for the SDF-

1/CXCR4/eNOS pathway in CKD. Pharmacological augmentation of this pathway may represent

a novel approach to slow the decline of renal function in patients.

99

Chapter 7 Future Directions

Our research aimed to evaluate the role of the SDF-1/CXCR4/eNOS pathway in preserving renal

microvascular integrity in CKD. Through our in vivo chronic CXCR4 antagonism experiments,

we have shown evidence for a reno-protective function for this pathway in CKD. In future work

it would be important to demonstrate that therapeutic augmentation of SDF-1/CXCR4 in the

kidney will preserve or restore the renal vasculature in CKD and maintain renal function.

Several options are available to investigate the effect of kidney-specific SDF-1/CXCR4

augmentation. One novel approach may be through the technique of plasmid-mediated gene

delivery by intravascular disruption of microbubbles with ultrasound. Ultrasound-targeted

microbubble destruction uses ultrasound contrast agents as vehicles that, when insonified at high

acoustic power, oscillate and result in microbubble destruction. Using this method, Leong-Poi

and colleagues were able to effectively deliver VEGF expressing plasmids and stimulate

therapeutic arteriogenesis in an experimental model of hindlimb ischaemia [363]. This method of

gene delivery has the advantage that microbubbles can be activated specifically within a target

tissue, thus combining low invasiveness with high gene transfer efficiency and organ specificity

[364]. The technique has been used to induce gene transfection in the pancreas [365], liver [366]

and kidney [367] although most studies to date have involved the cardiovascular system. With

this technique, we would be able to couple plasmids containing SDF-1 cDNA to microbubbles

with a cationic lipid shell and deliver the solution into the rat circulation. Directing the

ultrasound at the kidney will destroy the bubbles and release the SDF-1 plasmids into the local

100

tissue. Since our acute in vivo SDF-1 infusion experiment resulted in increased eNOS activation,

we anticipate that this technique of gene transfection may maintain a longer state of SDF-1

overexpression and preserve renal vasculature in SNx rats. An alternative approach to SDF-1

overexpression would be to employ adenoviral gene transfer technology and deliver SDF-1

recombinant replication-deficient adenovirus to the kidney. Historically, however, gene

transfection studies have met with limited success in the kidney and an inducible knockout

approach may represent an alternative experimental strategy.

Selection of SDF-1 isoforms may also be important. Six isoforms are present in humans,

generated through alternative splicing from a single gene and the predominant ones are the α and

β isoforms. Although there have been no identifiable functional differences between the

isoforms, some are more prone to degradation than others. For example, the α isoform that was

employed in our in vitro and acute in vivo infusion studies is degraded faster than the β isoform

in the vasculature. Therefore, therapies that aim to increase expression of the SDF-1 ß isoform

may be preferable.

Increasing the activity of CXCR4 signaling in renal endothelial cells may also be possible

without directly affecting SDF-1 expression. There exist many effectors and regulators of

CXCR4 signaling that can be modulated. For example, SDF-1 may be cleaved by various

proteases such as cathepsin G, matrix metalloproteinase and DPP-IV. In particular, DPP-IV

activity is present in the kidney [368, 369] and administration of clinically available DPP-IV

inhibitors may be beneficial to CKD patients. Intracellular regulators of this signaling pathway

are also targets of interest. CXCR4 internalization depends on GRK, ferritin and 73-kDa heat

shock cognate protein. Inhibiting these regulators in the glomerular endothelial cells may serve

101

to prolong the effects of CXCR4 signaling. In the future, all of these extracellular and

intracellular regulators of SDF-1/CXCR4 signaling may be promising targets of inhibition.

One intracellular effector of CXCR4 signaling that was not explored in our studies was mTOR

and this may be studied in future experiments. Since one of the downstream effectors of mTOR

is S6K1, we could conduct immunoblots for S6 phosphorylation, a widely-used biomarker for

mTOR activation [114]. Inhibition of mTOR may be achieved with rapamycin (Sirolimus), the

first identified inhibitor of mTOR. Rapamycin forms a complex with an intracellular receptor,

FK506 binding protein 12 (FKBP12), which inhibits mTOR. Alternatively, kinase inhibitors

such as Torin 1, PP242 and PP30 mimic ATP and directly inhibit the mTOR kinase domain

[370]. With these tools at hand, we could elucidate the role of mTOR in mediating endothelial

survival, migration and angiogenesis in response to SDF-1. Rapamycin has already been shown

to reduce angiogenesis in in vivo hepatic and dermal tumor models as well as reducing the

response of HUVECs to VEGF stimulation [371]. Since mTOR is implicated in regulating cell

cycle progression, particularly in cancer, rapamycin analogues have been approved for the

treatment of patients with metastatic renal cell carcinoma [372]. It is interesting to note that

hypoxia inhibits mTORC1 through activation of TSC1/2 complex and inhibits growth and this

may be one of the contributing factors for capillary rarefaction despite chronic ischaemia in SNx

rats.

Aside from mTOR, the other target of Akt is eNOS. In our studies, we focused on eNOS because

it is an ostensibly endothelial-specific gene. Moreover, our results showed that SDF-1/CXCR4-

induced effects on endothelial cells are mediated at least in part by eNOS. However, this does

not preclude involvement of other NOS-mediated effects by SDF-1/CXCR4 signaling. Neural

102

nitric oxide synthase (nNOS) is the most abundant renal NOS, with primarily an epithelial

distribution in the macula densa region of the cortex and in the inner medullary collecting duct

[373, 374]. C57BL/6 mice, which are normally resistant to CKD induced by renal mass ablation,

develop accelerated renal injury when either eNOS or nNOS are knocked out [124]. Indeed,

perhaps due its relative abundance compared to eNOS, in previous studies renal decline

correlated more closely with reduced cortical nNOS expression and activity than with eNOS

[375, 376]. Although no known associations between CXCR4 and nNOS have been defined,

future experiments may help elucidate this. In fact, therapies for CKD patients may be more

effective by augmenting nNOS than eNOS activities.

Finally, the most common cause of ESRD is diabetic nephropathy. Diabetes being a major

comorbidity associated with CKD. Our experiments did not explore whether high glucose

conditions would alter SDF-1/CXCR4 in the kidney. Isoe and colleagues showed the presence of

a carbohydrate response element binding protein that can activate Hif-1α in glomerular

mesangial cells [143]. Since Hif-1α can bind to both SDF-1 and CXCR4 promoters [140, 141],

subsequently augmenting expression of both genes, the presence of diabetes may likely have an

effect on SDF-1/CXCR4 signaling. In particular, the presence of pathological overgrowth of

blood vessels in diabetic retinopathy patients indicate that caution needs to be taken when

developing therapeutic strategies that involve modulation of angiogenic pathways.

103

References

1. TKFo, C., Facing the Facts. Includes Highlights from the Canadian Organ Replacement Register. http://www.kidney.ca/document.doc?id=1376, 2012.

2. (CORR), C.O.R.R., 2012 CORR Report-Treatment of End-Stage Organ Failure in Canada, 2001 to 2010. Canadian Institute for Health Information (CIHI), 2012.

3. (CDC), C.f.D.C.a.P., National chronic kidney disease fact sheet: general information and national estimates on chronic kidney disease in the United States. U.S. Department of Health and Human Services (HHS), 2010.

4. Fukuhara, S., et al., Health-related quality of life among dialysis patients on three continents: the Dialysis Outcomes and Practice Patterns Study. Kidney Int, 2003. 64(5): p. 1903-10.

5. Himmelfarb, J. and T.A. Ikizler, Hemodialysis. N Engl J Med, 2010. 363(19): p. 1833-45. 6. Manns, B., et al., Quality of life in patients treated with hemodialysis or peritoneal dialysis: what

are the important determinants? Clin Nephrol, 2003. 60(5): p. 341-51. 7. Munshi, S.K., et al., Outcome of renal replacement therapy in the very elderly. Nephrol Dial

Transplant, 2001. 16(1): p. 128-33. 8. system, U.R.D., USRDS 2011 Annual Data Report: Atlas of Chronic Kidney Disease and End-Stage

Renal Disease in the United States. National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, 2011.

9. Manns, B., et al., Illustrating the impact of including future costs in economic evaluations: an application to end-stage renal disease care. Health Econ, 2003. 12(11): p. 949-58.

10. K/DOQI clinical practice guidelines for chronic kidney disease: evaluation, classification, and stratification. Am J Kidney Dis, 2002. 39(2 Suppl 1): p. S1-266.

11. Levey, A.S., et al., Definition and classification of chronic kidney disease: a position statement from Kidney Disease: Improving Global Outcomes (KDIGO). Kidney Int, 2005. 67(6): p. 2089-100.

12. Remuzzi, G., A. Benigni, and A. Remuzzi, Mechanisms of progression and regression of renal lesions of chronic nephropathies and diabetes. J Clin Invest, 2006. 116(2): p. 288-96.

13. Hostetter, T.H., et al., Hyperfiltration in remnant nephrons: a potentially adverse response to renal ablation. J Am Soc Nephrol, 2001. 12(6): p. 1315-25.

14. Bohle, A., S. Mackensen-Haen, and M. Wehrmann, Significance of postglomerular capillaries in the pathogenesis of chronic renal failure. Kidney Blood Press Res, 1996. 19(3-4): p. 191-5.

15. O'Connor, P.M., Renal oxygen delivery: matching delivery to metabolic demand. Clin Exp Pharmacol Physiol, 2006. 33(10): p. 961-7.

16. Fine, L.G., C. Orphanides, and J.T. Norman, Progressive renal disease: the chronic hypoxia hypothesis. Kidney Int Suppl, 1998. 65: p. S74-8.

17. Fine, L.G. and J.T. Norman, Chronic hypoxia as a mechanism of progression of chronic kidney diseases: from hypothesis to novel therapeutics. Kidney Int, 2008. 74(7): p. 867-72.

18. Haase, V.H., The VHL/HIF oxygen-sensing pathway and its relevance to kidney disease. Kidney Int, 2006. 69(8): p. 1302-7.

19. Higgins, D.F., et al., Hypoxia promotes fibrogenesis in vivo via HIF-1 stimulation of epithelial-to-mesenchymal transition. J Clin Invest, 2007. 117(12): p. 3810-20.

20. Higgins, D.F., et al., Hypoxia-inducible factor signaling in the development of tissue fibrosis. Cell Cycle, 2008. 7(9): p. 1128-32.

21. Orphanides, C., L.G. Fine, and J.T. Norman, Hypoxia stimulates proximal tubular cell matrix production via a TGF-beta1-independent mechanism. Kidney Int, 1997. 52(3): p. 637-47.

104

22. Stetler-Stevenson, W.G., Dynamics of matrix turnover during pathologic remodeling of the extracellular matrix. Am J Pathol, 1996. 148(5): p. 1345-50.

23. Adamczak, M., et al., Reversal of glomerular lesions involves coordinated restructuring of glomerular microvasculature. J Am Soc Nephrol, 2004. 15(12): p. 3063-72.

24. Ferrara, N. and H.P. Gerber, The role of vascular endothelial growth factor in angiogenesis. Acta Haematol, 2001. 106(4): p. 148-56.

25. Ferrara, N., Molecular and biological properties of vascular endothelial growth factor. J Mol Med (Berl), 1999. 77(7): p. 527-43.

26. Fong, G.H., et al., Role of the Flt-1 receptor tyrosine kinase in regulating the assembly of vascular endothelium. Nature, 1995. 376(6535): p. 66-70.

27. Shalaby, F., et al., Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice. Nature, 1995. 376(6535): p. 62-6.

28. Carmeliet, P., et al., Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele. Nature, 1996. 380(6573): p. 435-9.

29. Ferrara, N., et al., Heterozygous embryonic lethality induced by targeted inactivation of the VEGF gene. Nature, 1996. 380(6573): p. 439-42.

30. Eremina, V., et al., Glomerular-specific alterations of VEGF-A expression lead to distinct congenital and acquired renal diseases. J Clin Invest, 2003. 111(5): p. 707-16.

31. Eremina, V., et al., VEGF inhibition and renal thrombotic microangiopathy. N Engl J Med, 2008. 358(11): p. 1129-36.

32. Kang, D.H., et al., Impaired angiogenesis in the remnant kidney model: I. Potential role of vascular endothelial growth factor and thrombospondin-1. J Am Soc Nephrol, 2001. 12(7): p. 1434-47.

33. Kang, D.H., et al., Impaired angiogenesis in the remnant kidney model: II. Vascular endothelial growth factor administration reduces renal fibrosis and stabilizes renal function. J Am Soc Nephrol, 2001. 12(7): p. 1448-57.

34. Kim, Y.G., et al., Vascular endothelial growth factor accelerates renal recovery in experimental thrombotic microangiopathy. Kidney Int, 2000. 58(6): p. 2390-9.

35. Suga, S., et al., Vascular endothelial growth factor (VEGF121) protects rats from renal infarction in thrombotic microangiopathy. Kidney Int, 2001. 60(4): p. 1297-308.

36. Kang, D.H., et al., Nitric oxide modulates vascular disease in the remnant kidney model. Am J Pathol, 2002. 161(1): p. 239-48.

37. Advani, A., et al., Role of VEGF in maintaining renal structure and function under normotensive and hypertensive conditions. Proc Natl Acad Sci U S A, 2007. 104(36): p. 14448-53.

38. Jeansson, M., et al., Angiopoietin-1 is essential in mouse vasculature during development and in response to injury. J Clin Invest, 2011. 121(6): p. 2278-89.

39. Visconti, R.P., C.D. Richardson, and T.N. Sato, Orchestration of angiogenesis and arteriovenous contribution by angiopoietins and vascular endothelial growth factor (VEGF). Proc Natl Acad Sci U S A, 2002. 99(12): p. 8219-24.

40. Satchell, S.C., et al., Human podocytes express angiopoietin 1, a potential regulator of glomerular vascular endothelial growth factor. J Am Soc Nephrol, 2002. 13(2): p. 544-50.

41. Baggiolini, M., Chemokines and leukocyte traffic. Nature, 1998. 392(6676): p. 565-8. 42. Nagasawa, T., et al., Molecular cloning and characterization of a murine pre-B-cell growth-

stimulating factor/stromal cell-derived factor 1 receptor, a murine homolog of the human immunodeficiency virus 1 entry coreceptor fusin. Proc Natl Acad Sci U S A, 1996. 93(25): p. 14726-9.

105

43. Petit, I., et al., G-CSF induces stem cell mobilization by decreasing bone marrow SDF-1 and up-regulating CXCR4. Nat Immunol, 2002. 3(7): p. 687-94.

44. Pillarisetti, K. and S.K. Gupta, Cloning and relative expression analysis of rat stromal cell derived factor-1 (SDF-1)1: SDF-1 alpha mRNA is selectively induced in rat model of myocardial infarction. Inflammation, 2001. 25(5): p. 293-300.

45. Salcedo, R., et al., Vascular endothelial growth factor and basic fibroblast growth factor induce expression of CXCR4 on human endothelial cells: In vivo neovascularization induced by stromal-derived factor-1alpha. Am J Pathol, 1999. 154(4): p. 1125-35.

46. Gupta, S.K., et al., Chemokine receptors in human endothelial cells. Functional expression of CXCR4 and its transcriptional regulation by inflammatory cytokines. J Biol Chem, 1998. 273(7): p. 4282-7.

47. Amara, A., et al., Stromal cell-derived factor-1alpha associates with heparan sulfates through the first beta-strand of the chemokine. J Biol Chem, 1999. 274(34): p. 23916-25.

48. Yu, L., et al., Identification and expression of novel isoforms of human stromal cell-derived factor 1. Gene, 2006. 374: p. 174-9.

49. Dettin, M., et al., Anti-HIV activity and conformational studies of peptides derived from the C-terminal sequence of SDF-1. J Med Chem, 2004. 47(12): p. 3058-64.

50. Shirozu, M., et al., Structure and chromosomal localization of the human stromal cell-derived factor 1 (SDF1) gene. Genomics, 1995. 28(3): p. 495-500.

51. Tashiro, K., et al., Signal sequence trap: a cloning strategy for secreted proteins and type I membrane proteins. Science, 1993. 261(5121): p. 600-3.

52. Schober, A., et al., SDF-1alpha-mediated tissue repair by stem cells: a promising tool in cardiovascular medicine? Trends Cardiovasc Med, 2006. 16(4): p. 103-8.

53. Pablos, J.L., et al., Stromal-cell derived factor is expressed by dendritic cells and endothelium in human skin. Am J Pathol, 1999. 155(5): p. 1577-86.

54. Zou, Y.R., et al., Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar development. Nature, 1998. 393(6685): p. 595-9.

55. Bleul, C.C., et al., The lymphocyte chemoattractant SDF-1 is a ligand for LESTR/fusin and blocks HIV-1 entry. Nature, 1996. 382(6594): p. 829-33.

56. Oberlin, E., et al., The CXC chemokine SDF-1 is the ligand for LESTR/fusin and prevents infection by T-cell-line-adapted HIV-1. Nature, 1996. 382(6594): p. 833-5.

57. Ara, T., et al., The role of CXCL12 in the organ-specific process of artery formation. Blood, 2005. 105(8): p. 3155-61.

58. Guleng, B., et al., Blockade of the stromal cell-derived factor-1/CXCR4 axis attenuates in vivo tumor growth by inhibiting angiogenesis in a vascular endothelial growth factor-independent manner. Cancer Res, 2005. 65(13): p. 5864-71.

59. Petit, I., D. Jin, and S. Rafii, The SDF-1-CXCR4 signaling pathway: a molecular hub modulating neo-angiogenesis. Trends Immunol, 2007. 28(7): p. 299-307.

60. Levesque, J.P., et al., Disruption of the CXCR4/CXCL12 chemotactic interaction during hematopoietic stem cell mobilization induced by GCSF or cyclophosphamide. J Clin Invest, 2003. 111(2): p. 187-96.

61. Teicher, B.A. and S.P. Fricker, CXCL12 (SDF-1)/CXCR4 pathway in cancer. Clin Cancer Res, 2010. 16(11): p. 2927-31.

62. Askari, A.T., et al., Effect of stromal-cell-derived factor 1 on stem-cell homing and tissue regeneration in ischaemic cardiomyopathy. Lancet, 2003. 362(9385): p. 697-703.

63. Yamaguchi, J., et al., Stromal cell-derived factor-1 effects on ex vivo expanded endothelial progenitor cell recruitment for ischemic neovascularization. Circulation, 2003. 107(9): p. 1322-8.

106

64. Salvucci, O., et al., Evidence for the involvement of SDF-1 and CXCR4 in the disruption of endothelial cell-branching morphogenesis and angiogenesis by TNF-alpha and IFN-gamma. J Leukoc Biol, 2004. 76(1): p. 217-26.

65. Schutyser, E., et al., Hypoxia enhances CXCR4 expression in human microvascular endothelial cells and human melanoma cells. Eur Cytokine Netw, 2007. 18(2): p. 59-70.

66. Kucia, M., et al., CXCR4-SDF-1 signalling, locomotion, chemotaxis and adhesion. J Mol Histol, 2004. 35(3): p. 233-45.

67. Kucia, M., et al., Trafficking of normal stem cells and metastasis of cancer stem cells involve similar mechanisms: pivotal role of the SDF-1-CXCR4 axis. Stem Cells, 2005. 23(7): p. 879-94.

68. Ratajczak, M.Z., et al., Stem cell plasticity revisited: CXCR4-positive cells expressing mRNA for early muscle, liver and neural cells 'hide out' in the bone marrow. Leukemia, 2004. 18(1): p. 29-40.

69. Wojakowski, W., et al., Mobilization of CD34/CXCR4+, CD34/CD117+, c-met+ stem cells, and mononuclear cells expressing early cardiac, muscle, and endothelial markers into peripheral blood in patients with acute myocardial infarction. Circulation, 2004. 110(20): p. 3213-20.

70. Kucia, M., et al., Tissue-specific muscle, neural and liver stem/progenitor cells reside in the bone marrow, respond to an SDF-1 gradient and are mobilized into peripheral blood during stress and tissue injury. Blood Cells Mol Dis, 2004. 32(1): p. 52-7.

71. Shi, Q., et al., Evidence for circulating bone marrow-derived endothelial cells. Blood, 1998. 92(2): p. 362-7.

72. Wang, X., et al., Albumin-expressing hepatocyte-like cells develop in the livers of immune-deficient mice that received transplants of highly purified human hematopoietic stem cells. Blood, 2003. 101(10): p. 4201-8.

73. Cogle, C.R., et al., Bone marrow transdifferentiation in brain after transplantation: a retrospective study. Lancet, 2004. 363(9419): p. 1432-7.

74. Rafii, S. and D. Lyden, Therapeutic stem and progenitor cell transplantation for organ vascularization and regeneration. Nat Med, 2003. 9(6): p. 702-12.

75. Wright, L.M., et al., Stromal cell-derived factor-1 binding to its chemokine receptor CXCR4 on precursor cells promotes the chemotactic recruitment, development and survival of human osteoclasts. Bone, 2005. 36(5): p. 840-53.

76. Secchiero, P., et al., Differential effects of stromal derived factor-1 alpha (SDF-1 alpha) on early and late stages of human megakaryocytic development. Anat Rec, 2000. 260(2): p. 141-7.

77. Yano, T., et al., Stromal cell derived factor-1 (SDF-1)/CXCL12 attenuates diabetes in mice and promotes pancreatic beta-cell survival by activation of the prosurvival kinase Akt. Diabetes, 2007. 56(12): p. 2946-57.

78. De Falco, V., et al., Biological role and potential therapeutic targeting of the chemokine receptor CXCR4 in undifferentiated thyroid cancer. Cancer Res, 2007. 67(24): p. 11821-9.

79. Kijowski, J., et al., The SDF-1-CXCR4 axis stimulates VEGF secretion and activates integrins but does not affect proliferation and survival in lymphohematopoietic cells. Stem Cells, 2001. 19(5): p. 453-66.

80. Broxmeyer, H.E., et al., Transgenic expression of stromal cell-derived factor-1/CXC chemokine ligand 12 enhances myeloid progenitor cell survival/antiapoptosis in vitro in response to growth factor withdrawal and enhances myelopoiesis in vivo. J Immunol, 2003. 170(1): p. 421-9.

81. Vila-Coro, A.J., et al., The chemokine SDF-1alpha triggers CXCR4 receptor dimerization and activates the JAK/STAT pathway. FASEB J, 1999. 13(13): p. 1699-710.

107

82. Zhang, X.F., et al., Janus kinase 2 is involved in stromal cell-derived factor-1alpha-induced tyrosine phosphorylation of focal adhesion proteins and migration of hematopoietic progenitor cells. Blood, 2001. 97(11): p. 3342-8.

83. Ling, K., et al., Five-transmembrane domains appear sufficient for a G protein-coupled receptor: functional five-transmembrane domain chemokine receptors. Proc Natl Acad Sci U S A, 1999. 96(14): p. 7922-7.

84. Gilman, A.G., G proteins: transducers of receptor-generated signals. Annu Rev Biochem, 1987. 56: p. 615-49.

85. Stephens, L., et al., A novel phosphoinositide 3 kinase activity in myeloid-derived cells is activated by G protein beta gamma subunits. Cell, 1994. 77(1): p. 83-93.

86. Rosenbaum, D.M., S.G. Rasmussen, and B.K. Kobilka, The structure and function of G-protein-coupled receptors. Nature, 2009. 459(7245): p. 356-63.

87. Arai, H. and I.F. Charo, Differential regulation of G-protein-mediated signaling by chemokine receptors. J Biol Chem, 1996. 271(36): p. 21814-9.

88. Offermanns, S., In vivo functions of heterotrimeric G-proteins: studies in Galpha-deficient mice. Oncogene, 2001. 20(13): p. 1635-42.

89. Rubin, J.B., et al., A small-molecule antagonist of CXCR4 inhibits intracranial growth of primary brain tumors. Proc Natl Acad Sci U S A, 2003. 100(23): p. 13513-8.

90. Maghazachi, A.A., Role of the heterotrimeric G proteins in stromal-derived factor-1alpha-induced natural killer cell chemotaxis and calcium mobilization. Biochem Biophys Res Commun, 1997. 236(2): p. 270-4.

91. Tan, W., D. Martin, and J.S. Gutkind, The Galpha13-Rho signaling axis is required for SDF-1-induced migration through CXCR4. J Biol Chem, 2006. 281(51): p. 39542-9.

92. Della Rocca, G.J., et al., Ras-dependent mitogen-activated protein kinase activation by G protein-coupled receptors. Convergence of Gi- and Gq-mediated pathways on calcium/calmodulin, Pyk2, and Src kinase. J Biol Chem, 1997. 272(31): p. 19125-32.

93. Crespo, P., et al., Ras-dependent activation of MAP kinase pathway mediated by G-protein beta gamma subunits. Nature, 1994. 369(6479): p. 418-20.

94. Whitehead, I.P., I.E. Zohn, and C.J. Der, Rho GTPase-dependent transformation by G protein-coupled receptors. Oncogene, 2001. 20(13): p. 1547-55.

95. Hart, M.J., et al., Direct stimulation of the guanine nucleotide exchange activity of p115 RhoGEF by Galpha13. Science, 1998. 280(5372): p. 2112-4.

96. Franke, T.F., et al., The protein kinase encoded by the Akt proto-oncogene is a target of the PDGF-activated phosphatidylinositol 3-kinase. Cell, 1995. 81(5): p. 727-36.

97. Franke, T.F., et al., Direct regulation of the Akt proto-oncogene product by phosphatidylinositol-3,4-bisphosphate. Science, 1997. 275(5300): p. 665-8.

98. Frech, M., et al., High affinity binding of inositol phosphates and phosphoinositides to the pleckstrin homology domain of RAC/protein kinase B and their influence on kinase activity. J Biol Chem, 1997. 272(13): p. 8474-81.

99. Cherla, R.P. and R.K. Ganju, Stromal cell-derived factor 1 alpha-induced chemotaxis in T cells is mediated by nitric oxide signaling pathways. J Immunol, 2001. 166(5): p. 3067-74.

100. Sameermahmood, Z., et al., Curcumin modulates SDF-1alpha/CXCR4-induced migration of human retinal endothelial cells (HRECs). Invest Ophthalmol Vis Sci, 2008. 49(8): p. 3305-11.

101. Morales-Ruiz, M., et al., Vascular endothelial growth factor-stimulated actin reorganization and migration of endothelial cells is regulated via the serine/threonine kinase Akt. Circ Res, 2000. 86(8): p. 892-6.

108

102. Zheng, H., et al., SDF-1alpha/CXCR4 decreases endothelial progenitor cells apoptosis under serum deprivation by PI3K/Akt/eNOS pathway. Atherosclerosis, 2008. 201(1): p. 36-42.

103. Datta, S.R., A. Brunet, and M.E. Greenberg, Cellular survival: a play in three Akts. Genes Dev, 1999. 13(22): p. 2905-27.

104. Reed, J.C., Bcl-2 family proteins. Oncogene, 1998. 17(25): p. 3225-36. 105. Green, D.R. and J.C. Reed, Mitochondria and apoptosis. Science, 1998. 281(5381): p. 1309-12. 106. Datta, S.R., et al., Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death

machinery. Cell, 1997. 91(2): p. 231-41. 107. del Peso, L., et al., Interleukin-3-induced phosphorylation of BAD through the protein kinase Akt.

Science, 1997. 278(5338): p. 687-9. 108. Cross, D.A., et al., Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase

B. Nature, 1995. 378(6559): p. 785-9. 109. Cardone, M.H., et al., Regulation of cell death protease caspase-9 by phosphorylation. Science,

1998. 282(5392): p. 1318-21. 110. Hashimoto, I., et al., Blocking on the CXCR4/mTOR signalling pathway induces the anti-

metastatic properties and autophagic cell death in peritoneal disseminated gastric cancer cells. Eur J Cancer, 2008. 44(7): p. 1022-9.

111. Monterrubio, M., et al., PI3Kgamma activation by CXCL12 regulates tumor cell adhesion and invasion. Biochem Biophys Res Commun, 2009. 388(2): p. 199-204.

112. Hwang, J.H., et al., CXC chemokine receptor 4 expression and function in human anaplastic thyroid cancer cells. J Clin Endocrinol Metab, 2003. 88(1): p. 408-16.

113. Song, N., et al., Overexpression of platelet-derived growth factor-BB increases tumor pericyte content via stromal-derived factor-1alpha/CXCR4 axis. Cancer Res, 2009. 69(15): p. 6057-64.

114. Guertin, D.A. and D.M. Sabatini, Defining the role of mTOR in cancer. Cancer Cell, 2007. 12(1): p. 9-22.

115. Bernardi, R., et al., PML inhibits HIF-1alpha translation and neoangiogenesis through repression of mTOR. Nature, 2006. 442(7104): p. 779-85.

116. Pi, X., et al., SDF-1alpha stimulates JNK3 activity via eNOS-dependent nitrosylation of MKP7 to enhance endothelial migration. Proc Natl Acad Sci U S A, 2009. 106(14): p. 5675-80.

117. Dimmeler, S., et al., Activation of nitric oxide synthase in endothelial cells by Akt-dependent phosphorylation. Nature, 1999. 399(6736): p. 601-5.

118. Chen, Z.P., et al., AMP-activated protein kinase phosphorylation of endothelial NO synthase. FEBS Lett, 1999. 443(3): p. 285-9.

119. Huang, P.L., et al., Hypertension in mice lacking the gene for endothelial nitric oxide synthase. Nature, 1995. 377(6546): p. 239-42.

120. Shesely, E.G., et al., Elevated blood pressures in mice lacking endothelial nitric oxide synthase. Proc Natl Acad Sci U S A, 1996. 93(23): p. 13176-81.

121. Teichert, A.M., et al., Characterization of the murine endothelial nitric oxide synthase promoter. Biochim Biophys Acta, 1998. 1443(3): p. 352-7.

122. Rudic, R.D., et al., Direct evidence for the importance of endothelium-derived nitric oxide in vascular remodeling. J Clin Invest, 1998. 101(4): p. 731-6.

123. Forbes, M.S., et al., Lack of endothelial nitric-oxide synthase leads to progressive focal renal injury. Am J Pathol, 2007. 170(1): p. 87-99.

124. Muller, V., et al., Chronic nitric oxide deficiency and progression of kidney disease after renal mass reduction in the C57Bl6 mouse. Am J Nephrol, 2010. 32(6): p. 575-80.

125. Nakayama, T., et al., Endothelial injury due to eNOS deficiency accelerates the progression of chronic renal disease in the mouse. Am J Physiol Renal Physiol, 2009. 296(2): p. F317-27.

109

126. Mendoza, M.G., et al., Kidney damage after renal ablation is worsened in endothelial nitric oxide synthase -/- mice and improved by combined administration of L-arginine and antioxidants. Nephrology (Carlton), 2008. 13(3): p. 218-27.

127. Reyes, A.A., et al., Dietary supplementation with L-arginine ameliorates the progression of renal disease in rats with subtotal nephrectomy. Am J Kidney Dis, 1992. 20(2): p. 168-76.

128. Baylis, C., Nitric oxide deficiency in chronic kidney disease. Am J Physiol Renal Physiol, 2008. 294(1): p. F1-9.

129. Zoccali, C., et al., Plasma concentration of asymmetrical dimethylarginine and mortality in patients with end-stage renal disease: a prospective study. Lancet, 2001. 358(9299): p. 2113-7.

130. Kielstein, J.T., et al., Marked increase of asymmetric dimethylarginine in patients with incipient primary chronic renal disease. J Am Soc Nephrol, 2002. 13(1): p. 170-6.

131. Kajimoto, H., et al., Inhibition of eNOS phosphorylation mediates endothelial dysfunction in renal failure: new effect of asymmetric dimethylarginine. Kidney Int, 2012. 81(8): p. 762-8.

132. Vallance, P., et al., Accumulation of an endogenous inhibitor of nitric oxide synthesis in chronic renal failure. Lancet, 1992. 339(8793): p. 572-5.

133. Murohara, T., et al., Nitric oxide synthase modulates angiogenesis in response to tissue ischemia. J Clin Invest, 1998. 101(11): p. 2567-78.

134. Chang, B., et al., Nitric oxide in obstructive uropathy: role of endothelial nitric oxide synthase. J Urol, 2002. 168(4 Pt 2): p. 1801-4.

135. Heeringa, P., et al., Lack of endothelial nitric oxide synthase aggravates murine accelerated anti-glomerular basement membrane glomerulonephritis. Am J Pathol, 2000. 156(3): p. 879-88.

136. Rolle, U., H. Shima, and P. Puri, Nitric oxide, enhanced by macrophage-colony stimulating factor, mediates renal damage in reflux nephropathy. Kidney Int, 2002. 62(2): p. 507-13.

137. de Vriese, A.S., et al., Antibodies against vascular endothelial growth factor improve early renal dysfunction in experimental diabetes. J Am Soc Nephrol, 2001. 12(5): p. 993-1000.

138. Meehan, B., et al., Age-related properties of the tumour vasculature in renal cell carcinoma. BJU Int, 2011. 107(3): p. 416-24.

139. Staller, P., et al., Chemokine receptor CXCR4 downregulated by von Hippel-Lindau tumour suppressor pVHL. Nature, 2003. 425(6955): p. 307-11.

140. Schioppa, T., et al., Regulation of the chemokine receptor CXCR4 by hypoxia. J Exp Med, 2003. 198(9): p. 1391-402.

141. Ceradini, D.J., et al., Progenitor cell trafficking is regulated by hypoxic gradients through HIF-1 induction of SDF-1. Nat Med, 2004. 10(8): p. 858-64.

142. Wang, D.H., et al., Conditioned medium from renal tubular epithelial cells stimulated by hypoxia influences rat bone marrow-derived endothelial progenitor cells. Ren Fail, 2010. 32(7): p. 863-70.

143. Isoe, T., et al., High glucose activates HIF-1-mediated signal transduction in glomerular mesangial cells through a carbohydrate response element binding protein. Kidney Int, 2010. 78(1): p. 48-59.

144. Petruzziello-Pellegrini, T.N., et al., The CXCR4/CXCR7/SDF-1 pathway contributes to the pathogenesis of Shiga toxin-associated hemolytic uremic syndrome in humans and mice. J Clin Invest, 2012. 122(2): p. 759-76.

145. Valenzuela-Fernandez, A., et al., Leukocyte elastase negatively regulates Stromal cell-derived factor-1 (SDF-1)/CXCR4 binding and functions by amino-terminal processing of SDF-1 and CXCR4. J Biol Chem, 2002. 277(18): p. 15677-89.

146. McQuibban, G.A., et al., Matrix metalloproteinase activity inactivates the CXC chemokine stromal cell-derived factor-1. J Biol Chem, 2001. 276(47): p. 43503-8.

110

147. Proost, P., et al., Processing by CD26/dipeptidyl-peptidase IV reduces the chemotactic and anti-HIV-1 activity of stromal-cell-derived factor-1alpha. FEBS Lett, 1998. 432(1-2): p. 73-6.

148. Naumann, U., et al., CXCR7 functions as a scavenger for CXCL12 and CXCL11. PLoS One, 2010. 5(2): p. e9175.

149. Cheng, Z.J., et al., beta-arrestin differentially regulates the chemokine receptor CXCR4-mediated signaling and receptor internalization, and this implicates multiple interaction sites between beta-arrestin and CXCR4. J Biol Chem, 2000. 275(4): p. 2479-85.

150. Orsini, M.J., et al., Trafficking of the HIV coreceptor CXCR4. Role of arrestins and identification of residues in the c-terminal tail that mediate receptor internalization. J Biol Chem, 1999. 274(43): p. 31076-86.

151. Ding, Z., et al., L-selectin stimulation enhances functional expression of surface CXCR4 in lymphocytes: implications for cellular activation during adhesion and migration. Blood, 2003. 101(11): p. 4245-52.

152. Bolte, S. and F.P. Cordelieres, A guided tour into subcellular colocalization analysis in light microscopy. J Microsc, 2006. 224(Pt 3): p. 213-32.

153. Ding, Y., et al., The 73-kDa heat shock cognate protein is a CXCR4 binding protein that regulates the receptor endocytosis and the receptor-mediated chemotaxis. Mol Pharmacol, 2006. 69(4): p. 1269-79.

154. Ding, Y., et al., Plectin regulates the signaling and trafficking of the HIV-1 co-receptor CXCR4 and plays a role in HIV-1 infection. Exp Cell Res, 2008. 314(3): p. 590-602.

155. Rey, M., et al., Myosin IIA is involved in the endocytosis of CXCR4 induced by SDF-1alpha. J Cell Sci, 2007. 120(Pt 6): p. 1126-33.

156. Amara, A., et al., HIV coreceptor downregulation as antiviral principle: SDF-1alpha-dependent internalization of the chemokine receptor CXCR4 contributes to inhibition of HIV replication. J Exp Med, 1997. 186(1): p. 139-46.

157. Wysoczynski, M., et al., Incorporation of CXCR4 into membrane lipid rafts primes homing-related responses of hematopoietic stem/progenitor cells to an SDF-1 gradient. Blood, 2005. 105(1): p. 40-8.

158. Berthebaud, M., et al., RGS16 is a negative regulator of SDF-1-CXCR4 signaling in megakaryocytes. Blood, 2005. 106(9): p. 2962-8.

159. Le, Y., et al., CXC chemokine ligand 12-induced focal adhesion kinase activation and segregation into membrane domains is modulated by regulator of G protein signaling 1 in pro-B cells. J Immunol, 2005. 174(5): p. 2582-90.

160. Balabanian, K., et al., The chemokine SDF-1/CXCL12 binds to and signals through the orphan receptor RDC1 in T lymphocytes. J Biol Chem, 2005. 280(42): p. 35760-6.

161. Mazzinghi, B., et al., Essential but differential role for CXCR4 and CXCR7 in the therapeutic homing of human renal progenitor cells. J Exp Med, 2008. 205(2): p. 479-90.

162. Sagrinati, C., et al., Isolation and characterization of multipotent progenitor cells from the Bowman's capsule of adult human kidneys. J Am Soc Nephrol, 2006. 17(9): p. 2443-56.

163. Takabatake, Y., et al., The CXCL12 (SDF-1)/CXCR4 axis is essential for the development of renal vasculature. J Am Soc Nephrol, 2009. 20(8): p. 1714-23.

164. Sierro, F., et al., Disrupted cardiac development but normal hematopoiesis in mice deficient in the second CXCL12/SDF-1 receptor, CXCR7. Proc Natl Acad Sci U S A, 2007. 104(37): p. 14759-64.

165. Burns, J.M., et al., A novel chemokine receptor for SDF-1 and I-TAC involved in cell survival, cell adhesion, and tumor development. J Exp Med, 2006. 203(9): p. 2201-13.

166. Hattermann, K., et al., The chemokine receptor CXCR7 is highly expressed in human glioma cells and mediates antiapoptotic effects. Cancer Res, 2010. 70(8): p. 3299-308.

111

167. Stokman, G., et al., SDF-1 provides morphological and functional protection against renal ischaemia/reperfusion injury. Nephrol Dial Transplant, 2010. 25(12): p. 3852-9.

168. Levoye, A., et al., CXCR7 heterodimerizes with CXCR4 and regulates CXCL12-mediated G protein signaling. Blood, 2009. 113(24): p. 6085-93.

169. Saini, V., A. Marchese, and M. Majetschak, CXC chemokine receptor 4 is a cell surface receptor for extracellular ubiquitin. J Biol Chem, 2010. 285(20): p. 15566-76.

170. Goldberg, A.L., Protein degradation and protection against misfolded or damaged proteins. Nature, 2003. 426(6968): p. 895-9.

171. Majetschak, M., Extracellular ubiquitin: immune modulator and endogenous opponent of damage-associated molecular pattern molecules. J Leukoc Biol, 2011. 89(2): p. 205-19.

172. Singh, M., et al., Extracellular ubiquitin inhibits beta-AR-stimulated apoptosis in cardiac myocytes: role of GSK-3beta and mitochondrial pathways. Cardiovasc Res, 2010. 86(1): p. 20-8.

173. Ohe, Y., et al., Cultured leptomeningeal cells secrete cerebrospinal fluid proteins. J Neurochem, 1996. 67(3): p. 964-71.

174. Kieffer, A.E., et al., The N- and C-terminal fragments of ubiquitin are important for the antimicrobial activities. FASEB J, 2003. 17(6): p. 776-8.

175. Wegrzyn, J., et al., Proteomics of neuroendocrine secretory vesicles reveal distinct functional systems for biosynthesis and exocytosis of peptide hormones and neurotransmitters. J Proteome Res, 2007. 6(5): p. 1652-65.

176. Hoffmann, U., et al., SDF-1 expression is elevated in chronic human renal allograft rejection. Clin Transplant, 2006. 20(6): p. 712-8.

177. Majetschak, M., et al., Extracellular ubiquitin inhibits the TNF-alpha response to endotoxin in peripheral blood mononuclear cells and regulates endotoxin hyporesponsiveness in critical illness. Blood, 2003. 101(5): p. 1882-90.

178. Majetschak, M., et al., Effects of exogenous ubiquitin in lethal endotoxemia. Surgery, 2004. 135(5): p. 536-43.

179. Meiron, M., et al., CXCL12 (SDF-1alpha) suppresses ongoing experimental autoimmune encephalomyelitis by selecting antigen-specific regulatory T cells. J Exp Med, 2008. 205(11): p. 2643-55.

180. Saini, V., et al., The CXC chemokine receptor 4 ligands ubiquitin and stromal cell-derived factor-1alpha function through distinct receptor interactions. J Biol Chem, 2011. 286(38): p. 33466-77.

181. Ding, M., et al., Loss of the tumor suppressor Vhlh leads to upregulation of Cxcr4 and rapidly progressive glomerulonephritis in mice. Nat Med, 2006. 12(9): p. 1081-7.

182. Grone, H.J., et al., Spatial and temporally restricted expression of chemokines and chemokine receptors in the developing human kidney. J Am Soc Nephrol, 2002. 13(4): p. 957-67.

183. Ueland, J., et al., A novel role for the chemokine receptor Cxcr4 in kidney morphogenesis: an in vitro study. Dev Dyn, 2009. 238(5): p. 1083-91.

184. Tachibana, K., et al., The chemokine receptor CXCR4 is essential for vascularization of the gastrointestinal tract. Nature, 1998. 393(6685): p. 591-4.

185. Lazarini, F., et al., Role of the alpha-chemokine stromal cell-derived factor (SDF-1) in the developing and mature central nervous system. Glia, 2003. 42(2): p. 139-48.

186. Nagasawa, T., et al., Defects of B-cell lymphopoiesis and bone-marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1. Nature, 1996. 382(6592): p. 635-8.

187. Bagri, A., et al., The chemokine SDF1 regulates migration of dentate granule cells. Development, 2002. 129(18): p. 4249-60.

188. Ma, Q., et al., Impaired B-lymphopoiesis, myelopoiesis, and derailed cerebellar neuron migration in CXCR4- and SDF-1-deficient mice. Proc Natl Acad Sci U S A, 1998. 95(16): p. 9448-53.

112

189. Sayyed, S.G., et al., Podocytes produce homeostatic chemokine stromal cell-derived factor-1/CXCL12, which contributes to glomerulosclerosis, podocyte loss and albuminuria in a mouse model of type 2 diabetes. Diabetologia, 2009. 52(11): p. 2445-54.

190. Breier, G., et al., Expression of vascular endothelial growth factor during embryonic angiogenesis and endothelial cell differentiation. Development, 1992. 114(2): p. 521-32.

191. Eremina, V. and S.E. Quaggin, The role of VEGF-A in glomerular development and function. Curr Opin Nephrol Hypertens, 2004. 13(1): p. 9-15.

192. Partanen, T.A., et al., VEGF-C and VEGF-D expression in neuroendocrine cells and their receptor, VEGFR-3, in fenestrated blood vessels in human tissues. FASEB J, 2000. 14(13): p. 2087-96.

193. Takahashi, T., et al., Temporally compartmentalized expression of ephrin-B2 during renal glomerular development. J Am Soc Nephrol, 2001. 12(12): p. 2673-82.

194. Bitzan, M.M., et al., Verotoxin and ricin have novel effects on preproendothelin-1 expression but fail to modify nitric oxide synthase (ecNOS) expression and NO production in vascular endothelium. J Clin Invest, 1998. 101(2): p. 372-82.

195. Couser, W.G., Rapidly progressive glomerulonephritis: classification, pathogenetic mechanisms, and therapy. Am J Kidney Dis, 1988. 11(6): p. 449-64.

196. Jie, W., et al., SDF-1alpha/CXCR4 axis is involved in glucose-potentiated proliferation and chemotaxis in rat vascular smooth muscle cells. Int J Exp Pathol, 2010. 91(5): p. 436-44.

197. Humpert, P.M., et al., Association of stromal cell-derived factor 1 genotype with diabetic foot syndrome and macrovascular disease in patients with type 2 diabetes. Clin Chem, 2006. 52(6): p. 1206-8.

198. Gariano, R.F. and T.W. Gardner, Retinal angiogenesis in development and disease. Nature, 2005. 438(7070): p. 960-6.

199. Arfken, C.L., et al., Development of proliferative diabetic retinopathy in African-Americans and whites with type 1 diabetes. Diabetes Care, 1998. 21(5): p. 792-5.

200. Butler, J.M., et al., SDF-1 is both necessary and sufficient to promote proliferative retinopathy. J Clin Invest, 2005. 115(1): p. 86-93.

201. Unoki, N., et al., SDF-1/CXCR4 contributes to the activation of tip cells and microglia in retinal angiogenesis. Invest Ophthalmol Vis Sci, 2010. 51(7): p. 3362-71.

202. Nyengaard, J.R., Number and dimensions of rat glomerular capillaries in normal development and after nephrectomy. Kidney Int, 1993. 43(5): p. 1049-57.

203. Cooper, M.E., et al., Increased renal expression of vascular endothelial growth factor (VEGF) and its receptor VEGFR-2 in experimental diabetes. Diabetes, 1999. 48(11): p. 2229-39.

204. Tsuchida, K., et al., Suppression of transforming growth factor beta and vascular endothelial growth factor in diabetic nephropathy in rats by a novel advanced glycation end product inhibitor, OPB-9195. Diabetologia, 1999. 42(5): p. 579-88.

205. Flyvbjerg, A., et al., Amelioration of long-term renal changes in obese type 2 diabetic mice by a neutralizing vascular endothelial growth factor antibody. Diabetes, 2002. 51(10): p. 3090-4.

206. Sung, S.H., et al., Blockade of vascular endothelial growth factor signaling ameliorates diabetic albuminuria in mice. J Am Soc Nephrol, 2006. 17(11): p. 3093-104.

207. Frangie, C., et al., Renal thrombotic microangiopathy caused by anti-VEGF-antibody treatment for metastatic renal-cell carcinoma. Lancet Oncol, 2007. 8(2): p. 177-8.

208. Izzedine, H., et al., Thrombotic microangiopathy and anti-VEGF agents. Nephrol Dial Transplant, 2007. 22(5): p. 1481-2.

209. Levine, R.J., et al., Soluble endoglin and other circulating antiangiogenic factors in preeclampsia. N Engl J Med, 2006. 355(10): p. 992-1005.

113

210. Levine, R.J., et al., Serum sFlt1 concentration during preeclampsia and mid trimester blood pressure in healthy nulliparous women. Am J Obstet Gynecol, 2006. 194(4): p. 1034-41.

211. Maynard, S.E., et al., Excess placental soluble fms-like tyrosine kinase 1 (sFlt1) may contribute to endothelial dysfunction, hypertension, and proteinuria in preeclampsia. J Clin Invest, 2003. 111(5): p. 649-58.

212. Roncone, D., et al., Proteinuria in a patient receiving anti-VEGF therapy for metastatic renal cell carcinoma. Nat Clin Pract Nephrol, 2007. 3(5): p. 287-93.

213. Society, C.C., Canadian Cancer Statistics 2011, P.T.C.R.a.H.A.o.C. Statistics Canada, Editor. 2012. 214. Presti, J.C., Jr., et al., Histopathological, cytogenetic, and molecular characterization of renal

cortical tumors. Cancer Res, 1991. 51(5): p. 1544-52. 215. Cindolo, L., et al., Comparison of predictive accuracy of four prognostic models for nonmetastatic

renal cell carcinoma after nephrectomy: a multicenter European study. Cancer, 2005. 104(7): p. 1362-71.

216. Wehler, T.C., et al., SDF1beta expression in renal cell carcinoma correlates with grading and infiltration by CD8+ T-cells. Anticancer Res, 2011. 31(9): p. 2797-803.

217. Haviv, Y.S., et al., Transcriptional targeting in renal cancer cell lines via the human CXCR4 promoter. Mol Cancer Ther, 2004. 3(6): p. 687-91.

218. Gerritsen, M.E., F.V. Peale, Jr., and T. Wu, Gene expression profiling in silico: relative expression of candidate angiogenesis associated genes in renal cell carcinomas. Exp Nephrol, 2002. 10(2): p. 114-9.

219. Wang, L., et al., Strong expression of chemokine receptor CXCR4 by renal cell carcinoma cells correlates with metastasis. Clin Exp Metastasis, 2009. 26(8): p. 1049-54.

220. Gahan, J.C., et al., Chemokine and chemokine receptor expression in kidney tumors: molecular profiling of histological subtypes and association with metastasis. J Urol, 2012. 187(3): p. 827-33.

221. D'Alterio, C., et al., Differential role of CD133 and CXCR4 in renal cell carcinoma. Cell Cycle, 2010. 9(22): p. 4492-4500.

222. Wehler, T.C., et al., Strong expression of chemokine receptor CXCR4 by renal cell carcinoma correlates with advanced disease. J Oncol, 2008. 2008: p. 626340.

223. Hanahan, D. and R.A. Weinberg, The hallmarks of cancer. Cell, 2000. 100(1): p. 57-70. 224. Ottaiano, A., Finding markers for cancer stem cells in renal cell carcinoma: looking beyond

CD133. Cell Cycle, 2010. 9(22): p. 4431. 225. Liang, Z., et al., CXCR4/CXCL12 axis promotes VEGF-mediated tumor angiogenesis through Akt

signaling pathway. Biochem Biophys Res Commun, 2007. 359(3): p. 716-22. 226. Ping, Y.F., et al., The anti-cancer compound Nordy inhibits CXCR4-mediated production of IL-8

and VEGF by malignant human glioma cells. J Neurooncol, 2007. 84(1): p. 21-9. 227. Gnarra, J.R., et al., Mutations of the VHL tumour suppressor gene in renal carcinoma. Nat Genet,

1994. 7(1): p. 85-90. 228. Shuin, T., et al., Frequent somatic mutations and loss of heterozygosity of the von Hippel-Lindau

tumor suppressor gene in primary human renal cell carcinomas. Cancer Res, 1994. 54(11): p. 2852-5.

229. Zhong, H., et al., Overexpression of hypoxia-inducible factor 1alpha in common human cancers and their metastases. Cancer Res, 1999. 59(22): p. 5830-5.

230. Turner, K.J., et al., Expression of hypoxia-inducible factors in human renal cancer: relationship to angiogenesis and to the von Hippel-Lindau gene mutation. Cancer Res, 2002. 62(10): p. 2957-61.

231. Raval, R.R., et al., Contrasting properties of hypoxia-inducible factor 1 (HIF-1) and HIF-2 in von Hippel-Lindau-associated renal cell carcinoma. Mol Cell Biol, 2005. 25(13): p. 5675-86.

114

232. Struckmann, K., et al., pVHL co-ordinately regulates CXCR4/CXCL12 and MMP2/MMP9 expression in human clear-cell renal cell carcinoma. J Pathol, 2008. 214(4): p. 464-71.

233. Zagzag, D., et al., Stromal cell-derived factor-1alpha and CXCR4 expression in hemangioblastoma and clear cell-renal cell carcinoma: von Hippel-Lindau loss-of-function induces expression of a ligand and its receptor. Cancer Res, 2005. 65(14): p. 6178-88.

234. Pan, J., et al., Stromal derived factor-1 (SDF-1/CXCL12) and CXCR4 in renal cell carcinoma metastasis. Mol Cancer, 2006. 5: p. 56.

235. Cardones, A.R., T. Murakami, and S.T. Hwang, CXCR4 enhances adhesion of B16 tumor cells to endothelial cells in vitro and in vivo via beta(1) integrin. Cancer Res, 2003. 63(20): p. 6751-7.

236. Wang, L., et al., CXCR4 nuclear localization follows binding of its ligand SDF-1 and occurs in metastatic but not primary renal cell carcinoma. Oncol Rep, 2009. 22(6): p. 1333-9.

237. Liang, Z., et al., Inhibition of breast cancer metastasis by selective synthetic polypeptide against CXCR4. Cancer Res, 2004. 64(12): p. 4302-8.

238. Jankowski, K., et al., Both hepatocyte growth factor (HGF) and stromal-derived factor-1 regulate the metastatic behavior of human rhabdomyosarcoma cells, but only HGF enhances their resistance to radiochemotherapy. Cancer Res, 2003. 63(22): p. 7926-35.

239. Mohle, R., et al., The chemokine receptor CXCR-4 is expressed on CD34+ hematopoietic progenitors and leukemic cells and mediates transendothelial migration induced by stromal cell-derived factor-1. Blood, 1998. 91(12): p. 4523-30.

240. Rosu-Myles, M., et al., The human hematopoietic stem cell compartment is heterogeneous for CXCR4 expression. Proc Natl Acad Sci U S A, 2000. 97(26): p. 14626-31.

241. Peled, A., et al., The chemokine SDF-1 activates the integrins LFA-1, VLA-4, and VLA-5 on immature human CD34(+) cells: role in transendothelial/stromal migration and engraftment of NOD/SCID mice. Blood, 2000. 95(11): p. 3289-96.

242. Salcedo, R. and J.J. Oppenheim, Role of chemokines in angiogenesis: CXCL12/SDF-1 and CXCR4 interaction, a key regulator of endothelial cell responses. Microcirculation, 2003. 10(3-4): p. 359-70.

243. Chu, P.Y., et al., CXCR4 antagonism attenuates the cardiorenal consequences of mineralocorticoid excess. Circ Heart Fail, 2011. 4(5): p. 651-8.

244. Herzog, E.L., L. Chai, and D.S. Krause, Plasticity of marrow-derived stem cells. Blood, 2003. 102(10): p. 3483-93.

245. Kale, S., et al., Bone marrow stem cells contribute to repair of the ischemically injured renal tubule. J Clin Invest, 2003. 112(1): p. 42-9.

246. Lin, F., et al., Hematopoietic stem cells contribute to the regeneration of renal tubules after renal ischemia-reperfusion injury in mice. J Am Soc Nephrol, 2003. 14(5): p. 1188-99.

247. Togel, F., et al., Renal SDF-1 signals mobilization and homing of CXCR4-positive cells to the kidney after ischemic injury. Kidney Int, 2005. 67(5): p. 1772-84.

248. Stroo, I., et al., Haematopoietic stem cell migration to the ischemic damaged kidney is not altered by manipulating the SDF-1/CXCR4-axis. Nephrol Dial Transplant, 2009. 24(7): p. 2082-8.

249. Lotan, D., et al., Expression of SDF-1/CXCR4 in injured human kidneys. Pediatr Nephrol, 2008. 23(1): p. 71-7.

250. Yuen, D.A., et al., Culture-modified bone marrow cells attenuate cardiac and renal injury in a chronic kidney disease rat model via a novel antifibrotic mechanism. PLoS One, 2010. 5(3): p. e9543.

251. Deng, H., et al., Identification of a major co-receptor for primary isolates of HIV-1. Nature, 1996. 381(6584): p. 661-6.

115

252. Feng, Y., et al., HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor. Science, 1996. 272(5263): p. 872-7.

253. Weissman, D., et al., Macrophage-tropic HIV and SIV envelope proteins induce a signal through the CCR5 chemokine receptor. Nature, 1997. 389(6654): p. 981-5.

254. Wegner, S.A., et al., Genomic organization and functional characterization of the chemokine receptor CXCR4, a major entry co-receptor for human immunodeficiency virus type 1. J Biol Chem, 1998. 273(8): p. 4754-60.

255. Bleul, C.C., et al., The HIV coreceptors CXCR4 and CCR5 are differentially expressed and regulated on human T lymphocytes. Proc Natl Acad Sci U S A, 1997. 94(5): p. 1925-30.

256. Keele, B.F., et al., Identification and characterization of transmitted and early founder virus envelopes in primary HIV-1 infection. Proc Natl Acad Sci U S A, 2008. 105(21): p. 7552-7.

257. Salazar-Gonzalez, J.F., et al., Deciphering human immunodeficiency virus type 1 transmission and early envelope diversification by single-genome amplification and sequencing. J Virol, 2008. 82(8): p. 3952-70.

258. Richman, D.D. and S.A. Bozzette, The impact of the syncytium-inducing phenotype of human immunodeficiency virus on disease progression. J Infect Dis, 1994. 169(5): p. 968-74.

259. Shimizu, N., et al., A putative G protein-coupled receptor, RDC1, is a novel coreceptor for human and simian immunodeficiency viruses. J Virol, 2000. 74(2): p. 619-26.

260. Hendrix, C.W., et al., Safety, pharmacokinetics, and antiviral activity of AMD3100, a selective CXCR4 receptor inhibitor, in HIV-1 infection. J Acquir Immune Defic Syndr, 2004. 37(2): p. 1253-62.

261. Freedman, B.I., S.S. Iskandar, and R.G. Appel, The link between hypertension and nephrosclerosis. Am J Kidney Dis, 1995. 25(2): p. 207-21.

262. Wang, P.X. and P.W. Sanders, Mechanism of hypertensive nephropathy in the Dahl/Rapp rat: a primary disorder of vascular smooth muscle. Am J Physiol Renal Physiol, 2005. 288(1): p. F236-42.

263. Neusser, M.A., et al., Human nephrosclerosis triggers a hypoxia-related glomerulopathy. Am J Pathol, 2010. 176(2): p. 594-607.

264. Banchereau, J. and V. Pascual, Type I interferon in systemic lupus erythematosus and other autoimmune diseases. Immunity, 2006. 25(3): p. 383-92.

265. D'Cruz, D.P., M.A. Khamashta, and G.R. Hughes, Systemic lupus erythematosus. Lancet, 2007. 369(9561): p. 587-96.

266. Chong, B.F. and C. Mohan, Targeting the CXCR4/CXCL12 axis in systemic lupus erythematosus. Expert Opin Ther Targets, 2009. 13(10): p. 1147-53.

267. Wang, A., et al., CXCR4/CXCL12 hyperexpression plays a pivotal role in the pathogenesis of lupus. J Immunol, 2009. 182(7): p. 4448-58.

268. Balabanian, K., et al., Role of the chemokine stromal cell-derived factor 1 in autoantibody production and nephritis in murine lupus. J Immunol, 2003. 170(6): p. 3392-400.

269. Robak, E., et al., Circulating proangiogenic molecules PIGF, SDF-1 and sVCAM-1 in patients with systemic lupus erythematosus. Eur Cytokine Netw, 2007. 18(4): p. 181-7.

270. Fritsch, R.D., et al., Abnormal differentiation of memory T cells in systemic lupus erythematosus. Arthritis Rheum, 2006. 54(7): p. 2184-97.

271. Henneken, M., et al., Differential expression of chemokine receptors on peripheral blood B cells from patients with rheumatoid arthritis and systemic lupus erythematosus. Arthritis Res Ther, 2005. 7(5): p. R1001-13.

272. Amoura, Z., et al., Roles of CCR2 and CXCR3 in the T cell-mediated response occurring during lupus flares. Arthritis Rheum, 2003. 48(12): p. 3487-96.

116

273. Stone, N.D., et al., Multiple-dose escalation study of the safety, pharmacokinetics, and biologic activity of oral AMD070, a selective CXCR4 receptor inhibitor, in human subjects. Antimicrob Agents Chemother, 2007. 51(7): p. 2351-8.

274. Stewart, D.A., et al., Pharmacokinetics and pharmacodynamics of plerixafor in patients with non-Hodgkin lymphoma and multiple myeloma. Biol Blood Marrow Transplant, 2009. 15(1): p. 39-46.

275. Schroppel, B., et al., The impact of polymorphisms in chemokine and chemokine receptors on outcomes in liver transplantation. Am J Transplant, 2002. 2(7): p. 640-5.

276. Yamani, M.H., et al., Peritransplant ischemic injury is associated with up-regulation of stromal cell-derived factor-1. J Am Coll Cardiol, 2005. 46(6): p. 1029-35.

277. Gao, C. and J. Huan, SDF-1 plays a key role in chronic allograft nephropathy in rats. Transplant Proc, 2008. 40(5): p. 1674-8.

278. Blantz, R.C. and F.B. Gabbai, Glomerular hemodynamics in pathophysiologic conditions. Am J Hypertens, 1989. 2(11 Pt 2): p. 208S-212S.

279. Purkerson, M.L., P.E. Hoffsten, and S. Klahr, Pathogenesis of the glomerulopathy associated with renal infarction in rats. Kidney Int, 1976. 9(5): p. 407-17.

280. Ibrahim, H.N. and T.H. Hostetter, The renin-aldosterone axis in two models of reduced renal mass in the rat. J Am Soc Nephrol, 1998. 9(1): p. 72-6.

281. Correa-Rotter, R., et al., Renin expression in renal ablation. Hypertension, 1992. 20(4): p. 483-90. 282. Kitamura, H., et al., Apoptosis in glomerular endothelial cells during the development of

glomerulosclerosis in the remnant-kidney model. Exp Nephrol, 1998. 6(4): p. 328-36. 283. Brenner, B.M., E.V. Lawler, and H.S. Mackenzie, The hyperfiltration theory: a paradigm shift in

nephrology. Kidney Int, 1996. 49(6): p. 1774-7. 284. Nath, K.A., S.M. Kren, and T.H. Hostetter, Dietary protein restriction in established renal injury in

the rat. Selective role of glomerular capillary pressure in progressive glomerular dysfunction. J Clin Invest, 1986. 78(5): p. 1199-205.

285. Fogo, A.B., Animal models of FSGS: lessons for pathogenesis and treatment. Semin Nephrol, 2003. 23(2): p. 161-71.

286. Griffin, K.A., M.M. Picken, and A.K. Bidani, Blood pressure lability and glomerulosclerosis after normotensive 5/6 renal mass reduction in the rat. Kidney Int, 2004. 65(1): p. 209-18.

287. Amann, K., et al., Glomerulosclerosis and progression: effect of subantihypertensive doses of alpha and beta blockers. Kidney Int, 2001. 60(4): p. 1309-23.

288. Advani, A., et al., Fluorescent microangiography is a novel and widely applicable technique for delineating the renal microvasculature. PLoS One, 2011. 6(10): p. e24695.

289. Kang, D.H., et al., Role of the microvascular endothelium in progressive renal disease. J Am Soc Nephrol, 2002. 13(3): p. 806-16.

290. Kelly, D.J., et al., Vascular endothelial growth factor expression and glomerular endothelial cell loss in the remnant kidney model. Nephrol Dial Transplant, 2003. 18(7): p. 1286-92.

291. Johnson, R.J., What mediates progressive glomerulosclerosis? The glomerular endothelium comes of age. Am J Pathol, 1997. 151(5): p. 1179-81.

292. D'Agati, V., The many masks of focal segmental glomerulosclerosis. Kidney Int, 1994. 46(4): p. 1223-41.

293. Kitiyakara, C., P. Eggers, and J.B. Kopp, Twenty-one-year trend in ESRD due to focal segmental glomerulosclerosis in the United States. Am J Kidney Dis, 2004. 44(5): p. 815-25.

294. Lavin, P.J., et al., Therapeutic targets in focal and segmental glomerulosclerosis. Curr Opin Nephrol Hypertens, 2008. 17(4): p. 386-92.

117

295. Haas, M., B.H. Spargo, and S. Coventry, Increasing incidence of focal-segmental glomerulosclerosis among adult nephropathies: a 20-year renal biopsy study. Am J Kidney Dis, 1995. 26(5): p. 740-50.

296. Haas, M., et al., Changing etiologies of unexplained adult nephrotic syndrome: a comparison of renal biopsy findings from 1976-1979 and 1995-1997. Am J Kidney Dis, 1997. 30(5): p. 621-31.

297. Klahr, S., G. Schreiner, and I. Ichikawa, The progression of renal disease. N Engl J Med, 1988. 318(25): p. 1657-66.

298. Foster, M.H., et al., Prolonged survival with a remnant kidney. Am J Kidney Dis, 1991. 17(3): p. 261-5.

299. Lhotta, K., et al., Renal function after tumor enucleation in a solitary kidney. Am J Kidney Dis, 1991. 17(3): p. 266-70.

300. Solomon, L.R., N.P. Mallick, and W. Lawler, Progressive renal failure in a remnant kidney. Br Med J (Clin Res Ed), 1985. 291(6509): p. 1610-1.

301. Stahl, R.A., I. Low, and W. Schoeppe, Progressive renal failure in a patient after one and two-thirds nephrectomy. Klin Wochenschr, 1988. 66(11): p. 508-10.

302. Novick, A.C., et al., Long-term follow-up after partial removal of a solitary kidney. N Engl J Med, 1991. 325(15): p. 1058-62.

303. Fricker, S.P., et al., Characterization of the molecular pharmacology of AMD3100: a specific antagonist of the G-protein coupled chemokine receptor, CXCR4. Biochem Pharmacol, 2006. 72(5): p. 588-96.

304. Gerlach, L.O., et al., Metal ion enhanced binding of AMD3100 to Asp262 in the CXCR4 receptor. Biochemistry, 2003. 42(3): p. 710-7.

305. De Clercq, E., et al., Highly potent and selective inhibition of human immunodeficiency virus by the bicyclam derivative JM3100. Antimicrob Agents Chemother, 1994. 38(4): p. 668-74.

306. Rosenkilde, M.M., et al., Molecular mechanism of AMD3100 antagonism in the CXCR4 receptor: transfer of binding site to the CXCR3 receptor. J Biol Chem, 2004. 279(4): p. 3033-41.

307. Klasse, P.J., et al., CD4-Chemokine receptor hybrids in human immunodeficiency virus type 1 infection. J Virol, 1999. 73(9): p. 7453-66.

308. Oelschlaegel, U., et al., Kinetics of CXCR-4 and adhesion molecule expression during autologous stem cell mobilisation with G-CSF plus AMD3100 in patients with multiple myeloma. Ann Hematol, 2007. 86(8): p. 569-73.

309. DiPersio, J.F., et al., Plerixafor. Nat Rev Drug Discov, 2009. 8(2): p. 105-6. 310. Li, K.C., et al., The role of IL-8 in the SDF-1alpha/CXCR4-induced angiogenesis of laryngeal and

hypopharyngeal squamous cell carcinoma. Oral Oncol, 2012. 311. Doyle, T.M., et al., Modulating progenitor accumulation attenuates lung angiogenesis in a

mouse model of asthma. Eur Respir J, 2011. 38(3): p. 679-87. 312. Advani, A., et al., Expression, localization, and function of the thioredoxin system in diabetic

nephropathy. J Am Soc Nephrol, 2009. 20(4): p. 730-41. 313. Kanki, S., et al., Stromal cell-derived factor-1 retention and cardioprotection for ischemic

myocardium. Circ Heart Fail, 2011. 4(4): p. 509-18. 314. Burlington, H. and E.P. Cronkite, Characteristics of cell cultures derived from renal glomeruli.

Proc Soc Exp Biol Med, 1973. 142(1): p. 143-9. 315. Advani, A., et al., The (Pro)renin receptor: site-specific and functional linkage to the vacuolar H+-

ATPase in the kidney. Hypertension, 2009. 54(2): p. 261-9. 316. Gilbert, R.E., et al., Histone deacetylase inhibition attenuates diabetes-associated kidney growth:

potential role for epigenetic modification of the epidermal growth factor receptor. Kidney Int, 2011. 79(12): p. 1312-21.

118

317. Advani, A., et al., Long-Term Administration of the Histone Deacetylase Inhibitor Vorinostat Attenuates Renal Injury in Experimental Diabetes through an Endothelial Nitric Oxide Synthase-Dependent Mechanism. Am J Pathol, 2011. 178(5): p. 2205-14.

318. Matsui, K., et al., Lymphatic microvessels in the rat remnant kidney model of renal fibrosis: aminopeptidase p and podoplanin are discriminatory markers for endothelial cells of blood and lymphatic vessels. J Am Soc Nephrol, 2003. 14(8): p. 1981-9.

319. Mundlos, S., et al., Nuclear localization of the protein encoded by the Wilms' tumor gene WT1 in embryonic and adult tissues. Development, 1993. 119(4): p. 1329-41.

320. Holthofer, H., et al., Nephrin localizes at the podocyte filtration slit area and is characteristically spliced in the human kidney. Am J Pathol, 1999. 155(5): p. 1681-7.

321. Holzman, L.B., et al., Nephrin localizes to the slit pore of the glomerular epithelial cell. Kidney Int, 1999. 56(4): p. 1481-91.

322. Ruotsalainen, V., et al., Nephrin is specifically located at the slit diaphragm of glomerular podocytes. Proc Natl Acad Sci U S A, 1999. 96(14): p. 7962-7.

323. Floege, J., B. Smeets, and M.J. Moeller, The SDF-1/CXCR4 axis is a novel driver of vascular development of the glomerulus. J Am Soc Nephrol, 2009. 20(8): p. 1659-61.

324. Serluca, F.C., I.A. Drummond, and M.C. Fishman, Endothelial signaling in kidney morphogenesis: a role for hemodynamic forces. Curr Biol, 2002. 12(6): p. 492-7.

325. Wu, L.L., et al., Transforming growth factor beta 1 and renal injury following subtotal nephrectomy in the rat: role of the renin-angiotensin system. Kidney Int, 1997. 51(5): p. 1553-67.

326. Gilbert, R.E., et al., Pathological expression of renin and angiotensin II in the renal tubule after subtotal nephrectomy. Implications for the pathogenesis of tubulointerstitial fibrosis. Am J Pathol, 1999. 155(2): p. 429-40.

327. Kelly, D.J., et al., Platelet-derived growth factor receptor transactivation mediates the trophic effects of angiotensin II in vivo. Hypertension, 2004. 44(2): p. 195-202.

328. Kelly, D.J., et al., Tranilast attenuates structural and functional aspects of renal injury in the remnant kidney model. J Am Soc Nephrol, 2004. 15(10): p. 2619-29.

329. Lopez-Hernandez, F.J. and J.M. Lopez-Novoa, Role of TGF-beta in chronic kidney disease: an integration of tubular, glomerular and vascular effects. Cell Tissue Res, 2012. 347(1): p. 141-54.

330. Norman, J.T., I.M. Clark, and P.L. Garcia, Hypoxia promotes fibrogenesis in human renal fibroblasts. Kidney Int, 2000. 58(6): p. 2351-66.

331. Horiguchi, K., et al., TGF-beta drives epithelial-mesenchymal transition through deltaEF1-mediated downregulation of ESRP. Oncogene, 2011.

332. Hempel, N., et al., Expression of the type III TGF-beta receptor is negatively regulated by TGF-beta. Carcinogenesis, 2008. 29(5): p. 905-12.

333. Wilkinson, D.S., et al., Chromatin-bound p53 anchors activated Smads and the mSin3A corepressor to confer transforming-growth-factor-beta-mediated transcription repression. Mol Cell Biol, 2008. 28(6): p. 1988-98.

334. Berg, D.T., et al., Negative regulation of inducible nitric-oxide synthase expression mediated through transforming growth factor-beta-dependent modulation of transcription factor TCF11. J Biol Chem, 2007. 282(51): p. 36837-44.

335. Daly, A.J., L. McIlreavey, and C.R. Irwin, Regulation of HGF and SDF-1 expression by oral fibroblasts--implications for invasion of oral cancer. Oral Oncol, 2008. 44(7): p. 646-51.

336. Lee, S., et al., Autocrine VEGF signaling is required for vascular homeostasis. Cell, 2007. 130(4): p. 691-703.

119

337. Hendrix, C.W., et al., Pharmacokinetics and safety of AMD-3100, a novel antagonist of the CXCR-4 chemokine receptor, in human volunteers. Antimicrob Agents Chemother, 2000. 44(6): p. 1667-73.

338. Devine, S.M., et al., Rapid mobilization of CD34+ cells following administration of the CXCR4 antagonist AMD3100 to patients with multiple myeloma and non-Hodgkin's lymphoma. J Clin Oncol, 2004. 22(6): p. 1095-102.

339. Donahue, R.E., et al., Plerixafor (AMD3100) and granulocyte colony-stimulating factor (G-CSF) mobilize different CD34+ cell populations based on global gene and microRNA expression signatures. Blood, 2009. 114(12): p. 2530-41.

340. Flomenberg, N., et al., The use of AMD3100 plus G-CSF for autologous hematopoietic progenitor cell mobilization is superior to G-CSF alone. Blood, 2005. 106(5): p. 1867-74.

341. Barri, Y.M., Hypertension and kidney disease: a deadly connection. Curr Hypertens Rep, 2008. 10(1): p. 39-45.

342. Advani, A., et al., Inhibition of the epidermal growth factor receptor preserves podocytes and attenuates albuminuria in experimental diabetic nephropathy. Nephrology (Carlton), 2011. 16(6): p. 573-81.

343. Bjarnegard, M., et al., Endothelium-specific ablation of PDGFB leads to pericyte loss and glomerular, cardiac and placental abnormalities. Development, 2004. 131(8): p. 1847-57.

344. Lindahl, P., et al., Paracrine PDGF-B/PDGF-Rbeta signaling controls mesangial cell development in kidney glomeruli. Development, 1998. 125(17): p. 3313-22.

345. Lindenmeyer, M.T., et al., Interstitial vascular rarefaction and reduced VEGF-A expression in human diabetic nephropathy. J Am Soc Nephrol, 2007. 18(6): p. 1765-76.

346. Oh, P., et al., Subtractive proteomic mapping of the endothelial surface in lung and solid tumours for tissue-specific therapy. Nature, 2004. 429(6992): p. 629-35.

347. Dai, S., et al., Chronic AMD3100 antagonism of SDF-1alpha-CXCR4 exacerbates cardiac dysfunction and remodeling after myocardial infarction. J Mol Cell Cardiol, 2010. 49(4): p. 587-97.

348. Jimenez, J.J., et al., Elevated endothelial microparticles in thrombotic thrombocytopenic purpura: findings from brain and renal microvascular cell culture and patients with active disease. Br J Haematol, 2001. 112(1): p. 81-90.

349. Weibel, E.R. and D.M. Gomez, A principle for counting tissue structures on random sections. J Appl Physiol, 1962. 17: p. 343-8.

350. White, K.E. and R.W. Bilous, Estimation of podocyte number: a comparison of methods. Kidney Int, 2004. 66(2): p. 663-7.

351. Flyvbjerg, A., et al., Amelioration of long-term renal changes in obese type 2 diabetic mice by a neutralizing vascular endothelial growth factor antibody. Diabetes, 2002. 51(10): p. 3090-4.

352. Masson, J., et al., Neurotransmitter transporters in the central nervous system. Pharmacol Rev, 1999. 51(3): p. 439-64.

353. Li, M. and R.M. Ransohoff, Multiple roles of chemokine CXCL12 in the central nervous system: a migration from immunology to neurobiology. Prog Neurobiol, 2008. 84(2): p. 116-31.

354. Werner, L., et al., Reciprocal regulation of CXCR4 and CXCR7 in intestinal mucosal homeostasis and inflammatory bowel disease. J Leukoc Biol, 2011. 90(3): p. 583-90.

355. Sorensson, J., et al., Glomerular endothelial fenestrae in vivo are not formed from caveolae. J Am Soc Nephrol, 2002. 13(11): p. 2639-47.

356. Zheng, H., et al., Migration of endothelial progenitor cells mediated by stromal cell-derived factor-1alpha/CXCR4 via PI3K/Akt/eNOS signal transduction pathway. J Cardiovasc Pharmacol, 2007. 50(3): p. 274-80.

120

357. Franke, R.P., et al., Induction of human vascular endothelial stress fibres by fluid shear stress. Nature, 1984. 307(5952): p. 648-9.

358. Resnick, N. and M.A. Gimbrone, Jr., Hemodynamic forces are complex regulators of endothelial gene expression. FASEB J, 1995. 9(10): p. 874-82.

359. Morigi, M., et al., Supernatant of endothelial cells exposed to laminar flow inhibits mesangial cell proliferation. Am J Physiol, 1993. 264(4 Pt 1): p. C1080-3.

360. Sarbassov, D.D., et al., Rictor, a novel binding partner of mTOR, defines a rapamycin-insensitive and raptor-independent pathway that regulates the cytoskeleton. Curr Biol, 2004. 14(14): p. 1296-302.

361. Jacinto, E., et al., Mammalian TOR complex 2 controls the actin cytoskeleton and is rapamycin insensitive. Nat Cell Biol, 2004. 6(11): p. 1122-8.

362. Wang, L., et al., Mechanisms of the proteinuria induced by Rho GTPases. Kidney Int, 2012. 363. Leong-Poi, H., et al., Therapeutic arteriogenesis by ultrasound-mediated VEGF165 plasmid gene

delivery to chronically ischemic skeletal muscle. Circ Res, 2007. 101(3): p. 295-303. 364. Mayer, C.R. and R. Bekeredjian, Ultrasonic gene and drug delivery to the cardiovascular system.

Adv Drug Deliv Rev, 2008. 60(10): p. 1177-92. 365. Chen, S., et al., Efficient gene delivery to pancreatic islets with ultrasonic microbubble

destruction technology. Proc Natl Acad Sci U S A, 2006. 103(22): p. 8469-74. 366. Nie, F., et al., Anti-angiogenic gene therapy for hepatocellular carcinoma mediated by

microbubble-enhanced ultrasound exposure: an in vivo experimental study. J Drug Target, 2008. 16(5): p. 389-95.

367. Ka, S.M., et al., Smad7 gene therapy ameliorates an autoimmune crescentic glomerulonephritis in mice. J Am Soc Nephrol, 2007. 18(6): p. 1777-88.

368. Hildebrandt, M., W. Reutter, and J.D. Gitlin, Tissue-specific regulation of dipeptidyl peptidase IV expression during development. Biochem J, 1991. 277 ( Pt 2): p. 331-4.

369. Stiller, D., H. Bahn, and C. August, Demonstration of glomerular DPP IV activity in kidney diseases. Acta Histochem, 1991. 91(1): p. 105-9.

370. Guertin, D.A. and D.M. Sabatini, The pharmacology of mTOR inhibition. Sci Signal, 2009. 2(67): p. pe24.

371. Guba, M., et al., Rapamycin inhibits primary and metastatic tumor growth by antiangiogenesis: involvement of vascular endothelial growth factor. Nat Med, 2002. 8(2): p. 128-35.

372. Dancey, J., mTOR signaling and drug development in cancer. Nat Rev Clin Oncol, 2010. 7(4): p. 209-19.

373. Mattson, D.L. and T.G. Bellehumeur, Neural nitric oxide synthase in the renal medulla and blood pressure regulation. Hypertension, 1996. 28(2): p. 297-303.

374. Star, R.A., Intrarenal localization of nitric oxide synthase isoforms and soluble guanylyl cyclase. Clin Exp Pharmacol Physiol, 1997. 24(8): p. 607-10.

375. Szabo, A.J., et al., Renal neuronal nitric oxide synthase protein expression as a marker of renal injury. Kidney Int, 2003. 64(5): p. 1765-71.

376. Roczniak, A., et al., Downregulation of neuronal nitric oxide synthase in the rat remnant kidney. J Am Soc Nephrol, 1999. 10(4): p. 704-13.

121

Supplementary Figure 1

Su

pp

lemen

tary

Fig

ure 1

. The S

DF

-1/C

XC

R4

/PI3

K/A

KT

/eNO

S In

tracellular S

ign

aling

Path

way

122

Supplementary Figure 2

Supplementary Figure 2. Flow Diagram of SDF-1/CXCR4 Expression study.

Supplementary Figure 3

Supplementary Figure 3. Flow Diagram of Chronic CXCR4 Inhibition Study.

123

Supplementary Figure 4

Supplementary Figure 4. Flow Diagram of Acute In Vivo SDF-1 Infusion Study.

124

Supplementary Figure 5

Supplementary Figure 5. Flow Diagram of Angiotensin Converting Enzyme (ACE) Inhibition Study.

125

Supplementary Figure 6

Supplementary Figure 6. Concentration of Circulating White Blood Cells (WBC) After AMD3100 Administration.

Treatment of Fischer F344 rats with AMD3100 at a dose of 1mg/kg resulted in an approximate two-fold increase in

circulating white blood cell (WBC) count after 4 h. *p<0.0001.

* *

126

Appendix

5% FITC-Inulin

100mg FITC-Inulin

2ml 0.9% NaCl solution

1. Add FITC-inulin to the NaCl solution and bring the solution to a boil.

2. To remove residual FITC not bound to inulin, fill the solution into a 1000Da cut-off dialysis membrane

(Spectrum Laboratories Inc., Rancho Dominguez, CA).

3. Put the dialysis membrane filled with FITC-inulin into 1000mL of NaCl solution for 24 hours at room

temperature.

4. Prior to use, sterilize the solution by filtering through a 0.22μm filter.

500mM HEPES Buffer

59.6g HEPES

500mL Deionized water

Drops 10M NaOH

1. Dissolve HEPES into the deionized water.

2. Adjust pH of the solution to 7.4 using NaOH.

Agarose-fluorescent microbead mixture

45mg Low melting point agarose (Sigma-Aldrich, St.Loius, MO)

4.5mL Distilled H2O

0.5mL 0.02µm fluospheres (Invitrogen, Carlsbad, CA)

1. Mix the low melting point agarose with the distilled water to make a 1% agarose solution.

2. Bring the agarose solution to a boil three times in a microwave at high power.

3. Add the fluorospheres to the agarose solution to give a solution of 10% fluorescent microbeads.

4. Keep the solution at 40°C in a warm water bath and away from light until time of infusion into the rat. 5mL of

the agarose-fluorescent microbead mixture is needed for each rat.

Citric Acid Buffer

495mL distilled H2O

4.1mL 1M sodium citrate

0.9mL 1M citric acid

~50μL 10M NaOH

1. Add distilled H2O, sodium citrate and citric acid and mix with magnetic stir bar

2. Add NaOH slowly while monitoring with pH meter. Add NaOH until pH of solution is 6.2-6.5

3. Store at 4°C

127

Sample Buffer

1mL 0.5 Tris, pH6.8

1.6mL 10% SDS

0.8mL Glycerol

4mL Milli-Q distilled H2O

0.2mL 0.05% bromophenol blue

1. Add all reagents and vortex

2. Store at room temperature

3. Add 0.40mL β-mercaptoethanol just before use

Running Buffer (10×)

148g Glycine

30g Tris base

10g SDS

1L distilled H2O

1. Add all reagents and mix

2. Store at 4°C

TBS (10×)

12.1g Tris

9.35g NaCl

~5mL Concentrated HCl until pH=7.8

2L distilled H2O

1. Add all reagents and mix

2. Store at 4°C. Dilute to 1× with distilled H2O.

Transfer Buffer*

14.4g Glycine

3.03g Tris

200mL methanol

1L distilled H2O

1. Add all reagents and mix

2. Store at -20°C

3. Partial thaw just before use. Buffer solution should remain ice cold.

* Transfer buffer should be made at least one day before use to allow temperature to remain ice cold

5% Blocking Solution

1.25g Skim milk powder

25mL TBS

1. Add all reagents and vortex thoroughly until skim milk powder dissolves completely in TBS.

2. Use approximately 25mL per nitrocellulose sample.