Role of DNA bubble rewinding in enzymatictranscription terminationJoo-Seop Park* and Jeffrey W. Roberts†

Department of Molecular Biology and Genetics, Biotechnology Building, Cornell University, Ithaca, NY 14853

Contributed by Jeffrey W. Roberts, February 3, 2006

By using DNA heteroduplexes that inhibit rewinding of the up-stream part of the transcription bubble, we show that transcriptrelease in termination by the enzymes Mfd and Rho is facilitated byreannealing of DNA in the upstream region of the transcriptionbubble, as is also true for termination by intrinsic terminators. Wealso show that, like Mfd, the Rho termination factor promotesforward translocation of RNA polymerase. These results supporttermination models in which external forces imposed on nucleicacids induce concerted rewinding of DNA and unwinding of theDNA�RNA hybrid, possibly accompanied by forward translocationof RNA polymerase, leading to transcription complex dissociation.

RNA polymerase � Mfd protein � Rho termination factor

Termination of transcription and the release of RNA poly-merase (RNAP) from its templating complex with DNA areessential for providing a boundary for gene expression andremoving stalled enzymes that may obstruct gene expression andreplication. Three mechanisms are known that cause the other-wise notably stable transcription complex of Escherichia coliRNAP to dissociate. These mechanisms are (i) the intrinsicterminator, consisting of nucleic acid structures that interactwith RNAP (1), (ii) the termination factor Rho, an RNA-dependent ATPase and RNA ‘‘helicase’’ (or, more accurately,RNA translocase) that acts by binding the emerging transcriptand (presumably) RNAP (2, 3), and (iii) Mfd, an ATP-dependent DNA translocase that acts on RNAP and DNAupstream of the transcription bubble (4–6) (Fig. 1). [The rep-lication fork apparatus could contain a fourth mechanism thatremoves obstructing transcription complexes (7).] Understand-ing these termination pathways may reveal important aspects oftranscription complex stability, as well as the nature of regulationthat acts through antitermination.

Two classes of models of termination describe how nucleicacids could move relative to the enzyme such that the RNAbecomes weakly held and can dissociate, leading to RNAPdissociation. The first class of models (‘‘mechanical models’’),illustrated in Fig. 2, proposes that rewinding of the upstreamboundary of the transcription bubble is coupled with unwindingof the RNA�DNA hybrid within the enclosing structure of theenzyme (Fig. 2 B and C). In one mechanical model (Fig. 2B), theenzyme translocates forward without RNA synthesis, retainingprotein–nucleic acid contacts of the elongation complex (8, 9);in another (Fig. 2C), the transcription bubble collapses withinthe channel as the hybrid unwinds, without enzyme transloca-tion. The second class of models (‘‘allosteric’’) is less defined butproposes that long-range conformational changes in RNAPinduced by some element of the terminator (e.g., the RNAhairpin or activities of the enzymatic terminators) destabilize theenzyme–nucleic acid contacts and lead to complex collapse (10).

One apparent similarity among intrinsic and enzymatic ter-minators favoring mechanical models is that all three involveforces exerted on upstream nucleic acid elements at the site oftermination.

The intrinsic terminator encodes an RNA hairpin that formsadjacent to a uridine-rich transcript segment at the site of RNArelease. Formation of the hairpin is believed to initiate dissoci-

ation of the transcription complex by disrupting the upstreamsegment of the templating RNA�DNA hybrid, with the overalldisruption process favored by the weak hybrid (8, 11). Formationof this hairpin also exerts forward force on RNAP in a tran-scription complex, because it can assist the enzyme in dislodginga blocking protein that is just downstream (9). Because a DNAoligonucleotide applied in trans can substitute for the upstreamstrand of the RNA hairpin, the critical event is the formation ofa duplex structure that engages the emerging transcript and notany action of the RNA hairpin per se (8).

Conflict of interest statement: No conflicts declared.

Freely available online through the PNAS open access option.

Abbreviation: RNAP, RNA polymerase.

*Present address: Department of Molecular and Cellular Biology, Biological Laboratories,Harvard University, Cambridge, MA 02138.

†To whom correspondence should be addressed. Email: jwr7@cornell.edu.

© 2006 by The National Academy of Sciences of the USA

Fig. 1. Three mechanisms of transcription termination. (A) Intrinsic termi-nation is driven by formation of an RNA hairpin in the emerging transcript, thebase of which occurs 8–9 nt from the site of release. Release also requires auridine-rich segment downstream of the hairpin, particularly in the regionimmediately adjacent to the G�C-rich end of the stem. Although not illus-trated, we suggest (as described in the text) that the DNA bubble is partlyrewound and that the RNA�DNA hybrid is partly unwound when the hairpinis fully formed. (B) The termination factor Rho is a hexameric RNA translocasethat binds �60 nt of emerging transcript, moving along it in a 5�–3� directionin an ATP-dependent reaction. This movement is believed to extract thetranscript. (C) Mfd is a DNA translocase that binds duplex DNA upstream of thetranscription bubble and RNAP in a region near the site of DNA rewinding. Theactivity of the translocase causes dissociation of the complex in conditions thatdo not allow the RNA chain to advance through NTP polymerization.

4870–4875 � PNAS � March 28, 2006 � vol. 103 � no. 13 www.pnas.org�cgi�doi�10.1073�pnas.0600145103

Dow

nloa

ded

by g

uest

on

June

18,

202

1

The enzyme Rho also binds the emerging transcript, possiblytranslocating along it to contact RNAP; Rho likely uses ATPenergy to move 5�–3� along the RNA and thereby to extract thetranscript from the complex while it binds RNAP, although thereis no evidence of a specific binding interaction between Rho andRNAP.

The activity of Mfd in exerting force on upstream DNA isparticularly revealing of the mechanism of RNA release. Mfd isthe transcription repair coupling protein of bacterial cells,serving to recognize RNAP stalled by damaged DNA, to removeit (and the transcript) from DNA in an ATP-dependent reaction(or, more conveniently for biochemical analysis, a dATP-dependent reaction), and to recruit DNA excision repair ma-chinery to the site (4, 5). Two segments of the Mfd polypeptideare known to contribute to the RNAP release activity: anRNAP-binding domain (5, 12) and a DNA translocase regionthat interacts with �25 bp of duplex DNA upstream of thetranscription bubble in the complex adjacent to the site of DNArewinding (5). The structure and function of the translocasedomain are well understood through comparison to the stronglyhomologous domain of the Holliday junction migration enzymeRecG (13) and through mutational analysis (14).

The role of the DNA translocase activity in RNAP release byMfd is shown by its ability to translocate RNAP along DNA (or viceversa) in the direction of synthesis. In this way, Mfd can rescue abacktracked and arrested complex into productive elongation;however, if elongation fails because the NTP substrate is notprovided in vitro, a condition presumed to model a site of templatestrand damage that blocks elongation, Mfd causes transcript releaseand dissociation of RNAP (5). Because essentially all arrestedRNAP can be rescued into elongation in such an experiment, theenzyme must be translocated forward until the RNA 3� end is in theactive site before release occurs. This biochemical evidence, inaddition to mutational confirmation that the translocase activity isrequired for complex release (14), strongly suggests that the forceexerted by the Mfd–RNAP complex on DNA that causes forwardtranslocation is also the direct cause of dissociation, which wesuggest occurs as in Fig. 2B. If forward translocation is blocked [e.g.,by a DNA-binding protein or possibly a DNA interstrand crosslink(9)], the rotational motion of the Mfd–RNAP complex trackingalong DNA would be converted to a torque imposed on theupstream DNA; we propose that bubble collapse imposed by this

torque is the prime element in Mfd-mediated transcription complexdissociation of a blocked complex, which we suggest occurs as inFig. 2C.

Study of the intrinsic terminator has provided related infor-mation about the movements of nucleic acids that can provokedissociation of the complex: Intrinsic termination is inhibited ifrewinding of DNA in the region of the transcription bubble isprevented through nucleotide substitutions in the nontemplateDNA strand of the bubble (15). Because substituents of differentsequences have similar effects, their effect is most likely to impairrewinding of the DNA strands in the region of the bubble. Thestronger effect of heteroduplexes close to the upstream bound-ary of the bubble is consistent with rewinding that initiates fromupstream, a process that we suggest is coordinated with unwind-ing of the hybrid. Finally, there is evidence that RNA release byan intrinsic terminator is facilitated by downstream translocationof the enzyme, in which downstream DNA is unwound in concertwith upstream rewinding (9).

We provide evidence here that enzymatic mechanisms oftermination have properties in common with the intrinsic mech-anism. They are inhibited if rewinding of DNA in the upstreamregion of the transcription bubble is impaired (a result specifi-cally consistent with the notion that Mfd and Rho act byimposing bubble rewinding), and they induce forward translo-cation of the enzyme. We suggest that all three mechanismsinitiate transcript release through a concerted rewinding ofupstream DNA and unwinding of the RNA�DNA hybrid, ineffect a branch migration that also tends to promote forwardtranslocation of the complex.

ResultsHeteroduplex DNA in the Transcription Bubble Region Inhibits Mfd-Induced Transcript Release. The transcript release activity of Mfd isconveniently measured by using defined, stalled transcription com-plexes that are affixed through a DNA end to paramagnetic beads;after incubation with or without Mfd, magnetic pelleting of com-plexes separates retained RNA from RNA released into thesupernatant (5). Release can also be detected as loss of the DNAexonuclease III digestion boundary of RNAP (5). A considerationof forces maintaining the elongation complex implies that RNA andenzyme are removed simultaneously, because neither transcript norcore RNAP alone would be stable in complex with DNA. Fig. 3shows the time course of RNA release by E. coli Mfd fromtranscription complexes stalled by NTP deprivation at position 74of an experimental DNA template (as well as a derived heterodu-plex template) that is described below. The reaction generallycontinues until �75% of the RNA is released; in these conditions,release from homoduplex DNA is nearly complete by 1 min, thefastest convenient time for the manual separation process. How-ever, the reaction is roughly linear at shorter times, as shown for theheteroduplex DNA.

To determine whether DNA strand rewinding affects tran-script release by Mfd, we prepared a series of heteroduplextemplates containing substitutions of three nucleotide segmentsthat prevent base-pairing in the transcription bubble or in theduplex region upstream of the bubble where Mfd is believed tobind. Nontemplate strand substitutions were used because thebase composition of the template strand is constrained by therequirement to stop transcription complexes at the same site bynucleotide starvation. Fig. 1C shows a portion of the templateand the presumed nucleic acid structure of the transcriptioncomplex at this site; the entire transcript up to position �74consists of A and C, so that RNA synthesis with only ATP andCTP produces a complex with a defined 74-nt transcript. Thedepicted size of the transcription bubble fits experimental de-terminations from crosslinking, as well as an independent de-tection of the site of rewinding at the rear of the bubble, albeitin a different sequence context (15).

Fig. 2. The elongation complex and models of RNA release in termination.(A) A model of an elongation complex showing helix rotation that wouldaccompany branch migration in mechanical models of termination. (B) Ter-mination by forward translocation. (C) Termination by bubble collapse. Ashows a particular intrinsic transcription terminator poised at the site ofrelease, but B and C are general to both intrinsic and enzymatic termination.The upstream rewound segment is indicated by the blue overscreen.

Park and Roberts PNAS � March 28, 2006 � vol. 103 � no. 13 � 4871

BIO

CHEM

ISTR

Y

Dow

nloa

ded

by g

uest

on

June

18,

202

1

We find that Mfd releases RNA more slowly from heterodu-plex DNA than from homoduplex DNA, for substitutions bothwithin the transcription bubble and just upstream of the bubble(Fig. 4). The rate of release of transcript from one suchsubstitution (60 GTG, named for the position of the firstsubstituted nucleotide) is compared with the rate of release fromhomoduplex DNA in Fig. 3. This rate is reduced at least 3-foldby the substitution, although the reduction at very early timescould be considerably larger, because there is no informationabout the initial rate of release from homoduplex DNA. Becauseof some variability in the maximum transcript release and thedifficulty of manipulating the release assay for times �1 min, weshow in Fig. 4 RNA released at 1 min as a fraction of RNAreleased from homoduplex DNA.

The important result of Fig. 4 is that heteroduplex substitu-tions mostly (substitution 62) or completely (substitution 64)within the region of single-stranded DNA of the transcriptionbubble inhibit release. Because substitutions of different basecompositions are effective, we conclude that impairment ofRNA release results from inhibition of DNA rewinding throughloss of base-pairing and, therefore, that DNA rewinding in thetranscription bubble occurs in the process of Mfd-mediatedtranscript release.

Heteroduplexes across �9 bp of the duplex region upstreamof the transcription bubble (substitutions 54, 57, and 60) alsoinhibit transcript release. This effect could be attributed to lackof the natural duplex substrate for Mfd binding or possibly to arequirement for an upstream duplex DNA to bind an (unknown)site in RNAP. However, mismatches in duplex DNA upstream

of the transcription bubble also are expected to stabilize abacktracked state of the elongation complex, which likely wouldinhibit release if Mfd must rewind DNA in the bubble to act.

Heteroduplex DNA in the Transcription Bubble Region also InhibitsRho-Induced Transcript Release. Rho factor is believed to have anentirely different primary substrate than Mfd, namely the emerg-ing transcript, and there is no evidence that Rho interactsdirectly with DNA. Crystallographic analysis of a Rho-RNAstructure shows that Rho binds �60 nt of transcript, which circlesthe RNA-binding domain of the Rho hexamer and penetratesinto the translocase active center of Rho, oriented such that Rhocan track in a 5�–3� direction along the RNA (3). Although Rhois very unlikely to contact RNA in the region of the RNA�DNAhybrid in the transcription complex directly, a ‘‘helicase’’ activitycould result from translocation that effectively pulls RNA fromthe complex, requiring that Rho be braced against RNAP atsome undefined interaction site or possibly through an interme-diary protein like NusG, which is known to bind both Rho andRNAP core (16).

If the mechanisms of Rho and Mfd have in common that DNArewinding provides energy to enable dissolution of the RNA�DNA hybrid and separation of the RNA, the DNA heterodu-plexes in the nontemplate region of the transcription bubble alsoshould inhibit Rho activity. We show in Fig. 5 that this is indeedthe case. Rho activity can be measured by the magnetic bead-based RNA release assay described above; for 20 nM Rho (Fig.5B), the rate of dATP-dependent release is approximatelyconstant over 5 min. We assayed release with three nontemplatestrand heteroduplexes in the same elongation complex describedin Fig. 3, which was designed to contain the cytidine-richtranscript that optimally activates Rho.

As for Mfd, substitutions in the region of single-stranded DNAof the transcription bubble (substitutions 62 and 64) reduce therate of RNA release by Rho by �2-fold. Thus, impairing DNArewinding of the transcription bubble inhibits transcript release

Fig. 3. Mfd-mediated RNA release from homoduplex and 60 GTG hetero-duplex DNA. Each pair of lanes shows a gel analysis of transcripts of stoppedelongation complexes affixed through a biotinylated DNA end to magneticbeads; the released or supernatant (S) fraction and retained or pellet (P)fraction after magnetic partitioning is shown. The position of the 60 GTGnontemplate strand substitution is illustrated. The data illustrated in Upperwere quantified and are plotted in Lower. Circles, homoduplex DNA; squares,heteroduplex DNA; filled symbols, �Mfd; open symbols, �Mfd.

Fig. 4. Effect of different nontemplate strand trinucleotide substitutions onMfd-mediated RNA release. The indicated nontemplate strand DNA substitu-tions were used in release experiments in comparison with homoduplexwild-type DNA; the percentage of release relative to homoduplex DNA isshown. Black bars, heteroduplex series 1 (upper row of trinucleotide substi-tutions), experiment 1; gray bars, heteroduplex series 1 (upper row of trinu-cleotide substitutions), experiment 2; hatched bars, heteroduplex series 2(lower row of trinucleotide substitutions). The incubation time was 1 min.

4872 � www.pnas.org�cgi�doi�10.1073�pnas.0600145103 Park and Roberts

Dow

nloa

ded

by g

uest

on

June

18,

202

1

by Rho. Furthermore, a substitution in the upstream duplexregion (substitution 60) also inhibits release. Because Rho doesnot contact DNA, we attribute the effect of this substitution tostabilizing a backtracked state of the stalled elongation complexand thus opposing upstream bubble rewinding that accompaniesrelease.

Forward Translocation Is Promoted by Mfd and Rho During TranscriptRelease. We have proposed that RNA release in intrinsic termi-nation is facilitated by downstream translocation of the elonga-tion complex, including unwinding of duplex DNA downstreamof the bubble and movement of RNAP downstream along theDNA (8, 9), as illustrated in Fig. 2B. In this view, formation ofthe hairpin promotes a concerted rewinding of upstream DNAand unwinding of downstream DNA, effectively translocatingthe bubble without addition of nucleotides to the end of theRNA, thereby shortening the hybrid and favoring its dissolution.Some evidence in favor of this view is that a hairpin, or a DNAoligonucleotide that simulates the hairpin, provides enoughforce to increase transcription read-through of a DNA-bindingprotein (9).

We show here that both Mfd and Rho also induce forwardtranslocation as they release RNA from the complex. This resultis not surprising for Mfd, which was shown to induce forwardtranslocation of backtracked transcription complexes (5). Forthe experiment of Fig. 6, complexes were made and stalled bynucleotide deprivation on the (homoduplex) template illustratedin Fig. 4, with the additional condition that the downstream endwas blocked by the DNA-binding protein EcoRI Gln-111 (17),an enzymatically inactive derivative of the EcoRI restrictionenzyme, bound to the EcoRI sequence (GAATTC) that beginsat position �87. Its effect is to stop most transcription at position�72 in the conditions used (50 �M ATP and CTP substrates),although the template sequence would allow elongation by ATP

and CTP to position �74. (Higher concentrations of substratesallow synthesis to �74 against the roadblock, presumably byproviding energy to force the enzyme forward against an elasticforce provided by the EcoRI block.) When NTP substrates areremoved and dATP is added as an energy source, both Mfd andRho release complexes stopped by EcoRI Gln-111 at �72,confirming previous results (17, 18) (data not shown). However,when 7 �M ATP and CTP are included in the reaction to permittranscript elongation, the release is largely at positions �73 and�74 (Fig. 6); thus, both enzymes induce forward translocation ofRNAP during the process of release. Presumably, Rho usesdATP energy to drive branch migration of the nucleic acids,against the force applied by EcoRI Gln-111, allowing furtherincorporation as forward translocation occurs. This experimentdoes not, of course, reveal whether translocation proceedsbeyond the final site of incorporation as RNA release occurs.

When 7 �M ATP, CTP, and GTP are provided to allowelongation beyond �74, Mfd causes a slight increase in tran-scription past the EcoRI Gln-111 block relative to the reactionin the absence of Mfd (Fig. 6). Presumably, the force exerted byMfd is enough to displace EcoRI occasionally while the RNA 3�end is still present in the RNAP active center, also a character-istic of the intrinsic terminator RNA hairpin (9).

DiscussionWe have shown that disruption of the E. coli transcriptioncomplex by the two enzymes Mfd and Rho is inhibited if DNAstrands of the open transcription bubble cannot pair, supportingmechanical models of termination. This result complementsprevious evidence that transcription termination by the RNAhairpin-based intrinsic terminator requires re-pairing of DNAstrands in the transcription bubble and suggests a commonunderlying mechanism of RNA release. It is obvious that the endpoint of RNAP complex release must be reannealed DNAstrands, because neither core RNAP nor RNA alone wouldengage DNA in a stable complex with unwound strands. How-ever, because heteroduplexes inhibit release, the process alsomust involve intermediate stages in which DNA strands arepartially rewound; in effect, the energy of DNA rewinding is usedto drive the process of termination. For the intrinsic terminator,there are strong effects of heteroduplexes in DNA correspondingto the upstream half of the RNA�DNA hybrid and much smallereffects in the downstream half (15). Similarly, heteroduplex

Fig. 5. Effect of nontemplate strand trinucleotide substitutions on Rho-mediated RNA release. (A) Rho-mediated release of RNA was measured fromcomplexes stopped on nontemplate heteroduplex DNAs made with the sub-stitutions shown. Black bars, release compared with wild-type homoduplexDNA; gray bars, release compared with mutant homoduplex DNA. (B) The timecourse of RNA release from complexes on wild-type homoduplex DNA.

Fig. 6. Effect of Mfd and Rho on the translocation state of RNAP during RNArelease. Transcription complexes were stopped on the JP-CA74-R1 template byEcoRI Gln-111 protein or by nucleotide deprivation at �74 through synthesiswith only CTP and ATP. The EcoRI Gln-111 block stops RNAP at �72 in theseconditions (50 �M ATP and CTP), although at higher NTP concentrations, thestop is at �74, in agreement with ref. 17. Released and retained RNA weremeasured after incubation with Mfd or Rho and the indicated NTP. In the lastsix lanes, 7 �M GTP was included, allowing continued synthesis if the EcoRIGln-111 block could be removed during the reaction.

Park and Roberts PNAS � March 28, 2006 � vol. 103 � no. 13 � 4873

BIO

CHEM

ISTR

Y

Dow

nloa

ded

by g

uest

on

June

18,

202

1

effects on Mfd activity are restricted to the upstream half of thehybrid region; the Rho results had less resolution.

We suggest that termination by all three mechanisms involvesa concerted rewinding of DNA, initiating at the upstream edgeof the transcription bubble, with unwinding of the RNA�DNAhybrid (essentially a branch migration, as in normal transloca-tion) that proceeds until the RNA is sufficiently destabilized todissociate from the complex. Furthermore, we suggest that thenormal pathway involves forward translocation of RNAP withdownstream DNA unwinding, as illustrated in Fig. 2B. Relativeto normal translocation, the energy provided by advance of theRNA chain is lacking, but we suggest that this deficit is made upby the energy of hairpin formation or ATP or dATP utilizationby Mfd or Rho. When a blocking agent prevents downstreamtranslocation of RNAP, RNA release would occur as in Fig. 2C;the migrating branch invades the RNAP channel, collapsing thebubble and freeing the RNA, leading to dissociation of thecomplex. Previous results indicated that either a blocking agent(EcoRI Gln-111) or an intrastrand crosslink slows but does notprevent release of RNA at an intrinsic terminator, a result thatis consistent with a more intrusive mechanism like that shown inFig. 2C. If downstream unwinding were unfavorable, the pathwayof Fig. 2C might be followed in the absence of a direct obstruc-tion, or there might be partitioning between the two pathways.Our evidence argues against an allosteric model in which desta-bilization is induced only by conformational changes within theenzyme. However, conformational changes could accompanythe models we propose, particularly that of Fig. 2C.

Our results allow a more complete description of the activityof Mfd on transcription complexes. We showed previously thatMfd uses ATP energy to drive forward translocation of thecomplex, visualized most directly with persistently backtracked(arrested) complexes that fail to elongate unless they are actedon by Mfd (5). There are two known important components ofthe Mfd polypeptide: a domain that binds the �-subunit ofRNAP near the site where the DNA strands rewind at theupstream edge of the transcription bubble and a DNA translo-case domain that binds upstream duplex DNA. Presumably, thisassembly is oriented such that movement of the translocase alongDNA forces the enzyme forward; the result is that RNAP trackshelically along the DNA, as long as forward movement allows theenzyme to continue melting downstream DNA. If the enzyme isblocked, the rotational motion becomes a torque imposed by theMfd translocase activity on upstream DNA in such a direction asto collapse the transcription bubble. Although the release mech-anism may well involve other interactions of the Mfd polypeptidewith RNAP, we propose that complex dissociation results pri-marily from this collapse of the transcription bubble. Thishypothesis is supported by mutational evidence that impairingtranslocase activity also inhibits the release function of Mfd (14).

An interesting, and contrasting, analogy can be drawn be-tween models for the activity of Mfd and the eukaryotic poly-merase II transcription initiation factor IIH. Whereas Mfd isproposed to use ATP energy to torque the bubble closed whenforward translocation does not occur, transcription factor IIH isproposed to open the transcription bubble (and thus promoteinitiation) by exerting the opposite torque on downstreamDNA (19).

Both Rho and Mfd induce some forward translocation againsta transcription block, the EcoRI Gln-111 protein, allowing oneor two more nucleotides to be added to the growing end asrelease occurs. We presume that the EcoRI Gln-111 proteinprovides an elastic barrier that can be compressed by a fewnucleotides at high-substrate NTP or through the ATP (ordATP) energy transduced into nucleic acid movement by Mfdand Rho. Release then occurs when this translocation finally failsand bubble collapse ensues, coupled with unwinding of theRNA�DNA hybrid (Fig. 2C).

Because Rho acts only on the RNA, even though its activitystill is influenced by the ability of DNA strands of the transcrip-tion bubble to rewind, it seems clear that DNA rewinding andRNA�DNA hybrid unwinding are coupled in some direct man-ner. This coupled movement presumably initiates within theelongation complex structure so that branch migration occurswhile the RNA�DNA hybrid, upstream template strand, andemerging RNA are bound in the enzyme. (It is possible thatupstream duplex DNA also is bound by RNAP, although no suchcontacts are known.) Either extraction of the RNA by Rho orforced translocation along DNA by Mfd would drive the coupledevent that leads to release of RNA from the complex.

Materials and MethodsProteins, Plasmids, and Templates for Transcription. Mfd protein waspurified from DH5� cells harboring pMFD19 as described (20).RNAP was purified as described (21). Rho protein was a giftfrom M. Kainz and R. Gourse (University of Wisconsin, Mad-ison). EcoRI Gln-111 protein was a gift from P. Modrich (DukeUniversity, Durham, NC) and I. Artsimovitch (Ohio StateUniversity, Columbus).

Templates and Plasmids. Transcription templates were made byPCR of selected segments of plasmids. JP-CA74-R1 templatecontains the sequence: TTGCAAAACTGGATTAAAAAG-CATATATTTCATATACCACCACACCCACACA CCCAC-ACCCACACACCACACCCACACCCACACCCACACACCA-CACCCACACC. CAACAGAGGGACACGGCGGAATTC,where the �35 and �10 promoter sequences derived from thephage 82 late gene promoter are set in italics, the start site is thebold italicized A, and the last six nucleotides are an EcoRI site.

Terminally biotinylated templates were synthesized by PCRusing biotinylated primers. They were purified with either theQIAquick PCR purification kit or the QIAquick gel extractionkit (Qiagen, Valencia, CA).

Heteroduplex Templates. JP-CA74-RI and its derivatives areflanked by T7 and T3 primer sequences, which are upstream anddownstream of the promoter, respectively. To produce hetero-duplex DNA (22), wild-type JP-CA74-RI was amplified by PCRusing a biotinylated T7 primer and a nonbiotinylated T3 primer,and mutant JP-CA74-RI carrying a 3-bp mutation was amplifiedby PCR using a nonbiotinylated T7 primer with four additionalT residues at the 5� end and a biotinylated T3 primer. Afterpurification with the QIAquick PCR purification kit, PCRproducts were mixed, denatured, and reannealed. To isolatenonbiotinylated dsDNA, the reannealed DNAs were incubatedwith an excess amount of streptavidin for 30 min at roomtemperature and resolved on a Tris–acetate–EDTA agarose gelat 4°C. When biotin is bound to streptavidin, nonbiotinylatedtemplates migrate faster than singly or doubly biotinylatedtemplates on an agarose gel. Nonbiotinylated DNA was purifiedby using the MinElute gel purification kit (Qiagen), filled in withbiotinylated dATP (Promega) using exonuclease-defective poly-merase (VentR; NEB, Beverly, MA), and purified by using theQIAquick PCR purification kit.

In Vitro Transcription. RNAP (50 nM) was added to 5 nM templatebound to magnetic beads in transcription buffer [20 mMTris�HCl, pH 8.0�0.1 mM EDTA�50 mM potassium gluta-mate�50 �g/ml acetylated BSA�50 �M ATP and CTP�0.2–1.0�Ci��l [�-32P]CTP (1 Ci � 37 GBq)]. After 10 min of incubationat 37°C, 4 mM MgCl2 and 10 �g�ml rifampicin were added, andthe reactions were incubated for 5 min at 37°C. The transcriptionbuffer was replaced by the incubation buffer (20 mM Tris�HCl,pH 8.0�0.1 mM EDTA�50 mM potassium glutamate�50 �g/mlacetylated BSA�4 mM MgCl2�50 �M dATP). When indicated,50 nM Mfd, 20 nM Rho, or the same volume of the storage buffer

4874 � www.pnas.org�cgi�doi�10.1073�pnas.0600145103 Park and Roberts

Dow

nloa

ded

by g

uest

on

June

18,

202

1

(10 mM Tris�HCl, pH 7.5�500 mM NaCl�1 mM DTT�1 mMEDTA�50% glycerol) was added. The reaction was incubated at37°C for 1 min unless indicated otherwise. Each reaction wasdivided into supernatant and pellet fractions by magnetic par-titioning and diluted with the precipitation buffer (500 mMTris�HCl, pH 7.5�10 mM EDTA�100 �g/ml tRNA). Afterextraction with phenol�chloroform�isoamyl alcohol (50:50:1)and ethanol precipitation, samples were resolved on a polyacryl-amide gel and bands were resolved and quantified with aPhosphorImager.

For the experiment shown in Fig. 6, the transcription bufferwas supplemented with 50 nM Gln-111, and the incubationbuffer contained 10 mM MgCl2 and 4 mM dATP plus 7 �M ofthe indicated NTP. The reaction was incubated at 37°C for 5 minbefore magnetic partitioning.

We thank members of our laboratory for discussions and reading themanuscript and Richard Ebright for helpful suggestions. This work wassupported by National Institutes of Health Grant GM21941.

1. Nudler, E. & Gottesman, M. E. (2002) Genes Cells 7, 755–768.2. Richardson, J. P. (2003) Cell 114, 157–159.3. Skordalakes, E. & Berger, J. M. (2003) Cell 114, 135–146.4. Selby, C. P. & Sancar, A. (1994) Microbiol. Rev. 58, 317–329.5. Park, J. S., Marr, M. T. & Roberts, J. W. (2002) Cell 109, 757–767.6. Roberts, J. & Park, J. S. (2004) Curr. Opin. Microbiol. 7, 120–125.7. French, S. (1992) Science 258, 1362–1365.8. Yarnell, W. S. & Roberts, J. W. (1999) Science 284, 611–615.9. Santangelo, T. J. & Roberts, J. W. (2004) Mol. Cell 14, 117–126.

10. Toulokhonov, I., Artsimovitch, I. & Landick, R. (2001) Science 292, 730–733.11. Komissarova, N., Becker, J., Solter, S., Kireeva, M. & Kashlev, M. (2002) Mol.

Cell 10, 1151–1162.

12. Selby, C. P. & Sancar, A. (1995) J. Biol. Chem. 270, 4882–4889.13. Singleton, M. R., Scaife, S. & Wigley, D. B. (2001) Cell 107, 79–89.14. Chambers, A. L., Smith, A. J. & Savery, N. J. (2003) Nucleic Acids Res. 31,

6409–6418.15. Ryder, A. M. & Roberts, J. W. (2003) J. Mol. Biol. 334, 205–213.16. Li, J., Mason, S. W. & Greenblatt, J. (1993) Genes Dev. 7, 161–172.17. Pavco, P. A. & Steege, D. A. (1990) J. Biol. Chem. 265, 9960–9969.18. Selby, C. P. & Sancar, A. (1995) J. Biol. Chem. 270, 4890–4895.19. Kim, T.-K., Ebright, R. H. & Reinberg, D. (2000) Science 288, 1418–1421.20. Selby, C. P. & Sancar, A. (1993) Science 260, 53–58.21. Marr, M. T. & Roberts, J. W. (2000) Mol. Cell 6, 1275–1285.22. Ring, B. Z., Yarnell, W. S. & Roberts, J. W. (1996) Cell 86, 485–493.

Park and Roberts PNAS � March 28, 2006 � vol. 103 � no. 13 � 4875

BIO

CHEM

ISTR

Y

Dow

nloa

ded

by g

uest

on

June

18,

202

1