Making the Most of Your ADMA Membership The Benefits of ADMA Membership.
ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine...
Transcript of ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine...
![Page 1: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/1.jpg)
1
ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE REGULATION OF ENDOTHELIAL DERIVED NITRIC OXIDE
By
ARTHUR JAMES JARAE POPE
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2009
![Page 2: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/2.jpg)
2
© 2009 Arthur James Jarae Pope
![Page 3: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/3.jpg)
3
To Mom, Dad, Damecko, and Dannae thank you all for your love and support
![Page 4: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/4.jpg)
4
ACKNOWLEDGMENTS
First and foremost, I would like to thank my mentor Dr. AJ Cardounel, without whom the
work presented in this dissertation would not be possible. I thank your patience and guidance
throughout these past four years. Your enthusiasm about science and our work really motivated
me to work harder and to become the scientist that I am today. I am not only grateful for the
mentorship you have provided me but, also the friendship. I could not have asked for a better
mentor!
I would also like to thank my committee: Dr. Chris Baylis, Dr. Tom Clanton and Dr. Peter
Sayeski. Though I have only known you all for a short period of time, your guidance has really
help to shape the last two years of my graduate experience and I thank you for that.
Thank you to all the members of the Cardounel lab, Scott, Kanchana, Patrick and our
former postdoc Dr. Jorge Guzman. I would also like to thank Dr. Larry Druhan at Ohio State for
his technical support.
I would like to also thank my friends and family for their love and continuous support.
Shanté, Kenny, Nick , Natasha, Wilton, Amanda, David, Levy, Inimary thank you all for your
listening ear and support during my time in graduate school. I could not have done it without
you all. To my brothers Dannae and Damecko, thanks for supporting your little brother
throughout all these years of schooling. I promise I am done! To Aunt Diane thank you for all
your support throughout the years. Last but certainly not least, thank you Mom and Dad for
allowing me to purse my passion no matter where it has taken me.
![Page 5: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/5.jpg)
5
TABLE OF CONTENTS page
ACKNOWLEDGMENTS ...............................................................................................................4
LIST OF TABLES...........................................................................................................................8
LIST OF FIGURES .........................................................................................................................9
ABSTRACT...................................................................................................................................11
CHAPTER
1 INTRODUCTION ..................................................................................................................13
Rationale for Study .................................................................................................................18
2 REVIEW OF LITERATURE.................................................................................................20
Nitric Oxide ............................................................................................................................20 Nitric Oxide Synthase Enzyme .......................................................................................21 Mediators of NO Release ................................................................................................22 Actions of Nitric Oxide ...................................................................................................22
Regulation of NOS .................................................................................................................25 Arginine...........................................................................................................................25 Arginine Transportation ..................................................................................................26
Arginine Metabolism..............................................................................................................27 Arginase...........................................................................................................................27 Arginine:Glycine Amindotransferase and Arginine Decarboxylase ..............................28
NOS Cofactor and Protein-Protein Interactions. ....................................................................29 Tetrahydrobipterin(H4B) .................................................................................................29 Hsp90...............................................................................................................................32 eNOS-Hsp90....................................................................................................................32 Calmodulin ......................................................................................................................33 Caveolae ..........................................................................................................................33 Caveolin-1 and eNOS......................................................................................................33
eNOS Posttranslational Modifcations.....................................................................................34 Myristoylation and Palmitoylation ..................................................................................34 eNOS Phosphorylation ....................................................................................................35 Ser 1177/1179..................................................................................................................35 Thr 495/497 .....................................................................................................................36 Ser 633/635......................................................................................................................36 Ser 615/617......................................................................................................................37 Ser 114/116......................................................................................................................37
Pathophysiology .....................................................................................................................38 Pathways Leading to Oxidative Stress Generation.................................................................39
NADPH Oxidase .............................................................................................................39
![Page 6: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/6.jpg)
6
eNOS Uncoupling ...........................................................................................................40 DDAH ADMA Pathway.........................................................................................................42
PRMT ..............................................................................................................................43 Methylarginine Biochemistry..........................................................................................44 Metabolism of Methylarginines ......................................................................................47 In Vivo and In Vitro Significance of DDAH ..................................................................49 ADMA Independent Mechanisms of DDAH ..................................................................51 Regulation of DDAH Activity.........................................................................................52
Pathophysiology .....................................................................................................................53
3 ROLE OF DDAH-1 AND DDAH-2 IN THE REGULATION OF ENDOTHELIAL NO PRODUCTION.......................................................................................................................58
Introduction.............................................................................................................................58 Materials and Methods ...........................................................................................................59
Cell Culture .....................................................................................................................59 EPR Spectroscopy and Spin Trapping ............................................................................59 HPLC...............................................................................................................................60 DDAH-1 and 2 Gene Silencing.......................................................................................60 DDAH Activity ...............................................................................................................61 DDAH Over-Expression .................................................................................................62 Assessment of mRNA Levels Following DDAH Gene Silencing ..................................63 eNOS Activity .................................................................................................................63
Results.....................................................................................................................................64 Effects of DDAH 1 and 2 Over- Expression on Endothelial NO Production .................64 Effects of DDAH-1 and DDAH-2 Over-Expression on ADMA Inhibition....................65 Effects of DDAH 1 and 2 Silencing on Endothelial NO Production ..............................65 Effects on DDAH Gene Silencing on Methylarginine Metabolism................................68 Effects of DDAH 1 and 2 Gene Silencing on eNOS Activity.........................................68
Discussion...............................................................................................................................69
4 ROLE OF DDAH-1 IN THE 4-HYDROXY-2-NONENAL MEDIATED INHIBTION OF ENDOTHELIAL NITRIC OXIDE GENERATION........................................................87
Introduction.............................................................................................................................87 Materials and Methods ...........................................................................................................89
Materials ..........................................................................................................................89 Cell Culture .....................................................................................................................89 Epr Spectroscopy and Spin Trapping .............................................................................89 Measurement of Endothelial Cell ADMA and L-Arg Levels .........................................90 DDAH-1 and eNOS Expression......................................................................................90 DDAH Activity ...............................................................................................................90
Results.....................................................................................................................................91 Effects of 4-HNE on Endothelial Cell NO Production ...................................................91 Effect of 4-HNE on eNOS Expression............................................................................92 Restoring NO Generation from Cells ..............................................................................92 Effects of 4-HNE on Superoxide Production and Nitrotyrosine Formation ...................93
![Page 7: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/7.jpg)
7
Effects of 4-HNE on Cellular ADMA Levels .................................................................94 Effect of 4-HNE on DDAH Expression and Activity .....................................................94 Effects of DDAH Over-Expression on Endothelial NO Production Following
Exposure to 4-HNE......................................................................................................95 Discussion...............................................................................................................................97
5 REGULATION OF ENDOTHELIAL DERVIED SUPEROXIDE BY THE METHYLARGININES ........................................................................................................116
Introduction...........................................................................................................................116 Materials and Methods .........................................................................................................118
Expression and Purification of the Human Full Length eNOS and eNOS Oxygenase Domain (eNOSox).......................................................................................................118
EPR Spectroscopy and Spin Trapping ..........................................................................119 NADPH Consumption by eNOS ...................................................................................120 UV/Visible Spectroscopy ..............................................................................................120
Results...................................................................................................................................120 Effects of Methylarginines on O2
.- Production from H4B Free eNOS ..........................120 Effects of methylarginines and L-Arginine on NADPH Consumption from H4B-
Free eNOS..................................................................................................................122 Effects of Methylarginines on the Heme of eNOSox .....................................................123
Discussion.............................................................................................................................123
6 REGULATION OF DIHYDROFOLATE REDUCTASE IN THE DIABETIC ENDOTHELIUM .................................................................................................................138
Introduction...........................................................................................................................138 Materials and Methods. ........................................................................................................140
Materials ........................................................................................................................140 DHFR Activity Assay....................................................................................................140 Tissue DHFR Activity...................................................................................................140 HPLC Techniques .........................................................................................................141 Vascular Reactivity .......................................................................................................141 EPR Spin Trapping Studies ...........................................................................................141
Results...................................................................................................................................142 Enzyme Kinetics of DHFR............................................................................................142 Effect of Oxidants on DHFR Activity...........................................................................142 Effects of the Diabetic State on In-Vivo DHFR Activity..............................................143 Effects of the Diabetic State on Vascular Reactivity ....................................................144 Effects of the Diabetic State on eNOS Derived O2
.- Production in the Aorta ...............144 Discussion.............................................................................................................................144
7 DISCUSSION.......................................................................................................................158
LIST OF REFRENCES ...............................................................................................................174
BIOGRAPHICAL SKETCH .......................................................................................................202
![Page 8: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/8.jpg)
8
LIST OF TABLES
Table page
3-1 L-NMMA Metabolism .................................................................................................86
5-1 Effects of Methylarginines and L-arg on NADPH consumption from H4B-free eNOS (100 nM)............................................................................................................137
![Page 9: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/9.jpg)
9
LIST OF FIGURES
Figure page 3-1 DDAH over-expression. ....................................................................................................75
3-2 Effects of adDDAH-1 over expression on endothelial cell NO production. ...................76
3-3 Effects of adDDAH-2 over expression on endothelial cell NO production. ...................77
3-4 Effects of DDAH-1 and DDAH-2 over-expression on ADMA mediated inhibtion of endothelial NO production.................................................................................................78
3-5 Effects of DDAH gene silencing on DDAH mRNA expression. ......................................79
3-6 Effects of DDAH gene silencing on endothelial cell DDAH activity ...............................80
3-7 Effects of DDAH-1 gene silencing on endothelial cell NO production. ...........................81
3-8 Effects of DDAH-2 gene silencing on endothelial cell NO production. ...........................82
3-9 Effects of DDAH-1 and DDAH-2 gene silencing on endothelial cell NO production......83
3-10 Effects of ADMA on endothelial cell NO production. ......................................................84
3-11 Effects of DDAH gene silencing on endothelial cell eNOS activity. ................................85
4-1 Effects of 4-HNE on NO production. ............................................................................103
4-2 Effects of Hexanol on NO production. ............................................................................104
4-3 4-HNE effects on eNOS expression and phosphorylation...............................................105
4-4 Effects of 4-HNE on Ser1179 phophorylation following calcium ionphore (5 µM, A23187) stimulation. .......................................................................................................105
4-5 Effects of L-arginine and GSH supplementation on NO generation ...............................106
4-6 Effects on 4-HNE on the levels of ADMA in BAECs.....................................................107
4-7 4-HNE effects on DDAH expression...............................................................................107
4-8 4-HNE effects on DDAH activity....................................................................................108
4-9 Effects of DDAH over-expression on endothelial cell NO production following 4-HNE challenge.. ...............................................................................................................109
4-10 Effects of 4-HNE on endothelial cell DDAH activity. ....................................................110
![Page 10: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/10.jpg)
10
4-11 Effects 4-HNE on nitrotyrsoine formation in BAECs. ....................................................111
4-12 Effects 4-HNE on ROS formation from BAECs. ............................................................112
4-13 Effects of Hexanol on DDAH-1 activity. ........................................................................113
4-14 MS/MS spectra of of a tryptic peptide generating the sequence b/y-ion series from the in-gel digest of the hDDAH-1 reacted with 4-HNE. .................................................114
4-15 Adenoviral transduction of hDDAH-1 in BAECs. ..........................................................115
5-1 Inhibition of NOS-derived O2.- from H4B depleted eNOS. ...........................................130
5-2 Effects of ADMA on eNOS-derived O2.-.........................................................................131
5-3 Effects of L-NMMA on eNOS-derived O2.- ....................................................................132
5-4 Effects of L-arg on eNOS-derived O2.- ............................................................................133
5-5 Effects of ADMA on O2.- production from H4B-depleted NOS in the presence of L-
arg. ...................................................................................................................................134
5-6 Effects of NMMA on NOS-derived O2.- in the presence of L-arg...................................135
5-7 Methylarginines alter the eNOS-bound heme..................................................................136
6-1 H4B biosynthesis pathway. ............................................................................................149
6-2 DHFR enzyme kinetics. ...................................................................................................150
6-3 Effects of Nitric Oxide on hDHFR activity. ....................................................................151
6-4 Effects of H2O2 on hDHFR activity.................................................................................152
6-5 Effect of O2.-on DHFR activity. .....................................................................................153
6-6 Effects of OONO- on hDHFR activity. ...........................................................................154
6-7 Effects of the diabetic condition on in-vivo DHFR activity. ...........................................155
6-8 Effects of the diabetic state on vascular reactivity...........................................................156
6-9 Effects of the diabetic condition on eNOS derived O2.- in the aorta................................157
![Page 11: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/11.jpg)
11
Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy
ROLE OF ADMA IN THE REGULATION OF ENDOTHELIAL DERIVED NITRIC OXIDE
By
Arthur James Jarae Pope
August 2009 Chair: Arturo Cardounel Major: Medical Sciences-Physiology and Pharmacology
The endogenous NOS inhibitor Asymmetric Dimethylarginine (ADMA) has been
demonstrated to be an independent cardiovascular disease risk factor. However, the mechanisms
regarding how ADMA levels are modulated and what role they play in disease progression are
not clearly understood. Dimethylarginine dimethylaminohydrolase (DDAH) is the enzyme
responsible for ADMA metabolism however, how it is regulate in the disease state is unclear.
Therefore, we hypothesize that decreased DDAH expression/activity may be involved in the
vascular pathophysiology observed in a variety of cardiovascular disease.
Here we present findings that each isoform of the DDAH enzyme regulates endothelial NO
production. Over-expression of either DDAH-1 or DDAH-2 was found to increase endothelial
NO production. Gene silencing of either isoform attenuated endothelial DDAH activity.
Interestingly, dual silencing of the enzymes did not result in an additive effect on DDAH activity
suggesting the existence of an alternative pathway of methylarginine metabolism. Furthermore,
gene silencing of either isoform results in decreased endothelial NO production.
Subsequent studies aimed at investigating mechanisms of DDAH regulation in a disease
state demonstrated that cells exposed to 4-HNE exhibit decreased endothelial NO production and
these effects were mediated through increased ADMA levels and decreased DDAH activity. In
![Page 12: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/12.jpg)
12
addition to methylarginine regulation of NO, it has been hypothesized the ADMA may be
involved in the phenomenon of eNOS uncoupling wherein the enzyme switches form an NO
producing enzyme to an superoxide producing enzyme. Investigations into this pathway revealed
that methylarginines caused a dose dependent increase in eNOS derived superoxide.
Interestingly, L-arginine also increased eNOS derived superoxide in a dose dependent manner.
In addition to ADMA accumulation, oxidative stress has also been associated with
endothelial dysfunction. The presence of reactive oxygen and nitrogen species decreased the
activity of the salvage pathway enzyme, dihydrofolate reductase (DHFR) which regulates the
conversion of H2B to H4B Physiological levels of OONO- increases enzyme activity.
Furthermore, using the diabetic db/db mouse model of diabetes it was observed that DHFR
activity was decreased and that these mice had impaired vascular function.
These findings demonstrate that the DDAH-ADMA pathway and oxidative stress plays a
critical role in the development of endothelial dysfunction.
![Page 13: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/13.jpg)
13
CHAPTER 1 INTRODUCTION
In the United States it is estimated that 80,000,000 or 1 in 3 Americans have
cardiovascular disease [1]. Data from the Framingham Heart Study demonstrates that 2 out of 3
men and 1 in 2 women will have cardiovascular disease in their lifetime [1]. Of those who have
cardiovascular disease, 73,600,000 have high blood pressure, which is defined as having a
systolic pressure ≥140 mm Hg or a diastolic pressure ≥ 90 mm Hg. In 2005, cardiovascular
disease was the underlying cause for 35.3% of all deaths in the United States [1]. The number of
deaths due to cardiovascular disease surpasses the total number of deaths due to cancer, diabetes,
and accidents combined. Of those who die as a result of cardiovascular disease, 52% died as a
result of coronary heart disease [1]. However, recent studies have shown that from the years
1980-2000, there was a substantial decrease in the number of deaths due to cardiovascular
disease. Furthermore, almost half of the reduction in deaths can be attributed to advances in the
treatment of cardiovascular disease, while the other half is due to maintaining a healthy lifestyle
[1].
Despite the drop in deaths due to heart disease, it is still the number one cause of death in
the United States, and providing care to these patients results in an enormous cost to the health
care system. In 2005, 1 out of every 6 hospital stays was related to coronary heart disease and
the total cost of hospital care was 71.2 billion dollars. The projected indirect and direct cost for
the treatment of cardiovascular disease is expected to rise to 475.3 billion dollars in 2009 [1].
The most prevalent form of heart disease is coronary artery disease (CAD). CAD is
caused by the build up of plaque in the coronary artery, which leads to lumen narrowing and a
decreased supply of oxygen rich blood to the heart. This pathological process of arterial
narrowing and impaired blood flow is termed atherosclerosis and is the most common cause of
![Page 14: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/14.jpg)
14
coronary heart disease. Coronary heart disease, if untreated, can eventually lead to a heart attack
and subsequently heart failure [1]. CAD is the result of various risk factors, including genetics,
high blood pressure, smoking and diabetes.
Familial hypercholesterolemia (FH) is an inherited disorder that is caused by a deficiency
in the clearance of the Low Density Lipoprotein (LDL). Hypercholesterolemia is defined as
having a total serum cholesterol level ≥ 240 mg/dl. Initially, it was believed that familial
hypercholesterolemia was caused by the increased production of cholesterol. However, this
proved not to be the cause with the discovery of the LDL receptor (LDLR) by Brown and
Goldstein in 1973 [2, 3]. Their studies revealed that patients who suffered from FH had
dysfunctional LDLRs, therefore, leading to the increased accumulation of cholesterol [2, 3]. The
risk of cardiac events in this population has been greatly reduced with the development of statins.
Additional major risk factors taken into account to determine risk for CAD included
diabetes, smoking, and high blood pressure. The Framingham Heart Study defines individuals
having a blood pressure of <120/80 mm Hg, total serum cholesterol levels <180 mg/dL, non
diabetics , and non smokers as those who are least likely to develop CAD [4]. High risk
individuals are those who have total serum cholesterol levels that are ≥ 240 mg/dl, hypertension,
diabetes and smokers. The risk factors for developing CAD increases with age, however if a
healthy lifestyle is maintained the risk remains low. At 50 years of age men have a 5.2% chance
and women have a 8.2% chance of developing CAD if they maintain a healthy lifestyle [4].
However, having two or more of the associated risk factors (i.e. hypertension, diabetes)
increases the risk of developing CAD to 68.9% for men and to 50% for women [4]. Although
increased serum cholesterol levels and the associated risk factors outlined by the Framingham
![Page 15: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/15.jpg)
15
Heart Study are known to increase the risk of coronary artery disease, it is not just a disease of
high cholesterol.
Atherogenesis, once considered mainly a disease of cholesterol storage, is now understood
as a complex disease of many interacting risk factors which include cells of the artery wall, the
blood and the molecular messengers exchanged between the two. It is now becoming clear that
inflammation plays a critical role in atherogenesis [5-9]. It also plays a key role in the local,
myocardial and systemic complications associated with atherosclerosis [6, 8, 10].
Dyslipidemia, vasoconstrictive hormones associated with hypertension, and
proinflammatory cytokines derived from excess adipose tissue, enhance the expression of
adhesion molecules that promote the sticking of blood leukocytes to the inner surface of the
vascular wall [6, 8, 10]. Once inside the intima, blood leukocytes activate the smooth muscle
cells (SMCs) resulting in their migration to the intima. The SMCs continue to proliferate leading
to the creation of a complex extracellular matrix [7, 11-15]. Proteoglycans of the extracellular
matrix bind to lipoproteins extending their stay within the intima therefore increasing their
chances of becoming oxidized. LDLs undergo oxidative alteration leading to the formation of
oxLDL in the arterial wall. Other cellular lipids also undergo redox modifications, which result
in the formation of lipid hydroperoxides. These oxidatively modified lipids have been
demonstrated to play an important role in the pathogenesis of atherosclerosis [16-21]. Among
the mechanisms proposed, Nitric Oxide Synthase (NOS) dysregulation and decreased Nitric
Oxide (NO) bioavailability have been implicated as a central mechanism in vascular endothelial
dysfunction associated with atherosclerosis.
NO is a potent vasodilator and critical effector molecule that helps the endothelium
maintain vascular homeostasis through its anti-proliferative and anti-thrombotic effects. NO is
![Page 16: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/16.jpg)
16
derived from the oxidation of L-Arginine (L-Arg) and catalyzed by the constitutively expressed
enzyme endothelial nitric oxide synthase (eNOS). NO freely diffuses across the vascular
endothelium to the vascular smooth muscle cell layer where it activates guanylate cyclase
leading to smooth muscle cell relaxation [22, 23]. In addition to its effects on vascular tone, NO
also helps to maintain the anti-atherogenic properties of the vascular wall. NO, in association
with other cell signaling molecules promotes smooth muscle cell quiescence counteracting pro-
proliferative molecules specifically those involved with athero-proliferative disorders [24-29].
Therefore, loss of NO bioavailability is an early symptom of endothelial dysfunction and is
implicated as the pathogenic trigger leading to atherosclerosis.
Among the proposed mechanisms that lead to decrease NO bioavailability, is the
accumulation of the endogenous NOS inhibitors asymmetric dimethylarginine (ADMA) and NG-
monomethyl-L-arginine (L-NMMA) [30-34]. ADMA and L-NMMA are both competitive
inhibitors of eNOS. ADMA and L-NMMA are derived from the proteolysis of methylated
arginine residues on various proteins. Methylation is carried out by a group of enzymes referred
to as protein-arginine methyl transferase’s (PRMT’s). Upon proteolysis of methylated proteins,
free methylarginines are released where they can then inhibit eNOS activity. The free
methylarginines are subsequently hydrolyzed by Dimethylarginine Dimethylaminohydrolase
(DDAH) to citrulline, and mono and dimethylarginine [35-37]. Recent studies from our lab and
others have shown that the methylarginines ADMA and L-NMMA play a critical role in vascular
function and that the dysregulation of the enzymes responsible for metabolizing the
methylarginines play an essential role in endothelial dysfunction [38].
In support of this hypothesis several studies from both human and animal models of
atherosclerosis have demonstrated that L-Arg enhances the anti-atherogenic properties of the
![Page 17: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/17.jpg)
17
endothelium by increasing NO bioavailability. Oral L-Arg supplementation has been
demonstrated to restore endothelium dependent vasorelaxation in both hyperlipidemic animals
and humans [30, 34, 35, 39, 40]. Additionally, oral L-Arg has also been shown to prevent the
development of atherosclerosis in LDL receptor knockout mice (LDLR) [30]. The beneficial
effects observed following L-Arg supplementation could be explained by the fact there is
increased substrate for the NOS enzyme. However, intracellular levels of L-Arg are 50 times
above the Km value for the enzyme therefore, increased NO generation would not be expected as
a result of L-Arg supplementation [41]. It has been hypothesized that basal levels of
methylarginines can inhibit NOS activity and L-Arg supplementation is able to improve vascular
function simply by overcoming the inhibitory effects of the methylarginines [42].
Another potential mechanism for reduced NO bioavailability is through direct scavenging
of NO by reactive oxygen species (ROS) [43]. Growing evidence has demonstrated that
oxidative stress is associated with the pathogenesis of diseases including hypercholesterolemia,
diabetes and hypertension [44-47]. In healthy tissues, superoxide anion (O2.-) is dismutated into
hydrogen peroxide (H2O2) and oxygen by the enzyme superoxide dismutase (SOD). The
enzyme, Catalase further reduces H2O2 to water and oxygen [48]. Increases in oxidative stress
seen in the pathological states overwhelm the antioxidant defense systems resulting in an
oxidative environment. Failure of the antioxidant system can also lead to the generation of
peroxynitrite (OONO-), which is a potent oxidant known to cause damage to proteins and tissues
[43]. In this regard, a human variant of ecSOD has been observed in 5% of the population. This
ecSOD variant is associated with decreased SOD activity, increased oxidative stress and
increased inactivation of NO [49].
![Page 18: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/18.jpg)
18
Alternatively it has been proposed that increased oxidative stress results in the uncoupling
of the NOS enzyme turning it into a superoxide generating enzyme. In vitro studies have
demonstrated that eNOS depleted of its essential cofactor, tetrahydrobiopterin (H4B), readily
makes superoxide [50, 51]. Futhermore, it is also known that H4B is highly redox sensitive and
can be readily oxidized to its inactive form dihydrobiopterin (H2B). H4B is produced via two
pathways in the endothelial cell, the de novo synthesis pathway and the salavage pathway. De
novo biosynthesis of H4B is a magnesium, zinc and NADPH dependent pathway. The first step
requires the conversion of GTP to 7,8-dyhydroneopterin triphosphate. This reaction is catalyzed
by the enzyme GTP cyclohydrolase I (GTPCH), and it is the rate limiting step in H4B
biosynthesis [52]. Following the GTPCH enzyme reaction pyruvoyl tetrahydropterin synthase
(PTPS) converts 7,8 dihydroneopterin triphosphate into 6-pryuvoyl-5,6,7,8-tetrahydropterin.
Alternatively, the salvage pathway enzyme Dihydrofolate reductase (DHFR) is a NADPH
dependent enzyme that catalyzes the conversion of H2B to H4B.
NOS uncoupling has also been demonstrated to occur in both animal and human models of
diseases associated with oxidative stress. In this regard, oral supplementation of H4B was
demonstrated to improve endothelial dependent vascular function in the apoE KO mouse model
of hypercholesterolemia. In addition to improved vascular function, a reduction in vascular
superoxide production was also observed following oral H4B supplementation [53]. Moreover,
endothelial function has been shown to improve in patients who are chronic smokers, type II
diabetics and those with CAD following H4B supplementation [54, 55].
Rationale for Study
It is clear that the mechanisms that lead to vascular endothelial dysfunction are quite
complicated. Though the evidence laid out in the introduction points to two possibilities. First,
increasing levels of methylarginines have been demonstrated to be an independent risk factor in
![Page 19: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/19.jpg)
19
the development of cardiovascular disease. However, how methylarginines are modulated and
what role they play in disease progression is poorly understood. Additionally, how DDAH is
regulated and what role it plays in endothelial dysfunction needs to be explored further. Because
NO possess both anti-proliferative and anti-atherogenic properties, methylarginine accumulation
in response to decreased DDAH expression and activity has been proposed to be involved in the
vascular pathophysiology observed in a variety of cardiovascular disease.
In addition to the accumulation of ADMA, the altered redox status of the endothelium has
also been implicated as a central mechanism in endothelial dysfunction associated with
cardiovascular disease. Previous studies have demonstrated that in diseases such as diabetes
there is an accumulation of H2B, the inactive oxidized form of the NOS cofactor H4B. This
increase has also been associated with increased superoxide production and vascular endothelial
dysfunction. However, it is unclear as to what leads to this accumulation, because DHFR should
reduce H2B back to H4B. Therefore, I hypothesized that DHFR activity may decrease in
oxidative stress situations. While it may appear that ADMA and oxidative stress are unrelated, it
has been suggested that ADMA also plays a role in NOS uncoupling.
Therefore to better establish the role of ADMA in the regulation of endothelial derived NO
and vascular endothelial dysfunction, the following aims will be carried out:
Aim 1: To determine the role of DDAH in the regulation endothelial derived NO
Aim 2: To determine the effects of the methylarginines on eNOS derived superoxide.
Aim 3: To determine the effects of oxidative stress on DHFR activity in vitro and in vivo.
![Page 20: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/20.jpg)
20
CHAPTER 2 REVIEW OF LITERATURE
Endothelial cells were once considered to be a population of elongated cells that were
homogenous in nature and that their main function was to serve as a barrier between the vascular
space and interstitium. Florey demonstrated in the late 60’s that the endothelium was a
permeability barrier and served a much bigger role than previous thought [56]. Subsequently,
intense research began to determine the role endothelial cells and their effects on vascular
function. Furchgott and Zawadzi were the first to describe that the endothelial layer was
necessary for acetylcholine (Ach) mediated vascular relaxation in rabbit aortic rings. Their
studies demonstrated that when the endothelial layer was removed, the vessel lost its ability to
relax in response to Ach and in fact it resulted in overt vasoconstriction [57]. Moncada, and
Ignarro, independently established that the effector previously described by Furchgott and
Zawadzi as endothelial derived relaxing factor (EDRF), was in fact NO [58, 59]. A year later, L-
Arg was discovered to be the substrate from which NO was synthesized [60]. Since then it has
been established that NO is one of the most important regulators of vascular homeostasis and
that decreased bioavailability of NO is involved in the endothelial dysfunction observed in
cardiovascular disease.
Nitric Oxide
Endothelial derived Nitric Oxide is synthesized from the oxidation of the guanidino carbon
of the amino acid L-Arg to NO and L-Cit by the enzyme eNOS [60]. The half life of NO is in
the range of 3-5 seconds in the presence of hemoglobin and can undergo rapid oxidation by
oxyhemoproteins to nitrate (NO3) and nitrite (NO2) [61]. One of the primary functions of NO in
the vasculature is to cause vascular smooth muscle cell (VSMC) relaxation. NO does this by
freely diffusing from the endothelium into the VSMC layer where it binds to the heme group of
![Page 21: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/21.jpg)
21
the enzyme guanylate cyclase. Guanylate cyclase then catalyzes the reaction of guanosine
triphosphate (GTP) to cyclic guanosine 3’5’-monophosphate (cGMP) and inorganic phosphate
[22, 59]. cGMP then activates protein kinaseG (PKG) resulting in the phosphorylation of
myosin light chain phosphatase. Myosin light chain phosphatase then dephosphorylates myosin
light chain, resulting in vascular smooth muscle cell relaxation. NO in concert with various cell
signaling molecules, has been demonstrated to maintain smooth muscle cell quiescence and as
such, counteracts pro-proliferative agents, specifically those involved in the propagation of
athero-proliferative disorders [25].
Nitric Oxide Synthase Enzyme
There are three isoforms of the NOS enzyme, neuronal nitric oxide synthase (nNOS),
inducible nitric oxide synthase (iNOS) and endothelial nitric oxide synthase (eNOS). The
cofactors required for the full enzymatic activity of all NOS enzymes are the flavin (FAD, FMN)
[28], heme, calmodulin (CaM) and tetrahydrobiopterin (H4B). The enzyme has three domains
which are required for catalytic activity, the reductase domain, CaM binding domain and
oxygenase domain [62-64]. The cofactors FAD and FMN are located within the reductase
domain and in concert with NADPH shuttle electrons to the heme binding site in the oxygenase
domain [62-64]. The oxygenase domain contains the heme, H4B, and arginine binding sites [65,
66]. eNOS and nNOS are activated by calcium-calmodulin binding to the CaM binding domain
of the enzyme. The binding of calcium-calmodulin to NOS activates the transfer of electrons
from the flavin to heme, where oxidation of L-Arg to NO and L-Cit occurs [67, 68].
eNOS, when inactive, is located within invaginations of the plasma membrane called
caveolae [69]. Specifically, it has been demonstrated that eNOS binds to caveolin-1 (CAV-1)
and that this interaction is inhibitory to enzyme activity [69]. Dissociation of the CAV/eNOS
complex occurs when excess amounts of calcium enter the cell and binds to CaM. The resulting
![Page 22: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/22.jpg)
22
Ca-CaM complex facilitates the dissociation of eNOS from Cav-1 resulting in eNOS activation
and NO production.
Mediators of NO Release
The release of NO from the vascular endothelium can be activated through both Ca2+
dependent and independent mechanisms. The binding of substances such as acetylcholine (Ach),
and bradykinin to their respective receptors activate NOS through a Ca2+ dependent mechanism
[70-72]. All of these substances mediate their effects on eNOS activity through phospholipase C
(PLC). Activation of PLC results in increased intracellular Ca2+, which subsequently leads to the
activation of eNOS [70-73].
Alternatively, laminar shear stress generated by blood flowing over the endothelial cell,
which is the main physiological way in which eNOS is activated, and vascular endothelial
growth factor (VEGF) can also stimulate the release of NO in a Ca2+ independent manner. Shear
stress and VEGF activate the phosphatidylinostiol-3-kinase (PI3K) pathway leading to the
activation of AKT consequently resulting in eNOS phosphorylation and activation [74].
Actions of Nitric Oxide
In addition to modulating vascular tone through VSMC relaxation, NO is also important
for maintaining vascular homeostasis through its anti-thrombotic, anti-proliferative and anti-
atherogenic effects. NO and prostaglandin (PGI) act in a synergistic manner through a cGMP
dependent mechanism to prevent platelet aggregation in the endothelium [75]. It has been
demonstrated in both human and animal models that NO is key in preventing platelet
aggregation. In this regard, it was observed in a rat model of common carotid artery thrombosis,
platelet aggregation increased at the site of the thrombosis following administration of the NOS
inhibitor Nitro-L-Arg methyl ester (L-NAME) [76]. Furthermore, studies involving healthy
![Page 23: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/23.jpg)
23
human volunteers have demonstrated that when the NOS inhibitor L-NMMA is given
intravenously bleeding times are decreased [77].
In addition to its anit-thrombotic effects, NO is known for its anti-atherogenic properties.
Endothelial cell activation is a process that involves the up regulation of transcription of a
number of pro-inflammatory genes, and adhesion molecules such as E and P selectin, VCAM-1
and ICAM-1. Addtionally, chemokines such as MCP-1 and IL-1 also increase during endothelial
cell activation. Taken together these adhension molecules and chemokines, increase leukocyte
rolling and adhension to the endothelium. NO through its inhibitory effects on the NF kappa B
signaling pathway prevents leukocyte adhesion to the endothelial cell monolayer. Thus,
resulting in the inhibition of the pro-atherogenic adhesion molecules P-selectin, E-selectin, and
VCAM-1 [78, 79].
The anti-proliferative properties of the endothelium are maintained through a NO mediated
mechanism in concert with various other signaling molecules. Balloon angioplasty is a standard
treatment for coronary artery stenosis caused by CAD. An unfortunate side effect to this
treatment is restenosis, which is caused by VSMC proliferation in response to vascular injury.
Several studies have demonstrated that in both human and animal models of restenosis,
increasing NO reduces neointimal hyperplasia [80-82]. Though it has been known for quite
some time that NO prevents VSMC proliferation, the molecular mechanism of how this occurs
was largely unknown. Recently it has been demonstrated that NO inhibits cell cycle progression
of VSCMs in the S phase by inducing down-regulation of cyclin-dependent kinase 2 (cdk2)
activity and cyclin A gene transcription [83].
In addition to its effects on the endothelium, NO has also emerged as a protein post
translational modifier. Several studies have demonstrated that endogenous and exogenous NO
![Page 24: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/24.jpg)
24
and its oxidative products NO3 and NO2 can S-nitrosylate proteins at active cysteine residues
altering their function. The exact function of protein S-nitrosylation (SNO) is not clearly
defined, however, it has been suggested that it may be involved in storage and transportation of
the NO molecule [84]. In support of this hypothesis it has been demonstrated that glutathione
and NO interact to form S-nitrosoglutathione (GSNO). GSNO is the most abundant SNO and in-
vitro its decomposition has been shown to generate NO [85].
The formation of SNO is prevented during high antioxidant activity. However, when the
antioxidant defense system is overwhelmed during times of oxidative stress, SNO formation
could be a key in preventing further oxidative damage [86]. SNO has also been shown to
partially mediate the antioxidant effects of statins in the endothelial cell by activating the
antioxidant enzyme thioredoxin [87].
SNO can also modulate the activity of enzymes important for regulating vascular
homeostasis. SNO formation has been demonstrated to occur in the catalytic triad of the DDAH
enzyme at cysteine 249 rendering the enzyme inactive [88]. Argininosuccinate synthetase, the
enzyme responsible for converting citrulline to argininosuccinate can also undergo SNO
formation also inhibiting its activity [89]. In-vitro studies using NO donors demonstrate that
formation of SNO on eNOS targets two cysteine residues at 96 and 101 rendering the enzyme
inactive [90]. Furthermore, it has been demonstrated in Bovine Aortic Endothelial Cells
(BAECs) that SNO formation on eNOS also occurs ,but can be rapidly denitrosylated in the
presence of VEGF [91]. Though eNOS can be self regulated through SNO formation, it is also
regulated by posttranslational modifications, substrate availability and protein-protein
interactions.
![Page 25: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/25.jpg)
25
Regulation of NOS
The role of eNOS in the regulation of cardiovascular function has been the focus of
extensive research efforts. Results have demonstrated that eNOS enzymatic activity is regulated
by a variety of factors including substrate/inhibitor bioavailability, protein-protein interactions
and post-translation modifications. In addition to being a substrate for NOS, L-Arg is also
metabolized through various pathways in the cell. Arginine is predominantly metabolized by the
enzyme arginase and its activity could play a key role in regulating eNOS. eNOS’s interactions
with other proteins and cofactors have been well documented as ways in which eNOS can be
regulated. Hsp90, CaM, H4B all promote increased enzyme activity and NO production. On the
other hand, eNOS’s interaction with Cav-1 results in the inhibition of enzyme activity. eNOS is
also regulated by post-translational modifications. Among them, phosphorylation of eNOS is
most extensively studied and has been demonstrated to result in both site specific activation and
inactivation of the enzyme. Finally, the last known post translational modification of eNOS that
occurs is myristoylation and palmitoylation. Myristoylation and plamitoylation of the enzyme
causes it to be targeted to the plasma membrane where it will interact with CAV-1 inhibting
enzymatic activity.
Arginine
The discovery in 1987 that Endothelial Dervied Relaxing Factor (EDRF) was NO was an
important milestone in understanding how vascular tone was regulated. However, it was not
until a year later that the substrate for eNOS was discovered to be the amino acid arginine [86].
Arginine is available from three main sources; dietary intake, endogenous biosynthesis, and
protein turnover. 40% of the arginine that we ingest through our diet is catabolized in the
intestine before reaching the whole body [92]. During fasting states, 85% of our circulating
arginine is derived from protein turn-over and the rest comes from endogenous biosynthesis [93].
![Page 26: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/26.jpg)
26
The endogenous biosynthesis of arginine in healthy adult humans is enough that it is not an
essential amino acid in the diet. However, in infants, growing children, and adults with kidney
or intestinal dysfunction, endogenous arginine synthesis is not enough. Therefore, it is classified
as a conditionally essential dietary amino acid [94].
Whole body arginine synthesis occurs primarily between the interaction of the small
intestine and the kidney and it is referred to as the gut-kidney axis. Citrulline is produced from
glutamine and proline in the small intestine. The kidney then takes up citrulline where it is
converted to arginine. A large amount of arginine synthesis also takes place in the liver,
however, it is not a significant source as arginine is quickly hydrolyzed to urea and ornithine
therefore not contributing a lot to the whole body [95].
Although the primary means of arginine synthesis occurs in the kidney renal tubules, the
majority of cell types have the ability to synthesize arginine. Arginine synthesis from citrulline
occurs via the synergistic action of argininosuccinate synthase and argininosuccinate lyase
(ASL). ASL is the rate-limiting step in the conversion of citrulline to arginine, and it requires
aspartate, citrulline and ATP as cofactors for full activity [95]. The citrulline-NO cycle, much
like the urea cycle, is recognized as an alternative means to produce arginine in the cell.
However, only a fraction of the citrulline produced by eNOS oxidation of arginine is recycled via
the citrulline-NO cycle [93].
Arginine Transportation
Transportation of the cationic amino acid arginine from the plasma into the cell occurs
though the sodium (Na+) independent transport system y+ . The y+ transport system family
consists of 3 cationic amino acid transporters (CAT) CAT-1, CAT-2 and CAT-3, each having
distinct tissue distribution. CAT-1 is ubiquitously expressed, CAT-2A expression is found in the
liver, skin and skeletal muscle, and CAT-3 expression is exclusively expressed to the brain. The
![Page 27: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/27.jpg)
27
amino acids lysine, ornithine and the methylarginines compete with arginine for transport
through the CAT transport system. Although intracellular arginine appears to be the most
important source of eNOS derived NO, there is evidence to support a role for CAT in the
regulation of endothelial NOS [95].
The y+ Km for arginine is within the physiological range of plasma arginine levels and
therefore arginine transportation into the cell maybe an important regulator of NOS. Kinetic
studies have demonstrated that the Km of eNOS for arginine is 2-3 µM. L-Arg intracellular
levels are in the range of 100 µM. Therefore, substrate availability should not be a limiting
factor in NO synthesis [96]. However, studies have clearly demonstrated in both animal and
human models that arginine supplementation leads to increases in NO generation. This
phenomenon has been termed the “L-Arg paradox” and has been hypothesized that perhaps
increased uptake through the y+ transport system may play a role in this paradox [93, 95].
Arginine Metabolism
Arginase
Arginase is the key urea cycle enzyme involved in arginine metabolism and is responsible
for the hydrolysis reaction of arginine to urea, and ornithine. There are two isoforms of arginase
that are expressed in the body. The type I isoform is located in the liver and is responsible for
the majority of arginase activity. The type II isoform is predominantly expressed as a
mitochondrial protein and is expressed in a variety of tissues with the highest expression
localized to the kidney, and the lowest in the liver [93].
Recently, several studies have demonstrated that arginase is present in the vasculature and
may serve a regulatory role in vasomotor tone. VSMC only express type I, while endothelial
cells express both isoforms. The aortic smooth muscle cells of rats were observed to have high
arginase activity. Addtionally, transforming growth factor-beta (TGF-β) up-regulates the
![Page 28: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/28.jpg)
28
expression and activity of arginase I in these cells [97]. Furthermore, it has been demonstrated
that both isoforms are expressed in the aorta, carotid artery and pulmonary artery [98].
Considering that arginine is also a substrate for arginase, it has been suggested that
arginase may compete with NOS for substrate binding. The Km for arginine for eNOS and
arginase are 2 µM and 1-5 mM respectively. Although, arginine has a higher affinity for NOS,
the activity of the arginase enzyme is 1000 fold greater therefore suggesting that at physiological
levels arginase can compete with NOS for substrate binding [93, 99]. In support of this
hypothesis, it was demonstrated in macrophages that L-Arg supplementation resulted in greater
urea production, than NO generation [100]. It has also been demonstrated in endothelial cells that
over-expression of either arginase isoforms resulted in decreased eNOS derived NO. In
microvascular endothelial cells isolated from Dahl salt sensitive rats, the increase in arginase
activity counteracts NO mediated relaxation, thus suggestive of a vasoconstrictive role [101]. In
contrast, inhibition of arginase activity has been demonstrated to increase endothelial NO
production in cultured endothelial cells [102]. Although arginase is the main pathway in which
arginine is metabolized; there are other pathways in which its metabolism can also occur.
Arginine:Glycine Amindotransferase and Arginine Decarboxylase
The arginine:glycine amidotransferase [103] enzyme catalyzes the first step and it is also
the rate limiting step in creatine formation. In the first step of creatine synthesis arginine donates
an amidino group to glycine to form guanidinoacetate and ornithine. The guanidionacetate is
then methylated to form S-Adenosylhomocysteine and creatine. Creatine negatively feedbacks
to inhibit enzyme activity [104]. Ornithine made from this pathway can be used by ornithine
decarboxlyase (ODC) to make polyamines.
Arginine Decarboxylase (ADC) catalyzes the reaction of arginine to carbon dioxide and
agmatine. Agmatine is further metabolized into putrescine and urea. Putrescine is used in the
![Page 29: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/29.jpg)
29
synthesis of polyamines, which are important for cell division [105]. Although AGAT, ADC,
and ODC do not appear to compete with NOS for substrate binding, they can play a role in
vascular remolding as polyamines are important for cell division and proliferation [74]
NOS Cofactor and Protein-Protein Interactions.
Tetrahydrobipterin(H4B)
First described as an essential cofactor for the aromatic amino acid hydroxylases,
tetrahydrobipterin (H4B) is also a essential cofactor for all three NOS isoforms [106-108]. The
role that H4B plays in NOS regulation has only recently become more defined. Located within
each domain of eNOS is a binding site for a H4B molecule. In vitro studies demonstrate that
H4B stabilizes and donates electrons to the ferrous-dioxygen complex in the oxygenase domain
to help initiate the oxidation of L-Arg [109-111]. Loss of H4B leads to the phenomenon of
“NOS uncoupling” which has been documented in a variety of cardiovascular releated diseases
[53, 112, 113]. H4B depletion leads to the dissociation of the ferrous-dioxygen complex and
electrons from the flavin domain are donated to molecular oxygen instead, leading to the
production of superoxide from the oxygenase domain [50, 51].
As previously stated, H4B is an essential cofactor for the aromatic amino acid hydroxylases
and NOS. The synthesis of H4B occurs via three pathways in the cell, the de novo pathway, the
salvage pathway, and recycling pathway. In the recycling pathway, the oxidized product of H4B,
tetrhydrobiopterin-4alpha-carbinolamine, is recycled back to H4B in a two step enzymatic
process. First Pterin-4alpha-carbionolamine dehydratase (PCD) reduces tetrahydrobiopterin-4
alpha-carbinolamine to a quinonoid dihydrobiopterin intermediate which is then further reduced
by dihydropteridine reductase (DHRP) to H4B [114, 115]. The recycling pathway has not been
shown to represent a critical pathway for production of H4B in the endothelial cell, nor does it
have an effect on eNOS activity [110, 116].
![Page 30: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/30.jpg)
30
De novo biosynthesis of H4B is a magnesium, zinc and NADPH dependent pathway. The
first step requires the conversion of GTP to 7,8-dyhydroneopterin triphosphate. This reaction is
catalyzed by the enzyme GTP cyclohydrolase I (GTPCH), and it is the rate limiting step in H4B
biosynthesis [52]. GTPCH can be regulated at both the gene and protein level. Cytokines such
as Tumor Necrosis Factor Alpha (TNF-a) and Interferon (IFN-y) increase GTPCH activity
resulting in increased H4B levels in human endothelial cells [117-119]. Platelet-derived growth
factor and angiotensin II (Ang II) have both been demonstrated to increase GTPCH activity by
phosphorylation in rat mesangial cells via a phosphokinsae C (PKC) dependent pathway.
However, this mechanism has not been observed in endothelial cells [120]. Over-expression of
GTPCH has been demonstrated to increase the levels of H4B by ten fold in human endothelial
cells [121]. Laminar shear stress also leads to increased GTPCH activity and H4B production in
the vascular endothelium [122]. Additionally, endothelial specific GTPCH transgenic mice have
been observed to have a two fold increase in NO synthesis compared to wild type litter mates
[123].
GTPCH activity is also regulated by its physical interaction with the GTPCH feedback
regulator protein (GFRP). H4B exerts its inhibitory effects on GTPCH by binding to GFRP[124].
Following exposure to H2O2 GFRP mRNA levels have been observed to decrease resulting in
increased GTPCH activity and H4B levels. However, the decrease in GFRP mRNA expression
has no effect on NO production [125]. What role if any GFRP plays in regulating eNOS is
unknown, however, in a yeast 2-hybrid studies the activator of heat shock protein 90 (Aha1) was
recently shown to be a binding partner in the N-terminal region of the GFRP protein [126]. HSP
90 is a known cofactor of the eNOS enzyme, and it’s binding to eNOS results in enhanced
enzyme activity (149). Because GFRP binds in a region that is not required for HSP 90
![Page 31: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/31.jpg)
31
activation it has been proposed that GFRP binding to Aha1 functions to help support local
changes in eNOS derived NO generation [126].
Following the GTPCH enzyme reaction, pyruvoyl tetrahydropterin synthanse (PTPS)
converts 7,8 dihydroneopterin triphosphate into 6-pryuvoyl-5,6,7,8-tetrahydropterin. In
macrophages, induction by cytokines leads to increased GTPCH activity however, the activity of
PTPS remains unchanged [127, 128]. Under these conditions PTPS becomes the rate limiting
enzyme for H4B synthesis, and as a result the 7, 8 dihydroneopterin triphosphate intermediate
accumulates and can become oxidized to neopterin. Neopterin is a stable metabolite that can be
detected in the plasma and used clinically as a marker of inflammation in CAD [129]. The final
step in the de novo synthesis pathway involves the NADPH dependent sepiapterin reductase
enzyme catalyzing the reaction of 6-pyruvoyl-5,6,7,8-tetrahydropterin to the final product of de
novo synthesis, H4B [130]. A mouse SPR KO model has been generated and this model shows
impaired synthesis of H4B. To date however, no studies have been done to gather what effect
this may have on the vascular endothelial function of these mice [131]. The salvage pathway is
another in which H4B can be synthesized. One way in which the salvage pathway works is
through the conversion of exogenous sepiapterin. Sepiapterin is metabolized to H2B by
sepiapterin reductase and subsequently to H4B by the enzyme dihydrofolate redutase (DHFR).
Alternatively, when H4B is oxidized to H2B, DHFR reduces it back to H4B [132]. Recently the
role of endothelial DHFR in BAECs as it relates to H4B and NO bioavailability was investigated.
As a result of DHFR gene silencing, endothelial NO production and H4B levels in endothelial
cell decreased [133]. Additionally, DHFR expression was observed to decrease in BAECs
following exposure to H2O2. Following Ang II mediated stimulation of NADPH, increases in
eNOS derived O2.- were observed. DHFR gene over-expression was able to restore H4B and NO
![Page 32: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/32.jpg)
32
bioavailability. It also resulted in decreased eNOS derived O2.- in ANG II treated cells. Overall,
this study demonstrates the importance of DHFR in maintaining endothelial H4B and NO
bioavailability. Moreover, under conditions of oxidative stress the salvage pathway maybe
critical in maintaining endothelial H4B and NO production [133].
Hsp90
Hsp 90 is a chaperone protein that is among the most abundant proteins in eukaryotic cells
accounting for 1-2 percent of total cytosolic protein [134]. It exists in two isoforms, Hsp90 alpha
and HSP90 beta and it is mostly localized to the cytoplasm with a marginal amount found in the
nucleus [134]. The role of Hsp90 in the cell is to promote protein folding by preventing protein
aggregation of unfolded protein [135, 136]. In addition to promoting protein folding, there is
evidence to suggest that Hsp 90 is important for signal transduction in all cell types. In support
of this, a variety of signaling proteins including v-Src, Raf-1 and MEK have been shown to
interact with Hsp 90 [137-139]
eNOS-Hsp90
eNOS was initially shown to interact with a 90 kDa tyrosine phosphorylated protein
following bradykinin stimulation in BAECs and this promoted translocation of eNOS to the
cytoskeleton [140, 141]. It was later shown that this protein termed endothelial nitric oxide
synthase associated protein (ENAP-1) was in fact HSP90 [140, 141]. Hsp90 is recruited for
binding to eNOS following VEGF, histamine and fluid shear stress stimulation and enhances the
activity of the enzyme [141]. Geldanamycin (GA) is a ansamycin antibiotic that binds to the
ATP binding site of Hsp90 preventing the ATP/ADP cycle that is required for protein-protein
interactions [142]. In support of Hsp 90 being critical to eNOS activity, it has been shown that
GA treatment in isolated mesenteric arteries and rat aortas decreases NO generation [141, 143].
Furthermore, Hsp 90 inhibition by GA has been shown to increase eNOS derived superoxide
![Page 33: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/33.jpg)
33
production [144]. Recent studies have demonstrated that there is an Hsp90 binding domain
present on eNOS. Site directed mutagenesis of this site yields an eNOS mutant that has a weak
binding affinity to HSP90 and increased generation of O2.- [145]. These observations suggest
that Hsp90 binding is not only important for enhancing enzyme activity, but that it can also be
important in modulating the balance between NO and O2-generation from eNOS.
Calmodulin
In addition to HSP 90, calmodulin has been known to have a positive regulatory effect on
eNOS activity [67] and was the first protein known to be involved in eNOS regulation. CaM
binding to its binding motif on eNOS displaces the auto-inhibitory loop on eNOS allowing the
electrons to flow from the reductase domain to the oxygenase domain [146].
Caveolae
Caveolae are small (50-100 nm) cholesterol rich invaginations located on the surface of the
cell membrane. They are found in practically every cell type and are found in copious amounts
in VSMC, endothelial cells and adipocytes. The major structural protein of caveolae is caveolin.
The caveolin family consists of three protein isoforms, Caveolin-1 (Cav-1), Caveolin-2 (Cav-2)
and Caveolin-3 (Cav-3). Cav-1 is expressed in most cell types including adipocytes, endothelial
cells and VSMC [147]. Cav-2 is found in the same cell types as Cav-1. In fact Cav-1, and Cav-2
co-localization is required in order for Cav-2 to make caveolae [147, 148]. Furthermore, without
Cav-1, Cav-2 is localized to the Golgi complex where it is degraded [148]. Cav-3 expression is
limited to muscle tissue and it is found in skeletal, cardiac and smooth muscle cells [149].
Caveolin-1 and eNOS
As previously stated, abundant amounts of Cav-1 are present in the endothelial cell.
Numerous studies have demonstrated in vivo and in vitro that Cav-1 is a negative regulator of
eNOS activity [150, 151]. eNOS contains a consensus binding sequence for Cav-1 at amino
![Page 34: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/34.jpg)
34
acids 350-358. In this regard, studies done using a scaffolding peptide corresponding to the
consensus sequence have been shown to cause inhibition of enzyme activity [151]. Additionally,
it has been demonstrated in cellular studies that over-expression of Cav-1 results in reduced
eNOS activity [150]. In further support of its inhibitory effects, in vivo studies using the Cav-1
scaffolding peptide was demonstrated to inhibit endothelial dependent vasorelaxation following
Ach stimulation [152]. In contrast, site directed mutagenesis of the Cav-1 consensus sequence
inhibits Cav-1 binding and suppression of eNOS activity [151]. Moreover, Cav-1 KO mice
exhibit enhanced endothelial dependent vasodilatation in response to acetylcholine stimulation
[153, 154].
The inhibitory effects of Cav-1 on eNOS activity can be overcome exogenously with the
addition of calmodulin, suggesting a reciprocal relationship between the two proteins [150, 155-
157]. In support of this, co-immunoprecipitation experiments demonstrate that in the absence of
calcium eNOS remains abound to Cav-1. However, stimulation of cells with calcium ionophore
results in reduced formation of the eNOS-Cav-1 complex [150].
eNOS Posttranslational Modifcations
Myristoylation and Palmitoylation
Myristoylation is important for the subcellular targeting of proteins to membranes. eNOS
is the only NOS isoform to posses an N-myristoylation consensus sequence [158-162]. Glycine
2 (Gly-2) and serine 6 (ser-6) are the preferred substrate binding sites for N-myristoyltransferase
[163]. In this regard, site directed mutagenesis studies have demonstrated that mutation of Gly-2
converts the eNOS membrane bound protein to the cytosolic form [164-166]. However,
inhibiting N-myristoylation of eNOS does not effect enzyme activity [166]. eNOS
palmitoylation unlike myristoylation is a reversible process. In order for eNOS to be targeted to
the plasma membrane myristoylation must precede palmitoylation [167]. Palmitoylation occurs
![Page 35: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/35.jpg)
35
at the cysteine residues 15 and 26. Mutations at these sites do not affect eNOS activity or protein
trafficking to the plasma membrane [167]. The role of palmitoylation is to specifically target
eNOS to caveolae. In support of this experiments done using wild type-eNOS and a
palmitoylation mutant form of the enzyme, showed that the wild type enzyme colocalized with
caveolin while the mutant form did not [69, 168]. Therefore, it appears that the first step in eNOS
protein localization to the plasma membrane requires myristoylation, which is then followed by
palmitoylation, which stabilizes the enzyme and targets it to the caveolae.
eNOS Phosphorylation
Phosphorylation of eNOS typically occurs at serine (Ser) residues, and less frequently at
tyrosine (Tyr) and threonine (Thr) residues. Currently five sites on eNOS have been identified as
targets for protein phosphorylation, Ser 1177 (human)/Ser 1179 (bovine), Ser 633 (H)/Ser 635
(B), Ser 615(H)/Ser 617 (B), Thr 495 (H)/Thr 497 (B), and Ser 114 (H)/Ser 116 (B).
Ser 1177/1179
The phosphatidylinositol 3-kinase (PI3K) pathway was first shown to be involved in eNOS
phosphorylation when it was demonstrated that VEGF or insulin stimulated release of NO was
attenuated by the pharmacological inhibitors of PI3K wortmannin and LY298004 [169, 170].
The protein kinase Akt is known to be activated by PI3K and to target phosphorylation sites with
the particular consensus sequence of RXRXXXS/T which have been identified on eNOS [171].
Two groups independently demonstrated that Akt could directly phosphorylate eNOS at Ser1179
resulting in its activtion [172, 173]. Various stimuli including shear stress, bradykinin, VEGF
and insulin activate Ser 1179 phosphorylation. It has been hypothesized that the activation of
eNOS by Ser 1179 phosphorylation causes a conformational change in the enzyme similar to the
effects caused by calmodulin binding [174]. Because of the wide variety of stimulators that can
activate Ser 1179, it appears that it is the most important site in the regulation of eNOS activity.
![Page 36: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/36.jpg)
36
In support of these observations, it has been demonstrated that mutating the Ser 1179 site to an
alanine thus preventing phosphorylation, leads to a reduction in basal and stimulated release of
NO [175]. Additionally, mutating the Ser 1179 site to aspartate to mimic the negative charge of
phosphorylation, results in increased eNOS activity when stimulated with low levels of calcium
[172]. Furthermore, it has been demonstrated that adenoviral mediated over-expression of Akt in
rabbit femoral arteries resulted in increased resting diameter of the artery [176]. Moreover, the
HmG CoA reductase inhibitor simvastatin has been shown to activate Akt leading to increased
eNOS phosphorylation at Ser 1179 [177].
Thr 495/497
Phosphorylation of eNOS does not only result in activation of the enzyme, as evident by
the inhibitory effects of phosphorylation of Thr 495. The phosphorylation of Thr 495 is
mediated through the PKC pathway [178-181]. The site of Thr 495 phosphorylation is located
within the Ca2+/CaM binding domain, and it appears that this interferes with the binding of
Ca2+/CaM to eNOS [179, 180]. The basal level of Thr 495 phosphorylation is high in cultured
endothelial cells [179-181]. Various agonists of eNOS such as bradykinin, VEGF and calcium
ionophore have been shown to cause dephosphorylation of Thr 495 [180, 182, 183]. Also, it has
been suggested that in order for eNOS activation to occur Thr 495 dephosphorylation must
precede Ser 1179 phosphorylation [180-184].
Ser 633/635
Phosphorylation at the Ser 633 site also enhances the activity of eNOS. The
phosphorylation site is located within the CaM autoinhibitory sequence of eNOS contained
within the FMN binding domain [181]. There have been several studies to suggest that Protein
Kinase A [74] phosphorylates Ser 633 [181, 182, 185, 186]. The same agonists that lead to the
activation of NO via Ser 1177 phosphorylation also stimulate Ser 633 phosphorylation. The rate
![Page 37: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/37.jpg)
37
of phosphorylation of Ser 633 is much slower than that of Ser 1177 after agonist stimulation.
Additionally, phosphorylation of Ser 633 by PKA in endothelial cells can increase NO
production without requiring increased intracellular Ca2+ levels [186].
Ser 615/617
Ser 617 phosphorylation also occurs in the CaM autoinhibitory sequence of the CaM
binding domain, however there is controversy over its function [181]. Various eNOS agonists
similar to the ones that trigger enzyme Ser 633 and Ser 1179 phosphorylation also increase
phosphorylation at the Ser 617 site [175, 181, 182]. One study showed that mimicking the
phosphorylation of Ser 617 with a serine to aspartate mutation increases Ca2+/CaM sensitivity of
eNOS, but not the overall activity of the enzyme [181]. In contrast, another study demonstrated
that phosphorylation at Ser 615 does increase eNOS activity. However, it was observed in the
same study that the serine to alanine mutation mimicking dephosphorylation also increased
enzyme activity [175]. Moreover, the dephosphorylation of Ser 615, led to increased recruitment
of Hsp 90 and Akt both which are know to activate eNOS [175]. These observations suggest that
the role of Ser 615 phosphorylation is to facilitate eNOS interaction with other proteins and
regulate phosphorylation at other sites.
Ser 114/116
The final identified site of eNOS phosphorylation occurs at Ser 116 and it is the only
known phosphorylation site in the oxygenase domain of eNOS. Currently, its role in eNOS
activity much like Ser 615 phosphorylation is controversial. eNOS activation due to VEGF is
associated with Ser 116 dephosphorylation [187]. Laminar shear stress and HDL exposure on
the other hand have been reported to cause phosphorylation of Ser 116 leading to eNOS
activation [188, 189]. Reports on Ser 114 to alanine mutations mimicking dephosphorylation
also conflict, with one study showing increased activity and the other reporting no change in
![Page 38: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/38.jpg)
38
activity, but increased NO release [175, 187]. These conflicting results suggest that further
studies need to be done to elucidate the role of Ser114/116 phosphorylation
Overall the regulation of eNOS has developed into this complex story that involves
protein-protein interactions, substrate ability and protein posttranslational modifications. This
tight regulation is necessary to maintain vascular homeostasis. However, loss of this regulation
has been implicated in the pathology of many diseases that eventually lead to vascular
endothelial dysfunction, CAD, myocardial infractions, heart failure and even death.
Pathophysiology
As previously stated, eNOS and its product NO are important for maintaining vascular
homeostasis. Given its significance it is important that a healthy environment is maintained
within the endothelium. However, it is known that in a variety of conditions such as diabetes,
chronic smoking, hypertension, and hypercholesterolemia the endothelium environment loses its
anti-atherogenic, anti-proliferative, and anti-thrombotic properties. Vascular endothelial
dysfunction is the common link seen in the pathology of all of these diseases and it is the
underlying cause to the more serious vascular disease, atherosclerosis. The exact mechanism as
to how endothelial dysfunction is caused is not known. However, there is growing evidence that
oxidative stress which subsequently leads to the loss of NO plays a significant role. Although
oxidative stress can be caused by a variety of ROS generating enzymes, studies have implicated
NAPDH oxidase as the main source of ROS in vascular diseases. The increase in ROS
generated from NADPH oxidase has also been implicated in playing a role in NOS uncoupling
by causing the oxidation of the essential NOS cofactor H4B. The depletion of H4B results in
decreased NO bioavailability and increased eNOS derived superoxide. This loss of NO
bioavailability and the increase in superoxide production results in an endothelium that is no
longer able to maintain homeostasis. Moreover, this change in vascular homeostasis results in
![Page 39: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/39.jpg)
39
impaired vascular relaxation and increased vascular damage eventually leading to vascular
remolding, which are all characteristic signs of endothelial dysfunction.
Pathways Leading to Oxidative Stress Generation
NADPH Oxidase
The NADPH Oxidase (NOX) isoforms NOX-2 and NOX-4 are both found to be highly
expressed in the endothelial cell. NOX-2 requires the translocation of many regulatory subunits
to the cytosol to become active, those subunits include p22phox, p47phox, Rac, p67phox and
p40phox [190]. Upon assembly of the complex, electrons from NADPH are transferred to
molecular oxygen to form O2-.NOX-4 expression on the other hand is greater than NOX-2 in the
endothelial cell. It also appears that NOX-4 is a constitutively active enzyme [191].
Furthermore, it does not require any of the cytosolic subunits that are required for NOX-2
activation [192]. Though ROS can be generated from other superoxide generating enzymes,
NOX has emerged as the main culprit, because its activity can be stimulated by many of the
substrates involved in vascular endothelial dysfunction such as oxLDL, ANG II, and TNF alpha.
In the endothelial cell a key event leading to NOX-2 activation is the phosphorylation of
p47phox [193]. The phosphorylation of this subunit has been shown to occur in the response to
ANG II, TNF alpha and VEGF [193-195].
In arteries of atherosclerotic patients NOX-2 and NOX-4 expression is increased
particularly in the shoulder region of the plaque. The increased expression of these isoforms
may also contribute to plaque erosion [196]. Furthermore, there is evidence to support that there
is a local increase in the renin angiotensin system in the tissue periphery associated with
hypercholesterolemia, as increased concentrations of Ang II are also observed the shoulder
region of plaques [197, 198]. Moreover, the expression of the angiotensin type I receptor is
increased in the platelets of hypercholesterolemic patients [199].
![Page 40: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/40.jpg)
40
In addition to being a producer of O2.-, NOX derived O2
.- can also quench eNOS derived
NO, resulting in the formation of OONO-. OONO- can subsequently oxidize lipoproteins in the
vasculature, which become trapped in the endothelium, leading to endothelial activation. This
activation causes an increase in expression of atherogenic proteins such as VCAM-1, P and E
selectin, and chemoattactants thus continuing the cycle of vascular injury and repair resulting in
atherosclerosis [200]. Additionally OONO- has been demonstrated to cause eNOS uncoupling
by directly oxidizing the NOS cofactor H4B [201].
eNOS Uncoupling
eNOS uncoupling was first shown to occur by two independent groups using purified
eNOS. Both groups demonstrated that eNOS depleted of H4B could catalyze O2- formation
primarily from the oxygenase domain [50, 51]. Furthermore, the first evidence of eNOS
uncoupling in-vivo was generated with the desoxycorticosterone acetate (DOCA) salt induced
model of hypertension demonstrating that vascular superoxide production was increased ,which
could be attenuated by the NOS inhibitor L-NAME [202]. Besides hypertension there is
evidence to support a role for eNOS uncoupling to occur in the pathology of diabetes, and
hypercholesterolemia.
Studies carried out in endothelial cells derived from diabetic mice provided early evidence
for altered H4B metabolism and NO production in diabetes. Despite having normal eNOS
protein levels, cells derived from the diabetic mice had decreased NO production and H4B levels.
Moreover, supplementation with the H4B precursor was able to reverse these effects [203].
Additional studies carried out in human aortic endothelial cells (HAECs) demonstrated that
following 48 hours of exposure to high glucose media, eNOS expression was increased while
H4B levels were decreased and eNOS derived O2.- was increased. Adenoviral mediated over-
expression of GTPCH I was able restore NO and H4B levels and suppress O2.- generation [121].
![Page 41: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/41.jpg)
41
In vivo studies have also provided further evidence that diabetes can result in altered H4B levels
and increased O2.- generation. In this regard, endothelium specific GTCPH transgenic mice
have been generated. These mice have been observed to have increased H4B levels in vascular
tissue [49]. To evaluate the effect of H4B bioavailability, diabetes was induced using the
streptoztocin experimental model. The vasculature of both control and diabetic mice exhibited
increased oxidative stress. While H4B levels were undetectable in control diabetic mice, the
GTPCH tg diabetic mice maintained modest H4B levels. Moreover, these mice exhibited
decreased eNOS dependent O2.- generation in the vascular endothelium and increased
endothelium dependent vasorelaxtion in response to acetylcholine (Ach) [204]. Finally in
patients with Type II diabetes, H4B infusion has been shown to reverse vascular endothelial
dysfunction via a NO-dependent mechanism [205]. In addition to being observed in both in-vivo
and in-vitro models of diabetes, several studies have also demonstrated that eNOS uncoupling
occurs in atherosclerosis.
The pathology of hypercholesterolemia is associated with impaired vascular function,
atherosclerosis, decreased H4B bioavailability and increased O2.- generation. In this regard, the
hypercholesterolaemic ApoE KO mice exhibit impaired vascular relaxation and increased
vascular superoxide production. Both of which can be attenuated by oral H4B supplementation
[53]. Furthermore, when ApoE KO mice are crossed with GTPCHtg mice, these mice were
observed to have a improved vascular relaxation response to Ach. Additionally these mice had
increased H4B levels and decreased O2.- generation in the vascular endothelium [206].
Moreover, when eNOS tg mice are crossed with ApoE KO mice, the progression of
atherosclerosis is accelerated and these mice also have increased O2.- generation, which is
improved following H4B supplementation [207]. In addition to the animal studies,
![Page 42: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/42.jpg)
42
administration of H4B in patients with hypercholesterolemia has been shown to improve vascular
endothelial dysfunction [103].
The ratio between H4B and H2B is another important trigger for eNOS uncoupling.
Recently, it has been demonstrated that H4B and H2B can bind eNOS with equal affinity.
Additionally, intracellular levels of H2B increased 40% after 48 hours of high glucose treatment
and this was associated with reduced NO activation and increased eNOS dependent O2-
production. [208]. Over all these studies suggest that it is not only important to maintain the
levels of H4B, but the ratio of H4B/ H2B may also be important in maintaing NO production.
Over all the studies presented in the section demostrate that oxidative stress plays a
significant role in vascular endothelial dysfunction. However, increasing evidence also supports
the role for the endogenous NOS inhibitors the methylarginines ADMA and L-NMMA in the
pathophysiology of endothelial dysfunction.
DDAH ADMA Pathway
The endogenous NOS inhibitor AMDA has been demonstrated to be an independent
cardiovascular disease risk factor. However, the mechanisms regarding how ADMA levels are
modulated and what role they play in disease progression are not clearly understood. Therefore,
ADMA accumulation in response to decreased DDAH expression/activity has been proposed to
be involved in the vascular pathophysiology observed in a variety of cardiovascular disease. The
following section will describe the production and function of the methylarginines. Futhermore,
the signficance of the methylarginine metabolizing enzyme DDAH will be described. Finally,
this section will end with studies describing the pathophysiology associated with increased levels
of methylarginines and decreased DDAH activity.
![Page 43: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/43.jpg)
43
PRMT
The methylation of protein arginine residues is carried out by a group of enzymes referred
to as protein-arginine methyl transferase’s (PRMT’s). To date, nine different isoforms of the
enzyme have been identified with each subtype exhibiting various levels of activity, substrate
specificity and tissue distribution. During PRMT catalysis S-adenosylmethionine serves as its
substrate (SAM) and is then subsequently converted to S-adenosylhomocysteine (SAH), which is
then enzymatically converted to homocysteine, which is either further metabolized, or
remethylated [5]. PRMT’s are separated into two classes depending on what type of
methylarginine they generate. In mammalian cells, these enzymes have been classified into type
I (PRMT1, 3, 4, 6, and 8) and type II (PRMT5, 7, and FBXO11) enzymes, depending on their
specific catalytic activity. Both types of PRMT, however, catalyze the formation of mono-
methylarginine (MMA) from L-Arg. In a second step, type I PRMT’s produce asymmetric
dimethylarginine (ADMA), while type II PRMT catalyzes symmetric dimethylarginine (SDMA)
[209]. Arginine methylation by both type of PRMT’s enzyme occurs mostly in the arginine-
glycine rich sequences of proteins [210, 211]. PRMT 1 is a member of the type I class of
PRMT’s and it specifically catalyzes the formation of L-NMMA and ADMA [212].The PRMT 1
enzyme is mostly expressed in the heart and testis [213]. Intracellularly, PRMT 1 is expressed
predominantly in the nucleus with partial expression in the cytoplasm [214]. During
development the expression of PRMT1 is essential, as PRMT1 KO mice have been observed to
be embryonically lethal [215]. Until recently protein arginine methylation was thought to be
irreversible. Recently, the Jumonji domain-containing protein 6 (JMJD6) has been identified as
a histone arginine demethylase, whether or not this has implications for intracellular protein
arginine methylation is unknown [216]. The relationship between PRMT1 activity, expression
and ADMA synthesis has been demonstrated in several studies. Specifically, it has been
![Page 44: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/44.jpg)
44
observed in HAEC’s following 24 hour incubation with either LDL or OxLDL within the
pathological range of 200-300 mg/dl that PRMT 1 mRNA expression increases 1.5-2.5 fold.
Furthermore, ADMA released into the media increased 2 fold following the 24 hour incubation
period. The increase in ADMA could be attenuated in the presence of the PRMT inhibitor SAH
[217]. In human umbilical vein endothelial cells (HUVECs) exposure to shear stress has been
demonstrated to increase gene expression of PRMT-1. Furthermore, low levels of shear stress
(5-15 dynes/cm2) increases ADMA release from HUVEC cells after 3-6 hours of exposure. In
contrast, high shear stress (25 dynes/cm2) does not result in increased release of ADMA. [218].
Methylarginine Biochemistry
The free methylarginines ADMA, L-NMMA, and SDMA are all transported through the y+
CAT transport system. However, only ADMA and L-NMMA competitively compete with L-
Arg for binding to eNOS, resulting in its inhibition. Inhibition of eNOS activity by the
methylarginines is reversible, but only under conditions in which excess L-Arg is added. In
support of the role of methylarginines in eNOS inhibition, several studies have reported that L-
Arg supplementation enhances endothelium dependent relaxation through increased NO
generation. However, considering that the intracellular concentrations of L-Arg is 50 times
higher than the Km for eNOS, increased NO generation would not be expected with L-Arg
supplementation; this phenomenon has been termed the “L-Arg paradox” [38]. Therefore, it is
hypothesized that L-Arg supplementation overcomes the endogenous inhibitory actions of
cellular methylarginines ADMA and NMMA [42]. However, whether or not these endogenous
methylarginines are present at concentrations sufficient to regulate eNOS is unclear. In this
regard, it has been reported that plasma levels of ADMA and L-NMMA are in the range of 0.5-
1µM in healthy individuals [219]. We have demostrated in studies from our lab that the basal
endothelial cells level of ADMA and L-NMMA were 3.6 µM and 2.9 µM respectively.
![Page 45: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/45.jpg)
45
Furthermore, our kinetic studies using purified eNOS demonstrated that the Ki for ADMA and L-
NMMA were 0.9µM and 1.1µM respectively [38]. Therefore, it is expected that under normal
physiological conditions that methylarginines would not have a significant affect on endothelial
NO production. In support of this, it has been demonstrated that at low concentrations of
methylarginines modest inhibition of NO production is observed. In isolated human blood
vessels, 1 µM of L-NMMA leads to inhibition of bradykinin induced vasodilatation by 20%
[220]. Simlar reports from a study using plasma from end stage renal paitents have shown that
plasma levels of ADMA of 2µM, can have a significant inhibitory effect on endothelial NO
production [221]. Additionally, in the circulation of the guinea-pig 10 µM ADMA was observed
to increase blood pressure by 15% [222]. Although, studies have demonstrated modest
inhibition of eNOS at physiological concentrations of methylarginines, there have been several
reports of increased methylarginine levels in various disease states including
hypercholesterolemia, diabetes and end stage renal disease.
In the disease state plasma methylarginine levels have been reported to increase 3 to 9 fold
[38]. It remains unclear whether or not increases in methylarginine levels will result in
significant inhibition of endothelial NO production. Recently, we have addressed this question
in cellular studies in an effort to determine the dose dependent effects of the methylarginines on
endothelial NO production. Previous studies suggest that compartmentalization of eNOS or L-
Arg may occur in the endothelial cell, limiting the ability of L- Arg to overcome the inhibition of
methylarginines on eNOS activity. Therefore, cellular studies were carried out in order to
determine the effective concentration of cellular methylarginines necessary to cause eNOS
inhibition in BAECs. Our results demonstrated that ADMA dose dependently inhibited eNOS
derived NO generation as 5 µM and 100 µM ADMA elicited a 38% and 74% inhibition,
![Page 46: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/46.jpg)
46
respectively. Similar results were obtained with L-NMMA, as 42% and 81% inhibition was seen
with 5 µM and 100 µM L-NMMA respectively. In the presence of L-Arg these effects were less
prominent. ADMA dose dependently inhibited eNOS derived NO 24% at 10µM ADMA and
52% at 100 µM. Similar results were obtained for L-NMMA with 17% inhibition observed at 10
µM L-NMMA and 63% at 100 µM. These results were surprising to us because based on kinetic
studies we did not expect to see such robust inhibition of endothelial NO production. This led us
to speculate that endothelial cells are able to concentrate methylarginines. Therefore, cellular
uptake studies were preformed. Our results demonstrated that in the absence of physiological
levels of L-Arg, 10 µM of exogenous ADMA resulted in intracellular ADMA concentration of
68.4 µM. When this same experiment was repeated in the presence of L-Arg (100 µM), 10 µM
ADMA resulted in a markedly lower intracellular ADMA concentration of 23.5 µM [38].
Additional studies were also performed with L-NMMA. Intracellular concentrations of L-
NMMA sometimes reach as much as 7 times higher than outside the cell. Moreover, L-NMMA
(10 µM) uptake was only inhibited by 65% in the presence of L-Arg (100 µM). As previously
mentioned the methylarginines along with L-Arg are all transported through the y+ transporter.
Therefore our results would indicate that even in the presence of L-Arg, elevated plasma levels
of methylarginines would result in increased uptake through the y+transporter resulting in even
higher intracellular levels. Moreover, this increased uptake through the y+ transporter represents
a novel mechanism by which methylarginines can modulate eNOS activity and endothelial NO
production.
Overall our studies suggest that under pathological conditions such as
hypercholesterolemia, and diabetes where methylarginine levels are increased, methylarginines
can modulate eNOS activity. Because NO is known to possess anti-proliferative and anti-
![Page 47: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/47.jpg)
47
atherogenic properties, methylarginine accumulation could play a significant role in development
of atherosclerosis.
Metabolism of Methylarginines
Initially it was believed that after proteolysis, free methylated arginine residues were
released and excreted through the kidney [223]. On the contrary, subsequent studies into
methylarginine metabolism in rabbits demonstrated that the urinary excretion of SDMA was 30
times greater than ADMA and L-NMMA excretion. This led to the assumption that ADMA and
L-NMMA were being metabolized through alternate pathways [224]. These early studies led to
further investigations into the metabolic fate of C14 labeled ADMA and SDMA. Sasaoka et al.
demonstrated that while both dimethylarginines could be metabolized by the Dimethylarginine:
pyruvate Aminotransferase pathway, there existed a specific pathway for ADMA metabolism. In
support of this they found that the radioactivity that remained in the tissue of rats injected with
14C ADMA consisted mainly of citrulline, in complete contrast to rats injected with 14C SDMA
[225].
After the identification of this alternative pathway, DDAH was identified as the
metabolizing enzyme of ADMA and was purified from the rat kidney [226]. It was
demonstrated that DDAH specifically hydrolyzed ADMA and L-NMMA to citrulline, and mono
and dimethylamine. Until recently, DDAH enzyme activity studies have only been performed on
bacterial sources and tissue homogenates from either rat kidney or porcine brain. Those studies
reported that DDAH hydrolyzes ADMA at a faster rate than L-NNMA with reported Km values
of 0.18 and 0.36 mM respectively and that it is responsible for >90% of ADMA metabolism
[224, 225, 227]. We have recently purified the human isoform of DDAH-1 (hDDAH-1) and in
contrast to previous studies we observed that hDDAH-1 hydrolyzes ADMA and L-NNMA at
similar rates 68.7 µM and 53.6 µM respectively [228]. Furthermore, we observed that hDDAH-
![Page 48: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/48.jpg)
48
1 is maximally active at pH 8.5, contrasting earlier reports that enzyme maximum activity at pH
5.2 to 6.5 [225, 229]. DDAH-1 contains a Zinc (II) binding site, with endogenous bound
Zinc(II) inhibiting its catalytic activity [230]. Birdsey et al. and Murray-Rust et al. were the first
to demonstrate that ADMA and not SDMA could be metabolized intracellularly [231, 232].
Additional studies by Murray-Rust et al, demonstrated that steric hindrance caused by the methyl
groups on both nitrogens of SDMA prevents its binding to the active site of DDAH, therefore it
is unable to hydrolyze it [232].
In observance that DDAH expression did not correlate to activity, Leiper et al. discovered
a second isoform of DDAH, DDAH-2. DDAH-2 has a 63% homology to hDDAH-1. Currently
there are no studies on the enzymatic activity of human DDAH-2, as the only study that has been
done uses recombinant bacterial lysates that express DDAH-2. Enzyme activity from bacterial
lysates demonstrated that DDAH-2 hydrolyzed L-NMMA at the comparable rates to reported
DDAH-1 in bacterial lysates [36].
DDAH-1 and 2 are predominantly located in the cytoplasm, DDAH-1 has also been found
in membrane fractions of endothelial cell lysates [231]. DDAH-1 is predominately expressed in
the liver and kidney which are major sites of ADMA metabolism [233, 234]. It is also expressed
strongly in the aorta and equally in adult and fetal tissues [235, 236]. DDAH-2 expression is
predominant in fetal tissues. However, expression decreases and becomes more tissue specific in
adults with DDAH-2 expression predominately in the vascular endothelium, kidney, heart, and
placenta [36]. DDAH-1 while it is also expressed in the endothelium, studies of mesenteric
resistance arteries demonstrate that DDAH-2 mRNA expression is 5.1 fold greater than that of
DDAH-1 suggesting an important role for DDAH-2 in the resistance vessels [237].
![Page 49: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/49.jpg)
49
In Vivo and In Vitro Significance of DDAH
The first functional studies of DDAH-1 were done using the inhibitor S-2-amino-4 (3-
methylguanidino) butanoic acid (4124W). Treatment with 4124W in cultured human endothelial
cells led to accumulation of ADMA in the supernatant thus demonstrating that the role of
DDAH-1 was to prevent the accumulation of ADMA. Ex-vivo studies using rat aortic rings
demonstrated that inhibition of DDAH-1 by 4124W caused vasoconstriction. However, this
effect was reversed in the presence of L-Arg. Additional studies done on human saphenous
veins demonstrated that inhibition of DDAH-1, led to the loss of the bradykinin mediated
relaxation response [238]. These studies were among the first to demonstrate that DDAH could
be important in the regulation of endothelial NOS activity and vascular function. Recently, the
in-vivo significance of DDAH-1 has been described by two independent groups using both
transgenic and knockout mice [239, 240].
Dayoub et al. described the effects of DDAH -1 over-expression in-vitro and in-vivo, with
the creation of DDAH-1 transgenic mouse model. Cellular studies performed in human
microvascular endothelial cells and murine endothelial cells demonstrated that over-expression
of DDAH-1 yields a 2-fold increase in NO activity and Nitrogen Oxides (NOX) released into the
culture media. The in-vivo studies demonstrate that DDAH-1 tg mice have increased NOS
activity in the heart and skeletal muscle however, no change was seen in the aorta. DDAH-1 tg
mice also have decreased mean arterial blood pressure (MAP). The systemic vascular resistance
(SVR) and cardiac contractility are also decreased in response to an increase in NO production.
Furthermore, it was observed in DDAH-1 tg mice, that urinary excretion of NOX was increased 2
fold, and this corresponded to a 2-fold drop in plasma ADMA levels [239]. Additional studies
done by Jacobi et al. demonstrated that DDAH-1 tg mice exhibit enhanced angioadapatation in
response to hind limb ischemia [241]. Subsequent studies by Tanaka and Sydow et al.,
![Page 50: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/50.jpg)
50
demonstrated in a cardiac transplantation model that DDAH-1 tg mice exhibit suppressed
immune responses as result of increased cardiac NO generation and decreased superoxide
production. Also, these mice exhibited less graft coronary artery disease, and improved function
of the allograft [242].
In more recent studies, Lieper et al have demonstrated the in-vivo effects of DDAH-1 gene
deletion in mice. The first significant finding of this study was that homozygous deletion of the
DDAH-1 gene was embryonically lethal. Demonstrating that DDAH-1 is essential to normal
embryonic development. Therefore, subsequent studies where performed with DDAH 1+/- mice.
The DDAH-1 +/- mice exhibit increased plasma levels of ADMA, indicative of DDAH’s role in
regulating ADMA levels. DDAH-2 expression was not altered by the drop in DDAH-1
expression. Tissue DDAH activity in the kidney, lung, and liver was decreased by
approximately 50% suggesting that DDAH-2 is not the principle methylarginine metabolizing
enzyme in these tissues. Additionally, it was observed that these mice exhibited impaired
vascular relaxation in response to Ach treatment. Moreover, hemodynamic studies reveal that
mean arterial blood pressure (MAP), systemic vascular resistance (SVR) and right ventricular
pressure are all increased in the DDAH 1 +/- mice [240].
Hasegawa et al recently created a transgenic mouse over-expressing the DDAH-2 gene.
They have reported that DDAH-2 tg mice have reduced plasma ADMA levels and an elevation
in cardiac NO levels. However, in contrast to DDAH-1 mice, there was no change in systemic
blood pressure. The difference seen in two models is likely to be due to the fact that plasma
ADMA levels are vastly different in these two mice. In the DDAH-1tg ADMA plasma levels
decreased by 60%, whereas DDAH-2 tg mice plasma ADMA levels were only reduced by 26%.
This further provides evidence that DDAH-1 is the principle methylarginine metabolizing
![Page 51: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/51.jpg)
51
enzyme. The expression of DDAH-2 was significantly increased in the heart, skeletal muscle
and brown adipose tissue. They also reported that DDAH-2 over-expression did not alter the
expression of DDAH-1. Furthermore, ADMA induced vascular lesions were attenuated in the
DDAH-2tg mice, which they attributed to decrease in angiotensin converting enzyme expression
[243]. ANG II infusion over a two week period induced increased medial thickening and
perivascular fibrosis in coronary microvessels of WT mice, however this response was
attenuated in DDAH-2 tg mice [244].
Studies done by Wang et al. reported that in-vivo DDAH-2 gene silencing in rat mesenteric
arteries caused almost complete inhibition of the NO response to Ach in vascular reactivity
studies. They also reported DDAH-1 gene silencing increased ADMA, however it had no effect
on vascular relaxation in response to Ach [237]. As demonstrated in the previous study by
Hasegawa et al., this study provides more evidence that DDAH-1 is the predominate
metabolizing enzyme of ADMA. In addition, this study provides some evidence that DDAH-2
regulates endothelial NO production independent of ADMA, because ADMA levels did not rise
following DDAH-2 gene silencing.
ADMA Independent Mechanisms of DDAH
Wang et al. reported that DDAH-2 gene silencing in mesenteric resistance vessels lead to a
significant down-regulation of eNOS mRNA and protein expression [237]. Smith et al. observed
that DDAH-2 over-expression in HUVEC cells lead to a 2-fold increase in VEGF mRNA
expression [245]. Later it was reported by Hasegawa et al. that DDAH-2 over-expression in
BAECs increased transcriptional activation of VEGF, without increasing NO generation. In this
study they observed that DDAH-2 mediated its effects by directly binding PKA leading to the
phosphorylation of the transcription factor specificity protein 1 (Sp1). Sp1 translocates to the
nucleus and binds the promoter region of VEGF activating its transcription. They also
![Page 52: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/52.jpg)
52
demonstrated that the DDAH-2 effect on VEGF transcription is blocked by gene silencing of Sp1
[246]. Tokuo et al. reported that DDAH-1 in a similar fashion, binds to nuerofibromin 1 (NF-1)
in a region coinciding specific sites of PKA phosphorylation. DDAH-1 binding to NF-1
increases NF-1 phosphorylation by PKA. Overall these studies demonstrate that DDAH can
mediate its effects independent of ADMA [247].
Regulation of DDAH Activity
Given the importance that DDAH plays in maintaining NO levels in the vascular
endothelium, extensive research efforts have been undertaken to study its regulation. Leiper et
al. were the first to report that NO could inactivate DDAH-1 by SNO of a cysteine (Cys) residue.
Cys 249 is located with in the active site of the DDAH-1 enzyme. It was observed in this study
using recombinant bacterial protein expressing DDAH-1 that SNO occurs at the Cys 249 residue,
rendering the enzyme inactive [88]. Additional studies done using mouse endothelial cells over-
expressing DDAH-2 demonstrated that cytokine mediated induction of iNOS resulted in the
SNO of DDAH-2 [88]. Thus, under conditions of enhanced immune response which leads to
iNOS induction, inhibiting DDAH activity would be beneficial; because of the accumulation of
ADMA which would be expected to inhibit iNOS derived NO. Knipp et al. observed that
DDAH-1 in its native form, Zn (II) bound, is resistant to SNO and it is the zinc depleted form
that is susceptible to [248]. It has also been suggested that DDAH activity maybe sensitive to
oxidative stress. However, studies from our lab and others have shown that DDAH is largely
resistance to oxidative species at pathophysiological levels [228, 249].
Studies by Scalera et al. demonstrated that the anti-hypertensive drug, Telmisartan, can
positively regulate DDAH. Although Telmisartin is known to function as an ANG II type 1
receptor blocker, it has also been found to activate PPAR y. PPAR y signaling is associated with
increased NO formation. In this study they observed that in the presence of Telmisartin, DDAH
![Page 53: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/53.jpg)
53
activity increased and DDAH-2 expression also increased. However, PPARy inactivation either
pharmacologically or by gene silencing mitigated the effects on DDAH activity and expression
[250]. Yin et al. reported that pravastatin a cholesterol lowering drug, restores DDAH activity
and endothelium relaxation in the rat aorta following exposure to glycated bovine serum albumin
(AGE-BSA) [251]. Achan et al. reported that all-trans-retinoic acid could transcriptionally
regulate DDAH II, increasing its mRNA expression in HUVECs [252]. Additional studies by
Jones et al. demonstrated that there are six single nucleotide polymorphisms(SNP) in the
promoter region of the DDAH-2 gene [253]. Furthermore, they observed that the 6G/7G
insertion/deletion SNP at position -871 in the promoter region of the DDAH-2 gene, resulted in
enhanced promoter activity [253]. Valkonen et al. observed in the Kuopio Ischemic Risk Factor
Study that 13 male patients were carriers of a of DDAH-1 gene varient that put them at 50 times
greater risk for cardiovascular disease [254].
Overall these studies suggest that ADMA and DDAH may play a role in endothelial
dysfunction. The next section will help to provide further evidence as to the excat role of ADMA
and DDAH in the disease state.
Pathophysiology
Clinical syndromes involving defective NO productions underscore the importance of
eNOS and NO in the maintenance of normal vascular function. Although it is well established
that NO is a critical effector molecule in the maintenance of vascular tone, NO also maintains the
non-atherogenic character of the normal vessel wall. Several studies have linked ADMA and L-
NMMA as key players in endothelial dysfunction.
Epidemiological studies have demonstrated a strong correlation between plasma ADMA
and incidence of cardiovascular disease. Initial studies by Boger et al. demonstrated that the
plasma ADMA levels of young hypercholesterolemic individuals were double that of
![Page 54: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/54.jpg)
54
normocholesterolemic patients [255]. The increase in ADMA in the hypercholesterolemic
patients resulted in impaired endothelium dependent response and reduced nitrate urinary
excretion. The effects on nitrate urinary excretion and vascular function, improved following L-
Arg supplementation [255]. Subsequent studies by Zoccali et al. were the first to establish
ADMA as an independent risk factor for cardiovascular disease in patients with chronic kidney
disease [256]. Lu et al. observed in patients following angioplasty that ADMA was the sole
predictor of future cardiovascular events [257]. Studies by Valkonen et al. demonstrated that in
healthy non smoking men, those in the highest quartile of ADMA plasma levels, had a 3.9 fold
increase in risk of acute coronary events [254]. Studies by Abbasi et al. reported that type II
diabetic patients, have increased ADMA plasma levels in comparison to healthy individuals.
Additional studies of obese woman found that women who are insulin resistant and obese have
higher plasma ADMA levels and that ADMA levels decreased following weight loss [258]. In
support of these epidemiological studies, in vitro and in vivo data has shown similar effects of
ADMA on endothelial function in several disease states.
Chan et al. demonstrated that blood monocytes from hypercholesterolemic individuals
adhered to human endothelial cells in culture greater than normocholesterolemic [259]. This
increase in adhesion of monocytes is one of the initial steps in the progression of endothelial
dysfunction and atherosclerosis. Furthermore, they observed that the adhesion was related to the
L-Arg/ADMA ratio. In support of this, monocytoid cells were co-cultured with BAECs exposed
to the corresponding L-Arg/ADMA ratios of the hypercholesterolemic patients. It was observed
that the adhesion of monocytoid cells increased in a dose dependent manner. Following the
initial adhesion studies patients were placed on 12-weeks of L-Arg supplementation which
resulted in the normalization of monocyte adhesion [259]. Studies by Azuma et al. demonstrated
![Page 55: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/55.jpg)
55
that ADMA and L-NMMA levels were increased in regenerated endothelial cells following
balloon angioplasty of the rabbit carotid artery. Furthermore, L-Arg levels were significantly
depleted in regenerated endothelial cells which resulted in increased neointima formation. The
accumulation of ADMA and L-NMMA in these regenerated cells led to decreased endothelium
dependent relaxation, which was attenuated with L-Arg supplementation [260]. Overall these
studies suggest that the L-Arg/ADMA ratio is an important predictor of endothelial dysfunction.
To add physiological relevance to our biochemistry studies discussed earlier, we wanted to
examine whether or not methylarginines inhibition on eNOS could modulate a physiological
response. Therefore changes in vascular reactivity in rat carotid rings under varying
concentrations of ADMA (1-500 µM) were observed. ADMA dose dependently inhibited the
Ach mediated relaxation response with a 52% reduction seen at 5 µM ADMA and a 95%
reduction at 500 µM, in the absence of L-Arg. In the presence of L-Arg 10 µM ADMA inhibited
the Ach mediated relaxation response by 7%, and an 84% reduction was seen at 500 µM.
Because our studies in vitro and ex vivo demonstrated that ADMA could inhibit eNOS, it was
unclear if this could occur in-vivo. Using the balloon model of carotid injury we observed that
intracellular methylarginine levels increased 4 fold and resulted in a 50% loss of vasculature
relaxation response. Overall these results demonstrated that intracellular methylarginine levels
are elevated in pathological conditions and that the levels reach high enough to inhibit
endothelial NOS activity and vascular function. In addition to increased plasma ADMA levels,
dysfunction of the DDAH enzyme and its ADMA independent effects on NO have become a
potential mechanism by which endothelial dysfunction can occur.
Ito et al. demonstrate in HUVEC cells that following 48 hours of exposure to either oxLDL
or TNFalpha the activity of DDAH decreased but expression remained unchanged [261].
![Page 56: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/56.jpg)
56
Furthermore, they observed in-vivo that New Zealand White rabbits fed on high-cholesterol diet
had significantly reduced aortic, renal, and hepatic DDAH activity [261]. These studies were the
first to demonstrate that DDAH activity could be modulated under pathological conditions.
In transplant patients there is an increased incidence of transplant atherosclerosis as a result
of the cytomegalovirus (CMV), which is known to promote atherogenesis [262].Weis et al.
demonstrated that human microvascular cells infected with CMV, resulted in increased ADMA
and decreased cellular DDAH activity [263]. Therefore, these studies demonstrate that CMV
infection contributes to endothelial dysfunction and transplant atherosclerosis that is observed in
heart transplant patients by modulating the DDAH-ADMA pathway.
Although previous studies using purfied human DDAH enzyme have demonstrated that
DDAH was largely resistant to reactive oxygen and nitrogen species, it may be the oxidatively
modified products of these reactions that influence DDAH activity [249]. 4-hyrdoxy-2-nonenal
(4-HNE) is a lipid hydroperoxide that is biologically active and known to accumulate in
membranes at concentrations 10 µM to 5 mM. Mounting evidence suggests that reactive
aldehydes such as 4-HNE play a role in the progression of atherosclerosis. We have
demonstrated using purified hDDAH-1 that 4-HNE inhibits DDAH activity by binding a
histidine residue in the catalytic triad of the enzyme [228]. Therefore, this may represent a novel
mechanism by which 4-HNE causes impairment of endothelial NO production, by directly
inhibiting DDAH activity. In contrast to our studies, Tain et al reported that DDAH activity was
signficaltny inhibited in the presence of NO and O2.- . The differences could be attributed using
either using purified recombinant enzyme, or species differences as their studies were done using
kidneys from rats [264]
![Page 57: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/57.jpg)
57
Recent evidence suggests that the DDAH-ADMA pathway may also play a significant role
in endothelial dysfunction associated with diabetes. Lin et al. demonstrated that in VSMC and
HUVECs cellular ADMA levels increased and DDAH activity decreased following 48 hours of
exposure to high glucose media. Furthermore, they observed in vivo that rats placed on a high
fat diet and injected with streptozotcin to induce type II diabetes, had elevated plasma ADMA
levels. Moreover, these diabetic rats had decreased tissue DDAH activity [265]. Sorrenti et al.
demonstrated that DDAH-2 expression and DDAH activity were decreased in human iliac artery
cells following five days of exposure to high glucose condition media [266].
Overall, these studies suggest that methylarginines are key in regulating eNOS in a disease
state. Based on cellular kinetic studies from our group, a 3-4 fold increase in cellular
methylarginines would be expected to inhibit NOS activity by greater than 50%.
It is evident that that NO bioavailability is key to maintaining the anti-atherogenic state of
the vascular wall. Furthermore, DDAH and ADMA have emerged as critical factors in diseases
associated with increased cardiovascular risk. It is also evident that oxidative stress also plays a
significant role in endothelial dysfunction observed in such dieases as hypertension and diabetes.
The observations provided in this dissertation could be of potential clinical importance as
CAD is the number cause of all deaths in the United States. Therefore, elucidating the
mechanism(s) of how eNOS is modulated by both methylarginines and oxidative stress may
provide knowledge for potential therapeutic targets in the treatment of athero-proliferative
disorders such as atherosclerosis. .
![Page 58: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/58.jpg)
58
CHAPTER 3 ROLE OF DDAH-1 AND DDAH-2 IN THE REGULATION OF ENDOTHELIAL NO
PRODUCTION
Introduction
Endothelium-derived Nitric Oxide (NO) is a potent vasodilator that plays a critical role in
maintaining vascular homeostasis through its anti-atherogenic and anti-proliferative effects on
the vascular wall. Altered NO biosynthesis has been implicated in the pathogenesis of
cardiovascular disease and evidence from animal models and clinical studies suggest that
accumulation of the endogenous nitric oxide synthase (NOS) inhibitors, asymmetric
dimethylarginine (ADMA) and NG-monomethyl arginine (L-NMMA) contribute to the reduced
NO generation and disease pathogenesis. ADMA and L-NMMA are derived from the
proteolysis of methylated arginine residues on various proteins. The methylation is carried out
by a group of enzymes referred to as protein-arginine methyl transferase’s (PRMT’s) [35].
Protein arginine methylation has been identified as an important post-translational modification
involved in the regulation of DNA transcription, protein function and cell signaling. Upon
proteolysis of methylated proteins, free methylarginines are released which can then metabolized
to citrulline through the activity of Dimethylarginine Dimethylamino Hydrolase (DDAH).
Currently there are two known isoforms of DDAH each having different tissue specificity.
DDAH-1 is thought to be associated with tissues that express high levels of Neuronal Nitric
Oxide (nNOS), while DDAH-2 is thought be associated with tissues that express eNOS.
Decreased DDAH expression/activity is evident in disease states associated with endothelial
dysfunction and is believed to be the mechanism responsible for increased methylarginines and
subsequent ADMA mediated eNOS impairment. However, the contribution of each enzyme to
the regulation of endothelial NO production has yet to be elucidated.
![Page 59: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/59.jpg)
59
The strongest evidence for DDAH involvement in endothelial dysfunction has come from
studies using DDAH gene silencing techniques and DDAH transgenic mice. Specifically, Cooke
et.al. has demonstrated that DDAH-1 transgenic mice are protected against cardiac transplant
vasculopathy [241, 242]. Using in-vivo siRNA techniques, Wang et.al. demonstrated that
DDAH-1 gene silencing increased plasma levels of ADMA by 50%, but this increase had no
effect on endothelial dependent relaxation. Conversely, in-vivo DDAH2 gene silencing had no
effect on plasma ADMA, but reduced endothelial dependent relaxation by 40% [237]. These
latter findings are particularly intriguing and demonstrate that elevated plasma ADMA is not
associated with impaired endothelial dependent relaxation while loss of DDAH-2 activity is
associated with impaired endothelial dependent relaxation, despite the fact the plasma ADMA
levels are not increased [237]. Given the obvious inconsistencies in the literature regarding the
individual roles of DDAH-1 and DDAH-2, the current study establishes the specific role of each
DDAH isoform in the regulation of endothelial NO production and its potential role in disease
pathogenesis.
Materials and Methods
Cell Culture
Bovine aortic endothelial cells (BAECs) were purchased from Cell-Systems and cultured
in MEM (Sigma, St Louis,MO) containing 10% FBS, 1% NEAA, 0.2% Endothelial Cell Growth
Factor Supplement (ECGS) and 1% Antibotic-Antimyotic (Gibco,Carsbad,CA)and incubated at
37° 5% CO2 -95% O2 .
EPR Spectroscopy and Spin Trapping
Spin-trapping measurements of NO were performed using a Bruker Escan spectrometer
with FE-MGD as the spin trap (22,38). For Measurements of NO produced by BAECs, cells
were cultured as described above and spin trapping experiments were performed on cells grown
![Page 60: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/60.jpg)
60
in 6 well plates. Attached cells were studied since scraping or enzymatic removal leads to injury
and membrane damage with impaired NO generation. The media from approximately 1x106cells
attached to the surface of the 6 well plates was removed and the cells were washed 3 x in
KREBS and incubated at 37° C 5% CO2 in 0.2 ml of KRBES buffer containing the spin trap
complex FE-MGD (0.5 mM Fe2+, 5.0 mM) was added and the cells stimulated with calcium
ionophore (1 uM). Subsequent measurements of NO production were performed following a 30
min incubation period. Spectra recorded from cellular preparations were obtained using the
following parameters: microwave power; 20 mW, modulation amplitude 3.00 G and modulation
frequency; 86 kHZ.
HPLC
BAEC’s were collected from confluent 75 mm culture flask and sonicated in PBS followed
by extraction using a cation exchange column. Samples were derivatized with OPA and
separated on a Supelco LC-DABS column (4.6 mm x 25 cm i.d., 5 µm particle size) and
methylarginines were separated and detected using an ESA (Chelmsford, MA) HPLC system
with electrochemical detection at 400mV. Homoarginine was added to the homogenate as an
internal standard to correct for the efficiency of extraction. The mobile phase consisted of buffer
A (50 mM KH2PO4 pH 7.0) and buffer B (ACN/MeOH 70:30) run at room temperature with a
flow rate of 1.3 mL/min. The following gradient method was used 0-10 min 90% A 10-40 min a
linear gradient from 90% A to 30% A (22,39).
DDAH-1 and 2 Gene Silencing
21-bp siRNA nucleotide sequences targeting the coding sequences for DDAH-1 (accession
no. NM_001102201) and DDAH-2 (accession no. NM_001034704) were purchased from
Ambion. Control cells received GAPDH siRNA also purchased from Invitrogen. 400 μl of
nuclease free water was added to the dried oligonucleotides to obtain a final concentration of 100
![Page 61: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/61.jpg)
61
μM. Transfections were done using the lipid mediated transfection reagent RNAiMax
(Invitrogen). The procedure was as follows, 240 nM or 5 ul of siRNA per well of a six well plate
was diluted into 250 μl of Opti MEM (Invitrogen) and 5 ul of RNAiMax was diluted in 250 μl of
Opti MEM. The siRNA and RNAiMax were then combined into one Eppendorff tube and then
incubated at room temperature for 20 minutes. Following the 20 minute incubation period, the
RNAi MAX-siRNA complexes were added to each well of a six well plate. The mixture was
rocked back and forth to allow for coating of the entire well. BAECs were trypsinized and spun
down at 1000 x g for 4 minutes and then resuspended in 1.5 mls of Opti MEM + 10% MEM
medium containing 10% FBS, 1% NEAA, 0.2% Endothelial Cell Growth Factor. The cells were
then added on top of the RNAiMAX-siRNA complexes and incubated at 37° 5% CO2 -95% O2
for 6 hours. After the 6 hour incubation period, 1ml of MEM medium containing 10% FBS, 1%
NEAA, 0.2% Endothelial Cell Growth Factor was added. 24 hours later 1ml of MEM medium
containing 10% FBS, 1% NEAA, 0.2% Endothelial Cell Growth Factor was added. At 48 hours
2 ml of medium was removed and replaced with fresh MEM medium containing 10% FBS, 1%
NEAA, 0.2% Endothelial Cell Growth Factor and the transfection was continued for another 24
hours.
DDAH Activity
DDAH activity was measured from the conversion of L-[3H]L-NMMA to L-[3H]citrulline.
A T-75 flask was used for each measurement, BAECs were trypsinized, pelleted and
resuspended in 150 μL of 50mM Tris (pH 7.4). The cells were then sonicated 3 x 2 seconds and
150 μL of reaction buffer (50 mM Tris, 20 μM L-[3 H]L-NMMA, 180 μM L-NMMA, pH 7.4)
was added. The samples were then incubated in a water bath at 37°C for 90 minutes. Following
the 90 minute incubation, the reaction was stopped with 1 ml of ice-cold stop buffer using 20
![Page 62: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/62.jpg)
62
mM N-2 Hydroxyethylpiperazine-N’-2 ethanesulfonic acid (HEPES) with 2 mM EDTA, pH 5.5
(15) Separation of L-[14C]citrulline from L-[3 H]L-NMMA was performed using the cation
exchange resin Dowex AG50WX-8 (0.5 ml, Na+ form, Pharmacia). The L-[14C]citrulline in the
eluent was then quantitated using a liquid scintillation counter.
DDAH Over-Expression
Following the 48 hours of adDDAH-1 or adDDAH-2 transduction, cells were trypsinized
and spun down at 1000 x g for 4 minutes. The cell pellet was then washed 1x with PBS and then
centrifuged at 1000 x g for an additional 4 minutes. The cell pellet was then homogenized using
RIPA buffer containing sodium orthovanadate (2 mM), phenylmethylsulphonyl fluoride (1 mM),
and protease inhibitor cocktail (Santa Cruz biotechnology). Following homogenization the cell
pellet was briefly sonicated 2 x 2 sec. Protein concentration was quantified using the Bradford
assay. 1x sample buffer containing DTT was added to 40 μg of protein and boiled at 95° for 3
minutes and then spun down briefly and cooled for 2 minutes. The samples were then loaded on
to a SDS Tris -Glycine gradient gel 4-12% (Invitrogen) and run at 130V for 2 hours. The gel
was then removed and the protein was transferred on to a nitrocellulose membrane using the
semi dry transfer blot system (BioRad). Following the transfer, the nitrocellulose membrane was
blocked for 1 hour in Tris Buffer Saline and 0.05% Tween (TBST) with 5% milk powder. After
the blocking period was over the membrane was washed 3x for 5 minutes with TBST and then
the respective primary antibody was added and incubated over night at 4°C. DDAH was
detected by anti-DDAH-1 and DDAH-2 rabbit IgG obtained from Dr. Renke Mass (Hamburg,
Germany) and diluted 1:1000. Following the overnight incubation with the primary antibody the
membrane was washed for 15 minutes 3x with TBST and the secondary goat-anti rabbit hrp tag
antibody diluted 1:2000 was added. After 1 hour of incubation at room temperature, detection
![Page 63: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/63.jpg)
63
was preformed using an enhanced chemiluminescence kit purchased from Amersham
Biosciences.
Assessment of mRNA Levels Following DDAH Gene Silencing
Following the 72 hour siRNA transduction period, BAECs were trypsinized and spun
down at 1000 x g for 4 minutes. The cell pellet was then wash 1 x with PBS and centrifuged at
1000 x g for an additional 4 minutes. The cell pellet was then homogenized in lysis buffer from
the Qiagen (Valencia,CA) RNAeasy Mini Kit. Following lysis, RNA was extracted using a
Qiagen (Valencia,CA) RNAeasy Mini Kit. cDNA was then isolated using the Invitrogen
(Carsbad,CA) One Step RT-PCR kit. Semiquantive PCR was preformed in order to detect
changes in mRNA expression following DDAH-1 or DDAH-2 gene silencing. Bovine Primers
for DDAH-1 Forward (GAGGAAGGAGGCTGACATGA), DDAH-1 Reverse
(TTCAAGTGCAAAGCATCCAC), and DDAH-2 Forward
(CTAGCCAAAGCTCAGAGGGACAT), DDAH-2 Reverse
(TCAGTCAACACTGCCATTGCCCT) were purchased from Invitrogen (Carsbad, CA).
eNOS Activity
eNOS activity was measured from the conversion of L-[14C] arginine to L-[14C]citrulline.
A T-75 flask was used for each measurement, BAECs were trypsinized, pelleted and
resuspended in 132 μL of 50 mM Tris (pH 7.4). The cells were then sonicated 3 x 2 seconds and
28 μL of reaction buffer (50 mM Tris containing 5 μM L-[14 C] arginine, 50 μM L-arginine 500
µM NADPH/50 µM CaCl2/50 µM H4B pH 7.4) The samples were then incubated in a water bath
at 37°C for 30 minutes. Following the 30 minute incubation the reaction was stopped with 1ml
of ice-cold stop buffer using 20 mM N 2-Hydroxyethlypiperazine-N’-2 ethansulfonic acid
(HEPES) with 2mM EDTA, pH 5.5. Separation of L- [14 C] arginine from to L-[14C]citrulline
![Page 64: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/64.jpg)
64
was performed using the cation exchange resin Dowex AG50WX-8 (0.5ml Na+ form,
Pharmacia). The L- [14C] citrulline in the eluent was then quantitated using a liquid scintillation
counter
Results
Effects of DDAH 1 and 2 Over- Expression on Endothelial NO Production
Previous studies have demonstrated that both DDAH-1 and DDAH-2 are expressed in the
vasculature. However, it is presently unknown which of the DDAH isoforms is responsible for
the regulation of endothelial NO. Therefore, studies were carried out using adenoviral mediated
over-expression of both DDAH-1 and DDAH-2 in order to determine which isoform is
responsible for endothelial methylarginine metabolism and NO regulation. Endothelial cells
were grown to 90% confluency and then transduced with either ad-DDAH-1 (50 MOI) or ad-
DDAH-2 (50 MOI) for 48 hours. Western blot analysis demonstrated robust increases in
endothelial expression of both DDAH-1 and DDAH-2 following respective adenoviral treatment
(Figure 3-1) At the end of the 48 hour period NO production was measured by EPR as
previously described. Results demonstrated that following 48 hours of transduction, adDDAH-1
mediated over-expression resulted in a 24% increase in NO production over basal NO levels
(Figure 3-2). It was anticipated that if DDAH over-expression is increasing NO through the
metabolism of basal methylarginines, then L-arg supplementation should prevent the increase.
Endothelial cells were transduced with adDDAH-1 for 48 hours as previously described. After
the 48 hour exposure the media was removed and BAECs were incubated with L-Arg (100 µm)
for 30 minutes in KREBS-HEPES buffer. Results demonstrated that L-Arg supplementation
alone resulted in a 30% increase in basal NO production in control cells (Figure 3-2). Moreover,
in the presence of DDAH-1 over-expression, L-arginine supplementation resulted in an additive
effect with a 13% increase in NO compared to L-arg supplementation alone.
![Page 65: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/65.jpg)
65
Similar to adDDAH-1, DDAH-2 over-expression resulted in an 18% increase in
endothelial cell NO production (Figure 3-3). Similar results were obtained with L-arginine
supplementation of DDAH-2 over-expressing cells in which we observed a 45% increase NO
production following the addition of L-arg compared to a 28% increase with L-arg
supplementation alone (Figure 3-3). The observation that the effects of L-arg supplementation
on NO production are not attenuated in the presence of DDAH-1 or DDAH-2 over-expression
possibly demonstrates that ADMA is not responsible for the “arginine paradox” as has been
proposed.
Effects of DDAH-1 and DDAH-2 Over-Expression on ADMA Inhibition
The previous studies assessed the effects of DDAH over-expression on NO production in
the presence of normal physiological levels of methylarginine. Given that normal intracellular
methylarginines are in the low micromolar range it would not be expected that physiological
levels of these competitive NOS inhibitors would elicit pathological eNOS inhibition.
Therefore, additional studies were performed in the presence of exogenously added ADMA to
assess whether DDAH over-expression can overcome ADMA accumulation at levels observed
with cardiovascular disease states [96]. Results demonstrated that exogenously added ADMA
(10 µM) resulted in 40% inhibition of endothelial cell NO production from BAECs and that
over-expression of either DDAH-1 or DDAH-2 was able to restore 50% of the loss in endothelial
NO production (Figure 3-4). These results indicate that both DDAH-1 and DDAH-2 may serve
as potential therapeutic targets for the treatment of diseases associated with elevated ADMA.
Effects of DDAH 1 and 2 Silencing on Endothelial NO Production
Previous studies have suggested that a decrease in DDAH activity, as has been observed in
vascular disease, contributes to endothelial dysfunction through a mechanism involving
increased cellular ADMA levels. In support, ADMA levels are an independent risk factor for
![Page 66: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/66.jpg)
66
cardiovascular disease and results from numerous clinical and basic science studies have
revealed increased ADMA levels in a variety of diseases including diabetes, pulmonary
hypertension, coronary artery disease and atherosclerosis [240, 241, 249, 265, 267-269].
However, whether loss of DDAH activity is directly responsible for the impaired NO production
and which specific isoform is responsible for NO regulation in the endothelium are unknown.
Therefore, in order to determine the role of each DDAH isoform in the regulation of endothelial
NO, cellular studies were performed using BAECs to asses the effects of DDAH-1 and 2 gene
silencing on NO production. Bovine aortic endothelial cells were cultured in 6 well plates and
using the reverse transfection protocol described in the methods, DDAH -1 and DDAH-2 genes
were silenced with specific siRNA’s. The degree of gene knock-down was evaluated using
semi-quantitative PCR analysis of DDAH-1 and DDAH-2 mRNA expression. This approach
was used in lieu of protein analysis because basal levels of DDAH-2 are undetectable by western
blot. Results demonstrated that DDAH-1 and DDAH-2 silencing resulted in greater than 70%
reduction in mRNA expression for the respective gene (Figure 3-5). In addition to DDAH
mRNA expression, the effects of siRNA mediated DDAH gene silencing on endothelial DDAH
activity was measured. Following 72 hours of DDAH-1, DDAH-2 or dual silencing, BAECs
were assessed for DDAH activity by measuring the conversion of L-[3H]NMMA to L-
[3H]Citrulline. Results demonstrated that DDAH-1 gene silencing resulted in a 64% decrease in
totally DDAH activity. DDAH-2 gene silencing resulted in a 48% decrease in total DDAH
activity (Figure 3-6). Interestingly, silencing of both DDAH-1 and DDAH-2 resulted in only a
50% drop in total DDAH activity suggesting that other methylarginine metabolic pathways may
be invoked as a consequence of loss of DDAH activity (Figure 3-6).
![Page 67: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/67.jpg)
67
The functional effects of DDAH gene silencing were assessed using EPR spin trapping to
measure endothelial derived NO production. Results demonstrated that DDAH-1 silencing
reduced endothelial NO production by 27% (Figure 3-7). In order to determine whether the
effects of DDAH gene silencing on NO production resulted from increased intracellular levels of
ADMA, L-arg supplementation experiments were carried out to assess the ability of L-arg to
overcome ADMA mediated eNOS inhibition. Specifically, DDAH gene silencing studies were
carried out in the presence of L-arg (100 µM). Results demonstrated that L-arginine (100 μM)
supplementation restored 50% of the siDDAH-1 mediated loss of endothelial NO production
(Figure 3-7). DDAH-2 gene silencing resulted in a 57% reduction in endothelial NO production.
L-arginine supplementation did not increase endothelial NO production in DDAH-2 silenced
BAEC’s (Figure 3-8). These results suggest that the effects of DDAH-2 silencing on endothelial
NO production are independent of ADMA-mediated eNOS inhibition. Additional studies were
performed in which both genes were silenced. Silencing of both the DDAH-1 and DDAH-2
genes resulted in 55% inhibition which was not increased with L-arg supplementation (Figure 3-
9).
These results are surprising given that L-arg would be expected to overcome the
accumulation of methlyarginines. Therefore, to confirm that L-arg supplementation can in fact
ameliorate ADMA mediated inhibition, additional studies were carried out with cells treated with
exogenous ADMA and the ability of L-arg supplementation to overcome eNOS inhibition was
measured. Cellular studies were carried out using BAEC’s stimulated by calcium inonophore
A23187 (1 µM). EPR-based NO measurements were preformed in modified KREBS buffer (0.5
mM Fe2+ and 5 mM MGD) in the presence or absence of L-arg (100 µM). The dose-dependent
effects of ADMA (0-10 µM) were then measured. Results demonstrated that ADMA dose-
![Page 68: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/68.jpg)
68
dependently inhibited eNOS-derived NO production with 5µM ADMA eliciting 46% inhibition
and 10 µM ADMA, exhibiting 58% inhibition in the absence of L-arg. In the presence of
physiologically relevant L-arg levels (100 µM), ADMA treatment resulted in a dose-dependent
inhibition of endothelial NO with < 20 % inhibition seen at ADMA concentrations of 5µM.
Overall these results demonstrate that L-arg supplementation can only partially restore the loss in
NO production occurring after ADMA administration. Although the addition of exogenous L-
arg would be expected to fully restore ADMA mediated eNOS inhibition, these results are
consistent with previous studies demonstrating partial restoration of endothelial NO with L-arg
following exposure to exogenous ADMA [96] (Figure 3-10).
Effects on DDAH Gene Silencing on Methylarginine Metabolism
As demonstrated earlier, when both DDAH-1 and DDAH-2 were silenced, total DDAH
activity was only inhibited by 50%, suggesting the endothelium may possess alternate metabolic
pathways for methylarginine metabolism. These are unexpected results given that DDAH is
considered to be the principle metabolic pathway for ADMA metabolism and was previously
demonstrated to mediate >80% of cellular methylarginine metabolism [267]. Therefore, studies
were carried out using HPLC techniques with radiolabeled NMMA to assess the metabolites of
methylarginine metabolism. Results demonstrated that in BAECs that were not silenced three
radiolabled peaks were identified, arginine, citrulline and L-NMMA. However, in BAECs that
were silenced an additional unidentified radiolabled peak was observed suggestive of induction
of an alternate metabolic pathway. Furthermore, following dual gene silencing the concentration
of the unknown metabolite increased 2-fold (Table 3-1). These results would suggest that
BAECs have an alternate inducible pathway for methylarginine metabolism in response to loss
of DDAH activity or methylarginine accumulation.
Effects of DDAH 1 and 2 Gene Silencing on eNOS Activity
![Page 69: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/69.jpg)
69
The studies on DDAH silencing demonstrate that loss of DDAH-2 expression/activity may
elicit ADMA independent effects given that L-arg supplementation was not able to enhance
endothelial NO production from DDAH-2 silenced cells. Therefore, studies were carried out in
order to determine whether gene silencing has any direct effects on eNOS activity independent of
ADMA. Studies were performed measuring the conversion of L- [14C] Arginine to L- [14C]
Citrulline from BAEC homogenates following DDAH gene silencing. Results demonstrated that
DDAH-1, DDAH-2 and dual silencing resulted in no change in total eNOS activity based on L-
NAME inhibitable counts (Figure 3-11).
Discussion
ADMA plasma levels have been shown to be elevated in diseases related to endothelial
dysfunction including hypertension, hyperlipidemia, diabetes mellitus, and others [267, 268,
270-272]. Moreover, it has been shown that ADMA predicts cardiovascular mortality in patients
who have coronary heart disease (CHD). Recent evidence published from the multicenter
Coronary Artery Risk Determination investigating the Influence of ADMA Concentration
(CARDIAC) study has indicated that ADMA is indeed an independent risk factor for CAD
[273]. There is a growing body of evidence implicating ADMA as a key player in endothelial
dysfunction and a independent risk factor involved in the pathophysiology of a variety of
cardiovascular diseases including hypertension, and atherosclerosis (21-26). Recently several
groups have demonstrated that modulating DDAH activity can have a profound effect on
endothelial NO production [237, 240]. In this regard, our group and others have shown that
over-expression of DDAH-1 results in increased NO production [242, 274]. Furthermore,
OxLDL and TNFα have been shown to decrease DDAH activity leading to decreased endothelial
NO production [275]. It has also been demonstrated that 4-hyrdoxy-nonenal (4-HNE), the
![Page 70: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/70.jpg)
70
highly reactive oxidant product of lipid peroxidation, inhibits DDAH activity and leads to
impaired NO generation through the formation of Michael addition products in the catalytic triad
of DDAH [274]. Thus, evidence suggests that DDAH-1 activity is under redox control and loss
of enzyme function impairs endothelial NO generation.
Whether the increased risk associated with elevated ADMA is a direct result of NOS
impairment is an area of controversy. Significant debate about the contribution of ADMA to the
regulation of NOS-dependent NO production has been initiated. In pathological conditions such
as pulmonary hypertension, coronary artery disease, diabetes and hypertension, plasma ADMA
levels have been shown to increase from an average of ~0.4 µM to ~0.8 µM [269, 272, 273, 276-
278]. Given that these values are at least 2 orders of magnitude lower than the plasma L-arg
levels it is unlikely that elevated plasma ADMA can significantly regulate eNOS activity. It is
more likely that elevated plasma ADMA levels reflect increased endothelial concentrations of
ADMA. In support of this hypothesis, we and others have demonstrated that endothelial ADMA
levels increase 3-4 fold in restenotic lesions and in the ischemia reperfused myocardium [96,
279]. Based on the kinetics of cellular inhibition, these concentrations of ADMA would be
expected to elicit a 30-40% inhibition in NOS activity [96]. These studies however involve
lesion specific increases in ADMA and are not associated with increased plasma levels of
ADMA and would not be expected to contribute to systemic cardiovascular pathology. In this
regard, there is little direct evidence that elevated plasma ADMA levels are associated with
increased endothelial ADMA nor is it clear whether ADMA directly contributes to the NOS
inhibition observed in chronic cardiovascular diseases. The current hypothesis in the field
suggests that decreased DDAH activity, as has been observed in cardiovascular disease, results
in impaired endothelial methylarginine metabolism with subsequent elevation in ADMA leading
![Page 71: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/71.jpg)
71
to NOS inhibition. However, identification of the endothelial DDAH isoform responsible for
NOS regulation and direct evidence for its role in modulating endothelial NO production has not
been demonstrated. Therefore, the current study was undertaken to evaluate the roles of both
DDAH-1 and DDAH-2 in the regulation of methylarginine metabolism and endothelial NO
production.
Initial studies were carried out to determine how cellular endothelial NO production is
regulated by the DDAH isoforms. DDAH-1 and DDAH-2 over-expression was induced using an
adenoviral construct carrying either the human DDAH-1gene (adDDAH-1) or DDAH-2 gene
(adDDAH2). Results demonstrated that adenoviral mediated overexpression of both DDAH-1
and DDAH-2 increased cellular endothelial NO production. These initial studies were done in
the presence of basal methylarginine levels and demonstrate that normal endogenous levels of
these NOS inhibitors are present at concentration sufficient to regulate eNOS activity. It had
previously been proposed that ADMA may be responsible for the “arginine paradox” and these
studies would appear to support the hypothesis. However, subsequent studies using L-arg
supplementation with DDAH over-expression demonstrated an additive effect which suggests
that ADMA is not involved in the “arginine paradox”.
It has been estimated that more than 80% of ADMA is metabolized by DDAH [267],
however, it is unclear which DDAH isoform represents the principal methylarginine
metabolizing enzyme. PCR and western blot analysis revealed that the endothelium contains
mRNA and protein for both DDAH-1 and DDAH-2. However, in order to assess the relative
contribution of each isoform a detailed analysis of the enzyme kinetics of each isoform is
necessary. Unfortunately, detailed biochemical studies have only been published for DDAH-1
[228, 249]. Using purified recombinant hDDAH-1 we and others have demonstrated the precise
![Page 72: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/72.jpg)
72
enzyme kinetics of this isoform and results demonstrated Km values of 68.7 and 53.6 μM and
Vmax values of 356 and 154 nmols/mg/min for ADMA and L-NMMA, respectively [228, 249]. In
regards to DDAH-2, previous attempts at purifying the protein have been unsuccessful primarily
due to solubility issues with recombinant enzyme. Therefore, to investigate the role of the
DDAH isoforms in the regulation of endothelial NO production, studies were performed using
siRNA to silence both the DDAH-1 and DDAH-2 genes in BAECs. It was anticipated that
silencing of DDAH would lead to increased cellular methylarginines and decreased endothelial
NO production. Results supported this prediction and demonstrated that DDAH-1 silencing
reduced endothelial NO production by 27% while DDAH-2 silencing reduced it by 57%. These
studies were then repeated with L-arg supplementation in order to establish the ADMA
dependence of the DDAH effects. The addition of L-arg (100 µM) was able to restore ~ 50% of
the loss of endothelial NO generation observed with DDAH-1 silencing. Although it may be
predicted that L-arg supplementation should completely restore NO production given that
ADMA is a competitive inhibitor of NOS, these result are consistent with previously published
studies and suggest that DDAH-1 silencing may lead to ADMA accumulation in sites that are not
freely exchangeable with L-arg. In support of this hypothesis it has been demonstrated by Simon
et al. that within the endothelial cell exists two pools of arginine both of which eNOS has access
to. Pool I is largely made up of extracellular cationic amino acids transported through the CAT
transport system, however Pool II does not freely exchange with extracellular cationic amino
acids. Furthermore they also demonstrated that Pool II is separated into two components. Pool
II A participates in the recycling of citrulline to arginine, while Pool II B is occupied by protein
derived by-products. It is within this Pool II B where the methylarginines are likely to
accumulate, thus rending its inhibitory effects on eNOS [280]. Alternatively, ADMA and/or
![Page 73: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/73.jpg)
73
DDAH may elicit effects that are independent of NOS, this appears to be the most plausible
explanation with regards to DDAH-2 wherein loss of activity reduced endothelial NO production
by greater than 50% and the loss was unaffected by L-arg supplementation. This is strong
evidence that DDAH may elicit effects that are independent of ADMA. Although this may
represent an overall paradigm shift with regards to the role of DDAH in the endothelium, it is not
with out support. The most convincing evidence that DDAH may regulate cellular function
through mechanisms independent of ADMA mediated NOS inhibition come from data on the
DDAH-1 knockout mouse. Homozygous null mice for DDAH-1 are embryonic lethal while the
NOS triple knockout mice are viable [240]. This further supports are hypothesis that DDAH
effects are not limited to ADMA dependent regulation of eNOS.
It has been widely reported that DDAH-2 is the predominant DDAH isoform in the
vascular endothelium; however these studies have widely relied on assessing the expression of
the DDAH isoforms in various cell and tissue types [237, 240, 281, 282]. Consequently, studies
were carried out in BAECs to determine which isoform is responsible for the majority of the
DDAH activity in the endothelial cell. DDAH-1 and DDAH-2 gene silencing decreased total
DDAH activity by 64% and 48%, respectively. Additional studies demonstrated that dual gene
silencing only resulted in a 50% loss total DDAH activity in BAECs thus suggesting that other
methylarginine metabolic pathways may be invoked as a consequence of loss of DDAH activity.
To investigate the possibility that loss of DDAH activity may lead to the induction of other
methyalrginine metabolic enzymes we used HPLC techniques to measure the metabolic products
of 14C-L-NMMA. In control cells we observed 3 peaks with radioactive counts and they were
identified as L-NMMA, L-arginine and L-cittruline. The formation of radiolablled L-citrtruline
is likely from the metabolism of L-NMMA by DDAH while radioactive L-arg is generated from
![Page 74: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/74.jpg)
74
citrulline recycling through ASS and ASL. In contrast, results from DDAH-1 and DDAH-2
silenced cells indicated the presence of 4 radioactive peaks including L-NMMA, L-arginine, L-
cittruline and a yet unidentified peak. The concentration of this unidentified peak increased 2
fold in the dual silencing group as compared to the levels in either the DDAH-1 or DDAH-2
silencing groups alone. Initial mass spec analysis has been unsuccessful in identifying the
unknown species and is currently an area of active investigation in our lab. Regardless, the
results clearly indicate that the endothelium possesses an alternate inducible pathways for
metabolizing methylarginies. Together, these results demonstrate that both DDAH-1 and
DDAH-2 are involved in the regulation of endothelial NO production. However, while DDAH-1
effects are largely ADMA-dependent, DDAH-2 effects appear to be ADMA-independent.
To determine whether the ADMA-independent effects of DDAH silencing on endothelial
NO production involved changes in eNOS protein, we measured eNOS activity from BAEC
homogenates following DDAH-1, DDAH-2 and dual silencing. Analysis of eNOS activity
demonstrated that DDAH gene silencing had no effect on the enzyme. These experiments were
carried out in the presence of saturating concentrations of substrate and cofactors and can rule
out DDAH effects on endothelial substrate/cofactor bioavailability.
Overall these results demonstrate that loss of DDAH activity, as has been demonstrated in
a number of cardiovascular diseases, leads to significant inhibition of endothelial NO production.
Moreover, the effect of DDAH-1 and DDAH-2 on endothelial NO appear to manifest through
very different mechanisms. DDAH-1 appears to be largely and ADMA dependent effect, while
DDAH-2 appears mostly to mediate its effects independent of ADMA. Moreover, we have
demonstrated for the first time an alternative pathway through which methlyarginines can be
metabolized.
![Page 75: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/75.jpg)
75
Figure 3-1. DDAH Over-expression. DDAH-1 and DDAH-2 expression was measured by western blot techniques from BAECs transduced for 48-hours with adDDAH-1(10,25,50 MOI) and adDDAH-2(10,25,50 MOI)
![Page 76: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/76.jpg)
76
Figure 3-2. Effects of adDDAH-1 over expression on endothelial cell NO production. NO generation from calcium ionophore A23187 (1 µM) stimulated BAECs (1x106) was measured by EPR spin trapping with the Fe2+-MGD complex. The left side of the panel represents the amplitude of the NO triplicate EPR spectra of a 30 consecutive 20 second scans following a 30 minute incubation period.B)The right panel represents the characteristic triplicate NO spectra and the effects of adDDAH-1 over-expression on NO production. Results are means ± SD. * Significance at p<0.05 as compared to the control. n=9
![Page 77: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/77.jpg)
77
Figure 3-3. Effects of adDDAH-2 over expression on endothelial cell NO production. NO generation from calcium ionophore A23187 (1 µM) stimulated BAECs (1x106) was measured by EPR spin trapping with the Fe2+-MGD complex. The left side of the panel represents the amplitude of the NO triplicate EPR spectra of a 30 consecutive 20 second scans following a 30 minute incubation period. The right panel represents the characteristic triplicate NO spectra and the effects of adDDAH-2 over-expression on NO production. Results are means ± SD as compared to the control. * Significance at p<0.05 as compared to the control. n=9
![Page 78: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/78.jpg)
78
Figure 3-4. Effects of DDAH-1 and DDAH-2 over-expression on ADMA mediated inhibtion of endothelial NO production. NO generation from calcium ionophore A23187 (1 µM) stimulated BAECs (1x106) was measured by EPR spin trapping with Fe2+-MGD complex. Experimental groups consisted of adGFP (control) adDDAH-1 and adDDAH-2. These experiments were preformed in the absence and presence of ADMA (5 µM). Results are ±SD *Significance at p<0.05 as compared to the respective control.
![Page 79: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/79.jpg)
79
Figure 3-5. Effects of DDAH gene silencing on DDAH mRNA expression. DDAH mRNA expression was measured by semi quantitative PCR, and ran on an agarose gel to check for differences in DDAH expression following siRNA treatment. Experimental groups consist of 60 nM siRNA (DDAH-1, DDAH-2) and 240 nM siRNA (DDAH-1 and DDAH
![Page 80: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/80.jpg)
80
Figure 3-6. Effects of DDAH gene silencing on endothelial cell DDAH activity. DDAH activity was measured from BAEC homogenates following 72 hours of DDAH gene silencing. Experimental groups consisted of si-DDAH-1, si-DDAH-2, si-DDAH1/2. Results are means ± SD. * Significance at p<0.05 as compared to the control. n=3
![Page 81: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/81.jpg)
81
Figure 3-7. Effects of DDAH-1 gene silencing on endothelial cell NO production. NO generation from calcium ionophore A23187 (1 µM) stimulated BAECs (1x106) was measured by EPR spin trapping with the Fe2+-MGD complex. Experimental groups consisted of
scrambled siRNA (control), and si-DDAH-1.These experiments were preformed both in the presence and absence of L-arginine (100µM). Results are means ± SD. * Significance at p<0.05 as compared to the respective control.n=9
![Page 82: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/82.jpg)
82
Figure 3-8. Effects of DDAH-2 gene silencing on endothelial cell NO production. NO generation from calcium ionophore A23187 (1
µM) stimulated BAECs (1x106) was measured by EPR spin trapping with the Fe2+-MGD complex. Experimental groups consisted of scrambled siRNA (control) and siDDAH-2.These experiments were preformed both in the presence and absence of L-arginine (100 µM). Results are means ± SD. * Significance at P<0.05 as compared to the respective control. n=9
![Page 83: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/83.jpg)
83
Figure 3-9. Effects of DDAH-1 and DDAH-2 gene silencing on endothelial cell NO production. NO generation from calcium ionophore A23187 (1 µM) stimulated BAECs (1x106) was measured by EPR spin trapping with the Fe2+-MGD complex. Experimental groups consisted of scrambled siRNA (control) and siDDAH-2.These experiments were preformed both in the presence and absence of L-arginine (100 µM). Results are means ± SD. * Significance at p<0.05 as compared to the respective control.n=9
![Page 84: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/84.jpg)
84
Figure3-10. Effects of ADMA on endothelial cell NO production. NO generation from calcium ionophore A23187 (1 µM) stimulated BAECs (1x106) was measured by EPR spin trapping with the Fe2+-MGD complex. Experimental groups consisted of control (0 µM), 5 µM and 10 µM ADMA. These experiments were preformed both in the presence and absence of L-arginine (100 µM). Results are means ± SD. * Significance at p<0.05 as compared to the respective control. n=9
![Page 85: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/85.jpg)
85
Figure 3-11. Effects of DDAH gene silencing on endothelial cell eNOS activity. eNOS activity was measured from BAEC homogenates following 72 hours of DDAH gene silencing. Experimental groups consisted of si-DDAH-1,si-DDAH-2,si-DDAH1/2 . Results are means ± SD. n=3
![Page 86: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/86.jpg)
86
Table 3-1. L-NMMA Metabolism Arginine Citrulline Unknown Control 5.5 µM 4.07 µM 0 µM siDDAH-1 5 µM 1.5 µM 2.2 µM siDDAH-2 4.25 µM 2.05 µM 2.8 µM siDDAH-1/2 5.1 µM 1.27 µM 4.4 µM BAECs were cultured in 6 well plates and transfected with siRNA. Following the 72 hour transfection period, cellular amino acid content was measured and quantified using HPLC techniques with ESA peak integration software.
![Page 87: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/87.jpg)
87
CHAPTER 4 ROLE OF DDAH-1 IN THE 4-HYDROXY-2-NONENAL MEDIATED INHIBTION OF
ENDOTHELIAL NITRIC OXIDE GENERATION
Introduction
Endothelium-derived nitric oxide (NO) is a potent vasodilator that plays a critical role in
maintaining vascular homeostasis through its anti-atherogenic and anti-thrombotic effects on the
vascular wall [283-285]. In this regard, impaired endothelial derived NO production has been
implicated in the pathogenesis of atheroproliferative disorders [286]. Among the proposed
mechanisms for the impaired NOS activity observed in these conditions are the elevated levels of
oxidatively modified lipids [287, 288]. Polyunsaturated fats in cholesterol esters, phospholipids
and triglycerides are subjected to free radical initiated oxidation. These polyunsaturated fatty
acid peroxides can yield a variety of highly reactive smaller molecules such as the aldehyde 4-
hydroxy-2-nonenal (4-HNE) upon further oxidative degradation [289]. 4-HNE is a major
biologically active aldehyde formed during lipid peroxidation of w6 polyunsaturated fatty acids
which has been shown to accumulate in membranes at concentrations from 10 μm to 5 mM
[290]. There is a body of evidence which suggests that reactive aldehydes such as 4-HNE play a
role in the progression of atherosclerosis. Plasma concentrations of these reactive aldehydes are
known to increase relative to the progression of aortic atherosclerosis, and during the oxidation
of LDL high concentrations of the reactive aldehydes are generated [291, 292]. It has been
suggested that the elevations in these highly reactive lipid hydroperoxide degradation products
result in impaired endothelial function and atherosusceptibility, secondary to NOS impairment
[288, 293, 294]. In support of the importance of the reactive aldehyde involvement in
endothelial dysfunction, here we demonstrate that exposure of aortic endothelial cells to 4-HNE
dose-dependently inhibits NO bioavailability. We hypothesize that the decrease in NO
![Page 88: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/88.jpg)
88
bioavailability is a result of increased levels of the NOS inhibitors, asymmetric dimethly arginine
(ADMA) and NG – monomethyl arginine (L-NMMA).
ADMA has been shown to be increased in conditions associated with increased risk of
atherosclerosis and independently predicts total and cardiovascular mortality in individuals with
angiographic coronary artery disease [31, 34, 273, 295-297]. However, little is known with
regards to the pathways leading to the methylarginine accumulation observed in cardiovascular
diseases. These endogenous inhibitors of NOS are derived from the proteolysis of methylated
arginine residues in various proteins. The methylation is carried out by a group of enzymes
referred to as protein-arginine methyl transferase’s (PRMT’s). Subsequent proteolysis of
proteins containing methylarginine groups leads to the release of free methylarginine into the
cytoplasm where NO production from NOS is inhibited [35, 298, 299]. These methylarginines
are subsequently degraded by the enzyme DDAH which hydrolyzes the conversion of ADMA to
L-citrulline and dimethylamine [36, 300]. The activity of DDAH has been shown to be
decreased by oxidized LDL and tumor necrosis factor (TNF-α), yielding increased
methylarginine levels with subsequent impairment of NOS-derived NO generation [239, 261,
301, 302]. Because NO is known to possess anti-proliferative and anti-atherogenic properties,
methylarginine accumulation in response to the decreased DDAH expression/activity has been
proposed to be involved in the vascular pathophysiology observed in a variety of cardiovascular
diseases [35, 96, 303-305]. However, the mechanisms as to how methylarginines are modulated
and what role they play in disease progression are not understood. Therefore, the current studies
were performed in order to establish the effects of the lipid peroxidation degradation product 4-
HNE on NO production and determine if methylarginines are involved in the lipid peroxidation
mediated pathogenesis of endothelial dysfunction.
![Page 89: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/89.jpg)
89
Materials and Methods
Materials
4-HNE was purchased form Biomol (Plymouth Meeting, PA). BAECs were purchased
form Cell-Systems (Kirkland, WA). All other reagents were purchased from Sigma (St.Louis,
MO).
Cell Culture
Bovine aortic endothelial cells (BAECs) were purchased from Cell-Systems and cultured
in DMEM containing 10% FBS, 1% NEAA, 0.2% endothelial cell growth factor supplement and
1% antibotic-antimyotic and incubated at 37°C under a humidified environment containing 5%
CO2 – 95% O2. For experiments involving exposure to 4-HNE, 4-HNE was prepared as a stock
solution in ethanol at a concentration of 50 mM. The 4-HNE was then added to the media of
BAECs and incubated for 24 hrs. Dilutions of 4-HNE were performed in order to maintain the
final ethanol concentration below 0.2%.
Epr Spectroscopy and Spin Trapping
Spin-trapping measurements of NO were performed using a Bruker ESP 300E
spectrometer with Fe-MGD as the spin trap [96, 306]. For Measurements of NO produced by
BAECs , cells were cultured as described above and spin trapping experiments were performed
on cells grown in 6-well plates (1 x 106 cells/ well). In these studies, cells attached to the
substratum were utilized since scraping or enzymatic removal leads to injury and membrane
damage with impaired NO generation. The medium from each well was removed and the cells
were washed 3 x with PBS (w/o CaCl2 or MgCl2). Next, 0.3 ml of PBS containing glucose (1
g/L), CaCl2, MgCl2, the NO spin trap FE-MGD (0.5 mM Fe2+, 5.0 mM MGD), and calcium
ionophore (1 μM) was added to each well and the plates were incubated at 37°C under a
humidified environment containing 5% CO2 – 95% O2 for 30 min. Following incubation, the
![Page 90: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/90.jpg)
90
medium from each well was removed and the trapped NO in the supernatants was quantified
using EPR. Spectra recorded from these cellular preparations were obtained using the following
parameters: microwave power; 20 mW, modulation amplitude; 3.16 G and modulation
frequency; 100 kHZ.
Measurement of Endothelial Cell ADMA and L-Arg Levels
BAEC’s were collected from confluent 75 cm2 culture flask by gentle scraping followed by
sonication in PBS followed by extraction using a cation-exchange column. Samples were
derivatized with OPA and separated on a Supelco LC-DABS column (4.6 mm x 25 cm i.d.,5 µm
particle size) and L-Arg and methylarginines separated and detected using an ESA (Chelmsford,
MA) HPLC system with electrochemical detection at 400 mV [306]. Intracellular levels of L-
Arg and methylarginines were determined from values derived from standard curves of each
analyte using the ESA peak integration software assuming the endothelial cell intracellular water
content of 2 pL.
DDAH-1 and eNOS Expression
DDAH-1 was detected by anti-DDAH-1 goat IG purchased from IMGENEX and diluted
1:2000 (San Diego, CA). eNOS was detected using an anti-eNOS antibody purchased from
Calbiochem (San Diego, CA). The secondary antibodies were donkey anti-goat IgG-HRP and
goat anti-rabbit IgG-HRP, respectively, and purchased from Santa Cruz (Santa Cruz, CA). The
secondary antibodies were diluted 1:2000. Western blot detection was performed using an
enhanced chemiliumnesece kit purchased from Amersham Biosciences (Piscataway, NJ).
DDAH Activity
DDAH activity was measured from the conversion of L-[14C]L-NMMA to L-[14C]
citrulline. BAECs grown to confluence in T-75 flasks were trypsinized, pelleted and
resuspended in 150 μL of 50 mM Tris (pH 7.4). The cells were then sonicated 4 x 2 seconds and
![Page 91: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/91.jpg)
91
150 μL of the reaction buffer (50 mM Tris, 20 μM L-[14C]L-NMMA, 180 μM L-NMMA, pH
7.4) was added to each sample. The samples were then incubated in a water bath at 37°C for 90
minutes. Following the incubation, the reaction was stopped with 1 ml of ice-cold stop buffer
using 20 mM N-2 Hydroxyethylpiperazine-N’-2 ethanesulfonic acid (HEPES) with 2 mM
EDTA, pH 5.5. Separation of L-[14C]citrulline from L-[14C]L-NMMA was performed using the
cation exchange resin Dowex AG50WX-8 (0.5 ml, Na+ form, Pharmacia). The L- [14C]
citrulline in the eluent was then determined using a liquid scintillation counter.
Results
Effects of 4-HNE on Endothelial Cell NO Production
Previous studies have demonstrated that lipid hydroperoxide levels are elevated in
atherosclerotic lesions and the presence of these oxidized lipid congeners may contribute to the
endothelial dysfunction observed in CAD [291, 292]. Therefore, in order to determine the
effects of lipid hydroperoxides on endothelial function, cellular studies were carried out using
BAECs stimulated with calcium ionophore to assess the effects of 4-HNE on NO production
from endothelial cells. Endothelial cells were cultured in 6 well plates and upon reaching
confluence were exposed to 4-HNE (10-100 μM) for 24 hours. 4-HNE was dissolved in ethanol
and added directly to the media (0.1 % EtOH). This compound is highly lipophilic and readily
crosses cellular membranes, as such no carrier is needed to deliver this agent into the cell [307].
At the end of the incubation period, EPR spin trapping measurements were performed to
measure endothelial-derived NO production. Results demonstrated that 4-HNE dose
dependently inhibited NO generation from BAECs, with 10 μM 4-HNE inhibiting NO
generation by 14%, 50 μM inhibited NO generation by 45% and at 100 μM a 72% inhibition was
observed (Figure 4-1). Results from these studies demonstrated that 4-HNE, at pathologically
![Page 92: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/92.jpg)
92
relevant levels, dose-dependently inhibited eNOS-derived NO generation. Measurements of cell
viability demonstrated no increase in cell death with 4-HNE doses up to 50 µM, however, at 100
µM 4-HNE cell viability decreased by 18 % following 24-hours of 4-HNE exposure. Thus all
subsequent studies were performed using 4-HNE concentrations ≤ 50 µM. Control studies using
the non-oxidized carbonyl hexanol demonstrated no significant inhibition in cellular NO
production with concentrations up to 50 µM (Figure 4-2). The concentration of 4-HNE (50 µM)
used for subsequent studies represents pathologically relevant levels of this reactive lipid
oxidation product as previous studies have shown concentrations exceeding 50 µM 4-HNE in the
plasma of dogs following reperfusion injury [308, 309].
Effect of 4-HNE on eNOS Expression
In order to determine whether the inhibitory effects of 4-HNE on cellular NO production
were due to alterations in eNOS expression, western blot analysis was performed and
measurements of eNOS expression were carried out (Figure 4-3). NOS phosphorylation status
was measured using the western blotting techniques with anti-pSer1179 and pThr-497 antibodies
(Figure 4-3). In addition, because calcium ionophore stimulation is known to alter Ser1179
phosphorylation, western blot experiments were also performed on A23187 stimulated BAECs
following 4-HNE treatment (Figure 4-4). Results demonstrated that the loss of NOS activity was
independent of both eNOS protein expression and phosphorylation status as both of these
outcomes were unchanged following exposure to 4-HNE.
Restoring NO Generation from Cells
Because the observed NO inhibition did not result from changes in protein expression or
phosphorylation state, we carried out additional studies aimed at assessing whether substrate or
cofactor depletion was involved in the observed decrease in NO bioavailability. In this regard,
oxidant stress, which has been shown to occur following exposure to lipid oxidation products,
![Page 93: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/93.jpg)
93
has been shown to reduce the bioavailability of the critical NOS cofactor H4B [290, 310, 311].
Loss of this cofactor results in NOS uncoupling with the enzyme primarily generating
superoxide. Moreover, oxidant injury has also been demonstrated to increase cellular levels of
the endogenous methylarginine, ADMA [88]. Therefore, cellular studies were carried out to
investigate the effects of adding both an antioxidant to prevent H4B oxidation as well as the
eNOS substrate L-Arginine, to overcome endogenous methylarginine mediated NOS inhibition.
Results demonstrated that 24 hour exposure of BAECs to 50 μM 4-HNE resulted in a 51%
decrease in endothelial NO generation (Figure 4-5). When these experiments were repeated in
the presence of GSH (1 mM) or with L-Arg supplementation (1 mM), NO production increased
by 26% and 7% respectively. Moreover, when these experiments were repeated in the presence
of both GSH and L-Arg, endothelial cell NO production was restored to near normal levels (87%
of control) (Figure 4-5). These results suggest that 4-HNE-mediated effects on NO production
involve multiple mechanisms which include elevated levels of methylarginines.
Effects of 4-HNE on Superoxide Production and Nitrotyrosine Formation
Because our previous results demonstrated that GSH was able to partially restore NO production
in BAEC treated with 4-HNE, studies were done in order to determine the effects of 4-HNE on
superoxide production (Figure 4-12). Following 24 hours of 4-HNE (50µM) treatment, resulted
in increased superoxide production in our BAEC cells. The superoxide signal was largely
quenched by the SOD mimetic. Furthermore, because it is know that oxidative stress can
increase eNOS derived by causing the oxidation of the essetinal NOS cofactor H4B we then
repeated these studies in the presence of the NOS inhibitor L-NAME. Results demostrated that
following 24 hours of 4-HNE exposure, L-NAME treatment caused a 20% reduction in
superoxide production (Figure 4-12). Finally, because increases in superoxide production are
![Page 94: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/94.jpg)
94
also know to increase OONO- production which can result in increased protein nitrosylation,
western blot analysis was done to measure nitrotyrosine formation. Results demonstrated that
there were no significant changes in protein nitrotyrosine formation. (Figure 4-11)
Effects of 4-HNE on Cellular ADMA Levels
Our observation that 4-HNE treatment impairs cellular NO production and that this
inhibitory effect can be reversed with L-Arg administration suggests that intracellular levels of
the NOS inhibitor ADMA may be elevated. In order to confirm this hypothesis, cellular levels of
ADMA and L-Arg were measured following exposure of BAECs to 50 μM 4-HNE for 24 hours.
Results demonstrated that at 24 hours post-exposure to 4-HNE, endothelial cell concentrations of
ADMA increased from 3.2 ± 0.5 to 6.5 ± 0.7, while L-Arg levels were not significantly different
(Figure 4-6). These results support our conclusion that the inhibitory effects of 4-HNE on
endothelial NO production are due, at least in part, to the increased levels of the competitive
NOS inhibitor, ADMA .
Effect of 4-HNE on DDAH Expression and Activity
Cellular methylarginine levels are regulated by DDAH, the enzyme responsible for the
metabolism of both ADMA and L-NMMA. Recent studies have demonstrated that the
expression and activity of this methylarginine-regulating enzyme decreases in variety of
cardiovascular diseases. Therefore, to determine whether the observed elevations in intracellular
ADMA were a result of changes in DDAH, measurements of DDAH expression and activity
were performed following exposure of BAECs to 4-HNE. BAECs were treated with 4-HNE (50
μM) followed by western blotting and enzyme activity assays. Results demonstrated that
exposure of endothelial cells to 4-HNE did not affect the protein expression (Figure 4-7), but
resulted in a 40% decrease in cellular DDAH activity (Figure 4-8). Studies were then performed
![Page 95: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/95.jpg)
95
with purified recombinant hDDAH-1 to evaluate whether the observed cellular inhibition of
DDAH activity was a result of direct 4-HNE effects on the enzyme. Incubation of purified
hDDAH-1 with 50 μM 4-HNE resulted in a 41% decrease in activity from the purified enzyme
(Figure 4-8). This loss in activity was largely restored by GSH (1 mM) pre-incubation.
Together, these results demonstrate that 4-HNE directly inhibits DDAH activity resulting in
increased methylarginine levels and thus impaired eNOS-derived NO.
Effects of DDAH Over-Expression on Endothelial NO Production Following Exposure to 4-HNE
Our results have demonstrated that the exposure of BAECs to the lipid peroxidation
product, 4-HNE, results in the impaired NO production and accumulation of ADMA, secondary
to the loss of DDAH activity. Therefore, studies were carried out in order to determine whether
over-expression of DDAH-1 could restore endothelial NO production following 4-HNE
challenge. BAECs were grown to 80% confluence and then transduced with adDDAH-1 (25
MOI) which resulted in a 3-fold increase in DDAH 1 expression. After 24 hours of adenoviral
transfection, cells were challenged with 4-HNE and allowed to incubate for an additional 24
hours. At the end of the 24 hour challenge, EPR analysis of NO production was carried out as
described in the Material and Methods. Results demonstrated that exposure to 4-HNE (50 μM)
resulted in a 36% decrease in NO generation in cells transduced with a control vector (Figure 4-
9). Cells over-expressing DDAH-1 demonstrated a 22% basal increase in NO generation as
compared to the control vector, suggesting that the endogenous levels of methylarginine are
sufficient to significantly inhibit cellular NO production (Figure 4-9). Exposure of cells over-
expressing DDAH-1 to 4-HNE (50 μM) resulted in a 58% decrease in NO production, thus
demonstrating that DDAH alone cannot restore eNOS function. However, when these
experiments were repeated in the presence of GSH, DDAH over-expression was able to almost
![Page 96: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/96.jpg)
96
completely restore NO production following 4-HNE challenge, while GSH alone had only
modest effect (Figure 4-9).
In order to confirm that these NO-restoring effects were dependent on increased DDAH
activity, studies were performed measuring the conversion of L-[14C]NMMA to L-[14C]citrulline
in BAECs. We found that exposure of BAECs to 4-HNE (50 μM) resulted in a 38% decrease in
DDAH activity, supporting our previous HPLC results (Figure 4-10). Over-expression of
DDAH-1 increased DDAH activity by ∼ 50% and this increase in activity was reduced by 25%
following exposure of BAECs to 4-HNE. Although DDAH activity was significantly higher in
the DDAH over-expressing cells exposed to 4-HNE as compared to the control, this increase in
DDAH activity was not accompanied by an in increased NO production (Figure4-9). Treatment
of BAECs with the antioxidant GSH had modest effect on the DDAH activity and did not
significantly prevent the loss of DDAH activity following 4-HNE challenge, while the
combination of DDAH over-expression and GSH increased DDAH activity by ∼50% (Figure 4-
10) with near complete restoration of NO production (Figure 4-9). These results suggest that 4-
HNE causes NOS impairment through multiple mechanisms the first involving methylarginine
accumulation. The second one being NOS uncoupling, because of its known oxidative effects on
H4B(Vivar Vasquez). Evidence for NOS uncoupling is supported by our data demonstrating that
DDAH over-expression in the presence of 4-HNE actually exacerbates the effects of 4-HNE on
NO production (Figure 4-9). In this regard, we have previously reported that methylarginines
inhibit nNOS derived superoxide, and as such, over-expression of DDAH would reduce this
inhibitory effect resulting in increased NOS derived superoxide and reduced NO bioavailability
[312]. Evidence for the multiple mechanisms through which 4-HNE mediates its effects are
supported by our results demonstrating that GSH treatment alone or DDAH over-expression
![Page 97: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/97.jpg)
97
alone has only moderate protection from 4-HNE induced NOS dysfunction. However, in
combination, these two treatments largely restored endothelial NO generation (Figure 4-9).
Therefore, complete protection of endothelial-derived NO generation from 4-HNE damage can
only be achieved by both preventing NOS uncoupling and oxdiase generation from other
oxidative soruces (GSH treatment) and methylarginine accumulation (DDAH over-expression).
Discussion
There is a growing volume of literature implicating ADMA as a key player in endothelial
dysfunction and strong correlative data suggesting that ADMA is involved in the
pathophysiology of a variety of cardiovascular diseases including; hypertension and
atherosclerosis [35, 303]. More recently we and others have shown that methylarginines are
elevated in response to vascular injury and that this elevation in ADMA and L-NMMA results in
impaired endothelial function [96, 313]. In addition to mechanical injury, studies have also
demonstrated that exposure of endothelial cells to pro-atherogenic lipoproteins such as LDL,
results in increased cellular ADMA levels [261]. Polyunsaturated fats in cholesterol esters,
phospholipids and triglycerides are subjected to free radical oxidation. These polyunsaturated
fatty acids can yield a variety of lipid hydroperoxides and highly reactive lipid peroxidation
products such as the aldehyde 4-hydroxy-2-nonenal (4-HNE). During inflammation and
oxidative stress levels of 4-HNE have been shown to accumulate in membranes at concentrations
from 10 μm to 5 mM [290]. Moreover, studies have suggested that reactive aldehydes/carbonyls
such as 4-HNE may play a critical role in the progression of atherosclerosis [291, 292]. Plasma
concentrations of these lipid peroxidation products are known to increase relative to the
progression of atherosclerosis, and during the oxidation of LDL high concentrations of these
reactive aldehydes/carbonyls are formed. We thus hypothesized that elevations in lipid
![Page 98: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/98.jpg)
98
peroxidation products may result in impaired endothelial function and atherosusceptibility,
secondary to NOS impairment.
Therefore, studies were performed in order to determine the effects of the highly reactive
lipid peroxidation product, 4-HNE, on endothelial-derived NO generation. Results demonstrated
that the exposure of BAECs to 4-HNE caused a dose-dependent inhibition of cellular NO
production. The observed 4-HNE effects were independent of changes in either NOS expression
or phosphorylation state, as the Western blotting analysis revealed no changes in either endpoint.
These results suggested that the observed NOS impairment involved mechanisms other than
those related to protein expression. As such, subsequent experiments were performed in order to
determine whether alterations in NOS cofactors or substrate may be involved in the decreased
NO bioavailability. In this regard, oxidant stress, which has been shown to occur following
exposure to lipid peroxidation products, has been shown to reduce the bioavailability of the
critical NOS cofactor, H4B [290, 311]. Loss of this cofactor results in NOS uncoupling evident
by impaired NO synthesis and enhanced superoxide production from the enzyme [310].
Moreover, oxidant injury has also been demonstrated to increase the cellular levels of the
endogenous methylarginine, ADMA [35]. Therefore, cellular studies were carried out to
investigate the effects of adding both an antioxidant (GSH) to prevent H4B oxidation as well as
the eNOS substrate L-Arginine to overcome endogenous methylarginine-mediated NOS
inhibition. Our data demonstrate that the addition of either GSH or L-Arginine alone had only
modest NO-enhancing effects, however, co-incubation with both GSH and L-Arg was able to
almost completely restore endothelial NO production. These data suggest that the observed NOS
impairment involves both oxidant induced NOS inhibition (alleviated by the addition of GSH) as
well as methylarginine accumulation (alleviated by the addition of excess substrate).
![Page 99: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/99.jpg)
99
Direct measurement of ADMA levels and DDAH activity within cells by HPLC
demonstrated that following 4-HNE challenge intracellular ADMA levels were increased greater
than 2-fold. Based on previously published studies demonstrating the kinetics of ADMA
mediated cellular inhibition, a 2 fold increase in methylarginine levels would be expected to
inhibit NOS dependent NO generation by 20-30 % [96]. The additional inhibition observed
could be due to compartmentalization or NOS uncoupling and increased NOS derived
superoxide production in the presence of ADMA. To test this hypothesis, western blotting
studies to measure nitrotyrosine formation (Figure 4-11). Although no significant increase in
ONOO- formation was observed, this does not rule out NOS uncoupling as superoxide
generation from the enzyme is likely below detection limits. In this regard, we have also
employed EPR spin-trapping techniques to measure eNOS derived endothelial superoxide
production. These studies demonstrated increased levels of oxygen radicals which were
inhibited by ~ 20% by L-NAME (Figure 4-12). L-NAME is currently the only known specific
inhibitor of NOS derived superoxide production, however, this observation is based primarily on
studies from purified enzyme. Because L-NAME is a methyl ester and is subject to modification
by cellular esterases, its intracellular kinetics on NOS derived superoxide production are not well
characterized. Nevertheless, increased endothelial superoxide production was observed from
BAECs exposed to 4-HNE, however not all can be contributed to eNOS derived superoxide
To determine whether the increased levels of ADMA observed following 4-HNE exposure
resulted from changes in the activity of the ADMA metabolizing enzyme DDAH, its activity was
measured. Studies of DDAH activity demonstrated a 40% decrease in hydrolytic activity,
suggesting that the mechanism for the observed 4-HNE-directed NOS impairment was via an
inhibition of DDAH. Additional studies were performed on purified recombinant hDDAH-1 in
![Page 100: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/100.jpg)
100
order to determine whether 4-HNE effects were through direct interaction with the enzyme.
Results demonstrated that incubation of hDDAH-1 with 4-HNE (50 μM) resulted in a > 40%
decrease in enzyme activity. These effects were specific to 4-HNE as incubation with the non-
oxidized carbonyl hexanol (10-500 µM) had no effect on DDAH activity (Figure 4-13). Similar
studies were performed with purified recombinant eNOS and no inhibition was observed
following 4-HNE exposure. 4-HNE forms Michael adducts with histidine and cysteine residues
on proteins. In this regard, the catalytic triad of DDAH contains both cysteine and histidine
residues and mutation of either amino acid has been demonstrated to render the enzyme inactive
(Figure 4-14) [314-316].
As further support to the role of DDAH in mediating the inhibitory effects of 4-HNE on
endothelial NO production, studies were performed using DDAH over-expressing BAECs.
Over-expression of DDAH should lead to a decrease in cellular methylarginines with the
concomitant increase in NOS-derived NO. DDAH over-expression was induced using an
adenoviral construct carrying the human DDAH-1 gene (adDDAH1) (Figure 4-15). Preliminary
studies demonstrated that incubation of BAECs with adDDAH1 at 25 MOI, resulted in a 3-fold
increase in protein expression and a > 50% increase in DDAH activity following a 48 hour
incubation. DDAH over-expression increased cellular DDAH activity in control cells by 50%
and resulted in a 22% increase in cellular NO production (Figures 4-9 and 4-10), demonstrating
that the endogenous levels of ADMA and L-NMMA are sufficient to significantly inhibit
endothelial NO generation. If one then considers the 2-fold increase in the levels of ADMA
observed following the 4-HNE treatment, a ∼40 % inhibitory effect would be predicted [96].
Subsequently, a series of studies were performed using this same transduction protocol to
examine the effects of DDAH over-expression on 4-HNE mediated endothelial NO inhibition.
![Page 101: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/101.jpg)
101
Although DDAH over-expression did increase DDAH activity and decrease endogenous
methylarginines, the over-expression of the enzyme alone was not sufficient to prevent the 4-
HNE-induced decrease in NO production. In fact, our results demonstrated that exposure of
DDAH over-expressing cells to 4-HNE resulted in worsened outcome as NO levels were
significantly lower than that in the control cells exposed to 4-HNE. Although these results may
appear contradictory to our hypothesis, they in fact support it and demonstrate that NOS
uncoupling is likely occurring. We have previously demonstrated that ADMA inhibits nNOS-
derived superoxide, and as such, DDAH over-expression in the presence of uncoupled NOS
would be expected to eliminate ADMA and thus prevent ADMA mediated inhibition of NOS-
derived superoxide. The outcome of this would be reduced NO bioavailability through the
reaction of available NO with superoxide, a reaction which occurs at diffusion limited rates.
Our hypothesis would predict that treatment of DDAH over-expressing cells with an
antioxidant would restore NO to levels similar to those observed with L-Arg and GSH treatment,
if in fact methylarginines are contributing to the inhibition in NO generation seen with 4-HNE
challenge. Indeed, we have demonstrated almost complete protection of cellular NO production
following 4-HNE challenge using a combination of viral over-expression of DDAH and
treatment with GSH, when compared to the respective control. These results would indicate that
GSH alone reduces NOS uncoupling but not the methylarginine accumulation, while L-Arg
supplementation and/or DDAH over-expression overcomes the 4-HNE-induced increase in
methylarginines but not the NOS uncoupling.
In conclusion, our results demonstrate for the first time that the lipid peroxidation product
4-HNE can inhibit the endothelial NO production. The doses used in this study represent
pathological levels of this highly reactive lipid peroxidation product and suggest that this
![Page 102: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/102.jpg)
102
bioactive molecule may play a critical role in the endothelial dysfunction observed in a variety of
cardiovascular diseases. The inhibitory effects of 4-HNE appear to be mediated through both
oxidant stress and elevated levels of the endogenous NOS inhibitors ADMA and L-NMMA, as
either L-Arg supplementation or DDAH over-expression in the presence of an anti-oxidant were
able to restore NO production. Together, these results represent a major step forward in our
understanding of the regulation, impact, and role of methylarginines and lipid peroxidation in
cardiovascular disease.
![Page 103: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/103.jpg)
103
Figure 4-1. Effects of 4-HNE on NO production. NO generation from BAECs stimulated with calcium ionophore A23187 (1 μM) was measured by EPR spin trapping with the Fe-MGD complex. The left panel shows the amplitude of the NO triplicate EPR spectrum over 10 consecutive 1 minute scans after a 30 minute incubation period. The right panel shows the EPR spectra and the dose dependent effects of the 4-HNE treatment on NO production. Results represent the mean ± SD. * indicates significance at p<0.05
![Page 104: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/104.jpg)
104
Figure 4-2. Effects of Hexanol on NO production. NO generation from BAECs stimulated with calcium ionophore A23187 ( 1 μM) was measured by EPR spin trapping with the Fe-MGD complex. The left panel shows the amplitude of the NO triplicate EPR spectrum over 10 consecutive 1 minute scans after a 30 minute incubation period. The right panel shows the EPR spectra and the dose dependent effects of the 4-Hexanol treatment on NO production. Results represent the mean ± SD. * indicates significance at p<0.05
![Page 105: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/105.jpg)
105
Figure 4-3. 4-HNE effects on eNOS expression and phosphorylation. Protein was obtained from BAECs treated with varying concentrations (1-50 μM) of 4-HNE for 24 hours. For measurements of eNOS, p-eNOSser1179 and p-eNOSthr 497 expression, 30 μg of protein was loaded into each well, Lane 1 is non treated cells, Lanes 2-5 are cells treated with 4-HNE.
Figure 4-4. Effects of 4-HNE on Ser1179 phophorylation following calcium ionphore (5 µM, A23187) stimulation. Protein was obtained from BAECs treated with varying concentrations (1-50 μM) of 4-HNE for 24 hours. For measurements of eNOS and, p-eNOSser1179 expression, 30 μg of protein was loaded into each well. Lane 1 is the cells treated with A23187, Lane 2 is non treated cells, Lanes 3-6 are cells treated with 4-HNE
![Page 106: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/106.jpg)
106
Figure 4-5. Effects of L-arginine and GSH supplementation on NO generation. NO generation from BAECs stimulated with calcium ionophore A23187 (1 μM) was measured by EPR spin trapping with the Fe-MGD complex. Experimental groups consisted of untreated (Control); 1 mM L-arginine supplementation (L-arg); 1 mM GSH supplementation (GSH); and 1 mM L-Arg with 1 mM GSH (L-arg + GSH) These experienments were performed both in the presence and absence of 4-HNE (50μM). Results represent the mean ± SD. * indicates significance at p<0.05
![Page 107: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/107.jpg)
107
Figure 4-6. Effects on 4-HNE on the levels of ADMA in BAECs. BAEC’s were cultured in T-75 flasks and exposed to 50 μM 4-HNE for 24 hours. Total cellular ADMA levels were measured using HPLC techniques and concentrations were determined as a factor of cell amount, cell volume and protein amount. Results represent the mean ± SD. * indicates significance at p<0.05.
Figure 4-7. 4-HNE effects on DDAH expression. DDAH-1 expression was measured by western blot techniques from BAECs treated with 50 μM 4-HNE for 24 hours
![Page 108: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/108.jpg)
108
Figure 4-8. 4-HNE effects on DDAH activity. DDAH activity was measured from BAEC homogenates following a 24 hour incubation with 4-HNE (50 μM) DDAH activity was measured from purified recombinant hDDAH-1 (5 μg) following a 60 minute incubation with 50 µM 4-HNE. Experimental groups consisted of 50 μM 4-HNE (4-HNE) and 50 μM 4-HNE + 1 mM GSH (GSH). Results represent the mean ± SD. * indicates significance at p<0.05.
![Page 109: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/109.jpg)
109
Figure 4-9. Effects of DDAH over-expression on endothelial cell NO production following 4-HNE challenge. NO generation BAECs stimulated with calcium ionophore A23187 (1 μM) was measured by EPR spin trapping with the Fe-MGD complex. Experimental groups consisted control vector (Control), DDAH over-expressing (DDAH), glutathione (1 mM) treated (GSH) and DDAH over-expression with GSH (1 mM) treatment (DDAH + GSH). These experiments were performed both in the presence and absence of 4-HNE (50 μM). Results represent the mean ± SD. * indicates significance at p<0.05.
![Page 110: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/110.jpg)
110
Figure 4-10. Effects of 4-HNE on endothelial cell DDAH activity. DDAH activity was assessed by measuring the conversion of C14-L-NMMA to C14-Citrulline. Experimental groups consisted control vector (Control); DDAH over-expressing (DDAH); 1 mM glutathione supplementation (GSH); and DDAH over-expression with 1 mM GSH treatment (DDAH + GSH). These experiments were performed both in the presence and absence of 4-HNE (50 μM). Results represent the mean ± SD. * indicates significance at p<0.05
![Page 111: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/111.jpg)
111
Figure 4-11. Effects 4-HNE on nitrotyrsoine formation in BAECs. BAECs were treated with 50 µM 4-HNE for 24 hours. Following the incubation period, cells were stimulated with calcium ionophore (5 µM A23187) and homogenized for western blot analysis. Results demonstrate no significant increase in protein tyrosine nitration.
![Page 112: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/112.jpg)
112
Figure 4-12. Effects 4-HNE on ROS formation from BAECs. BAECs were treated with 50 µM 4-HNE for 24 hours. Following the incubation period, cells were stimulated with calcium ionophore (5 µM A23187) and EPR measurements were performed using the spin trap DMPO (50 mM). Results demonstrated an increase in the DMPO-OH adduct following 4-HNE treatment. This adduct was superoxide derived as it was largely quenched by the SOD mimetic M40403 (10 µM). The DMPO-OH adduct was inhibited by ~ 20% with L-NAME. ↓’s indicates the four peaks corresponding to the DMPO-OH adduct. The other 3 peaks are consistent with a carbon center radical.
![Page 113: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/113.jpg)
113
Figure 4-13. Effects of Hexanol on DDAH-1 activity. DDAH activity was measured from purified recombinant hDDAH-1 (5 μg) following 60 minute incubation with Hexanol (10-500 µM). Results represent the mean ± SD. * indicates significance at p<0.05.
![Page 114: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/114.jpg)
114
Figure 4-14. MS/MS spectra of of a tryptic peptide generating the sequence b/y-ion series from the in-gel digest of the hDDAH-1 reacted with 4-HNE. The peptide observed at m/z 969.9+3 corresponds to the aa sequence 150-175 with H173 modified by HNE with the y3 – y13, y15 and y 20 ions labeled along with the corresponding b4 – b17, b24 – b25 ions labeled.
![Page 115: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/115.jpg)
115
Figure 4-15. Adenoviral transduction of hDDAH-1 in BAECs. BAECs were treated with adDDAH-1 at various MOI (10-50) to determine optimum viral titer. Results demonstrate a dose dependent increase in DDAH-1 expression at 48 hours post infection.
CHAPTER 5
![Page 116: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/116.jpg)
116
REGULATION OF ENDOTHELIAL DERVIED SUPEROXIDE BY THE METHYLARGININES
Introduction
The biological significance of guanidino-methylated arginine derivatives has been known
since the inhibitory actions of NG–monomethyl-L-Arginine (L-NMMA) on macrophage induced
cytotoxicity were first demonstrated. This naturally occurring arginine analog together with its
structural congener asymmetric dimethylarginine (ADMA), are L-Arginine derivatives that are
intrinsically present in tissues and they have the ability to regulate the L-Arginine:NO pathway.
These two compounds, along with NG–nitro-L-Arginine methyl ester (L-NAME), have been
shown to be potent inhibitors of eNOS activity [35, 298, 306, 317].
NO has been demonstrated as a critical effector molecule in the maintenance of vascular
function [318-320]. In the vasculature, NO is derived from the oxidation of L-Arginine (L-Arg),
catalyzed by the constitutively expressed enzyme, eNOS [158, 162, 321]. This endothelial-
derived NO diffuses from the vascular endothelium and exerts its effects on the smooth muscle
cell layer where it activates guanylate cyclase leading to smooth muscle cell relaxation [318-
320]. In addition to its role in the maintenance of vascular tone, NO helps to maintain the anti-
atherogenic character of the normal vascular wall. NO, in concert with various cell signaling
molecules, has been demonstrated to maintain smooth muscle cell quiescence and as such,
counteracts pro-proliferative agents, specifically those involved in the propagation of athero-
proliferative disorders [24-29, 322]. As such, eNOS dysfunction is an early symptom of vascular
disease and is manifested through insufficient NO bioavailability. Among the potential
mechanisms proposed for this NO deficiency is the uncoupling of NOS and subsequent
production of superoxide anion radical (O2.-)
![Page 117: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/117.jpg)
117
Our laboratory and others have demonstrated that when cells are depleted of the NOS
substrate L-Arginine (L-Arg) or the cofactor tetrahydrobiopterin (H4B), NOS switches from
production of NO to O2.- [310, 323-329]. In the absence of either of these requisite substrates or
co-factors, NOS mediated NADPH oxidation is uncoupled from NO synthesis and results in the
reduction of O2- to form O2.-
[323, 324, 328, 330]. O2.- exerts cellular effects on signaling and
function that are quite different and often opposite to those of NO. Thus, O2.- is another very
important NOS product, and its production may also be regulated by methylarginines.
Furthermore, in view of their strong inhibition of NO generation, methylarginines could
profoundly modulate the balance of NO and O2.- generation from the enzyme.
ADMA and L-NMMA are derived from the proteolysis of various proteins containing
methylated arginine residues. The methylation is carried out by a group of enzymes referred to
as protein-arginine methyl transferases (PRMTs). Subsequent proteolysis of proteins containing
methylarginine groups leads to the release of free methylarginine into the cytoplasm where NO
production from NOS is inhibited [35, 298, 317]. In addition to inhibition of NO generation,
methylarginines may have other important effects on NOS function.
Cytosolic L-Arg concentrations are generally in the range of 100 to 200 μM, and moderate
L-Arg depletion has been observed in conditions such as wound healing and aging [306, 331-
336]. The redox active cofactor H4B has been shown to be highly susceptible to oxidative stress.
Oxidation of H4B has been shown to result in NOS-derived O2.- generation [326, 327]. We have
previously reported on the effects of methylarginines on nNOS-derived O2.- generation, however,
little is known regarding the effects on eNOS [312]. Although L-NAME has been shown to
block O2.- production from eNOS, studies using L-NMMA have suggested that this endogenous
methylarginine does not appear to inhibit O2.- generation [324, 328, 329]. Furthermore, the
![Page 118: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/118.jpg)
118
effects of ADMA on O2.- release from eNOS have not been reported. In addition, there have
been no studies of the effects of endogenous methylarginines on the O2.- production that occur in
H4B -depleted enzyme. Therefore, critical questions remain regarding the fundamental effects of
methylarginine analogues on eNOS function and the process of O2.- release from the enzyme.
Since the levels of the intrinsic methylarginines, L-NMMA and ADMA, have been shown to be
sufficient to modulate basal eNOS function in a variety of cardiovascular disease settings, it is
critical to understand the concentration-dependent effect of these compounds on O2.- generation
from the enzyme.
Therefore, in the present study, we have applied EPR spectroscopy and spin trapping
techniques to measure the dose-dependent effects of ADMA and L-NMMA on the rates of O2.-
production from eNOS under conditions of H4B depletion with normal or depleted levels of L-
Arg. We observe that while both of these endogenous methylarginines inhibit NO formation
from H4B -repleat eNOS, in the presence of uncoupled-eNOS they significantly enhance eNOS-
derived O2.-. In addition, we observed that the native NOS substrate, L-Arg, also enhances
eNOS-derived O2.-. All of these substrates, result in enhanced NADPH consumption and shift in
heme spin state of eNOS resulting in increased eNOS derived O2.-. This observation has
important pathological relevance as NOS uncoupling is know to occur in a variety of
cardiovascular diseases.
Materials and Methods
Expression and Purification of the Human Full Length eNOS and eNOS Oxygenase Domain (eNOSox)
Human eNOS and eNOSox were expressed in E. coli similar to that previously described
[337] and purified using metal affinity chromatography on a HisTrap FF column (GE
Biosciences), followed by size exclusion chromatography using a HiLoad 16/60 Superdex 200
![Page 119: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/119.jpg)
119
column (GE Biosciences). Full-length human eNOS and eNOSox expressed in bacteria are
devoid of biopterin. All eNOS preparations were stored at liquid nitrogen temperature in buffer
containing 50 mM HEPES, pH 7.5, 10% glycerol, and 0.15 M NaCl. H4B (+) eNOS and H4B (+)
eNOSox were prepared by anaerobic incubation of purified proteins with 1 mM H4B and 1 mM
L-Arginine overnight at 4°C. Excess H4B and L-Arginine were removed by gel filtration through
a HiTrap desalting column at 4°C. Protein fractions were pooled, concentrated by Centriprep 30
(Amicon), and stored at liquid nitrogen temperature in the buffer described above. Typical NO
generation activity of the final purified eNOS ranged between 80-120 nmol/mg/min, with eNOS
concentration based upon heme content as determined by the pyridine hemochromogen assay.
EPR Spectroscopy and Spin Trapping
Spin-trapping measurements of NO and oxygen radical generation was performed using a
either a Bruker ER 300 or a Bruker EMX spectrometer. The reaction mixture consisted of
purified eNOS (50 nM) in 50 mM Tris, pH 7.4, containing 1 mM NADPH, 1 mM Ca2+, 30 μM
EDTA, 10 μg/ml calmodulin, and 10 μM H4B. For NO measurements, 25 nM eNOS and 100
μM L-Arg was added to the reaction system with Fe2+-MGD (0.5 mM Fe2+ and 5.0 mM MGD)
used to trap NO, as previously described [338]. The samples were measured at X-band in a
TM110 cavity. Spectra were obtained using the following parameters: microwave power; 20 mW,
modulation amplitude; 3.16 G, modulation frequency; 100 kHz. For the detection of O2.-, eNOS
(50 nM) was used in a reaction system containing 10 mM DEPMPO as the spin-trap. Spectra
were obtained using the following parameters: microwave power; 20 mW, modulation
amplitude; 0.5 G, modulation frequency; 100 kHz. Although multiple EPR spectrometers were
used for the studies, quantitation of the free radical signals was normalized to each system by
comparing the double integral of the observed signal with that of a known concentration of
![Page 120: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/120.jpg)
120
TEMPO free radical in aqueous solution. To quantify rates of O2.- generation, adduct signals
were corrected for trapping efficiency and decay rate as previously described [339, 340]. Rates
of O2.- formation were determined from the DEPMPO-OOH signal over the first 20 minutes of
acquisition.
NADPH Consumption by eNOS
NADPH oxidation was followed spectrophotometrically at 340 nm [326]. The reaction
systems were the same as described in EPR measurements, and the experiments were run at room
temperature. The rate of NADPH oxidation was calculated using an extinction coefficient of
6.22 mM-1 cm-1.
UV/Visible Spectroscopy
Spectra were recorded on H4B-free eNOSox (7.5 µM) in 50 mM sodium phosphate (pH
7.4) from 300 to 800 nm, and then again in the presence of either ADMA (500 uM) or L-NMMA
(500 uM) using an Agilent 8453 diode array spectrophotometer.
Results
Effects of Methylarginines on O2.- Production from H4B Free eNOS
We have previously reported that in the absence of H4B, NOS generates O2.- [328].
Therefore, to measure NOS-derived O2.- EPR measurements were carried out as previously
described with the nitrone spin-trap DEPMPO, which forms a stable O2.- adduct with half life of
∼16 minutes [340]. Initial studies were performed in the presence of L-Arg in order to determine
the ability of H4B-free eNOS to generate O2.-. EPR results demonstrated a significant DEPMPO
O2.- adduct which was inhibited by >80% in the presence of L-NAME (1 mM) and imidazole (5
mM). In addition, in the absence of Ca2+, O2.- generation was almost completely blocked (Figure
5-1). These results demonstrate that the observed O2.- generation is eNOS-dependent and largely
generated from the oxygenase domain, as the signal was quenched with imidazole.
![Page 121: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/121.jpg)
121
Subsequent studies were performed in order to determine the concentration-dependent
effects of ADMA, L-NMMA and L-Arginine on O2.- production from eNOS. EPR spin-trapping
measurements were performed on H4B -free eNOS as described in the methods. Purified eNOS
was incubated in L-Arginine free buffer in the presence of NOS cofactors (NADPH, calmodulin,
calcium). In the absence of L-Arg, eNOS gave rise to a strong DEPMPO-OOH signal
characteristic of trapped O2.- (Figure 5- 2). The effects of ADMA on O2
.- release were then
determined by adding varying concentrations of ADMA (1.0 to 100 μM). ADMA dose-
dependently increased NOS-derived O2.- generation, with a 43 % increase at 1.0 μM, a 125 %
increase at 10 μM, and a 151 % increase at 100 μM ADMA (Figure 5-2). Experiments were
repeated in the presence of L-NMMA (1.0-100 μM). L-NMMA dose-dependently increased
NOS-derived O2.- generation similar to that observed with ADMA, with a 18 % increase at 1.0
μM, a 80 % increase at 10 μM, and a 102 % increase at 100 μM L-NMMA (Figure 5- 3). A final
set of experiments were carried out to examine previous observations that the native substrate L-
Arginine is capable of increasing eNOS-derived O2.- (21). Results demonstrated that L-Arginine
dose-dependently increased eNOS-derived O2.- with a 26 % increase at 1.0 μM, a 116 % increase
at 10 μM, and a 152 % increase at 100 μM L-Arginine (Figure 5-4). These results demonstrate
that when eNOS is depleted of the critical cofactor H4B, as has been shown to occur under
conditions of oxidative stress, ADMA, L-NMMA and L-Arginine enhance O2.- generation.
Subsequent studies were then performed using an in-vitro system which could more
closely mimic the disease setting wherein eNOS is uncoupled through reduced H4B
bioavailability and cellular methylarginines are elevated in the presence of normal physiological
levels of L-Arginine. Using this model, we measured the effects of ADMA and L-NMMA on
H4B-free eNOS-derived O2.- production in the presence of physiological levels of L-Arg (100
![Page 122: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/122.jpg)
122
μM). As expected exposure to L-Arginine increased the rate of O2.- production 3 fold, and this
increase was only mildly affected by the addition of ADMA (0.1 - 100 μM) (Figure 5-5). In
contrast, L-NMMA (0.1 -100 μM) inhibited the formation of the observed O2.- adduct, with a
~30 % inhibition of the arginine-induced increase at 100 μM L-NMMA (Figure 5-6). Taken
together, these results suggest that L-Arginine, ADMA, and L-NMMA, independently increase
eNOS-derived O2.-. However, in the presence of physiological levels of L-Arginine, ADMA has
little effect on eNOS-derived O2.-, while L-NMMA inhibits O2
.-. We hypothesized that these
effects are mediated through alterations in the heme reduction potential upon ligand binding,
leading to a faster transfer of electrons from the reductase domain to the heme. If so, we would
then expect to observe an increase in NADPH consumption rate as a consequence of increased
electron flow through the heme.
Effects of methylarginines and L-Arginine on NADPH Consumption from H4B-Free eNOS
Experiments were performed to determine the effects of ADMA, L-NMMA and L-Arg on
NADPH consumption rate from H4B-free eNOS. Results demonstrated that ADMA dose-
dependently increased the rate of NADPH consumption from H4B-free eNOS from an initial rate
of 55 nmols/mg/min at 0 μM ADMA to 86 nmols/mg/min at 10 μM (Table 5-1). L-NMMA also
dose-dependently increased NADPH consumption rate with values of 79 nmols/mg/min
observed in the presence of 10 μM L-NMMA (Table 5-1). L-Arginine had the most pronounced
effects and like the methylarginines dose-dependently increased the rate of NADPH
consumption with an observed rate of 92 nmols/mg/min at 10 μM L-Arginine (Table 5-1).
Results from these studies support our previous observations that methylarginines and L-
Arginine enhance electron flux through the H4B -free enzyme, thus increasing O2.- generation.
![Page 123: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/123.jpg)
123
Effects of Methylarginines on the Heme of eNOSox
L-Arginine and L-NMMA binding to NOS is known to alter the spin-state of the heme
iron, and this change in spin-state is accompanied by a blue-shift in the Sorret absorbance peak
of the NOS heme [341-344]. By using only the oxygenase domain we can remove any spectral
contributions due to the flavins. Additionally, expression of eNOSox is much more robust than
the full length enzyme. Therefore, studies were performed in order to measure the effects of
methylarginine binding on the heme spin-state of the eNOS-oxygenase domain. Results
demonstrated that, both ADMA and L-NMMA caused a blue-shift in the Soret absorbance, from
a ~412 nm in the resting eNOSox to ~397 nm (Figure 5-7). Thus, just as for arginine and L-
NMMA, binding of ADMA produces a shift in the eNOS heme spin state to high-spin.
In summary, these results demonstrate for the first time that the methylarginines as well as
the native NOS susbtrate, L-Arginine, enhance O2.- generation from H4B -free eNOS. We
hypothesize that these effects are mediated through increased electron transfer to the heme via a
mechanism involving a change in the heme spin-state and the associated increase in the heme
reduction potential that occurs upon inhibitor/substrate binding.
Discussion
It is well known that the endogenous methylarginine derivatives, ADMA and L-NMMA,
are capable of regulating NO generation from purified eNOS, and we have previously shown that
their intrinsic levels in the endothelium are ∼10 μM and are able to basally regulate endothelial
NO production [306]. However, their role in controlling O2.- release from the enzyme was
unknown. Therefore, the current studies were carried out in order to characterize and quantify
the dose-dependent effects of L-Arginine and the endogenous methylarginines on the O2.-
generation from eNOS.
![Page 124: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/124.jpg)
124
Over the last several years, studies have shown that in addition to producing NO, NOS is
also capable of producing O2.- under conditions of L-Arginine or tetrahydrobiopterin depletion
[310, 324-328]. In the endothelium, this ·O2- generation has been shown to be a significant
mechanism of cellular injury [306, 328]. Although questions remain regarding the severity of
these conditions that arise in normal cells, there is evidence that normal cellular oxidation of H4B
can increase O2.- release [327]. Furthermore, a range of disease conditions favor H4B depletion.
These include hypertension, diabetes, ischemia/reperfusion injury, and inflammatory processes
[331-333, 345-349].
While prior studies have demonstrated that loss of the critical NOS cofactor, H4B, results
in NOS uncoupling and subsequent O2.- generation from the enzyme, the effects of the native
substrate L-Arginine and its methylated NOS inhibitors, ADMA and L-NMMA, on eNOS-
derived O2.- have been previously unknown. Prior studies from our laboratory have
characterized the effects of ADMA and L-NMMA on nNOS-derived O2.-. Results from the
neuronal isoform demonstrated that that the endogenous methylarginines, ADMA and L-NMMA
modulate NO production and that their effects on O2.- generation are H4B dependent. In the
presence of H4B, ADMA selectively inhibited O2.- generation from the enzyme, while L-NMMA
had no effect despite their structural similarities. However, when NOS was depleted of H4B,
ADMA no longer had any effect on O2.- production, while L-NMMA treatment resulted in a
marked increase in O2.- production from the enzyme. Based on these observations, we carried
out an extensive set of studies aimed at establishing the role of the methylarginines in regulating
eNOS-derived O2.-.
Initial experiments were carried out in order to determine the ability of eNOS to produce
O2.-. Results demonstrated that in the absence of H4B, eNOS gave rise to a strong DEPMPO-
![Page 125: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/125.jpg)
125
OOH adduct characteristic of O2.-. This signal was calcium-dependent and largely quenched in
the presence of L-NAME (1 mM) and imidazole (5 mM). Thus the observed O2.- generation is
eNOS-dependent and largely generated from the heme of the oxygenase domain as the signal
was quenched with imidazole.
We observed that both ADMA and L-NMMA dose-dependently enhanced O2.- generation
from eNOS in the absence of H4B. A significant, (43%) enhancement, of NOS-derived O2.- was
seen with 1 μM ADMA, increasing to a 151% enhancement at 100 μM. Of note, this O2.-
production is blocked by imidazole indicating that the observed increase is due to an increase in
heme-derived O2.-. Results obtained using L-NMMA demonstrated that the monomethylarginine
also enhanced heme-dependent ·O2- production with an 18% increase observed at 1.0 μM
reaching a maximum of 102% at 100 μM.
Furthermore, the native eNOS substrate, L-Arg, which had been previously thought to
reduce NOS generated O2.-, also significantly enhanced O2
.-production from H4B-free eNOS in a
dose-dependent manner. At 1 μM, L-Arginine increases NOS-derived ·O2- generation by 26%,
116% at 10 μM and by 152% at 100 μM. In support of our observations, it has recently been
reported that the oxygen consumption of H4B -replete eNOS is also stimulated by the addition of
arginine [350, 351]. These results have important pathophysiological relevance, as normal
cellular levels of L-Arg exceed 100 μM and would thus be expected to significantly augment
NOS-derived O2.- under conditions of reduced H4B bioavailability. This raises important
questions with regards to the current practice of nutraceutical supplementation with L-Arg in the
treatment of cardiovascular diseases such as hypertension and atherosclerosis in which NOS-
uncoupling is known to occur through oxidative loss of the cofactor H4B. In this setting, L-
![Page 126: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/126.jpg)
126
Arginine supplementation may actually exacerbate the disease resulting in increased NOS-
derived O2.- and further reduced NO bioavailability.
Next we performed studies to determine the effects of the ADMA and L-NMMA on
eNOS-derived O2.- in the presence of physiological levels of L-Arg (100 μM). Results from
these studies demonstrated that the addition of ADMA and L-NMMA did not further increase
NOS-derived O2.- and in fact, L-NMMA decreased O2
.- with a ~30% reduction observed at 100
μM L-NMMA. Thus, as arginine is replaced by L-NMMA there is decreased enhancement of
the eNOS-derived O2.-, because L-NMMA binding produces less stimulation of the eNOS-
derived O2.- compared to the stimulation induced by L-Arginine binding. ADMA competition
has very little effect because ADMA and L-Arginine binding produce very similar levels of
stimulation of eNOS-derived O2.-. It should be noted that the precise interpretation of the
competition data must include differences in binding affinities and binding cooperatively for L-
Arg, ADMA, and L-NMMA. Nevertheless, our results suggest that under normal or pathological
conditions wherein total methylarginines would not be expected to exceed 20-30 μM, their major
effect on eNOS would be to inhibit NO generation with only modest effect on NOS-derived O2.-.
However, if L-Arginine levels are low, the methylarginines would then increase NOS-derived
O2.- from uncoupled eNOS. These results differ significantly from what was previously observed
with nNOS, wherein we demonstrated that only L-NMMA was capable of enhancing nNOS-
derived O2.- generation. In this previously published study [312], we demonstrated that L-
Arginine and ADMA had no effect on nNOS-derived O2.- under conditions of H4B /L-Arg
depletion, while L-NMMA increased O2.- production by greater than 2 fold. Moreover, when
experiments were carried out using H4B -free nNOS in presence of L-Arg (100 µM), L-NMMA
![Page 127: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/127.jpg)
127
effects were maintained and O2.- generation dose-dependently increased with L-NMMA
concentration, while ADMA had no effect [312].
The mechanism of O2.- production from the heme in NOS first requires the transfer of an
electron from the reductase domain to the heme, generating the ferrous iron which can bind
oxygen. Subsequently, the one electron reduced O2.- can dissociate, regenerating the ferric heme.
The rate limiting step in this process for eNOS is the initial reduction of the heme [352, 353]. As
such, if the reduction of the heme is made more favorable, then the rate of O2.- production will be
increased. It has been shown that binding of arginine and L-NMMA to the NOS isoforms
produces a shift in heme spin-state, which can be monitored spectrophotometrically. This
arginine-induced shift in spin-state is accompanied by an increase in the NOS heme redox
potential to less negative values [354], theoretically this would produce an increased rate of
electron transfer from the reductase domain to the heme. This correlation between spin-state and
heme midpoint potential is also found in the related cytochrome P450 family [355, 356].
Furthermore, it is known that the less negative heme redox potential produced by L-Arginine
binding to the inducible NOS (iNOS) is accompanied by an increase in NADPH oxidase activity
[357]. Thus, we hypothesized that the mechanism for the observed arginine and methylarginine-
enhanced O·2
- production was via an increase in electron flow through eNOS produced by a
change in the heme redox potential in response to a ligand-induced change in heme spin-state.
Indeed, we found that just like L-Arginine and L-NMMA, ADMA binding to eNOS
produced a shift in the heme to the high-spin state, which in turn will result in a less negative
heme redox potential. Results from the NADPH consumption studies supported this hypothesis
and demonstrated that ADMA, L-NMMA and L-Arginine dose-dependently increased electron
transfer through the heme, consistent with a ligand-induced increase in heme reduction potential.
![Page 128: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/128.jpg)
128
The rate of NADPH consumption increased in the following order: no-substrate < L-NMMA <
ADMA < L-Arg. These data support the hypothesis that the inhibitory actions of the
methylarginines on O2.- generation in the presence of L-Arginine resulted from less enhancement
of electron transfer relative to L-Arginine. Thus, taken together our data support the hypothesis
that ligand-induced changes in the heme spin-state induced by L-Arginine and the
methylarginines are at least partially responsible for the observed increase in eNOS-derived O2.-.
However, it is clear that there are other factors to consider.
L-NAME, which also induces the formation of the high-spin eNOS upon binding, very
effectively inhibits O2.- formation from eNOS. This discrepancy has been noted for iNOS, and it
was proposed that an electrostatic interaction between an electron rich ligand and the NOS heme
inhibits reduction of the NOS heme and thus decreases NADPH oxidation [358]. Conversely, an
electrostatic interaction between a positively charged arginine or methylarginine side chain and
the heme iron, would theoretically favor the ferrous form of the heme, producing a less negative
midpoint potential, and thus increasing the rate of electron transfer to the heme. Additionally,
substrate binding is known to stabilize the dimeric form of the enzyme, and since heme reduction
is via an inter-monomer electron transfer, this ligand-induced structural stabilization could affect
the rate of this transfer.
It has been proposed that the NOS isoforms can produce H2O2 via a two electron reduction
of molecular oxygen [351, 359, 360]. For this to occur, the rate of transfer of a second electron
to the ferrous-heme O2.- complex, either from H4B or from the reductase domain, must exceed
the rate of superoxide release. It has been demonstrated that in the absence of L-Arginine (or
other substrate) the sole product of H4B -free eNOS is O2.- [351]. It is possible that our proposed
substrate-induced increase in reductase-to-heme transfer rate in the H4B-free eNOS could allow
![Page 129: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/129.jpg)
129
for the direct production of H2O2. However, in preliminary experiments comparing O2.-
consumption to NADPH oxidation of the H4B -free enzyme, the addition of substrates produced
similar increases in both O2.-consumption and NADPH oxidation (unpublished results). Thus,
although more definitive work is necessary, we have found no evidence for the
substrate/inhibitor-induced direct production of H2O2 from uncoupled eNOS.
In conclusion, the substrate L-Arginine, and the endogenous inhibitors ADMA and L-
NMMA, increase the O2.-generation from uncoupled eNOS by making the transfer of electrons to
the heme more favorable via mechanisms involving the modulation of the heme spin-state,
altering the electrostatic environment of the heme, and/or by altering the structural stability of
the active dimer. These findings have important clinical implications as methylarginine levels
have been demonstrated to be elevated in a variety of cardiovascular diseases associated with
oxidative stress. In addition, L-Arginine supplementation in these conditions may exacerbate the
NOS uncoupling observed in these conditions.
![Page 130: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/130.jpg)
130
Figure 5-1. Inhibition of NOS-derived O2.- from H4B depleted eNOS. EPR spin-trapping measurements of O2.- production from eNOS (50 nM) were performed in the presence of L-arg (100 µM) as described in Methods. The right panel shows the spectra of the O2.- adduct observed. The left panel shows the total amount of NOS-derived O2.-generation occurring over a 30-minute period. The results show the effects of L-NAME (500 μM), Imidazole (1 mM) and Ca2+-CAM removal on NOS-derived O2.- production. Both inhibitors largely blocked NOS-derived O2.- generation. In the absence of calcium and calmodulin, no signal was observed. Results shown represent the mean ± SEM of 5 experiments.
![Page 131: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/131.jpg)
131
Figure 5-2. Effects of ADMA on eNOS-derived O2.-. EPR spin-trapping measurements of O2
.- production from H4B-free eNOS (50 nM) were performed with the addition of ADMA (0.01-100 μM) and NOS cofactors as described in Figure 5-1. The right panel shows the spectra observed after 30 min. The DEPMPO-OOH adduct signal was clearly seen. The left panel shows the time-course of NOS-derived O2
.- generation determined from the observed EPR spectra recorded over a 40-minute period in a series of experiments. Results graphed are the mean ± SEM. In the absence of H4B, NOS gave rise to a prominent DEPMPO-OOH signal characteristic of O2
.- and this was dose-dependently increased by ADMA (1.0 μM-100 μM).
![Page 132: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/132.jpg)
132
Figure 5-3. Effects of L-NMMA on eNOS-derived O2.- EPR spin-trapping measurements of O2
.- production from H4B-free eNOS (50 nM) were performed with the addition of L-NMMA (0.01-100 μM) and NOS cofactors as described in Figure 5-1. The right panel shows the spectra observed after 30 min. The DEPMPO-OOH adduct signal was clearly seen. The left panel shows the time-course of NOS-derived O2
.- generation determined from the observed EPR spectra recorded over a 40-minute period in a series of experiments. Results graphed are the mean ± SEM. In the absence of H4B, NOS gave rise to a prominent DEPMPO-OOH signal characteristic of O2
.- and this was dose-dependently increased by L-NMMA (1.0 μM-100 μM).
![Page 133: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/133.jpg)
133
Figure 5-4. Effects of L-arg on eNOS-derived O2.- EPR spin-trapping measurements of O·
2- production from H4B-free eNOS (50 nM)
were performed with the addition of L-arg (0.01-100 μM) and NOS cofactors as described in Figure 5-1. The right panel shows the spectra observed after 30 min. The DEPMPO-OOH adduct signal was clearly seen. The left panel shows the time-course of NOS-derived O·
2- generation determined from the observed EPR spectra recorded over a 40-minute period
in a series of experiments. Results graphed are the mean ± SEM. In the absence of H4B, NOS gave rise to a prominent DEPMPO-OOH signal characteristic of O2
.- and this was dose-dependently increased by L-arg (1.0 μM-100 μM).
![Page 134: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/134.jpg)
134
Figure 5-5. Effects of ADMA on O2.- production from H4B-depleted NOS in the presence of L-arg. EPR spin-trapping
measurements of O·2
- production from eNOS (50 nM) were performed in the presence of 100 μM L-arg, with the addition of ADMA (0.1-100 μM) and NOS cofactors (w/o H4B) as described in Figure 5-1. Results show the time-course of NOS-derived O2
.- generation determined from the observed EPR spectra recorded in a series of experiments. H4B depleted eNOS gave rise to a prominent DEPMPO-OOH signal characteristic of O2
.-, which was increased in the presence of L-arg and unaffected by ADMA (0.1-100 μM). Results graphed are the mean ± SEM.
![Page 135: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/135.jpg)
135
Figure 5-6. Effects of NMMA on NOS-derived O2.- in the presence of L-arg. EPR spin-trapping measurements of O2
.- production from eNOS (50 nM) were performed in the absence of 100 μM L-arg, with the addition of NMMA (0.1-100 μM) and NOS cofactors as described in Figure 5-1. Results show the time-course of NOS-derived O2
.- generation determined from the observed EPR spectra recorded in a series of experiments. H4B-depleted eNOS gave rise to a prominent DEPMPO-OOH signal characteristic of O2
.-, which was increased in the presence of L-arg and unaffected by ADMA (0.1-100 μM). Results graphed are the mean ± SEM.
![Page 136: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/136.jpg)
136
Figure 5-7. Methylarginines alter the eNOS-bound heme. The UV/Vis spectrum for the eNOS oxygenase domain (7.5 µM) in 50 mM sodium phosphate (pH 7.4) was recorded from 300 to 800 nm, and then again in the presence of either ADMA (500 uM) or NMMA (500 uM).
![Page 137: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/137.jpg)
137
Table 5-1. Effects of Methylarginines and L-arg on NADPH consumption from H4B-free eNOS (100 nM) Substrate 0.0 µM 0.1 µM 1.0 µM 10.0 µM L-arginine 55±2 67±3 79±3 92±4 ADMA 55±2 62±2 74±3 86±2 L-NMMA 55±2 61±3 70±4 79±3 The dose-dependent effects of ADMA, L-NMMA and L-arg on NADPH oxidation was followed spectrophotometrically at 340 nm [326]. The reaction systems were the same as described in EPR measurements, and the experiments were run at room temperature for 2 minutes. Results are ± SEM.
![Page 138: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/138.jpg)
138
CHAPTER 6 REGULATION OF DIHYDROFOLATE REDUCTASE IN THE DIABETIC ENDOTHELIUM
Introduction
Endothelial derived Nitric Oxide (NO) is synthesized from the oxidation of the guanidino
carbon of the amino acid L-Arginine to NO and L-citrulline. This reaction is catalyzed by the
enzyme nitric oxide synthase (NOS). NO is a potent vasodilator and critical effector molecule
involved in the maintainence of vascular homeostasis, through its anti-proliferative and anti-
thrombotic effects. NO, in concert with various cell signaling molecules, has been demonstrated
to maintain vascular smooth muscle cell quiescence and as such, counteracts pro-proliferative
agents specifically those involved in the propagation of athero-proliferative disorders. Diabetes
has long been associated with increased oxidative stress and impaired vascular function. NOS
dysregulation and decreased NO bioavailability have been implicated as a central mechanism in
vascular endothelial dysfunction observed in diabetes. Several studies have demonstrated that
while eNOS protein levels are increased in the diabetic state, NO bioavailability decreases and
superoxide production increases [361]. Among the proposed mechanisms that lead to decreased
NO bioavailability and eNOS uncoupling is oxidation of the essential NOS cofactor
Tetrahydrobipetrin (H4B). In vitro studies have demonstrated that H4B stabilizes and donates
electrons to the ferrous-dioxygen complex in the oxygenase domain of eNOS to help facilitate
the oxidation of the substrate L-Arginine. Furthermore, studies have demonstrated that depletion
of H4B causes electrons to be donated to molecular oxygen, turning NOS from a NO generating
enzyme to an oxidase. This phenomenon has been termed “NOS uncoupling” and it has been
documented in the pathophysiology of various diseases including atherosclerosis and diabetes
(56,119,120). H4B is highly redox sensitive and can be readily oxidized to its inactive form
dihydrobiopterin (H2B). Therefore, it is likely that during increased oxidative stress intracellular
![Page 139: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/139.jpg)
139
levels of H4B fall leading to NOS uncoupling and the enzyme primarily being a O2- generating
enzyme.
The synthesis of H4B occurs via two pathways in the endothelial cell, the de novo and
salvage pathways (Figure 6-1). De novo biosynthesis of H4B is a magnesium, zinc and NADPH
dependent pathway. The first step requires the conversion of GTP to 7,8-dyhydroneopterin
triphosphate. This reaction is catalyzed by the enzyme GTP cyclohydrolase I (GTPCH), and it is
the rate limiting step in H4B biosynthesis [52]. Following the GTPCH enzyme reaction
pyruvoyl tetrahydropterin synthase (PTPS) converts 7,8 dihydroneopterin triphosphate into 6-
pryuvoyl-5,6,7,8-tetrahydropterin. Alternatively, the salvage pathway enzyme dihydrofolate
reductase (DHFR) is a NADPH dependent enzyme that catalyzes the conversion of H2B to H4B
(140). The functionality of the DHFR enzyme in the endothelial cell was unknown until
recently. The strongest evidence for the involvement of DHFR involvement in regulating
endothelial NO production has come from DHFR gene silencing studies. Specifically,
Chalupsky et al. demonstrated that DHFR gene silencing resulted in a significant reduction in
H4B levels, as well as a 50% reduction in endothelial NO production [133]. Furthermore, DHFR
over-expression was able to abolish the production of O2.- in angiotensin II stimulated cells
[133]. Because DHFR activity has been demonstrated to be involved in the regulation of NO
bioavailability, it is important to understand how the enzyme activity is affected in disease states.
Therefore, studies were carried out to determine the effects of oxidative stress and
metabolic dysregulation on DHFR activity. We observed that DHFR is highly resistant to most
oxidants at concentrations within the pathophysiological range. We also observed that at low
concentrations of OONO- DHFR activity is significantly increased. Additionally, using the
diabetic db/db mouse model we observed reduced DHFR activity, impaired vascular function
![Page 140: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/140.jpg)
140
and increased eNOS derived superoxide in the aorta. These observations have important
implications for the role of oxidative stress and its effects on DHFR activity as it relates to the
diabetic state.
Materials and Methods.
Materials
DHFR, H2O2, Xanthine and Xanthine Oxidase were purchased from Sigma-Aldrich (St
Louis, MO). Peroxynitrate was purchased from Millipore(Lake Placid,NY) Diethylamine
NONOate was purchased from Sigma=Aldrich(St.Louis, MO)
DHFR Activity Assay
For kinetic measurements of enzyme activity, human recombinant DHFR (6.0 ug) was
incubated for 5 minutes at 25°C in 50 mM Tris buffer (pH 7.5) in the presence of .01-1000 µM
substrate with a total reaction volume of 100 µl. Following incubation each sample was added to
a 96 well plate and NADPH consumption was measured at 340 nM. The rate of NADPH
consumption was calculated using an extinction coefficient of 6.22 mM-1cm-1.
Tissue DHFR Activity
For kinetic measurements of tissue DHFR activity, kidneys were removed from age
matched control mice and db/db mice on a C57/Blk6 background. The samples were
homogenized in diionized water with ascorbic acid (1 mg/ml) to prevent auto-oxidation. Protein
concentration was measured by the Bradford assay. 250 µg of protein, 200 µm H2B and 1 mM
NADPH were incubated together for 30 minutes at 37°C in a water bath. Following the
incubation the samples were then loaded into a Centricon filter with a 3,000 molecular weight
cut off and centrifuged at 10,000 x g, 4° C for 60 minutes.
![Page 141: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/141.jpg)
141
HPLC Techniques
DHFR activity assay was performed by measuring the conversion of H2B to H4B using
HPLC techniques.20 µl of the filtrate was then injected into onto the HPLC column using an
ESA HPLC with electrochemical gradient detection a 400 mV and 800 mV. The mobile phase
consisted of Buffer A (100 mM KH2 PO4,25 mM octyl sodium sulfate,0.6 mM EDTA PH 2.5),
Buffer B (2% MeOH) run at room temperature with a flow rate of 1.3 ml/ml
Vascular Reactivity
Contraction and relaxation of isolated aortic rings were measured in an organ bath
containing modified Krebs-Henseleit buffer (118 mM NaCl,24 mM NaHCO3,4.6 mM KCl,1.2
mM NaH2PO4,1.2 mM CaCl2,4.6 mM HEPES and 18 mM glucose) aerated with
95%CO2/5%O2,37°C. Aortic rings were cut inton 2-to3 mm segments and mounted on a wire
myograph (Danish Myo, Aarhus, Denmark). Contraction was measured via a force transducer
interfaced with Chart software for data analysis. Following a 30-min incubation equilibration
period, the rings were stretched to generate a tension of 0.5 g. The optimum resting force of the
aortic rings was determined by comparing the force developed by 40 mM KCL under varying
resting force. Aortic rings were preconstricted with 1 µM phenylephrine. The vascular relxation
response was determined using increasing concentrations of acetylcholine (0.1 nM to 10 µM)
EPR Spin Trapping Studies
Given the millisecond-range half-life of superoxide in situ, electron paramagnetic
resonance (EPR) assay involves the approach of using the superoxide spin-trap, 1-hydroxy-3-
methoxycarbonyl-2,2,5,5-tetramethyl pyrrolidine HCl (CMH hydrochloride; Axxora) (8, 9, 11,
16, 18) to generate a stable chemical product, 3-methoxycarbonyl- proxyl, by a general method.
Stock solution of CMH (10 mM) dissolved in EPR buffer [PBS containing 2µM
Diethyldithiocarbamate (Sigma-Aldrich) and 50 µM Desferrioxamine (Sigma-Aldrich)] and
![Page 142: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/142.jpg)
142
purged with Nitrogen, were prepared daily and kept under nitrogen on ice. Six aortic ring
segments (1 mm) were placed in EPR buffer. CMH at a concentration of 50 µM was then added
and incubated at 37°C for 60 min with and without L-NAME (1 mM). Frozen samples were
analyzed with a Benchtop ESR Spectrometer (Bruker Biospin) in a finger Dewar filled with
liquid nitrogen with following EPR settings: microwave frequency 9.7 GHz, microwave power
1.2 mW, modulation amplitude 6.7 G, conversion time 10.3 ms and time constant 40.96 ms.
Results
Enzyme Kinetics of DHFR
Enzyme kinetic studies were performed to establish the Km and Vmax values for H2B. The
kinetic activity of human DHFR (hDHFR) was measured by the detection of NADPH
consumption as described under the “Material and Methods.” Km and Vmax values were derived
using the Michaelis-Menten equation and generated values of 48 µM and 6.7 µmols/mg/min,
respectively (Figure 6-2).
Effect of Oxidants on DHFR Activity
Previous studies have demonstrated that DHFR expression can be affected following
exposure to H2O2. Because H4B is known to be highly sensitive to oxidants leading to its
oxidation to H2B, it may also be possible that DHFR is modulated by the redox environment
which could result in impaired H4B recycling. Therefore, we carried out a series of studies
aimed at determining the dose dependent effects of NO, OONO-, H2O2, and O2.-on DHFR
activity. NO studies were carried out using the NO donor compound DEANONate (1 µM-1
mM). H2O2 (1 µM-1 mM) and OONO- (0.01 µM-1 mM) studies were carried out using the
authentic oxidant. For O2- , we used a generating system consisting of xanthine and xanthine
oxidase (1 μM-1 mM). In order to prevent Fenton type reactions in the H2O2 experiments, the Fe
chelator DTPA (100 µM) was added. The exposure of DHFR to oxidants was found to have a
![Page 143: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/143.jpg)
143
modest effect on enzyme activity. Results demonstrated that following exposure to NO, hDHFR
activity was dose dependently reduced with 38 % inhibition observed at 100 µM NO and 53%
inhibition observed at 1 mM (Figure 6-3). Results also demonstrated that exposure to H2O2 dose
dependently decreased activity with 31% inhibition at 100 µM H2O2 and 53% inhibition at 1 mM
(Figure 6-4). Furthermore, O2-dose dependently inhibited hDHFR activity as 1 µM and 1 mM
elicited a 28% and 70% inhibition respectively (Figure 6-5). Additional studies demonstrated
that hDHFR activity was significantly increased 56-58% following exposure to 0.01 µM and 1
µM of OONO- (Figure 6-6). In contrast, at the 10 µM and 100 µM concentrations no significant
changes in activity were observed. However, exposure to 1 mM OONO- resulted in a modest
inhibition of 24%.
Effects of the Diabetic State on In-Vivo DHFR Activity
Previous studies have suggested that increases in oxidative stress, as have been observed in
diabetes, contribute to decreased endothelial NO generation through a mechanism involving the
loss of H4B. In support, it has been observed in several studies that H4B supplementation
restores endothelial NO generation (56,54,209). However, whether DHFR activity is also
sensitive to the redox environment is unknown. Therefore, in order to determine the effects of
the diabetic disease state on DHFR activity, basal activity in the kidney of db/db mice and age
matched controls was measured. Using HPLC techniques, hDHFR activity was measured as
described in the “Materials and Methods”. Results demonstrated that db/db mice had
significantly more H2B than the age matched control mice. Furthermore, the control mice
produced significantly more H4B than the db/db mice (Figure 6-7). Overall, these results suggest
that the diabetic condition of the db/db mice results in a significant decrease in DHFR activity,
which is likely involved in eNOS uncoupling as a result of altered B2H/B4H ratios. To confirm
![Page 144: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/144.jpg)
144
this, we preformed additional studies to determine the effects of decreased DHFR activity on
vascular function.
Effects of the Diabetic State on Vascular Reactivity
Our previous results demonstrated that tissue DHFR activity was reduced in the diabetic
db/db mouse model, which resulted in reduced levels of H4B. Therefore, vascular studies were
performed using mouse aortic rings and the vascular relaxation in response to acetylcholine (1
µM) was measured. The percent relaxation to 1 µM Ach was then compared among the control
and db/db groups. Results demonstrated that db/db mice had a 35% reduction in vascular
relaxation in response to 1 µM Ach, when compared to their aged matched controls (Figure 6-8).
Effects of the Diabetic State on eNOS Derived O2.- Production in the Aorta
Previous studies have demonstrated that depletion of H4B under oxidative stress conditions
increases the production of eNOS derived superoxide in the vasculature (54,211). Although our
data demonstrated that db/db mice have a significant reduction in DHFR activity and impaired
vascular function, we wanted to examine whether the loss of DHFR activity would also resulted
in increased vascular eNOS derived O2.-. Therefore, EPR spin trapping studies were carried out
to measure eNOS derived O2.- in the aorta. Results demonstrated that the aorta of db/db mice
produced significant O2.-, while in wt type age matched controls it was undetectable. This
increase in O2.- production was attenuated following exposure to the NOS inhibitor L-NAME
(Figure 6-9). Overall, these studies support the hypothesis that loss of DHFR activity is involved
in the endothelial dysfunction associated with diabetes and that loss of DHFR activity increases
eNOS derived O2.- in the aorta.
Discussion
There is a growing body of evidence indicating that the increased cardiovascular risks
associated with diabetes are due to oxidative stress and eNOS dysfucntion. In support, several
![Page 145: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/145.jpg)
145
studies have reported that the pathology of diabetes results in decreased endothelial NO
production, impaired vascular function, and increases in eNOS derived O2.- generation
(54,56,211). The primary pathway way for H4B synthesis is through the de novo pathway which
involves the rate limiting enzyme GTPCH I. Previous studies have demonstrated that inhibiting
GTPCH I leads to impaired vascular relaxation in response to Ach. Over-expression of GTPCH
I was found to partially restore vascular function in diabetic mice (208). However, under
pathological conditions in which oxidative stress increases and in which H4B can be readily
oxidized, DHFR activity maybe critically important in maintaining H4B levels and endothelial
NO production. Therefore, studies were carried out in order to investigate the redox regulation
of DHFR and its role in diabetic vasculopathy.
Despite its importance of H4B regulation during oxidative stress, few studies have been
done regarding the enzymatic activity of DHFR. Furthermore, the few studies which exist have
been conducted using rat brain homogenates. In this regard, we have recently measured the
kinetic parameters of the human isoform of DHFR. Results from these studies demonstrated the
Km value of 48 µM and Vmax value of 6.7 µmols/mg/min for H2B. The Km value obtained
correlates well with the previously published report in which the value of 88 µM was reported.
However, the maximal enzymatic activity that we report here differs from the previously
published using DHFR from rat brain, in which a value of 30 pmole/mg/min was reported,
however this was for dihydrofolate metabolism, as DHFR is also known to be an important
enzyme in folate metabolism [362].
Cai et al. demonstrated that following exposure to H2O2, DHFR expression decreased in
cultured endothelial cells [133]. These studies suggest that DHFR activity may be modulated by
the redox environment. Therefore, studies were conducted in order to determine the effect of
![Page 146: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/146.jpg)
146
various reactive oxygen and nitrogen species on DHFR activity. Following exposure of DHFR
to NO, OONO-, H2O2, O2-, we observed that at concentrations between 1 µM -100 µM, NO
elicited a 31-38% decrease in DHFR activity. Additionally, at the 1 mM concentration a 53%
loss in enzyme activity was observed. In support of our results, previous studies have
demonstrated that following exposure to NO, proteins can be s-nitrosylated at active cysteine
residues resulting in altered enzyme activity (95,96,97). Similar effects on DHFR activity were
observed following exposure to H2O2. We also observed a dose dependent decrease in DHFR
activity in the presence of O2.- with 1 µM and 1mM eliciting a 28% and 70% decrease in enzyme
activity respectively. Additional studies exposing DHFR to OONO- at low pathophsyiologicaly
relevant concentrations (0.1 µM- 1 µM) demonstrated a significant increase DHFR activity.
This result was surprising as OONO- has been demonstrated to increased eNOS derived
superoxide production in vascular aortic rings, suggesting it has a role in eNOS uncoupling
[363]. In contrast, higher pathophysiological concentrations of OONO-(10-100 µM) resulted in
no change to DHFR activity. Only a modest inhibition of 24% was observed following exposure
to 1 mM OONO- however, this does not represent physiological or pathophysiological relevant
concentrations. Overall these results suggest that the DHFR enzyme is moderatley sensitive to
ROS mediated inhibition in the pathophysiological/physiological relevant dose ranges.
However, OONO- at pathophysiologically relevant levels induced a significant increase DHFR
activity. This is an intriguing finding given that ONOO- has been shown to be the most potent
oxidizer of H4B and may represent a novel compensatory mechanism for the cell to maintain
adequate H2B / H4B ratios.
In prior studies it has been observed that diabetes is associated with increased oxidative
stress, and NOS uncoupling. However, no studies to date have examined the role of diabetes and
![Page 147: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/147.jpg)
147
its effects on DHFR activity. Therefore, we carried out in vivo studies in order to determine the
effects of the diabetic state on tissue DHFR activity. We observed that in the kidney of db/db
mice, DHFR activity was significantly inhibited when compared to wt age matched control. This
decrease in DHFR activity resulted in increased H2B levels in db/db mice. Our findings are in
line with previous reports of increased H2B levels in diabetic mice [361, 364]. In addition,
previous reports have also demonstrated that alterations in the H2B/ H4B ratio is an important
trigger in NOS uncoupling [208]. Taken together these results represent a potential mechanism
linking diabetes to vascular endothelial dysfunction.
Next, we carried out studies to determine the effect of the loss of DHFR activity on aortic
vascular relaxation. Results demonstrated a 35% impairment of the NO mediated vascular
relaxation in db/db mice when compared to the wt age matched controls. Additional studies
were carried out to determine the effect of decreased DHFR activity and eNOS derived O2.- in
the aorta. In contrast to the wild type mice, resulted demonstrated that eNOS derived O2.- was
detectable in the isolated aorta of db/db mice. In support of our findings, in the streptozotocin
induced model of diabetes, mice were observed to have impaired vascular function and increased
aortic eNOS derived O2.- that was attenuated in the presence of H4B [204].
Overall these results provide evidence for our hypothesis that loss of DHFR activity leads
to endothelial dysfunction in diabetes. Future studies using a gene therapy approach will be
carried out in order to provide further evidence for the importance of the modulation of DHFR
activity and its role in vascular endothelial dysfunction. In addition to animal studies, cellular
studies will examine the effects of the H2B/ H4B ratio in regards to preserving endothelial NO
production. We hypothesis that adenoviral mediated over expression of the DHFR gene will
![Page 148: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/148.jpg)
148
result in improved vascular endothelial function and endothelial NO generation in the diabetic
condition.
In conclusion, this is the first study to demonstrate that DHFR can be regulated by redox
environment in vivo. However, most oxidants have a modest effect on DHFR activity. Also, we
have demonstrated for the first time that OONO- increases DHFR activity, which could
potentially be protective mechanism in which the cell acts to preserve endothelial NO generation.
Furthermore, we have also demonstrated that the loss of DHFR in db/db mice results in impaired
vascular relaxation and increased eNOS derived O2.-. Moreover, the loss of DHFR activity may
represent a novel mechanism in endothelial dysfunction associated with diabetes.
![Page 149: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/149.jpg)
149
Figure 6-1. H4B biosynthesis pathway. H4B is synthesized in the endothelial cell by either the de novo or salvage pathway.
![Page 150: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/150.jpg)
150
Figure 6-2. DHFR enzyme kinetics. hDHFR was incubated in the presence of varying concentrations of B2H(1 µM-1 mM). DHFR activity was measured by the rate of NADPH consumption as measured by absorbance at 340 nm. The Km and Vmax were fitted using the Michaelis-Menton equation. The Km was found to be 48 µM and the Vmax was found to be 6.7 µmols/mg/min
![Page 151: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/151.jpg)
151
Figure 6-3. Effects of Nitric Oxide on hDHFR activity. hDHFR was exposed to varying concentrations (1 µM-1 mM) of Nitric Oxide. hDHFR activity measured by the rate of NADPH consumption as measured by absorbance at 340 nm. Nitric oxide was found to dose dependently reduce hDHFR activity with 38 % inhibition observed at 100 µM NO and 53% inhibition observed at 1mM. Results represent the mean ± SD n=3
![Page 152: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/152.jpg)
152
Figure 6-4. Effects of H2O2 on hDHFR activity. hDHFR was exposed to varying concentrations (1 µM-1 mM) of H2O2. hDHFR activity measured by the rate of NADPH consumption as measured by absorbance at 340 nm. H2O2 dose dependently decreased hDHFR activity with 31% inhibition at 100 µM H2O2 and 53% inhibition at 1 mM. Results represent the mean ± SD n=3
![Page 153: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/153.jpg)
153
Figure 6-5. Effect of O2.- on dDHFR activity. hDHFR was exposed to varying concentrations of
(0.01 µM-1 mM).of Xanthine Oxidase and Xanthine(1 unit/mg) to generate O2.-
.hDHFR activity was measured by NADPH consumption as measured by absorbance at 340 nm. O2
.- was demonstrated to dose dependently inhibit DHFR activity with 1 µM and 1 mM eliciting a 28% and 70% inhibition respectively. Results represent the mean ± SD. * indicates significance at p<0.05. n=3
![Page 154: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/154.jpg)
154
Figure6-6. Effects of OONO- on hDHFR activity. hDHFR was exposed to varying concentrations of (0.01 µM-1 mM).of OONO-. hDHFR activity was measured by NADPH consumption as measured by absorbance at 340 nm. OONO- was observed to increase DHFR activity 56-58% following exposure to 0.01 µM and 1 µM. Exposure to 1 mM OONO- resulted in a modest inhibition of 24%. Results represent the mean ± SD. * indicates significance at p<0.05. n=3
![Page 155: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/155.jpg)
155
Figure 6-7. Effects of the diabetic condition on in-vivo DHFR activity. HPLC studies were carried out the measure basal DHFR activity in the kidneys of db/db and wild type age matched control mice. DHFR activity was observed to be significantly decreased in the db/db mice population (2) vs. the age matched controls (1) Peak (3) is a H2B standard.
3
2
1
![Page 156: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/156.jpg)
156
Figure 6-8. Effects of the diabetic state on vascular reactivity. The effects of the diabetic state on vascular relaxation response to
AcH(0.1-1 µM) were determined using mice aortic rings from db/db mice and age matched wild type controls. Following phenylephrine-induced constriction, Ach (0.1 nM to 10 µM) was added to the bath and the relaxation response was measured. Results represent the mean ± SD. * indicates significance at p<0.05. n=4
![Page 157: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/157.jpg)
157
Figure 6-9. Effects of the diabetic condition on eNOS derived O2.- in the aorta. EPR spin-trapping measurements of O2- production
from mouse aortic rings were performed. The panel shows the spectra of the O2.- adduct observed. The results show the
effects of L-NAME (500 µM) on eNOS derived O2.- production, which blocked eNOS derived O2
.-.
![Page 158: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/158.jpg)
158
CHAPTER 7 DISCUSSION
ADMA and L-NMMA are endogenous NOS inhibitors derived from the proteolysis of
methylated arginine residues on various proteins. The methylation is carried out by a group of
enzymes referred to as protein-arginine methyl transferase’s (PRMT’s) [35]. In mammalian
cells, these enzymes have been classified into type I (PRMT1, 3, 4, 6, and 8) and type II
(PRMT5, 7, and FBXO11) enzymes, depending on their specific catalytic activity. Both types of
PRMT, however, catalyze the formation of mono-methylarginine (MMA) from L-arginine (L-
Arg). In a second step, type I PRMT’s produce asymmetric dimethylarginine (ADMA), while
type II PRMT catalyzes symmetric dimethylarginine (SDMA) [365, 366]. Subsequent
proteolysis of proteins containing methylarginine groups leads to the release of free
methylarginine into the cytoplasm where NO production from NOS can be inhibited. Free
cytoplasmic MMA and ADMA are degraded to citrulline and mono- or dimethylamines by
dimethylarginine dimethylaminohydrolases (DDAH) [367]. While on the other minor clearance
of unchanged plasma methylarginines are cleared from the circulation by renal excretion and
hepatic metabolism [304, 367]. In addition to the DDAH pathway, ADMA can also be
converted to α-keto valeric acid by alanine:glyoxylate aminotransferase [368], although the
influence of this pathway on total ADMA metabolism has not been extensively studied thus far.
Moreover, the demethylation of methylarginines is believed to be restricted to free
methylarginines, as a potential mechanism for possible demethylation of protein-incorporated
methylarginines in situ have not yet been identified. It should be noted, however, that the
conversion of protein-incorporated L-NMMA to citrulline by peptidylarginine deiminase 4 was
recently demonstrated, which prevented histone methylation by PRMT 1 and 4 [369, 370]. This
may influence protein methylation directly, as L-NMMA deimination will decrease the amount
![Page 159: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/159.jpg)
159
of protein-incorporated MMA that is available for dimethylation by PRMT, but the relevance of
protein deimination of protein-incorporated MMA by PAD enzymes has been challenged recent
[369].
Asymmetric dimethylarginine (ADMA) plasma levels have been shown to be elevated in
diseases related to endothelial dysfunction including hypertension, hyperlipidemia, diabetes
mellitus, and others [267, 268, 270-272]. Moreover, it has been shown that ADMA predicts
cardiovascular mortality in patients who have coronary heart disease (CHD). Recent evidence
published from the multicenter Coronary Artery Risk Determination investigating the Influence
of ADMA Concentration (CARDIAC) study has indicated that ADMA is indeed an independent
risk factor for CAD [273]. However, whether the increased risk associated with elevated ADMA
is a direct result of NOS impairment is an area of controversy. Significant debate about the
contribution of ADMA to the regulation of NOS-dependent NO production has been initiated.
In pathological conditions such as pulmonary hypertension, coronary artery disease,
diabetes and hypertension, plasma ADMA levels have been shown to increase from an average
of ~0.4 µM to ~0.8 µM [269, 272, 273, 276-278]. Given that these values are at least 2 orders of
magnitude lower than the plasma L-arg levels it is unlikely that elevated plasma ADMA can
significantly regulate eNOS activity. It is more likely that elevated plasma ADMA levels reflect
increased endothelial concentrations of ADMA. In support of this hypothesis, we and others
have demonstrated that endothelial ADMA levels increase 3-4 fold in restenotic lesions and in
the ischemia reperfused myocardium [96, 279]. Based on cellular kinetic inhibtion studies from
our lab in which we observed sigfinciant inhibtion of NO production at 5µM ADMA, these
concentrations of ADMA would be expected to elicit a 30-40% inhibition in NOS activity [96].
These studies however involve lesion specific increases in ADMA and are not associated with
![Page 160: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/160.jpg)
160
increased plasma levels of ADMA and would not be expected to contribute to systemic
cardiovascular pathology. In this regard, there is little direct evidence that elevated plasma
ADMA levels are associated with increased endothelial ADMA nor is it clear whether plasma
ADMA directly contributes to the NOS inhibition observed in chronic cardiovascular diseases
and other disease such as end stage renal disease.
The principal mechanism put forth to explain the pathological role of ADMA in
cardiovascular diseases has focused on DDAH. It has been demonstrated that diabetes and
hypertension are associated with reduced DDAH activity which is believed to result in ADMA
accumulation to levels associated with NOS inhibition. However, a direct cause-effect
relationship between DDAH activity and NOS inhibition has not been demonstrated. It has been
estimated that more than 80% of ADMA is metabolized by DDAH [267], however, it is unclear
which DDAH isoform represents the principal methylarginine metabolizing enzyme. PCR and
western blot analysis has revealed that the endothelium contains mRNA and protein for both
DDAH-1 and DDAH-2. However, in order to assess the relative contribution of each isoform a
detailed analysis of the enzyme kinetics of each isofrom is necessary. Unfortunately, detailed
biochemical studies have only been published for DDAH-1. Using purified recombinant
hDDAH-1 we and others have demonstrated the precise enzyme kinetics of this isofrom and
results demonstrated Km values of 68.7 and 53.6 μM and Vmax values of 356 and 154
nmols/mg/min for ADMA and L-NMMA, respectively [228, 249]. In regards to DDAH-2,
previous attempts at purifying the protein have been unsuccessful primarily due to solubility
issues with recombinant enzyme expressed in e.coli. Recently we have successfully purified
recombinant human DDAH-2 from bacterial inclusion bodies using a protein refolding method
with L-arginine and cyclodextrin. Initial results demonstrate a Km value of 16 µM and Vmax
![Page 161: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/161.jpg)
161
value of 14.8 nmols.mg/min for ADMA (unpublished results). Thus the apparent rate of ADMA
metabolism for DDAH-2 is almost 10 times less than that of DDAH-1. Based on these enzyme
kinetics, DDAH-1 is likely the principal ADMA metabolizing pathway in the endothelium.
Nevertheless, there is significant controversy in the field regarding which DDAH isoform is
responsible for endothelial methylarginine metabolism. Along these same lines, it is also unclear
whether diseases associated with reduced DDAH activity represent loss of DDAH-1 or DDAH-2
activity. Therefore, the studies described in chapter 3 were carried out in order to address these
issues and identify the role of DDAH-1 and DDAH-2 in the regulation of endothelial NO
production.
It has been widely reported that DDAH-2 is the predominant DDAH isoform in the
vascular endothelium; however these studies have widely relied on assessing the expression of
the DDAH isoforms in various cell and tissue types [237, 240, 281, 282]. Consequently, studies
were carried out in BAECs to determine which isoform is responsible for the majority of the
DDAH activity in the endothelial cell. DDAH-1 and DDAH-2 gene silencing decreased total
DDAH activity by 64% and 48%, respectively. There is a possibility that DDAH-2 gene
silencing could have an effect on DDAH-1 but further studies need to be done. Additional
studies demonstrated that dual gene silencing only resulted in a 50% loss total DDAH activity in
BAECs thus suggesting that other methylarginine metabolic pathways may be invoked as a
consequence of loss of DDAH activity. To investigate the possibility that loss of DDAH activity
may lead to the induction of other methyalrginine metabolic enzymes we used HPLC techniques
to measure the metabolic products of 14C-L-NMMA. In control cells we observed 3 peaks with
radioactive counts and they were identified as L-NMMA, L-arginine and L-citrulline. The
formation of radiolablled L-citrulline is likely from the metabolism of L-NMMA by DDAH
![Page 162: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/162.jpg)
162
while radioactive L-arg is generated from citrulline recycling through ASS and ASL. In contrast,
results from DDAH-1 and DDAH-2 silenced cells indicated the presence of 4 radioactive peaks
including L-NMMA, L-arginine, L-citrulline and a yet unidentified peak. The concentration of
this unidentified peak increased 2 fold in the dual silencing group as compared to the levels in
either the DDAH-1 or DDAH-2 silencing groups alone. Initial mass spec analysis has been
unsuccessful in identifying the unknown species and is currently an area of active investigation
in our lab. Regardless, the results clearly indicate that the endothelium possesses alternate
inducible pathways for metabolizing methylarginines.
Subsequent studies were carried out to assess the role of DDAH-1 and DDAH-2 in the
regulation of endothelial NOS activity. Results demonstrated that adenoviral mediated over-
expression of both DDAH-1 and DDAH-2 increased cellular endothelial NO production. These
initial studies were done in the presence of basal methylarginine levels and demonstrate that
normal endogenous levels of these NOS inhibitors are present at concentration sufficient to
regulate eNOS activity. It had previously been proposed that ADMA may be responsible for the
“arginine paradox” and these studies would appear to support the hypothesis. However,
subsequent studies using L-arg supplementation with DDAH over-expression demonstrated an
additive effect which clearly indicates that ADMA is not involved in the “arginine paradox”.
Studies were then performed using siRNA to silence both the DDAH-1 and DDAH-2
genes in BAECs. It was anticipated that silencing of DDAH would lead to increased cellular
methylarginines and decreased endothelial NO production. Results supported this prediction and
demonstrated that DDAH-1 silencing reduced endothelial NO production by 27% while DDAH-
2 silencing reduced it by 57%. These studies were then repeated with L-arg supplementation in
order to establish the ADMA dependence of the DDAH effects. The addition of L-arg (100 µM)
![Page 163: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/163.jpg)
163
was able to restore ~50% of the loss of endothelial NO generation observed with DDAH-1
silencing. Although it may be predicted that L-arg supplementation should completely restore
NO production given that ADMA is a competitive inhibitor of NOS, these result are consistent
with previously published studies and suggest that DDAH-1 silencing may lead to ADMA
accumulation in sites that are not freely exchangeable with L-arg. In support of this hypothesis it
has been demonstrated by Simon et al. that within the endothelial cell exists two pools of
arginine both which eNOS has access to. Pool I is largely made up of extracellular cationic
amino acids transported through the CAT transport system, however Pool II does not freely
exchange with extracellular cationic amino acids. Furthermore they also demonstrated that Pool
II is separated into two components. Pool II A participates in the recycling of citrulline to
arginine, while Pool II B is occupied by protein derived by-products. It is within this Pool II B
where the methylarginines are likely to accumulate, thus rending its inhibitory effects on eNOS
[280]. Futhermore, the studies were only done using one concentration of L-Arg, it would be
interesting to see what effects higher doses would have endothelial NO production.
Alternatively, ADMA and/or DDAH may elicit effects that are independent of NOS, this appears
to be the most plausible explanation with regards to DDAH-2 wherein loss of activity reduced
endothelial NO production by greater than 50% and the loss was unaffected by L-arg
supplementation. This is strong evidence that DDAH may elicit effects that are independent of
ADMA. Although this may represent an overall paradigm shift with regards to the role of
DDAH in the endothelium, it is not with out support. Specifically, Cooke et al. have
demonstrated that DDAH-1 transgenic mice are protected against cardiac transplant
vasculopathy [241, 242]. Using in-vivo siRNA techniques, Wang et al. demonstrated that
DDAH-1 gene silencing increased plasma levels of ADMA by 50% but this increase had no
![Page 164: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/164.jpg)
164
effect on endothelial dependent relaxation. Conversely, in vivo DDAH-2 gene silencing had no
effect on plasma ADMA, but reduced endothelial dependent relaxation by 40% [237]. These
latter findings are particularly intriguing and demonstrate that elevated plasma ADMA is not
associated with impaired endothelial dependent relaxation while loss of DDAH-2 activity is
associated with impaired endothelial dependent relaxation, despite the fact the plasma ADMA
levels are not increased (40). This provides strong evidence that DDAH effects are not limited to
ADMA dependent regulation of eNOS.
The most convincing evidence that DDAH may regulate cellular function through
mechanisms independent of ADMA mediated NOS inhibition come from data on the DDAH-1
knockout mouse. Homozygous null mice for DDAH-1 are embryonic lethal while the NOS
triple knockout mice are viable [240]. This provides strong evidence that DDAH effects are not
limited to ADMA dependent regulation of eNOS. Using DDAH1 heterozygous mice, which are
viable, Leiper et al. demonstrated that reduced DDAH-1 activity leads to accumulation of plasma
ADMA and a reduction in NO signaling. These animals exhibited a 50% decrease in DDAH
activity which was associated with a 20% increase in plasma and tissue ADMA levels [240].
This in turn was associated with vascular pathology, including endothelial dysfunction, increased
systemic vascular resistance and elevated systemic and pulmonary blood pressure. Given that
the intracellular concentrations of ADMA are 1-3 µM, it is unlikely that a 20% increase in
ADMA could be responsible for the 40% reduction in endothelial dependent relaxation observed
with the DDAH+/- mice. Moreover, the addition of exogenous L-arg to the organ chambers only
partially restored the loss in endothelial relaxation [240]. These results further support the
hypothesis that DDAH modulates endothelial function through both ADMA-NOS dependent
![Page 165: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/165.jpg)
165
pathways as well as independent. Although this represents an overall paradigm shift, it is not
surprising given the lethality of the DDAH-1 knockout mouse.
Together, these results demonstrate that both DDAH-1 and DDAH-2 are involved in the
regulation of endothelial NO production; however, while DDAH-1 effects are largely ADMA-
dependent, DDAH-2 effects appear to be ADMA-independent. In this regard, elevated plasma
ADMA may serve as a marker of impaired methylarginine metabolism and the pathology
previously attributed to elevated ADMA may be manifested, atleast in part, through altered
activity of the enzymes involved in ADMA regulation, specifically DDAH and PRMT.
Although increased plasma levels of ADMA are associated with cardiovascular disease, it
is the endothelial ADMA levels that are implicated in the regulation of NOS activity. It is
therefore surprising that, to date, there have been no studies examining the cellular kinetics of
ADMA synthesis and metabolism in the endothelium. It is generally accepted that PRMT’s
synthesize methylarginines on proteins using the methyl donor SAM and L-arg as the terminal
methyl acceptor. It is then believed that normal protein turnover releases free methylarginines
which are then metabolized to citrulline by DDAH. In this regard, loss of DDAH activity has
been implicated as the molecular trigger for ADMA accumulation and subsequent endothelial
dysfunction. It is our hypothesis that there is crosstalk among these pathways and that the levels
of both free and protein incorporated methylarginines play important roles in regulating
endothelial function, including but not limited to eNOS regulation. In summary, dysregulation
of the PRMT-DDAH-ADMA axis has now been shown to contribute to the pathogenesis of
several cardiovascular disorders, in experimental animal models as well as human disease.
Causal relationships between dysregulated arginine-methylation and the initiation, progression,
or therapy of disease, however, remain to be dissected. Future investigations into arginine-
![Page 166: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/166.jpg)
166
methylation and DDAH dynamics in disease states are clearly needed in order elucidate the role
of this post-translational modification in the pathogenesis of cardiovascular disease.
The results from chapter 3 clearly demonstrated that loss of DDAH activity was associated
with NOS impairment. This raises a critical question regarding the mechanisms of DDAH
regulation in disease. Among the mechanisms proposed for the loss of DDAH activity
associated with cardiovascular disease is redox modification of DDAH in response to oxidative
stress. In support, Leiper et al. have demonstrated that NO inhibits the activity of DDAH-1
through a mechanism involving the formation of S-nitrosyl complexes within the catalytic
domain of DDAH-1. Therefore, in chapter 4 we carried out a series of studies to investigate the
effects of altered redox state and oxidative stress on DDAH activity and endothelial NO
production. Using purified human recombinant DDAH-1, our lab and others have previously
demonstrated that hDDAH-1 was largely resistant to oxidants (ONOO-, H2O2, OH., O2.-) as
concentrations exceeding 100 µM were needed to elicit any significant inhibition [228, 249].
However, significant inhibition was seen with the lipid peroxidation product 4-HNE and the
inhibition occurred at concentrations associated with pathological conditions.
Results demonstrated that the exposure of BAECs to 4-HNE caused a dose-dependent
inhibition of cellular NO production. The observed 4-HNE effects were independent of changes
in either NOS expression or phosphorylation state, as the Western blotting analysis revealed no
changes in either endpoint. These results suggested that the observed NOS impairment involved
mechanisms other than those related to protein expression. As such, subsequent experiments
were performed in order to determine whether alterations in NOS cofactors or substrate may be
involved in the decreased NO bioavailability. In this regard, oxidant stress, which has been
shown to occur following exposure to lipid peroxidation products, has been shown to reduce the
![Page 167: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/167.jpg)
167
bioavailability of the critical NOS cofactor, H4B [290, 311]. Loss of this cofactor results in NOS
uncoupling evident by impaired NO synthesis and enhanced superoxide production from the
enzyme [310]. Moreover, oxidant injury has also been demonstrated to increase the cellular
levels of the endogenous methylarginine, ADMA [35]. Therefore, cellular studies were carried
out to investigate the effects of adding both an antioxidant (GSH) to prevent H4B oxidation as
well as the eNOS substrate L-Arginine to overcome endogenous methylarginine-mediated NOS
inhibition. Our data demonstrate that the addition of either GSH or L-Arginine alone had only
modest NO-enhancing effects, however, co-incubation with both GSH and L-Arg was able to
almost completely restore endothelial NO production. These data suggest that the observed NOS
impairment involves both oxidant induced NOS inhibition (alleviated by the addition of GSH) as
well as methylarginine inhibitory effects (alleviated by the addition of excess substrate).
Direct measurement of ADMA levels and DDAH activity within cells by HPLC
demonstrated that following 4-HNE challenge intracellular ADMA levels were increased greater
than 2-fold. Based on previously published studies demonstrating the kinetics of ADMA
mediated cellular inhibition, a 2 fold increase in methylarginine levels would be expected to
inhibit NOS dependent NO generation by 20-30 % [96]. The additional inhibition observed
could be due to compartmentalization or NOS uncoupling and increased NOS derived
superoxide production in the presence of ADMA. To determine whether the increased levels of
ADMA observed following 4-HNE exposure resulted from changes in the activity of the ADMA
metabolizing enzyme DDAH, its activity was measured. Studies of DDAH activity
demonstrated a 40% decrease in hydrolytic activity, suggesting that the mechanism for the
observed 4-HNE-directed NOS impairment was via an inhibition of DDAH. Additional studies
were performed on purified recombinant hDDAH-1 in order to determine whether 4-HNE effects
![Page 168: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/168.jpg)
168
were through direct interaction with the enzyme. Results demonstrated that incubation of
hDDAH-1 with 4-HNE (50 μM) resulted in a > 40% decrease in enzyme activity. These effects
were specific to 4-HNE as incubation with the non-oxidized carbonyl hexanol (10-500 µM) had
no effect on DDAH activity. Similar studies were performed with purified recombinant eNOS
and no inhibition was observed following 4-HNE exposure. 4-HNE forms Michael adducts with
histidine and cysteine residues on proteins. In this regard, the catalytic triad of DDAH contains
both cysteine and histidine residues and mutation of either amino acid has been demonstrated to
render the enzyme inactive. [314-316].
As further support to the role of DDAH in mediating the inhibitory effects of 4-HNE on
endothelial NO production, studies were performed using DDAH over-expressing BAECs.
Over-expression of DDAH should lead to a decrease in cellular methylarginines with the
concomitant increase in NOS-derived NO. DDAH over-expression was induced using an
adenoviral construct carrying the human DDAH-1 gene. DDAH over-expression increased
cellular DDAH activity in control cells by 50% and resulted in a 22% increase in cellular NO
production. If one then considers the 2-fold increase in the levels of ADMA observed following
the 4-HNE treatment, a ∼40 % inhibitory effect would be predicted [96].
Subsequently, a series of studies were performed using this same transduction protocol to
examine the effects of DDAH over-expression on 4-HNE mediated endothelial NO inhibition.
Although DDAH over-expression did increase DDAH activity and decrease endogenous
methylarginines, the over-expression of the enzyme alone was not sufficient to prevent the 4-
HNE-induced decrease in NO production. In fact, our results demonstrated that exposure of
DDAH over-expressing cells to 4-HNE resulted in worsened outcome as NO levels were
significantly lower than that in the control cells exposed to 4-HNE. Although these results may
![Page 169: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/169.jpg)
169
appear contradictory to our hypothesis, they in fact support it and demonstrate that NOS
uncoupling is likely occurring. The mechanism involved methylarginine mediated regulation of
eNOS derived superoxide. These findings are consistent with studies presented in chapter 5
wherin using electron paramagnetic resonance spin trapping techniques we measured the dose
dependent effects of ADMA and L-NMMA on ·O2- production from eNOS under conditions of
H4B depletion. In the absence of H4B, ADMA dose dependently increased NOS derived ·O2-
generation, with a maximal increase of 151 % at 100 μM ADMA. L-NMMA also dose
dependently increased NOS derived O2.-, but to a lesser extent, demonstrating a 102 % increase
at 100 μM L-NMMA. Moreover, the native substrate L-arginine also increased eNOS derived
·O2-, exhibiting a similar degree of enhancement as that observed with ADMA. Measurements of
NADPH consumption from eNOS demonstrated that binding of either L-arginine or
methylarginines increased the rate of NADPH oxidation. Spectrophotometric studies suggest,
just as for L-arginine, that binding of ADMA and L-NMMA shift the eNOS heme to the high-
spin state, indicative of a more positive heme redox potential, enabling enhanced electron
transfer from the reductase to the oxygenase site. These results demonstrate that the
methylarginines can profoundly shift the balance of NO and O2.-generation from eNOS. These
observations have important implications with regard to the therapeutic use of L-arginine and the
methylarginine-NOS inhibitors in the treatment of disease. While these studies were done using
prufied enzyme, in the cell, eNOS is known to have various cofactors that may play a role in
eNOS derived superoxide. Currently, the effects of methylarginines on cellular eNOS derived
superoxide are an area of active investigation in our lab.
Based on the results presented thus far, our hypothesis would predict that treatment of
DDAH over-expressing cells with an antioxidant would restore NO to levels similar to those
![Page 170: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/170.jpg)
170
observed with L-Arg and GSH treatment, if in fact methylarginines are contributing to the
inhibition in NO generation seen with 4-HNE challenge. Indeed, we demonstrated almost
complete protection of cellular NO production following 4-HNE challenge using a combination
of viral over-expression of DDAH and treatment with GSH, when compared to the respective
control. These results would indicate that GSH alone reduces NOS uncoupling, but not the
methylarginine accumulation, while L-Arg supplementation and/or DDAH over-expression
overcomes the 4-HNE-induced increase in methylarginines but not the NOS uncoupling.
The research presented demonstrates for the first time that the lipid peroxidation product 4-
HNE can inhibit the endothelial NO production. The doses used in this study represent
pathological levels of this highly reactive lipid peroxidation product and suggest that this
bioactive molecule may play a critical role in the endothelial dysfunction observed in a variety of
cardiovascular diseases. The inhibitory effects of 4-HNE appear to be mediated through both
oxidant stress and elevated levels of the endogenous NOS inhibitors ADMA and L-NMMA, as
either L-Arg supplementation or DDAH over-expression in the presence of an anti-oxidant were
able to restore NO production. Together, these results represent a major step forward in our
understanding of the regulation, impact, and role of methylarginines and lipid peroxidation in
cardiovascular disease.
Altered redox status of the endothelium has been implicated as a central mechanism in the
endothelial dysfunction associated with cardiovascular diseases. Based on the results described
in these studies, we propose that loss of DDAH activity under conditions of oxidative stress
contributes to the pathogenesis of cardiovascular disease through its effects on NOS derived NO
and superoxide production. Specifically, we believe that decreased DDAH activity inhibits
eNOS derived NO production through both ADMA-dependent and independent pathways.
![Page 171: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/171.jpg)
171
Moreover, the ADMA accumulation that occurs as a result of loss of DDAH activity is also
involved in the perpetuation of eNOS derived superoxide which likely contributes to the NO
inactivation observed in cardiovascular disease.
Biochemical studies using recombinant NOS have demonstrated that eNOS, in the absence
of H4B, has the potential to be a major source of superoxide with catalytic rates approaching
those of NADPH Oxidase and Xanthine Oxidase [371]. However, cellular studies of eNOS
derived superoxide have revealed that H4B depletion alone does not significantly increase
superoxide fluxes [372, 373]. Instead, it appears that increased levels of the H4B oxidation
product, H2B, is the molecular trigger for eNOS uncoupling. Evidence for this hypothesis is
supported by our data as well as work from Gross et al. in which they demonstrated 48-h
exposure to diabetic glucose levels (30 mM) caused H2B levels to increase from undetectable to
40% of total biopterin. This H2B accumulation was associated with diminished NO activity and
accelerated superoxide production. However, it is unclear why H2B accumulates in cellular and
animal models of diabetes. Bioaccumulation of H2B or quinoid H2B following oxidation of H4B
would not be expected to occur in the endothelium as the combination of dihydrofolate reductase
and dihydropteridine reductase should efficiently reduce these oxidized pterins back to H4B.
Given that numerous studies have clearly identified increased H2B formation in diabetes suggests
that these conditions are likely associated with impaired pterin salvage or recycling pathways.
Therefore, we hypothesized that in diabetes, enzymes involved in either the H4B salvage or
recycling pathways are impaired resulting in an inability to maintain adequate H4B levels. The
result is eNOS uncoupling and altered NO and ROS signaling which leads to diabetic vascular
dysfunction.
![Page 172: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/172.jpg)
172
Therefore, the studies described in chapter 6 were carried out to investigate pterin
regulation in diabetes. Initial studies were conducted in order to determine the effect of ROS and
RNS on DHFR activity. These studies demonstrated that the DHFR enzymatic activity is
sensitive to ROS with significant inhibition observed with pathophysiologically relevant doses of
superoxide, NO and H2O2. In contrast, OONO- at pathophysiologically relevant levels induced a
significant increase DHFR activity. This is an intriguing finding given that ONOO- has been
shown to be the most potent oxidizer of H4B and may represent a novel compensatory
mechanism for the cell to maintain adequate H2B / H4B ratios.
Although previous studies have clearly demonstrated increased oxidative stress and NOS
uncoupling in diabetes, no studies to date have examined the role of DHFR in this process.
Therefore, we carried out in vivo studies in order to determine the effects of the diabetic state on
tissue DHFR activity. We observed that in the kidney of db/db mice, DHFR activity was
significantly inhibited when compared to wt age matched controls. This decrease in DHFR
activity resulted in increased H2B levels in db/db mice. Functional studies were also performed
to determine the effect of the loss of DHFR activity on aortic vascular relaxation. Results
demonstrated a 35% impairment of the NO mediated vascular relaxation in db/db mice when
compared to the wt age matched controls. This decreased endothelial dependent relaxation was
associated with increased eNOS derived O2.- in the aorta as measured by EPR. In contrast to the
wild type mice, eNOS derived O2- was detectable in the isolated aorta of db/db mice. These
findings are in line with previous reports of increased H2B levels in diabetic mice [361, 364] and
implicate DHFR as a key regulatory element involved in eNOS dysregulation.
In summary, the data presented in this thesis demonstrate a critical role for the DDAH-
ADMA axis in the pathogenesis of endothelial dysfunction associated with cardiovascular
![Page 173: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/173.jpg)
173
diseases. Evidence suggests that DDAH is capable of modulating both eNOS derived NO and
superoxide generation through ADMA-dependent as well as independent pathways.
![Page 174: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/174.jpg)
174
LIST OF REFRENCES
1. Lloyd-Jones, D., et al., Heart Disease and Stroke Statistics--2009 Update: A Report From the American Heart Association Statistics Committee and Stroke Statistics Subcommittee. Circulation, 2009. 119(3): p. 480-486.
2. Goldstein, J.L. and M.S. Brown, Familial hypercholesterolemia: identification of a defect in the regulation of 3-hydroxy-3-methylglutaryl coenzyme A reductase activity associated with overproduction of cholesterol. Proc Natl Acad Sci U S A, 1973. 70(10): p. 2804-8.
3. Brown, M.S. and J.L. Goldstein, Receptor-mediated endocytosis: insights from the lipoprotein receptor system. Proc Natl Acad Sci U S A, 1979. 76(7): p. 3330-7.
4. Lloyd-Jones, D.M., et al., Prediction of lifetime risk for cardiovascular disease by risk factor burden at 50 years of age. Circulation, 2006. 113(6): p. 791-8.
5. Baldwin, G.S. and P.R. Carnegie, Specific Enzymic Methylation of an Arginine in the Experimental Allergic Encephalomyelitis Protein from Human Myelin. Science, 1971. 171(3971): p. 579-581.
6. Corti, R., et al., Evolving concepts in the triad of atherosclerosis, inflammation and thrombosis. J Thromb Thrombolysis, 2004. 17(1): p. 35-44.
7. Gutierrez, J., et al., Free radicals, mitochondria, and oxidized lipids: the emerging role in signal transduction in vascular cells. Circ Res, 2006. 99(9): p. 924-32.
8. Libby, P., Vascular biology of atherosclerosis: overview and state of the art. Am J Cardiol, 2003. 91(3A): p. 3A-6A.
9. Stary, H.C., et al., A definition of advanced types of atherosclerotic lesions and a histological classification of atherosclerosis. A report from the Committee on Vascular Lesions of the Council on Arteriosclerosis, American Heart Association. Circulation, 1995. 92(5): p. 1355-74.
10. Libby, P., Inflammation and cardiovascular disease mechanisms. Am J Clin Nutr, 2006. 83(2): p. 456S-460S.
11. Azevedo, L.C., et al., Oxidative stress as a signaling mechanism of the vascular response to injury: the redox hypothesis of restenosis. Cardiovasc Res, 2000. 47(3): p. 436-45.
12. Bauters, C. and J.M. Isner, The biology of restenosis. Prog Cardiovasc Dis, 1997. 40(2): p. 107-16.
13. Ferns, G.A., et al., Inhibition of neointimal smooth muscle accumulation after angioplasty by an antibody to PDGF. Science, 1991. 253(5024): p. 1129-32.
14. Heckenkamp, J., M. Gawenda, and J. Brunkwall, Vascular restenosis. Basic science and clinical implications. J Cardiovasc Surg (Torino), 2002. 43(3): p. 349-57.
![Page 175: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/175.jpg)
175
15. Libby, P. and H. Tanaka, The molecular bases of restenosis. Prog Cardiovasc Dis, 1997. 40(2): p. 97-106.
16. Galle, J., et al., Impact of oxidized low density lipoprotein on vascular cells. Atherosclerosis, 2006. 185(2): p. 219-26.
17. Hamilton, C.A., Low-density lipoprotein and oxidised low-density lipoprotein: their role in the development of atherosclerosis. Pharmacol Ther, 1997. 74(1): p. 55-72.
18. Heinecke, J.W., Is the emperor wearing clothes? Clinical trials of vitamin E and the LDL oxidation hypothesis. Arterioscler Thromb Vasc Biol, 2001. 21(8): p. 1261-4.
19. Navab, M., et al., HDL and the inflammatory response induced by LDL-derived oxidized phospholipids. Arterioscler Thromb Vasc Biol, 2001. 21(4): p. 481-8.
20. Spiteller, G., The relation of lipid peroxidation processes with atherogenesis: a new theory on atherogenesis. Mol Nutr Food Res, 2005. 49(11): p. 999-1013.
21. Uchida, K., et al., Michael addition-type 4-hydroxy-2-nonenal adducts in modified low-density lipoproteins: markers for atherosclerosis. Biochemistry, 1994. 33(41): p. 12487-94.
22. Arnold, W.P., et al., Nitric oxide activates guanylate cyclase and increases guanosine 3':5'-cyclic monophosphate levels in various tissue preparations. Proc Natl Acad Sci U S A, 1977. 74(8): p. 3203-7.
23. Palmer, R.M., D.S. Ashton, and S. Moncada, Vascular endothelial cells synthesize nitric oxide from L-arginine. Nature, 1988. 333(6174): p. 664-6.
24. Jeremy, J.Y., et al., Oxidative stress, nitric oxide, and vascular disease. J Card Surg, 2002. 17(4): p. 324-7.
25. Sarkar, R. and R.C. Webb, Does nitric oxide regulate smooth muscle cell proliferation? A critical appraisal. J Vasc Res, 1998. 35(3): p. 135-42.
26. Cooke, J.P. and R.K. Oka, Atherogenesis and the arginine hypothesis. Curr Atheroscler Rep, 2001. 3(3): p. 252-9.
27. Holm, A.M., et al., Effects of L-arginine on vascular smooth muscle cell proliferation and apoptosis after balloon injury. Scand Cardiovasc J, 2000. 34(1): p. 28-32.
28. Le Tourneau, T., et al., Role of nitric oxide in restenosis after experimental balloon angioplasty in the hypercholesterolemic rabbit: effects on neointimal hyperplasia and vascular remodeling. J Am Coll Cardiol, 1999. 33(3): p. 876-82.
29. Janero, D.R. and J.F. Ewing, Nitric oxide and postangioplasty restenosis: pathological correlates and therapeutic potential. Free Radic Biol Med, 2000. 29(12): p. 1199-221.
![Page 176: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/176.jpg)
176
30. Aji, W., et al., L-arginine prevents xanthoma development and inhibits atherosclerosis in LDL receptor knockout mice. Circulation, 1997. 95(2): p. 430-7.
31. Boger, R.H., et al., Dietary L-arginine reduces the progression of atherosclerosis in cholesterol-fed rabbits: comparison with lovastatin. Circulation, 1997. 96(4): p. 1282-90.
32. Boger, R.H., et al., Plasma concentration of asymmetric dimethylarginine, an endogenous inhibitor of nitric oxide synthase, is elevated in monkeys with hyperhomocyst(e)inemia or hypercholesterolemia. Arterioscler Thromb Vasc Biol, 2000. 20(6): p. 1557-64.
33. Kielstein, J.T., et al., Relationship of asymmetric dimethylarginine to dialysis treatment and atherosclerotic disease. Kidney Int Suppl, 2001. 78: p. S9-13.
34. Miyazaki, H., et al., Endogenous nitric oxide synthase inhibitor: a novel marker of atherosclerosis. Circulation, 1999. 99(9): p. 1141-6.
35. Leiper, J. and P. Vallance, Biological significance of endogenous methylarginines that inhibit nitric oxide synthases. Cardiovasc Res, 1999. 43(3): p. 542-8.
36. Leiper, J.M., et al., Identification of two human dimethylarginine dimethylaminohydrolases with distinct tissue distributions and homology with microbial arginine deiminases. Biochem J, 1999. 343(Pt 1): p. 209-14.
37. Tang, J., et al., PRMT 3, a type I protein arginine N-methyltransferase that differs from PRMT1 in its oligomerization, subcellular localization, substrate specificity, and regulation. J Biol Chem, 1998. 273(27): p. 16935-45.
38. Cardounel, A.J., et al., Evidence for the pathophysiological role of endogenous methylarginies in regulation of endothelial NO production and vascular function. J Biol Chem, 2006.
39. White, C.R., et al., L-Arginine inhibits xanthine oxidase-dependent endothelial dysfunction in hypercholesterolemia. FEBS Lett, 2004. 561(1-3): p. 94-8.
40. Wu, Z., et al., Long-term oral administration of L-arginine enhances endothelium-dependent vasorelaxation and inhibits neointimal thickening after endothelial denudation in rats. Chin Med J (Engl), 1996. 109(8): p. 592-8.
41. Cardounel, A.J. and J.L. Zweier, Endogenous methylarginines regulate neuronal nitric-oxide synthase and prevent excitotoxic injury. J Biol Chem, 2002. 277(37): p. 33995-4002.
42. Tsikas, D., et al., Endogenous nitric oxide synthase inhibitors are responsible for the L-arginine paradox. FEBS Lett, 2000. 478(1-2): p. 1-3.
43. Cai, H. and D.G. Harrison, Endothelial dysfunction in cardiovascular diseases: the role of oxidant stress. Circ Res, 2000. 87(10): p. 840-4.
![Page 177: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/177.jpg)
177
44. Durante, W., A.K. Sen, and F.A. Sunahara, Impairment of endothelium-dependent relaxation in aortae from spontaneously diabetic rats. Br J Pharmacol, 1988. 94(2): p. 463-8.
45. Lockette, W., Y. Otsuka, and O. Carretero, The loss of endothelium-dependent vascular relaxation in hypertension. Hypertension, 1986. 8(6 Pt 2): p. II61-6.
46. Oyama, Y., et al., Attenuation of endothelium-dependent relaxation in aorta from diabetic rats. Eur J Pharmacol, 1986. 132(1): p. 75-8.
47. Winquist, R.J., et al., Decreased endothelium-dependent relaxation in New Zealand genetic hypertensive rats. J Hypertens, 1984. 2(5): p. 541-5.
48. Fukai, T., et al., Extracellular superoxide dismutase and cardiovascular disease. Cardiovasc Res, 2002. 55(2): p. 239-49.
49. Juul, K., et al., Genetically reduced antioxidative protection and increased ischemic heart disease risk: The Copenhagen City Heart Study. Circulation, 2004. 109(1): p. 59-65.
50. Xia, Y., et al., Superoxide generation from endothelial nitric-oxide synthase. A Ca2+/calmodulin-dependent and tetrahydrobiopterin regulatory process. J Biol Chem, 1998. 273(40): p. 25804-8.
51. Vasquez-Vivar, J., et al., Superoxide generation by endothelial nitric oxide synthase: the influence of cofactors. Proc Natl Acad Sci U S A, 1998. 95(16): p. 9220-5.
52. Burg, A.W. and G.M. Brown, The biosynthesis of folic acid. 8. Purification and properties of the enzyme that catalyzes the production of formate from carbon atom 8 of guanosine triphosphate. J Biol Chem, 1968. 243(9): p. 2349-58.
53. Laursen, J.B., et al., Endothelial regulation of vasomotion in apoE-deficient mice: implications for interactions between peroxynitrite and tetrahydrobiopterin. Circulation, 2001. 103(9): p. 1282-8.
54. Heitzer, T., et al., Tetrahydrobiopterin improves endothelium-dependent vasodilation in chronic smokers : evidence for a dysfunctional nitric oxide synthase. Circ Res, 2000. 86(2): p. E36-41.
55. Settergren, M., et al., l-Arginine and tetrahydrobiopterin protects against ischemia/reperfusion-induced endothelial dysfunction in patients with type 2 diabetes mellitus and coronary artery disease. Atherosclerosis, 2008.
56. Jennings, M.A. and L. Florey, An investigation of some properties of endothelium related to capillary permeability. Proc R Soc Lond B Biol Sci, 1967. 167(6): p. 39-63.
57. Furchgott, R.F. and J.V. Zawadzki, The obligatory role of endothelial cells in the relaxation of arterial smooth muscle by acetylcholine. Nature, 1980. 288(5789): p. 373-6.
![Page 178: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/178.jpg)
178
58. Ignarro, L.J., et al., Endothelium-derived relaxing factor produced and released from artery and vein is nitric oxide. Proc Natl Acad Sci U S A, 1987. 84(24): p. 9265-9.
59. Palmer, R.M., A.G. Ferrige, and S. Moncada, Nitric oxide release accounts for the biological activity of endothelium-derived relaxing factor. Nature, 1987. 327(6122): p. 524-6.
60. Palmer, R.M., D.S. Ashton, and S. Moncada, Vascular endothelial cells synthesize nitric oxide from L-arginine. Nature, 1988. 333(6174): p. 664-6.
61. Ignarro, L.J., et al., Oxidation of nitric oxide in aqueous solution to nitrite but not nitrate: comparison with enzymatically formed nitric oxide from L-arginine. Proc Natl Acad Sci U S A, 1993. 90(17): p. 8103-7.
62. Masters, B.S., et al., Neuronal nitric oxide synthase, a modular enzyme formed by convergent evolution: structure studies of a cysteine thiolate-liganded heme protein that hydroxylates L-arginine to produce NO. as a cellular signal. FASEB J, 1996. 10(5): p. 552-8.
63. Mayer, B. and B. Hemmens, Biosynthesis and action of nitric oxide in mammalian cells. Trends Biochem Sci, 1997. 22(12): p. 477-81.
64. Stuehr, D.J., Structure-function aspects in the nitric oxide synthases. Annu Rev Pharmacol Toxicol, 1997. 37: p. 339-59.
65. Abu-Soud, H.M. and D.J. Stuehr, Nitric oxide synthases reveal a role for calmodulin in controlling electron transfer. Proc Natl Acad Sci U S A, 1993. 90(22): p. 10769-72.
66. White, K.A. and M.A. Marletta, Nitric oxide synthase is a cytochrome P-450 type hemoprotein. Biochemistry, 1992. 31(29): p. 6627-31.
67. Bredt, D.S. and S.H. Snyder, Isolation of nitric oxide synthetase, a calmodulin-requiring enzyme. Proc Natl Acad Sci U S A, 1990. 87(2): p. 682-5.
68. Knowles, R.G., et al., Formation of nitric oxide from L-arginine in the central nervous system: a transduction mechanism for stimulation of the soluble guanylate cyclase. Proc Natl Acad Sci U S A, 1989. 86(13): p. 5159-62.
69. Garcia-Cardena, G., et al., Targeting of nitric oxide synthase to endothelial cell caveolae via palmitoylation: implications for nitric oxide signaling. Proc Natl Acad Sci U S A, 1996. 93(13): p. 6448-53.
70. Goetz, R.M., et al., Estradiol induces the calcium-dependent translocation of endothelial nitric oxide synthase. Proc Natl Acad Sci U S A, 1999. 96(6): p. 2788-93.
71. Loscalzo, J. and G. Welch, Nitric oxide and its role in the cardiovascular system. Prog Cardiovasc Dis, 1995. 38(2): p. 87-104.
![Page 179: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/179.jpg)
179
72. Fujimoto, T., et al., Localization of inositol 1,4,5-trisphosphate receptor-like protein in plasmalemmal caveolae. J Cell Biol, 1992. 119(6): p. 1507-13.
73. Siddhanta, U., et al., Heme iron reduction and catalysis by a nitric oxide synthase heterodimer containing one reductase and two oxygenase domains. J Biol Chem, 1996. 271(13): p. 7309-12.
74. Li, H., et al., Regulatory role of arginase I and II in nitric oxide, polyamine, and proline syntheses in endothelial cells. Am J Physiol Endocrinol Metab, 2001. 280(1): p. E75-82.
75. Radomski, M.W., R.M. Palmer, and S. Moncada, The anti-aggregating properties of vascular endothelium: interactions between prostacyclin and nitric oxide. Br J Pharmacol, 1987. 92(3): p. 639-46.
76. Stagliano, N.E., et al., The effect of nitric oxide synthase inhibition on acute platelet accumulation and hemodynamic depression in a rat model of thromboembolic stroke. J Cereb Blood Flow Metab, 1997. 17(11): p. 1182-90.
77. Simon, D.I., et al., Effect of nitric oxide synthase inhibition on bleeding time in humans. J Cardiovasc Pharmacol, 1995. 26(2): p. 339-42.
78. Lefer, A.M. and X.L. Ma, Decreased basal nitric oxide release in hypercholesterolemia increases neutrophil adherence to rabbit coronary artery endothelium. Arterioscler Thromb, 1993. 13(6): p. 771-6.
79. Peng, H.B., P. Libby, and J.K. Liao, Induction and stabilization of I kappa B alpha by nitric oxide mediates inhibition of NF-kappa B. J Biol Chem, 1995. 270(23): p. 14214-9.
80. Lablanche, J.M., et al., Effect of the direct nitric oxide donors linsidomine and molsidomine on angiographic restenosis after coronary balloon angioplasty. The ACCORD Study. Angioplastic Coronaire Corvasal Diltiazem. Circulation, 1997. 95(1): p. 83-9.
81. Janssens, S., et al., Human endothelial nitric oxide synthase gene transfer inhibits vascular smooth muscle cell proliferation and neointima formation after balloon injury in rats. Circulation, 1998. 97(13): p. 1274-81.
82. Varenne, O., et al., Local adenovirus-mediated transfer of human endothelial nitric oxide synthase reduces luminal narrowing after coronary angioplasty in pigs. Circulation, 1998. 98(9): p. 919-26.
83. Guo, K., V. Andres, and K. Walsh, Nitric OxideñInduced Downregulation of Cdk2 Activity and Cyclin A Gene Transcription in Vascular Smooth Muscle Cells. Circulation, 1998. 97(20): p. 2066-2072.
84. Muller, B., et al., Nitric oxide transport and storage in the cardiovascular system. Ann N Y Acad Sci, 2002. 962: p. 131-9.
![Page 180: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/180.jpg)
180
85. Xu, A., J.A. Vita, and J.F. Keaney, Jr., Ascorbic acid and glutathione modulate the biological activity of S-nitrosoglutathione. Hypertension, 2000. 36(2): p. 291-5.
86. Beltran, B., et al., Oxidative stress and S-nitrosylation of proteins in cells. Br J Pharmacol, 2000. 129(5): p. 953-60.
87. Haendeler, J., et al., Antioxidant Effects of Statins via S-Nitrosylation and Activation of Thioredoxin in Endothelial Cells: A Novel Vasculoprotective Function of Statins. Circulation, 2004. 110(7): p. 856-861.
88. Leiper, J., et al., S-nitrosylation of dimethylarginine dimethylaminohydrolase regulates enzyme activity: further interactions between nitric oxide synthase and dimethylarginine dimethylaminohydrolase. Proc Natl Acad Sci U S A, 2002. 99(21): p. 13527-32.
89. Hao, G., L. Xie, and S.S. Gross, Argininosuccinate synthetase is reversibly inactivated by S-nitrosylation in vitro and in vivo. J Biol Chem, 2004. 279(35): p. 36192-200.
90. Ravi, K., et al., S-nitrosylation of endothelial nitric oxide synthase is associated with monomerization and decreased enzyme activity. Proc Natl Acad Sci U S A, 2004. 101(8): p. 2619-24.
91. Erwin, P.A., et al., Receptor-regulated Dynamic S-Nitrosylation of Endothelial Nitric-oxide Synthase in Vascular Endothelial Cells. J. Biol. Chem., 2005. 280(20): p. 19888-19894.
92. Wu, G., Intestinal mucosal amino acid catabolism. J Nutr, 1998. 128(8): p. 1249-52.
93. Wu, G. and S.M. Morris, Jr., Arginine metabolism: nitric oxide and beyond. Biochem J, 1998. 336 ( Pt 1): p. 1-17.
94. Morris, S.M., Jr., Arginine metabolism in vascular biology and disease. Vasc Med, 2005. 10 Suppl 1: p. S83-7.
95. Hallemeesch, M.M., W.H. Lamers, and N.E. Deutz, Reduced arginine availability and nitric oxide production. Clin Nutr, 2002. 21(4): p. 273-9.
96. Cardounel, A.J., et al., Evidence for the pathophysiological role of endogenous methylarginines in regulation of endothelial NO production and vascular function. J Biol Chem, 2007. 282(2): p. 879-87.
97. Durante, W., et al., Transforming Growth Factor-{beta}1 Stimulates L-Arginine Transport and Metabolism in Vascular Smooth Muscle Cells : Role in Polyamine and Collagen Synthesis. Circulation, 2001. 103(8): p. 1121-1127.
98. Durante, W., F.K. Johnson, and R.A. Johnson, Arginase: a critical regulator of nitric oxide synthesis and vascular function. Clin Exp Pharmacol Physiol, 2007. 34(9): p. 906-11.
![Page 181: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/181.jpg)
181
99. Reczkowski, R.S. and D.E. Ash, Rat liver arginase: kinetic mechanism, alternate substrates, and inhibitors. Arch Biochem Biophys, 1994. 312(1): p. 31-7.
100. Chang, C.I., J.C. Liao, and L. Kuo, Arginase modulates nitric oxide production in activated macrophages. Am J Physiol, 1998. 274(1 Pt 2): p. H342-8.
101. Johnson, F.K., et al., Arginase inhibition restores arteriolar endothelial function in Dahl rats with salt-induced hypertension. Am J Physiol Regul Integr Comp Physiol, 2005. 288(4): p. R1057-62.
102. Chicoine, L.G., et al., Arginase inhibition increases nitric oxide production in bovine pulmonary arterial endothelial cells. Am J Physiol Lung Cell Mol Physiol, 2004. 287(1): p. L60-8.
103. Fukuda, Y., et al., Tetrahydrobiopterin restores endothelial function of coronary arteries in patients with hypercholesterolaemia. Heart, 2002. 87(3): p. 264-9.
104. Walker, J.B., Creatine: biosynthesis, regulation, and function. Adv Enzymol Relat Areas Mol Biol, 1979. 50: p. 177-242.
105. Morris, S.M., Jr., Enzymes of arginine metabolism. J Nutr, 2004. 134(10 Suppl): p. 2743S-2747S; discussion 2765S-2767S.
106. Kwon, N.S., C.F. Nathan, and D.J. Stuehr, Reduced biopterin as a cofactor in the generation of nitrogen oxides by murine macrophages. J Biol Chem, 1989. 264(34): p. 20496-501.
107. Tayeh, M.A. and M.A. Marletta, Macrophage oxidation of L-arginine to nitric oxide, nitrite, and nitrate. Tetrahydrobiopterin is required as a cofactor. J Biol Chem, 1989. 264(33): p. 19654-8.
108. Kaufman, S., Studies on the mechanism of the enzymatic conversion of phenylalanine to tyrosine. J Biol Chem, 1959. 234: p. 2677-82.
109. Vasquez-Vivar, J., et al., The ratio between tetrahydrobiopterin and oxidized tetrahydrobiopterin analogues controls superoxide release from endothelial nitric oxide synthase: an EPR spin trapping study. Biochem J, 2002. 362(Pt 3): p. 733-9.
110. Hurshman, A.R., et al., Formation of a pterin radical in the reaction of the heme domain of inducible nitric oxide synthase with oxygen. Biochemistry, 1999. 38(48): p. 15689-96.
111. Schmidt, P.P., et al., Formation of a protonated trihydrobiopterin radical cation in the first reaction cycle of neuronal and endothelial nitric oxide synthase detected by electron paramagnetic resonance spectroscopy. J Biol Inorg Chem, 2001. 6(2): p. 151-8.
112. Cai, S., et al., GTP cyclohydrolase I gene transfer augments intracellular tetrahydrobiopterin in human endothelial cells: effects on nitric oxide synthase activity, protein levels and dimerisation. Cardiovasc Res, 2002. 55(4): p. 838-49.
![Page 182: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/182.jpg)
182
113. Hattori, Y., et al., Oral administration of tetrahydrobiopterin slows the progression of atherosclerosis in apolipoprotein E-knockout mice. Arterioscler Thromb Vasc Biol, 2007. 27(4): p. 865-70.
114. Kaufman, S., A protein that stimulates rat liver phenylalanine hydroxylase. J Biol Chem, 1970. 245(18): p. 4751-9.
115. Nakanishi, N., H. Hasegawa, and S. Watabe, A new enzyme, NADPH-dihydropteridine reductase in bovine liver. J Biochem, 1977. 81(3): p. 681-5.
116. Vasquez-Vivar, J., et al., Reaction of tetrahydrobiopterin with superoxide: EPR-kinetic analysis and characterization of the pteridine radical. Free Radic Biol Med, 2001. 31(8): p. 975-85.
117. Katusic, Z.S., A. Stelter, and S. Milstien, Cytokines stimulate GTP cyclohydrolase I gene expression in cultured human umbilical vein endothelial cells. Arterioscler Thromb Vasc Biol, 1998. 18(1): p. 27-32.
118. Linscheid, P., et al., Regulation of 6-pyruvoyltetrahydropterin synthase activity and messenger RNA abundance in human vascular endothelial cells. Circulation, 1998. 98(17): p. 1703-6.
119. Huang, A., et al., Cytokine-stimulated GTP cyclohydrolase I expression in endothelial cells requires coordinated activation of nuclear factor-kappaB and Stat1/Stat3. Circ Res, 2005. 96(2): p. 164-71.
120. Lapize, C., et al., Protein kinase C phosphorylates and activates GTP cyclohydrolase I in rat renal mesangial cells. Biochem Biophys Res Commun, 1998. 251(3): p. 802-5.
121. Cai, S., et al., GTP cyclohydrolase I gene transfer augments intracellular tetrahydrobiopterin in human endothelial cells: effects on nitric oxide synthase activity, protein levels and dimerisation. Cardiovasc Res, 2002. 55(4): p. 838-849.
122. Widder, J.D., et al., Regulation of Tetrahydrobiopterin Biosynthesis by Shear Stress. Circ Res, 2007. 101(8): p. 830-838.
123. Bendall, J.K., et al., Stoichiometric Relationships Between Endothelial Tetrahydrobiopterin, Endothelial NO Synthase (eNOS) Activity, and eNOS Coupling in Vivo: Insights From Transgenic Mice With Endothelial-Targeted GTP Cyclohydrolase 1 and eNOS Overexpression. Circ Res, 2005. 97(9): p. 864-871.
124. Harada, T., H. Kagamiyama, and K. Hatakeyama, Feedback regulation mechanisms for the control of GTP cyclohydrolase I activity. Science, 1993. 260(5113): p. 1507-10.
125. Ishii, M., et al., Reduction of GTP cyclohydrolase I feedback regulating protein expression by hydrogen peroxide in vascular endothelial cells. J Pharmacol Sci, 2005. 97(2): p. 299-302.
![Page 183: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/183.jpg)
183
126. Swick, L. and G. Kapatos, A yeast 2-hybrid analysis of human GTP cyclohydrolase I protein interactions. J Neurochem, 2006. 97(5): p. 1447-55.
127. Kaspers, B., et al., Coordinate induction of tetrahydrobiopterin synthesis and nitric oxide synthase activity in chicken macrophages: upregulation of GTP-cyclohydrolase I activity. Comp Biochem Physiol B Biochem Mol Biol, 1997. 117(2): p. 209-15.
128. Werner, E.R., et al., Biochemistry and function of pteridine synthesis in human and murine macrophages. Pathobiology, 1991. 59(4): p. 276-9.
129. Gupta, S., et al., Serum neopterin in acute coronary syndromes. Lancet, 1997. 349(9060): p. 1252-3.
130. Curtius, H.C., et al., Biosynthesis of tetrahydrobiopterin in man. J Inherit Metab Dis, 1985. 8 Suppl 1: p. 28-33.
131. Yang, S., et al., A murine model for human sepiapterin-reductase deficiency. Am J Hum Genet, 2006. 78(4): p. 575-87.
132. Nichol, C.A., et al., Biosynthesis of tetrahydrobiopterin by de novo and salvage pathways in adrenal medulla extracts, mammalian cell cultures, and rat brain in vivo. Proc Natl Acad Sci U S A, 1983. 80(6): p. 1546-50.
133. Chalupsky, K. and H. Cai, Endothelial dihydrofolate reductase: critical for nitric oxide bioavailability and role in angiotensin II uncoupling of endothelial nitric oxide synthase. Proc Natl Acad Sci U S A, 2005. 102(25): p. 9056-61.
134. Czar, M.J., M.J. Welsh, and W.B. Pratt, Immunofluorescence localization of the 90-kDa heat-shock protein to cytoskeleton. Eur J Cell Biol, 1996. 70(4): p. 322-30.
135. Wiech, H., et al., Hsp90 chaperones protein folding in vitro. Nature, 1992. 358(6382): p. 169-70.
136. Hutchison, K.A., M.J. Czar, and W.B. Pratt, Evidence that the hormone-binding domain of the mouse glucocorticoid receptor directly represses DNA binding activity in a major portion of receptors that are "misfolded" after removal of hsp90. J Biol Chem, 1992. 267(5): p. 3190-5.
137. Oppermann, H., W. Levinson, and J.M. Bishop, A cellular protein that associates with the transforming protein of Rous sarcoma virus is also a heat-shock protein. Proc Natl Acad Sci U S A, 1981. 78(2): p. 1067-71.
138. Stancato, L.F., et al., The hsp90-binding antibiotic geldanamycin decreases Raf levels and epidermal growth factor signaling without disrupting formation of signaling complexes or reducing the specific enzymatic activity of Raf kinase. J Biol Chem, 1997. 272(7): p. 4013-20.
![Page 184: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/184.jpg)
184
139. Stancato, L.F., et al., Raf exists in a native heterocomplex with hsp90 and p50 that can be reconstituted in a cell-free system. J Biol Chem, 1993. 268(29): p. 21711-6.
140. Venema, V.J., M.B. Marrero, and R.C. Venema, Bradykinin-stimulated protein tyrosine phosphorylation promotes endothelial nitric oxide synthase translocation to the cytoskeleton. Biochem Biophys Res Commun, 1996. 226(3): p. 703-10.
141. Garcia-Cardena, G., et al., Dynamic activation of endothelial nitric oxide synthase by Hsp90. Nature, 1998. 392(6678): p. 821-4.
142. Stebbins, C.E., et al., Crystal structure of an Hsp90-geldanamycin complex: targeting of a protein chaperone by an antitumor agent. Cell, 1997. 89(2): p. 239-50.
143. Shah, V., et al., Hsp90 regulation of endothelial nitric oxide synthase contributes to vascular control in portal hypertension. Am J Physiol, 1999. 277(2 Pt 1): p. G463-8.
144. Pritchard, K.A., Jr., et al., Heat Shock Protein 90 Mediates the Balance of Nitric Oxide and Superoxide Anion from Endothelial Nitric-oxide Synthase. J. Biol. Chem., 2001. 276(21): p. 17621-17624.
145. Xu, H., et al., A heat shock protein 90 binding domain in endothelial nitric-oxide synthase influences enzyme function. J Biol Chem, 2007. 282(52): p. 37567-74.
146. Nishida, C.R. and P.R. Ortiz de Montellano, Autoinhibition of endothelial nitric-oxide synthase. Identification of an electron transfer control element. J Biol Chem, 1999. 274(21): p. 14692-8.
147. Scherer, P.E., et al., Cell-type and tissue-specific expression of caveolin-2. Caveolins 1 and 2 co-localize and form a stable hetero-oligomeric complex in vivo. J Biol Chem, 1997. 272(46): p. 29337-46.
148. Li, S., et al., Mutational analysis of caveolin-induced vesicle formation. Expression of caveolin-1 recruits caveolin-2 to caveolae membranes. FEBS Lett, 1998. 434(1-2): p. 127-34.
149. Song, K.S., et al., Expression of caveolin-3 in skeletal, cardiac, and smooth muscle cells. Caveolin-3 is a component of the sarcolemma and co-fractionates with dystrophin and dystrophin-associated glycoproteins. J Biol Chem, 1996. 271(25): p. 15160-5.
150. Michel, J.B., et al., Reciprocal regulation of endothelial nitric-oxide synthase by Ca2+-calmodulin and caveolin. J Biol Chem, 1997. 272(25): p. 15583-6.
151. Garcia-Cardena, G., et al., Dissecting the interaction between nitric oxide synthase (NOS) and caveolin. Functional significance of the nos caveolin binding domain in vivo. J Biol Chem, 1997. 272(41): p. 25437-40.
152. Bucci, M., et al., In vivo delivery of the caveolin-1 scaffolding domain inhibits nitric oxide synthesis and reduces inflammation. Nat Med, 2000. 6(12): p. 1362-7.
![Page 185: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/185.jpg)
185
153. Drab, M., et al., Loss of caveolae, vascular dysfunction, and pulmonary defects in caveolin-1 gene-disrupted mice. Science, 2001. 293(5539): p. 2449-52.
154. Razani, B., et al., Caveolin-1 null mice are viable but show evidence of hyperproliferative and vascular abnormalities. J Biol Chem, 2001. 276(41): p. 38121-38.
155. Feron, O., et al., Dynamic regulation of endothelial nitric oxide synthase: complementary roles of dual acylation and caveolin interactions. Biochemistry, 1998. 37(1): p. 193-200.
156. Feron, O., et al., The endothelial nitric-oxide synthase-caveolin regulatory cycle. J Biol Chem, 1998. 273(6): p. 3125-8.
157. Michel, J.B., et al., Caveolin versus calmodulin. Counterbalancing allosteric modulators of endothelial nitric oxide synthase. J Biol Chem, 1997. 272(41): p. 25907-12.
158. Janssens, S.P., et al., Cloning and expression of a cDNA encoding human endothelium-derived relaxing factor/nitric oxide synthase. J Biol Chem, 1992. 267(21): p. 14519-22.
159. Lamas, S., et al., Endothelial nitric oxide synthase: molecular cloning and characterization of a distinct constitutive enzyme isoform. Proc Natl Acad Sci U S A, 1992. 89(14): p. 6348-52.
160. Marsden, P.A., et al., Molecular cloning and characterization of human endothelial nitric oxide synthase. FEBS Lett, 1992. 307(3): p. 287-93.
161. Nishida, K., et al., Molecular cloning and characterization of the constitutive bovine aortic endothelial cell nitric oxide synthase. J Clin Invest, 1992. 90(5): p. 2092-6.
162. Sessa, W.C., et al., Molecular cloning and expression of a cDNA encoding endothelial cell nitric oxide synthase. J Biol Chem, 1992. 267(22): p. 15274-6.
163. Gordon, J.I., et al., Protein N-myristoylation. J Biol Chem, 1991. 266(14): p. 8647-50.
164. Busconi, L. and T. Michel, Endothelial nitric oxide synthase. N-terminal myristoylation determines subcellular localization. J Biol Chem, 1993. 268(12): p. 8410-3.
165. Liu, J. and W.C. Sessa, Identification of covalently bound amino-terminal myristic acid in endothelial nitric oxide synthase. J Biol Chem, 1994. 269(16): p. 11691-4.
166. Sessa, W.C., C.M. Barber, and K.R. Lynch, Mutation of N-myristoylation site converts endothelial cell nitric oxide synthase from a membrane to a cytosolic protein. Circ Res, 1993. 72(4): p. 921-4.
167. Liu, J., G. Garcia-Cardena, and W.C. Sessa, Biosynthesis and palmitoylation of endothelial nitric oxide synthase: mutagenesis of palmitoylation sites, cysteines-15 and/or -26, argues against depalmitoylation-induced translocation of the enzyme. Biochemistry, 1995. 34(38): p. 12333-40.
![Page 186: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/186.jpg)
186
168. Shaul, P.W., et al., Acylation targets emdothelial nitric-oxide synthase to plasmalemmal caveolae. J Biol Chem, 1996. 271(11): p. 6518-22.
169. Papapetropoulos, A., et al., Nitric oxide production contributes to the angiogenic properties of vascular endothelial growth factor in human endothelial cells. J Clin Invest, 1997. 100(12): p. 3131-9.
170. Zeng, G. and M.J. Quon, Insulin-stimulated production of nitric oxide is inhibited by wortmannin. Direct measurement in vascular endothelial cells. J Clin Invest, 1996. 98(4): p. 894-8.
171. Fulton, D., J.P. Gratton, and W.C. Sessa, Post-translational control of endothelial nitric oxide synthase: why isn't calcium/calmodulin enough? J Pharmacol Exp Ther, 2001. 299(3): p. 818-24.
172. Dimmeler, S., et al., Activation of nitric oxide synthase in endothelial cells by Akt-dependent phosphorylation. Nature, 1999. 399(6736): p. 601-5.
173. Fulton, D., et al., Regulation of endothelium-derived nitric oxide production by the protein kinase Akt. Nature, 1999. 399(6736): p. 597-601.
174. Lane, P. and S.S. Gross, Disabling a C-terminal autoinhibitory control element in endothelial nitric-oxide synthase by phosphorylation provides a molecular explanation for activation of vascular NO synthesis by diverse physiological stimuli. J Biol Chem, 2002. 277(21): p. 19087-94.
175. Bauer, P.M., et al., Compensatory Phosphorylation and Protein-Protein Interactions Revealed by Loss of Function and Gain of Function Mutants of Multiple Serine Phosphorylation Sites in Endothelial Nitric-oxide Synthase. J. Biol. Chem., 2003. 278(17): p. 14841-14849.
176. Luo, Z., et al., Acute modulation of endothelial Akt/PKB activity alters nitric oxide-dependent vasomotor activity in vivo. J Clin Invest, 2000. 106(4): p. 493-9.
177. Kureishi, Y., et al., The HMG-CoA reductase inhibitor simvastatin activates the protein kinase Akt and promotes angiogenesis in normocholesterolemic animals. Nat Med, 2000. 6(9): p. 1004-10.
178. Chen, Z.P., et al., AMP-activated protein kinase phosphorylation of endothelial NO synthase. FEBS Lett, 1999. 443(3): p. 285-9.
179. Matsubara, M., et al., Regulation of endothelial nitric oxide synthase by protein kinase C. J Biochem, 2003. 133(6): p. 773-81.
180. Fleming, I., et al., Phosphorylation of Thr(495) regulates Ca(2+)/calmodulin-dependent endothelial nitric oxide synthase activity. Circ Res, 2001. 88(11): p. E68-75.
![Page 187: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/187.jpg)
187
181. Michell, B.J., et al., Coordinated control of endothelial nitric-oxide synthase phosphorylation by protein kinase C and the cAMP-dependent protein kinase. J Biol Chem, 2001. 276(21): p. 17625-8.
182. Harris, M.B., et al., Reciprocal phosphorylation and regulation of endothelial nitric-oxide synthase in response to bradykinin stimulation. J Biol Chem, 2001. 276(19): p. 16587-91.
183. Lin, M.I., et al., Phosphorylation of threonine 497 in endothelial nitric-oxide synthase coordinates the coupling of L-arginine metabolism to efficient nitric oxide production. J Biol Chem, 2003. 278(45): p. 44719-26.
184. Thomas, S.R., K. Chen, and J.F. Keaney, Jr., Hydrogen peroxide activates endothelial nitric-oxide synthase through coordinated phosphorylation and dephosphorylation via a phosphoinositide 3-kinase-dependent signaling pathway. J Biol Chem, 2002. 277(8): p. 6017-24.
185. Boo, Y.C., et al., Shear stress stimulates phosphorylation of eNOS at Ser(635) by a protein kinase A-dependent mechanism. Am J Physiol Heart Circ Physiol, 2002. 283(5): p. H1819-28.
186. Boo, Y.C., et al., Endothelial NO synthase phosphorylated at SER635 produces NO without requiring intracellular calcium increase. Free Radic Biol Med, 2003. 35(7): p. 729-41.
187. Kou, R., D. Greif, and T. Michel, Dephosphorylation of endothelial nitric-oxide synthase by vascular endothelial growth factor. Implications for the vascular responses to cyclosporin A. J Biol Chem, 2002. 277(33): p. 29669-73.
188. Gallis, B., et al., Identification of flow-dependent endothelial nitric-oxide synthase phosphorylation sites by mass spectrometry and regulation of phosphorylation and nitric oxide production by the phosphatidylinositol 3-kinase inhibitor LY294002. J Biol Chem, 1999. 274(42): p. 30101-8.
189. Drew, B.G., et al., High-density lipoprotein and apolipoprotein AI increase endothelial NO synthase activity by protein association and multisite phosphorylation. Proc Natl Acad Sci U S A, 2004. 101(18): p. 6999-7004.
190. Babior, B.M., NADPH oxidase. Curr Opin Immunol, 2004. 16(1): p. 42-7.
191. Ago, T., et al., Nox4 as the major catalytic component of an endothelial NAD(P)H oxidase. Circulation, 2004. 109(2): p. 227-33.
192. Martyn, K.D., et al., Functional analysis of Nox4 reveals unique characteristics compared to other NADPH oxidases. Cell Signal, 2006. 18(1): p. 69-82.
193. Dworakowski, R., S.P. Alom-Ruiz, and A.M. Shah, NADPH oxidase-derived reactive oxygen species in the regulation of endothelial phenotype. Pharmacol Rep, 2008. 60(1): p. 21-8.
![Page 188: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/188.jpg)
188
194. Frey, R.S., et al., PKCzeta regulates TNF-alpha-induced activation of NADPH oxidase in endothelial cells. Circ Res, 2002. 90(9): p. 1012-9.
195. Li, J.M. and A.M. Shah, Mechanism of endothelial cell NADPH oxidase activation by angiotensin II. Role of the p47phox subunit. J Biol Chem, 2003. 278(14): p. 12094-100.
196. Sorescu, D., et al., Superoxide production and expression of nox family proteins in human atherosclerosis. Circulation, 2002. 105(12): p. 1429-35.
197. Ohishi, M., et al., Enhanced expression of angiotensin-converting enzyme is associated with progression of coronary atherosclerosis in humans. J Hypertens, 1997. 15(11): p. 1295-302.
198. Diet, F., et al., Increased accumulation of tissue ACE in human atherosclerotic coronary artery disease. Circulation, 1996. 94(11): p. 2756-67.
199. Nickenig, G., et al., Statin-sensitive dysregulated AT1 receptor function and density in hypercholesterolemic men. Circulation, 1999. 100(21): p. 2131-4.
200. Bevilacqua, M.P., Endothelial-leukocyte adhesion molecules. Annu Rev Immunol, 1993. 11: p. 767-804.
201. Kuzkaya, N., et al., Interactions of peroxynitrite, tetrahydrobiopterin, ascorbic acid, and thiols: implications for uncoupling endothelial nitric-oxide synthase. J Biol Chem, 2003. 278(25): p. 22546-54.
202. Landmesser, U., et al., Oxidation of tetrahydrobiopterin leads to uncoupling of endothelial cell nitric oxide synthase in hypertension. J Clin Invest, 2003. 111(8): p. 1201-9.
203. Meininger, C.J., et al., Impaired nitric oxide production in coronary endothelial cells of the spontaneously diabetic BB rat is due to tetrahydrobiopterin deficiency. Biochem J, 2000. 349(Pt 1): p. 353-6.
204. Cai, S., et al., Endothelial nitric oxide synthase dysfunction in diabetic mice: importance of tetrahydrobiopterin in eNOS dimerisation. Diabetologia, 2005. 48(9): p. 1933-40.
205. Heitzer, T., et al., Tetrahydrobiopterin improves endothelium-dependent vasodilation by increasing nitric oxide activity in patients with Type II diabetes mellitus. Diabetologia, 2000. 43(11): p. 1435-8.
206. Takaya, T., et al., A specific role for eNOS-derived reactive oxygen species in atherosclerosis progression. Arterioscler Thromb Vasc Biol, 2007. 27(7): p. 1632-7.
207. Ozaki, M., et al., Overexpression of endothelial nitric oxide synthase accelerates atherosclerotic lesion formation in apoE-deficient mice. J Clin Invest, 2002. 110(3): p. 331-40.
![Page 189: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/189.jpg)
189
208. Crabtree, M.J., et al., Ratio of 5,6,7,8-tetrahydrobiopterin to 7,8-dihydrobiopterin in endothelial cells determines glucose-elicited changes in NO vs. superoxide production by eNOS. Am J Physiol Heart Circ Physiol, 2008. 294(4): p. H1530-40.
209. Miranda, T.B., et al., Yeast Hsl7 (histone synthetic lethal 7) catalyses the in vitro formation of omega-N(G)-monomethylarginine in calf thymus histone H2A. Biochem J, 2006. 395(3): p. 563-70.
210. Gary, J.D. and S. Clarke, RNA and protein interactions modulated by protein arginine methylation. Prog Nucleic Acid Res Mol Biol, 1998. 61: p. 65-131.
211. Rawal, N., et al., Structural specificity of substrate for S-adenosylmethionine:protein arginine N-methyltransferases. Biochim Biophys Acta, 1995. 1248(1): p. 11-8.
212. Gary, J.D., et al., The predominant protein-arginine methyltransferase from Saccharomyces cerevisiae. J Biol Chem, 1996. 271(21): p. 12585-94.
213. Chen, S.L., et al., The coactivator-associated arginine methyltransferase is necessary for muscle differentiation: CARM1 coactivates myocyte enhancer factor-2. J Biol Chem, 2002. 277(6): p. 4324-33.
214. Tang, J., et al., PRMT 3, a type I protein arginine N-methyltransferase that differs from PRMT1 in its oligomerization, subcellular localization, substrate specificity, and regulation. J Biol Chem, 1998. 273(27): p. 16935-45.
215. Pawlak, M.R., et al., Arginine N-methyltransferase 1 is required for early postimplantation mouse development, but cells deficient in the enzyme are viable. Mol Cell Biol, 2000. 20(13): p. 4859-69.
216. Chang, B., et al., JMJD6 is a histone arginine demethylase. Science, 2007. 318(5849): p. 444-7.
217. Boger, R.H., et al., LDL Cholesterol Upregulates Synthesis of Asymmetrical Dimethylarginine in Human Endothelial Cells : Involvement of S-Adenosylmethionine-Dependent Methyltransferases. Circ Res, 2000. 87(2): p. 99-105.
218. Osanai, T., et al., Effect of Shear Stress on Asymmetric Dimethylarginine Release From Vascular Endothelial Cells. Hypertension, 2003. 42(5): p. 985-990.
219. MacAllister, R.J., et al., Concentration of dimethyl-L-arginine in the plasma of patients with end-stage renal failure. Nephrol Dial Transplant, 1996. 11(12): p. 2449-52.
220. MacAllister, R.J., et al., Metabolism of methylarginines by human vasculature; implications for the regulation of nitric oxide synthesis. Br J Pharmacol, 1994. 112(1): p. 43-8.
221. Xiao, S., et al., Circulating endothelial nitric oxide synthase inhibitory factor in some patients with chronic renal disease. Kidney Int, 2001. 59(4): p. 1466-72.
![Page 190: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/190.jpg)
190
222. Vallance, P., et al., Accumulation of an endogenous inhibitor of nitric oxide synthesis in chronic renal failure. Lancet, 1992. 339(8793): p. 572-5.
223. Kakimoto, Y. and S. Akazawa, Isolation and identification of N-G,N-G- and N-G,N'-G-dimethyl-arginine, N-epsilon-mono-, di-, and trimethyllysine, and glucosylgalactosyl- and galactosyl-delta-hydroxylysine from human urine. J Biol Chem, 1970. 245(21): p. 5751-8.
224. McDermott, J.R., Studies on the catabolism of Ng-methylarginine, Ng, Ng-dimethylarginine and Ng, Ng-dimethylarginine in the rabbit. Biochem J, 1976. 154(1): p. 179-84.
225. Ogawa, T., et al., Metabolism of NG,NG-and NG,N'G-dimethylarginine in rats. Arch Biochem Biophys, 1987. 252(2): p. 526-37.
226. Ogawa, T., M. Kimoto, and K. Sasaoka, Purification and properties of a new enzyme, NG,NG-dimethylarginine dimethylaminohydrolase, from rat kidney. J Biol Chem, 1989. 264(17): p. 10205-9.
227. Tran, C.T., J.M. Leiper, and P. Vallance, The DDAH/ADMA/NOS pathway. Atheroscler Suppl, 2003. 4(4): p. 33-40.
228. Forbes, S.P., et al., Mechanism of 4-HNE mediated inhibition of hDDAH-1: implications in no regulation. Biochemistry, 2008. 47(6): p. 1819-26.
229. Okubo, K., et al., Role of asymmetrical dimethylarginine in renal microvascular endothelial dysfunction in chronic renal failure with hypertension. Hypertens Res, 2005. 28(2): p. 181-9.
230. Braun, O., et al., Specific reactions of S-nitrosothiols with cysteine hydrolases: A comparative study between dimethylargininase-1 and CTP synthetase. Protein Sci, 2007. 16(8): p. 1522-34.
231. Birdsey, G.M., J.M. Leiper, and P. Vallance, Intracellular localization of dimethylarginine dimethylaminohydrolase overexpressed in an endothelial cell line. Acta Physiol Scand, 2000. 168(1): p. 73-9.
232. Murray-Rust, J., et al., Structural insights into the hydrolysis of cellular nitric oxide synthase inhibitors by dimethylarginine dimethylaminohydrolase. Nat Struct Biol, 2001. 8(8): p. 679-83.
233. Nijveldt, R.J., et al., The liver is an important organ in the metabolism of asymmetrical dimethylarginine (ADMA). Clin Nutr, 2003. 22(1): p. 17-22.
234. Nijveldt, R.J., et al., Elimination of asymmetric dimethylarginine by the kidney and the liver: a link to the development of multiple organ failure? J Nutr, 2004. 134(10 Suppl): p. 2848S-2852S; discussion 2853S.
![Page 191: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/191.jpg)
191
235. Tran, C.T., et al., Chromosomal localization, gene structure, and expression pattern of DDAH1: comparison with DDAH2 and implications for evolutionary origins. Genomics, 2000. 68(1): p. 101-5.
236. Kimoto, M., et al., Detection of NG,NG-dimethylarginine dimethylaminohydrolase in the nitric oxide-generating systems of rats using monoclonal antibody. Arch Biochem Biophys, 1993. 300(2): p. 657-62.
237. Wang, D., et al., Isoform-specific regulation by N(G),N(G)-dimethylarginine dimethylaminohydrolase of rat serum asymmetric dimethylarginine and vascular endothelium-derived relaxing factor/NO. Circ Res, 2007. 101(6): p. 627-35.
238. MacAllister, R.J., et al., Regulation of nitric oxide synthesis by dimethylarginine dimethylaminohydrolase. Br J Pharmacol, 1996. 119(8): p. 1533-40.
239. Dayoub, H., et al., Dimethylarginine dimethylaminohydrolase regulates nitric oxide synthesis: genetic and physiological evidence. Circulation, 2003. 108(24): p. 3042-7. Epub 2003 Nov 24.
240. Leiper, J., et al., Disruption of methylarginine metabolism impairs vascular homeostasis. Nat Med, 2007. 13(2): p. 198-203.
241. Jacobi, J., et al., Overexpression of dimethylarginine dimethylaminohydrolase reduces tissue asymmetric dimethylarginine levels and enhances angiogenesis. Circulation, 2005. 111(11): p. 1431-8.
242. Tanaka, M., et al., Dimethylarginine dimethylaminohydrolase overexpression suppresses graft coronary artery disease. Circulation, 2005. 112(11): p. 1549-56.
243. Cardounel, A.J., W.A. Wallace, and C.K. Sen, Proximal middle cerebral artery occlusion surgery for the study of ischemia-reoxygenation injury in the brain. Methods Enzymol, 2004. 381: p. 416-22.
244. Hasegawa, K., et al., Role of Asymmetric Dimethylarginine in Vascular Injury in Transgenic Mice Overexpressing Dimethylarginie Dimethylaminohydrolase 2. Circ Res, 2007. 101(2): p. e2-10.
245. Smith, C.L., et al., Dimethylarginine dimethylaminohydrolase activity modulates ADMA levels, VEGF expression, and cell phenotype. Biochem Biophys Res Commun, 2003. 308(4): p. 984-9.
246. Hasegawa, K., et al., Dimethylarginine dimethylaminohydrolase 2 increases vascular endothelial growth factor expression through Sp1 transcription factor in endothelial cells. Arterioscler Thromb Vasc Biol, 2006. 26(7): p. 1488-94.
247. Tokuo, H., et al., Phosphorylation of neurofibromin by cAMP-dependent protein kinase is regulated via a cellular association of N(G),N(G)-dimethylarginine dimethylaminohydrolase. FEBS Lett, 2001. 494(1-2): p. 48-53.
![Page 192: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/192.jpg)
192
248. Knipp, M., et al., Zn(II)-free dimethylargininase-1 (DDAH-1) is inhibited upon specific Cys-S-nitrosylation. J Biol Chem, 2003. 278(5): p. 3410-6.
249. Hong, L. and W. Fast, Inhibition of human dimethylarginine dimethylaminohydrolase-1 by S-nitroso-L-homocysteine and hydrogen peroxide. Analysis, quantification, and implications for hyperhomocysteinemia. J Biol Chem, 2007. 282(48): p. 34684-92.
250. Scalera, F., et al., Effect of telmisartan on nitric oxide--asymmetrical dimethylarginine system: role of angiotensin II type 1 receptor gamma and peroxisome proliferator activated receptor gamma signaling during endothelial aging. Hypertension, 2008. 51(3): p. 696-703.
251. Yin, Q.F. and Y. Xiong, Pravastatin restores DDAH activity and endothelium-dependent relaxation of rat aorta after exposure to glycated protein. J Cardiovasc Pharmacol, 2005. 45(6): p. 525-32.
252. Achan, V., et al., all-trans-Retinoic acid increases nitric oxide synthesis by endothelial cells: a role for the induction of dimethylarginine dimethylaminohydrolase. Circ Res, 2002. 90(7): p. 764-9.
253. Jones, L.C., et al., Common genetic variation in a basal promoter element alters DDAH2 expression in endothelial cells. Biochem Biophys Res Commun, 2003. 310(3): p. 836-43.
254. Valkonen, V.P., T.P. Tuomainen, and R. Laaksonen, DDAH gene and cardiovascular risk. Vasc Med, 2005. 10 Suppl 1: p. S45-8.
255. Boger, R.H., et al., Asymmetric dimethylarginine (ADMA): a novel risk factor for endothelial dysfunction: its role in hypercholesterolemia. Circulation, 1998. 98(18): p. 1842-7.
256. Zoccali, C., et al., Plasma concentration of asymmetrical dimethylarginine and mortality in patients with end-stage renal disease: a prospective study. Lancet, 2001. 358(9299): p. 2113-7.
257. Lu, T.M., et al., Plasma levels of asymmetrical dimethylarginine and adverse cardiovascular events after percutaneous coronary intervention. Eur Heart J, 2003. 24(21): p. 1912-9.
258. McLaughlin, T., et al., Plasma asymmetric dimethylarginine concentrations are elevated in obese insulin-resistant women and fall with weight loss. J Clin Endocrinol Metab, 2006. 91(5): p. 1896-900.
259. Chan, J.R., et al., Asymmetric Dimethylarginine Increases Mononuclear Cell Adhesiveness in Hypercholesterolemic Humans. Arterioscler Thromb Vasc Biol, 2000. 20(4): p. 1040-1046.
260. Azuma, H., et al., Accumulation of endogenous inhibitors for nitric oxide synthesis and decreased content of L-arginine in regenerated endothelial cells. Br J Pharmacol, 1995. 115(6): p. 1001-4.
![Page 193: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/193.jpg)
193
261. Ito, A., et al., Novel mechanism for endothelial dysfunction: dysregulation of dimethylarginine dimethylaminohydrolase. Circulation, 1999. 99(24): p. 3092-5.
262. Shahgasempour, S., S.B. Woodroffe, and H.M. Garnett, Alterations in the expression of ELAM-1, ICAM-1 and VCAM-1 after in vitro infection of endothelial cells with a clinical isolate of human cytomegalovirus. Microbiol Immunol, 1997. 41(2): p. 121-9.
263. Weis, M., et al., Cytomegalovirus infection impairs the nitric oxide synthase pathway: role of asymmetric dimethylarginine in transplant arteriosclerosis. Circulation, 2004. 109(4): p. 500-5.
264. Tain, Y.L. and C. Baylis, Determination of dimethylarginine dimethylaminohydrolase activity in the kidney. Kidney Int, 2007. 72(7): p. 886-9.
265. Lin, K.Y., et al., Impaired nitric oxide synthase pathway in diabetes mellitus: role of asymmetric dimethylarginine and dimethylarginine dimethylaminohydrolase. Circulation, 2002. 106(8): p. 987-92.
266. Sorrenti, V., et al., High glucose-mediated imbalance of nitric oxide synthase and dimethylarginine dimethylaminohydrolase expression in endothelial cells. Curr Neurovasc Res, 2006. 3(1): p. 49-54.
267. Achan, V., et al., Asymmetric dimethylarginine causes hypertension and cardiac dysfunction in humans and is actively metabolized by dimethylarginine dimethylaminohydrolase. Arterioscler Thromb Vasc Biol, 2003. 23(8): p. 1455-9.
268. Boger, G.I., et al., Asymmetric dimethylarginine determines the improvement of endothelium-dependent vasodilation by simvastatin: Effect of combination with oral L-arginine. J Am Coll Cardiol, 2007. 49(23): p. 2274-82.
269. Maas, R., et al., Asymmetric dimethylarginine, smoking, and risk of coronary heart disease in apparently healthy men: prospective analysis from the population-based Monitoring of Trends and Determinants in Cardiovascular Disease/Kooperative Gesundheitsforschung in der Region Augsburg study and experimental data. Clin Chem, 2007. 53(4): p. 693-701.
270. Maas, R., et al., Asymmetrical dimethylarginine (ADMA) and coronary endothelial function in patients with coronary artery disease and mild hypercholesterolemia. Atherosclerosis, 2007. 191(1): p. 211-9.
271. Maas, R., et al., Elevated plasma concentrations of the endogenous nitric oxide synthase inhibitor asymmetric dimethylarginine predict adverse events in patients undergoing noncardiac surgery. Crit Care Med, 2007. 35(8): p. 1876-81.
272. Boger, R.H., et al., Plasma concentration of asymmetric dimethylarginine, an endogenous inhibitor of nitric oxide synthase, is elevated in monkeys with hyperhomocyst(e)inemia or hypercholesterolemia. Arterioscler Thromb Vasc Biol, 2000. 20(6): p. 1557-64.
![Page 194: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/194.jpg)
194
273. Schulze, F., et al., Asymmetric dimethylarginine is an independent risk factor for coronary heart disease: results from the multicenter Coronary Artery Risk Determination investigating the Influence of ADMA Concentration (CARDIAC) study. Am Heart J, 2006. 152(3): p. 493 e1-8.
274. Pope, A.J., et al., Role of DDAH-1 in lipid peroxidation product-mediated inhibition of endothelial NO generation. Am J Physiol Cell Physiol, 2007. 293(5): p. C1679-86.
275. Ito, A., et al., Novel mechanism for endothelial dysfunction: dysregulation of dimethylarginine dimethylaminohydrolase. Circulation, 1999. 99(24): p. 3092-5.
276. Zakrzewicz, D. and O. Eickelberg, From arginine methylation to ADMA: a novel mechanism with therapeutic potential in chronic lung diseases. BMC Pulm Med, 2009. 9: p. 5.
277. Zoccali, C., et al., Asymmetric dimethyl-arginine (ADMA) response to inflammation in acute infections. Nephrol Dial Transplant, 2007. 22(3): p. 801-6.
278. Vallance, P. and J. Leiper, Asymmetric dimethylarginine and kidney disease--marker or mediator? J Am Soc Nephrol, 2005. 16(8): p. 2254-6.
279. Stuhlinger, M.C., et al., Asymmetric dimethyl L-arginine (ADMA) is a critical regulator of myocardial reperfusion injury. Cardiovasc Res, 2007. 75(2): p. 417-25.
280. Simon, A., et al., Role of neutral amino acid transport and protein breakdown for substrate supply of nitric oxide synthase in human endothelial cells. Circ Res, 2003. 93(9): p. 813-20.
281. Gray, G.A., et al., Immunolocalisation and activity of DDAH I and II in the heart and modification post-myocardial infarction. Acta Histochem, 2009.
282. Leiper, J.M., et al., Identification of two human dimethylarginine dimethylaminohydrolases with distinct tissue distributions and homology with microbial arginine deiminases. Biochem J, 1999. 343 Pt 1: p. 209-14.
283. Guerra, R., Jr., et al., Mechanisms of abnormal endothelium-dependent vascular relaxation in atherosclerosis: implications for altered autocrine and paracrine functions of EDRF. Blood Vessels, 1989. 26(5): p. 300-14.
284. Palmer, R.M., A.G. Ferrige, and S. Moncada, Nitric oxide release accounts for the biological activity of endothelium-derived relaxing factor. Nature, 1987. 327(6122): p. 524-6.
285. Radomski, M.W. and S. Moncada, Regulation of vascular homeostasis by nitric oxide. Thromb Haemost, 1993. 70(1): p. 36-41.
286. Cohen, R.A., The role of nitric oxide and other endothelium-derived vasoactive substances in vascular disease. Prog Cardiovasc Dis, 1995. 38(2): p. 105-28.
![Page 195: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/195.jpg)
195
287. Keaney, J.F., Jr., et al., Dietary probucol preserves endothelial function in cholesterol-fed rabbits by limiting vascular oxidative stress and superoxide generation. J Clin Invest, 1995. 95(6): p. 2520-9.
288. Yla-Herttuala, S., et al., Evidence for the presence of oxidatively modified low density lipoprotein in atherosclerotic lesions of rabbit and man. J Clin Invest, 1989. 84(4): p. 1086-95.
289. Jurgens, G., et al., Immunostaining of human autopsy aortas with antibodies to modified apolipoprotein B and apoprotein(a). Arterioscler Thromb, 1993. 13(11): p. 1689-99.
290. Usatyuk, P.V., N.L. Parinandi, and V. Natarajan, Redox regulation of 4-hydroxy-2-nonenal-mediated endothelial barrier dysfunction by focal adhesion, adherens, and tight junction proteins. J Biol Chem, 2006. 281(46): p. 35554-66.
291. Chisolm, G.M. and D. Steinberg, The oxidative modification hypothesis of atherogenesis: an overview. Free Radic Biol Med, 2000. 28(12): p. 1815-26.
292. Quinn, M.T., et al., Oxidatively modified low density lipoproteins: a potential role in recruitment and retention of monocyte/macrophages during atherogenesis. Proc Natl Acad Sci U S A, 1987. 84(9): p. 2995-8.
293. Sawamura, T., et al., An endothelial receptor for oxidized low-density lipoprotein. Nature, 1997. 386(6620): p. 73-7.
294. Simon, B.C., L.D. Cunningham, and R.A. Cohen, Oxidized low density lipoproteins cause contraction and inhibit endothelium-dependent relaxation in the pig coronary artery. J Clin Invest, 1990. 86(1): p. 75-9.
295. Meinitzer, A., et al., Asymmetrical dimethylarginine independently predicts total and cardiovascular mortality in individuals with angiographic coronary artery disease (the Ludwigshafen Risk and Cardiovascular Health study). Clin Chem, 2007. 53(2): p. 273-83.
296. Smith, C.L., et al., Effects of ADMA upon gene expression: an insight into the pathophysiological significance of raised plasma ADMA. PLoS Med, 2005. 2(10): p. e264.
297. Tsao, P.S. and J.P. Cooke, Endothelial alterations in hypercholesterolemia: more than simply vasodilator dysfunction. J Cardiovasc Pharmacol, 1998. 32 Suppl 3: p. S48-53.
298. Boger, R.H., P. Vallance, and J.P. Cooke, Asymmetric dimethylarginine (ADMA): a key regulator of nitric oxide synthase. Atheroscler Suppl, 2003. 4(4): p. 1-3.
299. Cooke, J.P., Does ADMA cause endothelial dysfunction? Arterioscler Thromb Vasc Biol, 2000. 20(9): p. 2032-7.
300. Kimoto, M., et al., Purification, cDNA cloning and expression of human NG,NG-dimethylarginine dimethylaminohydrolase. Eur J Biochem, 1998. 258(2): p. 863-8.
![Page 196: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/196.jpg)
196
301. Chen, Y., et al., Dimethylarginine dimethylaminohydrolase and endothelial dysfunction in failing hearts. Am J Physiol Heart Circ Physiol, 2005. 289(5): p. H2212-9.
302. Leiper, J.M., The DDAH-ADMA-NOS pathway. Ther Drug Monit, 2005. 27(6): p. 744-6.
303. Boger, R.H., J.P. Cooke, and P. Vallance, ADMA: an emerging cardiovascular risk factor. Vasc Med, 2005. 10 Suppl 1: p. S1-2.
304. Vallance, P. and J. Leiper, Cardiovascular biology of the asymmetric dimethylarginine:dimethylarginine dimethylaminohydrolase pathway. Arterioscler Thromb Vasc Biol, 2004. 24(6): p. 1023-30.
305. Wojciak-Stothard, B., et al., The ADMA/DDAH pathway is a critical regulator of endothelial cell motility. J Cell Sci, 2007. 120(Pt 6): p. 929-42.
306. Cardounel, A.J. and J.L. Zweier, Endogenous methylarginines regulate neuronal nitric-oxide synthase and prevent excitotoxic injury. J Biol Chem, 2002. 277(37): p. 33995-4002. Epub 2002 Jun 28.
307. Esterbauer, H., R.J. Schaur, and H. Zollner, Chemistry and biochemistry of 4-hydroxynonenal, malonaldehyde and related aldehydes. Free Radic Biol Med, 1991. 11(1): p. 81-128.
308. Lieners, C., et al., Lipidperoxidation in a canine model of hypovolemic-traumatic shock. Prog Clin Biol Res, 1989. 308: p. 345-50.
309. Siakotos, A.N., et al., 4-Hydroxynonenal: a specific indicator for canine neuronal-retinal ceroidosis. Am J Med Genet Suppl, 1988. 5: p. 171-81.
310. Xia, Y., et al., Superoxide generation from endothelial nitric-oxide synthase. A Ca2+/calmodulin-dependent and tetrahydrobiopterin regulatory process. J Biol Chem, 1998. 273(40): p. 25804-8.
311. Landmesser, U., et al., Oxidation of tetrahydrobiopterin leads to uncoupling of endothelial cell nitric oxide synthase in hypertension. J Clin Invest, 2003. 111(8): p. 1201-9.
312. Cardounel, A.J., Y. Xia, and J.L. Zweier, Endogenous methylarginines modulate superoxide as well as nitric oxide generation from neuronal nitric-oxide synthase: differences in the effects of monomethyl- and dimethylarginines in the presence and absence of tetrahydrobiopterin. J Biol Chem, 2005. 280(9): p. 7540-9.
313. Konishi, H., K. Sydow, and J.P. Cooke, Dimethylarginine dimethylaminohydrolase promotes endothelial repair after vascular injury. J Am Coll Cardiol, 2007. 49(10): p. 1099-105.
314. Frey, D., et al., Structure of the mammalian NOS regulator dimethylarginine dimethylaminohydrolase: A basis for the design of specific inhibitors. Structure, 2006. 14(5): p. 901-11.
![Page 197: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/197.jpg)
197
315. Stone, E.M., et al., Substrate-assisted cysteine deprotonation in the mechanism of dimethylargininase (DDAH) from Pseudomonas aeruginosa. Biochemistry, 2006. 45(17): p. 5618-30.
316. Uchida, K., 4-Hydroxy-2-nonenal: a product and mediator of oxidative stress. Prog Lipid Res, 2003. 42(4): p. 318-43.
317. Cooke, J.P., Does ADMA cause endothelial dysfunction? Arterioscler Thromb Vasc Biol, 2000. 20(9): p. 2032-7.
318. Arnold, W.P., et al., Nitric oxide activates guanylate cyclase and increases guanosine 3':5'-cyclic monophosphate levels in various tissue preparations. Proc Natl Acad Sci U S A, 1977. 74(8): p. 3203-7.
319. Gruetter, D.Y., et al., Activation of coronary arterial guanylate cyclase by nitric oxide, nitroprusside, and nitrosoguanidine--inhibition by calcium, lanthanum, and other cations, enhancement by thiols. Biochem Pharmacol, 1980. 29(21): p. 2943-50.
320. Martin, W., et al., Selective blockade of endothelium-dependent and glyceryl trinitrate-induced relaxation by hemoglobin and by methylene blue in the rabbit aorta. J Pharmacol Exp Ther, 1985. 232(3): p. 708-16.
321. Hecker, M., D.T. Walsh, and J.R. Vane, On the substrate specificity of nitric oxide synthase. FEBS Lett, 1991. 294(3): p. 221-4.
322. Sarkar, R., et al., Cell cycle effects of nitric oxide on vascular smooth muscle cells. Am J Physiol, 1997. 272(4 Pt 2): p. H1810-8.
323. Pou, S., et al., Generation of superoxide by purified brain nitric oxide synthase. J Biol Chem, 1992. 267(34): p. 24173-6.
324. Pou, S., et al., Mechanism of superoxide generation by neuronal nitric-oxide synthase. J Biol Chem, 1999. 274(14): p. 9573-80.
325. Rosen, G.M., et al., The role of tetrahydrobiopterin in the regulation of neuronal nitric-oxide synthase-generated superoxide. J Biol Chem, 2002. 277(43): p. 40275-80. Epub 2002 Aug 14.
326. Vasquez-Vivar, J., et al., Superoxide generation by endothelial nitric oxide synthase: the influence of cofactors. Proc Natl Acad Sci U S A, 1998. 95(16): p. 9220-5.
327. Vasquez-Vivar, J., et al., Tetrahydrobiopterin-dependent inhibition of superoxide generation from neuronal nitric oxide synthase. J Biol Chem, 1999. 274(38): p. 26736-42.
328. Xia, Y., et al., Nitric oxide synthase generates superoxide and nitric oxide in arginine-depleted cells leading to peroxynitrite-mediated cellular injury. Proc Natl Acad Sci U S A, 1996. 93(13): p. 6770-4.
![Page 198: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/198.jpg)
198
329. Xia, Y. and J.L. Zweier, Superoxide and peroxynitrite generation from inducible nitric oxide synthase in macrophages. Proc Natl Acad Sci U S A, 1997. 94(13): p. 6954-8.
330. Nishida, C.R. and P.R. Ortiz de Montellano, Electron transfer and catalytic activity of nitric oxide synthases. Chimeric constructs of the neuronal, inducible, and endothelial isoforms. J Biol Chem, 1998. 273(10): p. 5566-71.
331. Witte, M.B. and A. Barbul, Arginine physiology and its implication for wound healing. Wound Repair Regen, 2003. 11(6): p. 419-23.
332. Witte, M.B., et al., L-Arginine supplementation enhances diabetic wound healing: involvement of the nitric oxide synthase and arginase pathways. Metabolism, 2002. 51(10): p. 1269-73.
333. Reckelhoff, J.F., et al., Changes in nitric oxide precursor, L-arginine, and metabolites, nitrate and nitrite, with aging. Life Sci, 1994. 55(24): p. 1895-902.
334. Hasegawa, T., et al., Impairment of L-arginine metabolism in spontaneously hypertensive rats. Biochem Int, 1992. 26(4): p. 653-8.
335. Albina, J.E., et al., Temporal expression of different pathways of 1-arginine metabolism in healing wounds. J Immunol, 1990. 144(10): p. 3877-80.
336. Hecker, M., et al., The metabolism of L-arginine and its significance for the biosynthesis of endothelium-derived relaxing factor: cultured endothelial cells recycle L-citrulline to L-arginine. Proc Natl Acad Sci U S A, 1990. 87(21): p. 8612-6.
337. Rodriguez-Crespo, I. and P.R. Ortiz de Montellano, Human endothelial nitric oxide synthase: expression in Escherichia coli, coexpression with calmodulin, and characterization. Arch Biochem Biophys, 1996. 336(1): p. 151-6.
338. Xia, Y., et al., Electron paramagnetic resonance spectroscopy with N-methyl-D-glucamine dithiocarbamate iron complexes distinguishes nitric oxide and nitroxyl anion in a redox-dependent manner: applications in identifying nitrogen monoxide products from nitric oxide synthase. Free Radic Biol Med, 2000. 29(8): p. 793-7.
339. Souza, H.P., et al., Quantitation of superoxide generation and substrate utilization by vascular NAD(P)H oxidase. Am J Physiol Heart Circ Physiol, 2002. 282(2): p. H466-74.
340. Roubaud, V., et al., Quantitative measurement of superoxide generation and oxygen consumption from leukocytes using electron paramagnetic resonance spectroscopy. Anal Biochem, 1998. 257(2): p. 210-7.
341. Chen, P.F., et al., Effects of Asp-369 and Arg-372 mutations on heme environment and function in human endothelial nitric-oxide synthase. J Biol Chem, 1998. 273(51): p. 34164-70.
![Page 199: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/199.jpg)
199
342. Salerno, J.C., et al., Characterization by electron paramagnetic resonance of the interactions of L-arginine and L-thiocitrulline with the heme cofactor region of nitric oxide synthase. J Biol Chem, 1995. 270(46): p. 27423-8.
343. Du, M., et al., Redox properties of human endothelial nitric-oxide synthase oxygenase and reductase domains purified from yeast expression system. J Biol Chem, 2003. 278(8): p. 6002-11.
344. Salerno, J.C., et al., Substrate and substrate analog binding to endothelial nitric oxide synthase: electron paramagnetic resonance as an isoform-specific probe of the binding mode of substrate analogs. Biochemistry, 1997. 36(39): p. 11821-7.
345. Tiefenbacher, C.P., et al., Restoration of endothelium-dependent vasodilation after reperfusion injury by tetrahydrobiopterin. Circulation, 1996. 94(6): p. 1423-9.
346. Tiefenbacher, C.P., et al., Endothelial dysfunction of coronary resistance arteries is improved by tetrahydrobiopterin in atherosclerosis. Circulation, 2000. 102(18): p. 2172-9.
347. Tiefenbacher, C.P., et al., Sepiapterin reduces postischemic injury in the rat heart. Pflugers Arch, 2003. 447(1): p. 1-7. Epub 2003 Aug 5.
348. Setoguchi, S., et al., Tetrahydrobiopterin improves endothelial dysfunction in coronary microcirculation in patients without epicardial coronary artery disease. J Am Coll Cardiol, 2001. 38(2): p. 493-8.
349. Maier, W., et al., Tetrahydrobiopterin improves endothelial function in patients with coronary artery disease. J Cardiovasc Pharmacol, 2000. 35(2): p. 173-8.
350. Gao, Y.T., et al., Oxygen metabolism by neuronal nitric-oxide synthase. J Biol Chem, 2007. 282(11): p. 7921-9.
351. Gao, Y.T., et al., Oxygen metabolism by endothelial nitric-oxide synthase. J Biol Chem, 2007. 282(39): p. 28557-65.
352. Abu-Soud, H.M., et al., Electron transfer, oxygen binding, and nitric oxide feedback inhibition in endothelial nitric-oxide synthase. J Biol Chem, 2000. 275(23): p. 17349-57.
353. Berka, V., et al., Redox function of tetrahydrobiopterin and effect of L-arginine on oxygen binding in endothelial nitric oxide synthase. Biochemistry, 2004. 43(41): p. 13137-48.
354. Gao, Y.T., et al., Thermodynamics of oxidation-reduction reactions in mammalian nitric-oxide synthase isoforms. J Biol Chem, 2004. 279(18): p. 18759-66.
355. Sligar, S.G., Coupling of spin, substrate, and redox equilibria in cytochrome P450. Biochemistry, 1976. 15(24): p. 5399-406.
356. Sligar, S.G., et al., Spin state control of the hepatic cytochrome P450 redox potential. Biochem Biophys Res Commun, 1979. 90(3): p. 925-32.
![Page 200: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/200.jpg)
200
357. Presta A, W.-M.A., Stankovich M, Stuehr D, Comparative Effects of Substrates and Pterin Cofactor on the Heme Midpoint Potential in Inducible and Neuronal Nitric Oxide Synthases. J. Am. Chem. Soc., 1997. 120 (37): p. 9460 -9465.
358. Sennequier, N. and D.J. Stuehr, Analysis of substrate-induced electronic, catalytic, and structural changes in inducible NO synthase. Biochemistry, 1996. 35(18): p. 5883-92.
359. Rosen, G.M., et al., The role of tetrahydrobiopterin in the regulation of neuronal nitric-oxide synthase-generated superoxide. J Biol Chem, 2002. 277(43): p. 40275-80.
360. Weaver, J., et al., A comparative study of neuronal and inducible nitric oxide synthases: generation of nitric oxide, superoxide, and hydrogen peroxide. Biochim Biophys Acta, 2005. 1726(3): p. 302-8.
361. Sasaki, N., et al., Augmentation of vascular remodeling by uncoupled endothelial nitric oxide synthase in a mouse model of diabetes mellitus. Arterioscler Thromb Vasc Biol, 2008. 28(6): p. 1068-76.
362. Abelson, H.T., et al., Kinetics of tetrahydrobiopterin synthesis by rabbit brain dihydrofolate reductase. Biochem J, 1978. 171(1): p. 267-8.
363. Laursen, J.B., et al., Endothelial Regulation of Vasomotion in ApoE-Deficient Mice : Implications for Interactions Between Peroxynitrite and Tetrahydrobiopterin. Circulation, 2001. 103(9): p. 1282-1288.
364. Alp, N.J., et al., Tetrahydrobiopterin-dependent preservation of nitric oxide-mediated endothelial function in diabetes by targeted transgenic GTP-cyclohydrolase I overexpression. J Clin Invest, 2003. 112(5): p. 725-35.
365. Bedford, M.T. and S. Richard, Arginine methylation an emerging regulator of protein function. Mol Cell, 2005. 18(3): p. 263-72.
366. Boulanger, M.C., et al., Methylation of Tat by PRMT6 regulates human immunodeficiency virus type 1 gene expression. J Virol, 2005. 79(1): p. 124-31.
367. Tran, C.T., J.M. Leiper, and P. Vallance, The DDAH/ADMA/NOS pathway. Atheroscler Suppl, 2003. 4(4): p. 33-40.
368. Ogawa, T., M. Kimoto, and K. Sasaoka, Dimethylarginine:pyruvate aminotransferase in rats. Purification, properties, and identity with alanine:glyoxylate aminotransferase 2. J Biol Chem, 1990. 265(34): p. 20938-45.
369. Thompson, P.R. and W. Fast, Histone citrullination by protein arginine deiminase: is arginine methylation a green light or a roadblock? ACS Chem Biol, 2006. 1(7): p. 433-41.
370. Wang, Y., et al., Human PAD4 regulates histone arginine methylation levels via demethylimination. Science, 2004. 306(5694): p. 279-83.
![Page 201: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/201.jpg)
201
371. Regulation of eNOS-derived superoxide by endogenous methylarginines. Biochemistry., 2008. 47(27): p. 7256-63. Epub 2008 Jun 14.
372. The ratio between tetrahydrobiopterin and oxidized tetrahydrobiopterin analogues controls superoxide release from endothelial nitric oxide synthase: an EPR spin trapping study. Biochem J., 2002. 362(Pt 3): p. 733-9.
373. Ratio of 5,6,7,8-tetrahydrobiopterin to 7,8-dihydrobiopterin in endothelial cells determines glucose-elicited changes in NO vs. superoxide production by eNOS. Am J Physiol Heart Circ Physiol., 2008. 294(4): p. H1530-40. Epub 2008 Jan 11.
![Page 202: ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE ... · 1 role of asymmetric dimethylarginine (adma) in the regulation of endothelial derived nitric oxide by arthur james jarae pope](https://reader036.fdocuments.net/reader036/viewer/2022090717/60f80cc4d9014b781d070087/html5/thumbnails/202.jpg)
202
BIOGRAPHICAL SKETCH
Arthur Pope was born in 1982 in Chicago, IL. He graduated from the Illinois Mathematics
and Science Academy in 2001. Following graduation, he attended the University of Illinois at
Urbana Champaign and obtained a B.S. degree in Chemistry in 2005. He then enrolled in the
Integrated Biomedical Science Program at The Ohio State University College of Medicine in
June of 2005 to obtain his doctorate of philosophy. In January 2006 he joined Dr AJ Cardounel’s
lab and in June of 2007 he relocated with his mentor to the University of Florida joining the
Interdisplenary Program in Biomedical Sciences where he obtained his doctorate of philosophy
in August of 2009. During his graduate training he received a pre-doctoral fellowship award
from the NIH National Heart Lung and Blood Institute. Arthur has also been the first author on
three publications, and co-author on two others. He also has presented his research at several
confrences and has had two invited talks.