ROADBUILDERTHE ALABAMACOMMUNICATIONS DIRECTOR TERRI MITCHELL [email protected] ADMINISTRATIVE...

Summer 2008 • A Publication of the Alabama Road Builders’ AssociationSummer 2008 • A P bbbbbbbbbbbllil tittitittttttittttit of the Alab RRRRRRRRRRRRRRRRRRRRR ddddddddddddddddddddddddddddd BBBBBBBBBBBBBBBBBBBBBBB iiildldddddddddddddddddddd ’’’ AAAAAAAAAAAAAA iiiiiiiiii ttitittititittitSuSuSuSuSuSuSummmmmmmmmmmmmm erererererere 22 2 22 2 22000000000000000008 88888 8 8888 • A• A• A• A• A• A• A• A PP P PPPPPubbbbbubububbbbbbbbbubbbbbbbbbbbbbbbubbbbbbbbbbblliliilil cacacacacacccacaccacccccacacacccccacacacaccccccacccccacaccccccaccccatittttttttiitttttititittttttitttttittttitttttttittttttt onononoooooonooonooonooonoooooooooooooooooooooooooo oooooooof f ff fff ththththhththhe e e e ee e e AlAlAlAAAAA ababababababababamamamamamamammmama aaaaaa aaa aaaaaaaaa a a aa a aaaaa aaaaaaaa aaaaaaaaaa RoRoRoRoRoRoRRoRoRoRoRoRoRoRoRoooRoRoRooRRoRoRRoRoRoRoRRoRoooRRoRRoooRoooRoooooooooooooRoooRooooooooooaaadadaadadaaadaadadadadadadaddadadadadadaadadaaddadadadadadadaadaadadadaadaadaddadaadadadadadaddaaddadadddadddddaadddadadadaaaddddddd B B B BBBBBBB BB BBB BBBBBBB BBBBB BBBBBBB BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBuuuuiuiuuiuiuiuiuuuuuuuuuuiuuuuuuuuuuiuuuuiiuuuuuiuuiuuuuuuuuuuuuuuuu ldlddddddddddddldldddddddlddddddddddldddllddddl eeeerereeeeeerereeeererererererereeeeerereereee s’s’s’s’s’s’s’ss’s’s’s’s’s’s’s’s’s’ss’s’s’s’’s’s’s’s’s’’’’ss A A A A AAA AAA A A A AAAA A AAA AAA AA AAAAAAAAssssssssssssssssssssssssssssssssssssssssssssssssocococococccococococccococococcococoocococcocooocococooocoo iaiaiaiaiaiaiaiaiaiaiaiaiiaiaaiaiaiaiaaaiaaiaiaiaaiaaiaiiiiiiatititittititttitititititititititititittttttttit onononononononononnnonnnonononnnnonnononononononnnonnononononnononononnnnonnnn

ROADBUILDERTHE ALABAMA

Also:

Buying Smart

Grassroots Activism: ‘Fundamental’ to Success

Also:

Buying Smart

Hall of Fame

At Vulcan Materials Company we’ve been connecting Alabama com-munities for more than fty years; from our role in the transportation construction industry to our statewide educational initiatives, we bring people together, to build, to grow, to learn.

As an Alabama-based company, we’re proud of our long association with the Alabama Road Builders Association and its work to improve our state’s transportation infrastructure. We’re honored to be the rst company inducted into the Association’s Hall of Fame.

Connecting Communities

375899_Vulcan.indd 1 4/19/08 12:29:05 PM

EQUIPMENT.SUPPORT.SOLUTIONS.

Count on Cat for solutions.You’ve always been able to count onCat® machines, work tools and supporton the job site. But we also offersolutions that address the larger issues:

• Enhanced operating environmentsand advanced operator training

• Solutions for emissions and jobsite efficiency

• Precision guidance systems

• Flexible financing, rental optionsand insurance assistance

From the day you put a Cat machineto work, count on Cat to be there withequipment expertise and comprehensivesupport that will help you do your jobmore efficiently... and meet yourbusiness challenges more effectively.

Contact Thompson Tractortoday or visit us online to learnhow you can Count on Cat.

www.thompsontractor.com

Call 1-800-547-0760Serving Alabama and Northwest Florida for 50 years.

341587_thompson.indd 1 8/22/07 6:50:38 PM

282051_ergon.indd 1 5/16/06 9:18:33 PM

The Alabama Roadbuilder • Summer 2008 5

ROADBUILDERSummer 2008 • A Publication of the Alabama Road Builders’ Association

THE ALABAMA

CONTENTSExecutive Director’s Message ...................................7

President’s Message ..................................................9

From the Alabama Department of Transportation .............................. 10

Hall of Fame 2008 ................................................. 12

Buying Smart ........................................................22

Grassroots Activism:‘Fundamental’ to Success .....................................25

Heard Along the Highway ....................................27

Index to Advertisers ..............................................30

Advertisers.com ....................................................30

ARBA OFFICERS, DIRECTORS & STAFF

PresidentGREG ABRAMSON

Vice PresidentS.T. (SONNY) BUNN, JR.

TreasurerSHERMAN SUITTS

SecretaryMICHAEL H. MCCARTNEY, II

Immediate Past PresidentTIM MULLENDORE

Directors 2007-2008KEITH ANDREWSRANDY BILLINGSLEYTERRY BUNNRANDY BUTLERBOB DAWSONCRAIG FLEMINGJOHN FULLERLEE GROSSJOHN HARPERMITCHELL HARRISRON JACKSONDAVE JONESTIM MCINNISKEITH (TAC) MIMSJOHN E. MURPHY, IICHRIS NEWELLDAVID REEDIKE SCOTTPAUL B. SCOTT, JR.JIM WAITZMAN, JR.JOHN G. WALTONNORMAN WALTONCHARLES E. WATTS, JR.

Published for:Alabama Road Builders’ Association630 Adams AvenueMontgomery, AL 36104(334) 832-4331Fax: (334) 265-4931www.alrba.org

STAFF

EXECUTIVE DIRECTORBILLY [email protected]

COMMUNICATIONS DIRECTORTERRI [email protected]

ADMINISTRATIVE ASSISTANTSHIRLEY [email protected]

Published by:

Naylor, LLC5950 N.W. 1st PlaceGainesville, FL 32607(352) 332-1252 or(800) 369-6220Fax: (352) 331-3525www.naylor.com

PUBLISHERKathleen Gardner

EDITORJulie Bancroft

PROJECT MANAGERTom Schell

PUBLICATION DIRECTORRick Sauers

ADVERTISING SALESSusan Maracle, Mark Tumarkin

MARKETING ASSOCIATEPatti Callahan

LAYOUT AND DESIGNDave Reimer

ADVERTISING ARTReanne Dawson

©2008 Naylor, LLC. All rights reserved. The contents of this publication may not be reproduced by any means, in whole or in part, without the prior written consent of the publisher.

PUBLISHED JUNE 2008/ALR-Q0208/7332

6 The Alabama Roadbuilder • Summer 2008

• Regulatory & Warning Signage• Barricades (Types I, II and III)• Barricade Lights• Sign Stands• Stop and Slow Paddles• Road and Lane Closure Signs• Arrow Boards (Diesel and Solar assisted)

• Construction Signage (Aluminum roll up and mesh)• Delineators• Message Boards• Beacons• Traffi c Cones

YOU CAN COUNT ON ALABAMA BARRICADE, INC.

Sales • Service • Rentals • Installation • Maintenance

7007 Praytor Road • P.O. Box 832 • Trussville, AL 35173(205) 655-5290 • (205) 655-5292www.alabamabarricade.com

Also in Stock: Safety Vests, Flags, Pavement Tape, Stripping and Marking Tape, Refl ective Cone Collars, Sign Hardware, Refl ective Tapes, Emergency Warning Lights and Sign Posts.

ALABAMA BARRICADEEMPLOYEES HAVE OVER 100 YEARS OFTOTAL COMBINED TRAFFIC CONTROL

WORK EXPERIENCE

348412_Alabama.indd 1 11/16/07 3:16:15 PM

Alabama Administrative Offi ce and Customer Service

Lafarge South Central Aggregates#2 Riverchase Offi ce Plaza, Suite 206

Birmingham, Alabama 35244(205)-682-8373 Fax (205)-682-8379

Josh Isbill - Commercial [email protected]

Anita Daugherty - Customer [email protected]

Lakeshore Quarry911 Wenonah RoadBirmingham, Alabama 35221(205)-425-1575 Fax (205)-425-4371Brad Handley - Territory [email protected]

Calera Quarry730 Hwy 23Calera, Alabama(205)-665-1201 Fax (205)-665-1203Mike Herring - Territory [email protected]

Citadel Quarry3545 Erwin Dairy RoadTarrant, Alabama 35207(205)-841-6582 Fax (205)-849-3370Brad Handley - Territory [email protected]

QUALITY CRUSHED STONE AT COMPETITIVE PRICING

382435_lafarge.indd 1 5/13/08 4:25:40 PM


EXECUTIVE DIRECTOR’S MESSAGE

BETTER ROADS EQUAL BETTER LIVESBY BILLY NORRELLARBA EXECUTIVE DIRECTOR

STATEWIDE EDITORIALS RECENTLY lament-ed the defeat of transportation commission legisla-tion proposed by Rep. Cam Ward (R–Alabaster). This proposal would change the governance of the Alabama Department of Transportation and set it up under the guidance of a non-political panel, select-ed in staggered terms by Gov. Riley. In theory, this would take out the politics of selecting where road and bridge projects are located and how gasoline and motor fuel tax dollars are spent.

The Alabama Road Builders Association has many contractor members who perform work in states governed by a commission—some like them, some don’t. For that reason, we have chosen to let the Legislature decide if this is what is best for ALDOT. Obviously, they don’t think this is the way to go as the effort has been killed for six years in a row and numerous times prior to Gov. Riley championing this proposal in his original list of 2002 priorities.

Has a road project ever been advanced or relocat-ed as a political reward (or delayed as a punishment)? Certainly it has. A governor has a limited number of clubs in their bag to garner favor with lawmak-ers, and road projects happen to be one of them. According to ALDOT Director Joe McInnes, since Gov. Riley came into offi ce, Alabama’s Department of Transportation has functioned without the hint of any political quid pro quo.

Transportation commissions are designed to sep-arate the process of deciding what and where roads are constructed from the executive branch of govern-

ment. Appoint individuals who have no agendas and the system should function independently of politics. But that has not always been the case. In 1987 Robert Joiner, then-Highway Commissioner for the southern district of Mississippi, was indicted on 11 counts of extortion, bribery and tax evasion. Additional exam-ples were discovered through a simple web search on incidents involving corruption and transportation commission members.

Ideas to streamline or reinvent ALDOT have been numerous lately. Shifting additional responsibilities, like the oversight of short line railroads and water-ways (if these bills pass the Legislature) will hope-fully be as successful as the move that was made with airports several years ago. But with additional responsibilities come additional fi nancial burdens. At a time when ALDOT’s resources are at a premium, an $18 million transfer to the Department of Public Safety is being proposed by Gov. Riley in his Gener-al Fund budget to assist with its operating expenses.

Our industry appreciates and values the partner-ship we enjoy with DPS. Saving lives and working with law enforcement offi cials to protect our road and bridge system (and those who construct it) is a funda-mental responsibility of government. But ALDOT is not a bank, and should not be treated as such. Since 1996, more than $240 million has been diverted from gasoline and motor fuel tax collections and used for things other than the building and maintain-ing of Alabama’s highways. To make matters worse, Uncle Sam just rescinded more than $60 million

If we don’t address the funding needs of our state infrastructure network, then we are truly heading down a path that will severely impact the economic

development success Alabama has enjoyed in recent years.


from Alabama’s 2008 federal highway apportionment, impacting the immedi-ate future of numerous projects.

Road projects are never completed fast enough, effi ciently enough, or in the right area. They start, then they stop. Whenever one area of the state seems to receive more construction work than others, accusations of favor-itism and unfair distribution formulas arise. All these symptoms are the result of the number one critical need of the department—additional funding. If we

don’t address the funding needs of our state infrastructure network, then we are truly heading down a path that will severely impact the economic develop-ment success Alabama has enjoyed in recent years.

New capacity alone, while desper-ately needed in parts of the state, won’t address our needs. We must also rein-vest in the system we have built over the last 50 years. Our industry is fully prepared to build the public/private toll road projects being proposed, but that

will only address a few areas of the state, while leaving the rest of the sys-tem without answers—and resources.

Transportation construction in Ala-bama and the nation is headed for the perfect storm—the amount of fed-eral support for roads and bridges is shrinking; the amount of state support is stagnant or shrinking; and infl ation and material costs are increasing dra-matically. The legislation to address these issues has been introduced in this legislative session, but it has failed to move. And without success this ses-sion, it will likely be 2011, after the next election cycle, when it can be real-istically addressed again.

The recent Grading the State report from the Pew Center showed improve-ment in Alabama’s overall report card, in all areas but one—infrastructure support. The Department of Transpor-tation has $3 billion in deferred main-tenance. That’s up from $1.6 billion in the 2005 report. And the report marked Alabama down for “desperately under-funding maintenance of roads and bridges.”

According to the Public Research Council of Alabama (PARCA), since 1993 the purchasing power of Ala-bama’s transportation dollars has declined by approximately 41 percent due to infl ation, based on defl ators from the Bureau of Economic Analy-sis. This has decreased the purchas-ing power of Alabama’s state gasoline taxes and fees by about $134.2 million in 2006, the latest year for which data are available.

The thousands of hard-working state employees at the Alabama Department of Transportation toil day in and day out to make sure the traveling pub-lic has a safe and effi cient system on which to travel. So do the contractors who build the projects. These are good jobs performed by people from your hometown, and at the end of the day the money stays right here in Alabama. Hopefully, our elected leaders will, sooner than later, have the courage to address the challenge of adequately funding Alabama’s highways. Because it is the right thing to do, and it builds Alabama’s economy. Better roads mean better lives. ❏

Alabama District • 1-800-292-4013


PRESIDENT’S MESSAGE

ARBA UNIFIES OUR INDUSTRYBY GREG ABRAMSONARBA PRESIDENT

THROUGHOUT MY YEAR AS PRESIDENT of the Alabama Road Builders Association, we have had the opportunity to address a number of issues that have been extremely important to our industry. Legislative efforts have proven to be successful and at the same time frustrating. While we succeeded in avoiding efforts to divert road and bridge funds for mass transit uses, we were unable to keep the funds entirely immune from being used in other places. Activities and meetings with the ALDOT have been productive, and we value and appreciate the relation-ship that exists between ARBA and the department.

One of my roles as president is to act as spokes-person for our industry to the membership of ARBA as well as to the customers we work with—the Ala-bama Legislature, the United States Congress and the governor’s offi ce. We have had more than one occasion to visit with each one of these entities, and I can assure you that they all respect and appreciate the work we perform for our great state. How they intend to continue funding our industry is a com-pletely different story. While they all agree the needs are there for additional funding, no one is willing to step to the table and make the big leap on just how to tackle this issue.

It is our responsibility as a membership of this great organization to tell our story to those folks who can make a difference in the future of our industry. We need their support when it comes to funding, as well as lawsuit protection for the unique work we perform, so we can continue to provide these servic-es that are so vital to the continued economic devel-opment of Alabama and the Southeast. Make every effort to talk to your locally elected representatives when you see them. Support of our industry is criti-cal to the future of all Alabama generations, and we are in a position to infl uence the process by being proactive, not reactive. We don’t want our highway system to fall into disrepair before our elected lead-ers take action on how to best address the situation. If they don’t act soon, we are certainly headed in that direction.

As we prepare for future legislative sessions and a federal highway plan reauthorization in 2009, our industry stands at a crossroads. We are hopeful that the issues of funding will be properly addressed by these leaders in our government and the road system that we are all so proud of can continue to thrive and grow for the betterment of all Alabamians and our nation. ❏

We don’t want our highway system to fall into disrepair before our elected leaders take action on how

to best address the situation.


FROM THE ALABAMA DEPARTMENT OF TRANSPORTATION

TRANSPORTATION LEGACY HANGS IN THE BALANCEBY JOE MCINNESTRANSPORTATION DIRECTOR, ALDOT

IN THE NOT TOO distant future, Congress begins debating the next surface transportation funding leg-islation to replace the Safe, Accountable, Flexible, Effi cient Transportation Equity Act: A Legacy for Users (SAFETEA-LU). That may sound surprising since it seems like only yesterday when Congress passed SAFETEA-LU, but by then we had operated on an unprecedented string of continuing resolutions amid political infi ghting.

Even though SAFETEA-LU promised a modest increase in federal funds for Alabama, that prospect quickly eroded because of a federally imposed limit that sets our obligation authority at about 90 percent of our expected appropriations. It eroded further with rescissions totaling about $216 million over the past three years. The funding picture is a growing concern as we study our costs and as a bleak picture emerges of projected state revenues. State fuel tax collections are down from a year ago. More specifi cally, our costs for steel, concrete and asphalt have increased more than 40 percent in the past few years. And our cost for fuel has increased by 42 percent in the past year alone and is now at a run rate of approximately $1 million per month as I write this report.

The overall result is that our limited resources are being eroded day by day. We’ve made tremen-

dous efforts since January 2003 to manage the Department of Transportation in a way that com-mits maximum funding toward our construction and maintenance programs, and the result has been a more streamlined organization with dramatically improved operational effi ciencies. Those effi cien-cies have resulted in more accountability and real changes in the way we operate, and one prime example that is a source of great pride to me is the unprecedented completion of three consecutive per-fect property audits covering the last 65 months for 34,000 pieces of equipment valued at more than $250 million dollars. Perhaps the biggest change is that we’ve ended the decades-long practice of bas-ing spending decisions on political infl uence.

We continue seeking maximum effi ciencies with our internal operations, but it’s becoming increas-ingly clear that our stagnant current federal and state revenues have cast us into the limited but important role of maintaining our existing transportation net-work while new capacity projects are relegated to a smaller segment of our total programming.

As we move toward the fall elections and—a little further down the road—to the next surface trans-portation funding act, we fi nd ourselves in a situa-tion where transportation is poised to become one of

The states and the industrial sector must work together to persuade Congress to develop a plan that addresses priorities.


the biggest issues at the state and national level. U.S. DOT Secretary Mary Peters has said recently that our next sur-face transportation funding act has the potential to be as far-reaching and visionary as the legislation President Eisen-hower enacted in 1956 giving birth to America’s Interstate Highway System—but if and only if we (collectively) get the public policy right.

Secretary Peters makes a subtle but important point in saying it that way … we must get the policy right. That means Congress needs to work together on a plan that allo-cates and spends taxpayer dollars wisely and based on need. We’ve harped on that in Alabama for almost six years that we must make decisions based on priorities. The states and the industrial sector must work together to persuade Con-gress to develop a plan that addresses priorities. Our future plans must have the same vision as the Interstate funding program, and we must fi nd ways to be more innovative to make available dollars go further, to incorporate public-private partnerships when there is a real benefi t, and to address other funding issues as needs may dictate in the years ahead.

We’re reaching a point where the issues facing our indus-try must be front and center in the public and political arenas. SAFETEA-LU claims to be a funding act that provides a leg-acy for users, but the true legacy will be determined by how successfully we, as a state and as a nation, address the issues our industry is facing. ALDOT’s partnership with ARBA is critical to our success, and we look forward to working together as passionate advocates for improvements in the via-bility of dedicated increased funding for our industry—our future and our legacy deserve no less. ❏

We’re reaching a point where the issues facing our industry must be front and center in the public and political arenas.

ROGERS GROUP, INC.

SERVING NORTHWESTALABAMA

CRUSHED LIMESTONE PRODUCTS

ASPHALT CONSTRUCTION

DEREK ROBERTS - GENERAL MANAGERSCOT CORNELIUS - SALES MANAGER

KENNY ADOMYETZ - CONSTRUCTION MGR.

P.O. BOX 188, TUSCUMBIA, AL 35674PHONE (256) 383-1645 FAX (256) 381-4464

PROUDLY SERVING ALABAMA SINCE 1955

WWW.ROGERSGROUPINC.COM

375392_RogersGroup.indd 1 4/11/08 2:11:06 PM

800.292.8525252.4444 B’ham Area

www.al1call.com

375297_Alabama.indd 1 4/5/08 1:14:01 PM


T he Alabama Road Builders Hall of Fame was created in 2002 by the efforts of several visionary

members of the Alabama Road Builders Association’s board of directors. Patterned largely after

Alabama’s engineering hall of fame, our intent to honor the leaders and pioneers of Alabama’s

transportation construction industry has taken a giant leap toward this success with the installation of

its sixth class in April 2008.

Praisefor Industry Pioneers Alabama Road Builders Hall of Fame 2008 Ceremony

HALL OF FAME


This special event was once again held in Montgomery at the Mont-gomery Country Club on April 9, 2008, and featured another class of families that were and continue to be the backbone of our indus-try and association from its infan-cy to the billion-dollar economic engine that helps drive our state’s economy. The intent of the Hall of Fame is to remember and honor all those individuals who have been instrumental in the estab-lishment of today’s transportation construction environment, while giving the individuals and their families a chance to re-establish relationships from long ago by visiting with industry friends at this special occasion.

The ballroom of the Mont-gomery Country Club was packed to capacity, with more than 225 special guests for the momen-tous event. An opening reception allowed all those present to min-gle about, see friends and review photos from the Alabama Road Builders Association archives.

Mr. M.B. McCartney, chair-man of the Hall of Fame board of directors, welcomed all those in attendance and gave a description of his vision for the Hall of Fame. He also thanked all the sponsors of the event for their generosity and for making certain the cere-mony would be a success. He next introduced Dr. Larry Benefi eld, dean of the Auburn University Samuel Ginn College of Engi-neering, who served as emcee for the remainder of the ceremony. Mr. Ike Scott then blessed the meal that had been served to the attendees.

During the latter part of 2002 and early 2003, the Hall of Fame board of directors worked to fash-

ion a ceremony that was refl ective of both the past history of the transportation construction indus-try in Alabama as well as those who had an instrumental part in the creation of the Alabama Road Builders Association. At the same time, the board also wanted to include several deserving honor-ees that could enjoy being a part of the actual ceremony as it was taking place.

Selecting from a list of appli-cants that was solicited from the membership of the Alabama Road Builders Association and also by review of the Hall of Fame board, the board came up with the inau-gural slate of honorees for the 2003 class of the Alabama Road Builders Hall of Fame.

The honorees for the class of 2008 are:

David B. AbramsonS. Edward Hodges *Michael B. McCartneyG. Mack RobertsI. J. (Jud) Scott, Sr. *C. P. (Pat) Wilson, Sr. *Vulcan Materials Company*DeceasedOur thanks go out to the fami-

lies of all the honorees for the class of 2008. We appreciate all their support and assistance as we prepared biographical informa-tion on each of the inductees in the class of 2008. The coopera-tion between the families and our association staff was tremendous and made the creation of this pro-gram a delight.

In addition to the support of our Alabama Road Build-ers Association membership, we would also like to thank the board of directors of the Alabama Road Builders Hall of Fame. Their ded-ication and commitment to see


this project through, culminating in the ceremony described in this article, is a testament to the hard work and dedica-tion they showed as we met time and again to prepare this inaugural event.

We encourage all members of the transportation construction fam-ily and the Alabama Road Builders Association to actively participate in the support and continued success of this annual event. We ask that you provide potential candidates for this distinguished honor at the appropriate time so they too may be considered for addition in the Alabama Road Builders Hall of Fame.

David Abramson spent his entire adult life, until his retirement, in the highway construction business. In his very early adult life he worked for Abramson & Son, which was pri-marily owned by his father, Leo, and brother, Bill. At that time, A.E. Bur-gess was a partner in the business. After working in the fi eld for several years, he acquired ownership in the business, which was then incorporated as Abramson & Sons, Inc.

In the early years, Abramson & Sons, Inc. was primarily a concrete subcontractor, building bridges and cul-verts as well as ditch paving and slope paving. They performed work for most of the larger highway contractors such as A.E. Burgess Co., Inc.; McDowell-Purcell, Inc.; Moss-Thornton, Inc.; and many others through the years. After operating out of the offi ce of A.E. Bur-gess Co., Inc. in Birmingham, Ala., for several years, in 1970 the three Abramsons purchased the portion of the company owned by A.E. Burgess and moved their operations to property

owned by the company in Pinson, Ala. With the company beginning to

grow, they began forming a separate bridge-building company. Alabama Bridge Builders, Inc. was incorporat-ed in March 1977, with the principals being Bill Abramson, David Abramson, Keith “Tack” Mims, and Tom God-frey. As growth continued and areas of interest differed, Bill and David sepa-rated the companies, with Bill keeping Abramson & Sons, Inc. and David tak-ing Alabama Bridge Builders, Inc. As president of Alabama Bridge Builders, Inc., David began a program of growth for the company, taking it from a com-pany of about 20 employees in 1977 to about 100 by the mid-1980s.

With growth and expansion always on his mind, in 1985 the opportunity presented itself to acquire Ballew & Roberts Construction Co., Inc., which he did along with his two current part-ners and John Haraway, who had been a long-time Ballew & Roberts employee. Ballew & Roberts was a grading and asphalt paving company which fi t very well in the bridge-building operation. In 1994, David traded his interest in Alabama Bridge Builders, Inc. to Tack Mims for Mims interest in Ballew & Roberts and once again began a growth program for this company which con-tinued until 1997 when he sold the company and retired.

David Abramson clearly under-stood that what was good for everyone in the highway industry was good for his company. He worked tirelessly on relationships in the industry. He made it a point to get to know and to have a working relationship with every high-way/transportation director during his career. He always encouraged pro-grams that were good for the industry as well as his own company. He worked endlessly every time legislation was pending in the state House concern-ing the highway industry. He made it a point to develop an excellent reputa-tion with elected offi cials that could be helpful to the industry. Especially dur-ing the last gas tax that was passed to help with the road program in the state, his efforts at the state House were very infl uential in seeing that the package was passed. He always worked quietly

behind the scenes, never seeking rec-ognition for himself, but being effi cient in his efforts for the highway industry as a whole.

Samuel Edward Hodges was born in Anniston, Ala., on April 28, 1913, to Dr. Samuel and Margaret Hodges. He graduated from Alabama Polytechnic Institute, Class of 1936, with a degree in highway engineering. While in col-lege, he was a member of Lambda Chi Alpha social fraternity. Between grad-uation and the formation of his com-pany, Hodges worked for the Alabama Highway Department, the Tennessee Coal Iron and Steel Company, and the Southern Railway System in Chicago. In 1946, after returning home to his native city of Anniston having worked with the Southern Railway System in Chicago, he married Jane Sikes Lane of Gadsden. They had two daughters, Jane Lane and Peggy.

Hodges and half brother, Pitts Doug-las, joined together to form Hodges & Company in 1947. The company per-formed road and street work, base work, paving, gas lines, water lines, sewer line construction, rock quarry-ing and crushing, and operation of an asphalt plant. Hodges, along with other bituminous plant mix distributors, was instrumental in organizing an associa-tion for the purpose of promoting their product in the highway construction industry. In 1959, at the organizational meeting, Hodges & Company was one of 17 fi rms to become charter members. He was also elected one of the original eight directors. In 1970, he became the Alabama Asphalt Pavement Asso-ciation’s 12th president. In September 1976, he sold the business to Ashland

Samuel Edward Hodges

David Abramson


Oil Co. of Kentucky and retired as president of Hodges & Company. He died of a heart attack on June 7, 1992. Ed Hodges was a tough competitor and a big factor in the roadbuilding indus-try in Northeast Alabama.

Michael Bailey McCartney was born in Gadsden, Ala., on April 2, 1934. He graduated from the Baylor School in Chattanooga, Tenn., in 1952, and in 1957 he received his B.S. degree in civil engineering from Alabama Polytechnic Institute in Auburn. While attending Auburn, McCartney served two years as president of the student chapter of American Society of Civil Engineers. He was also a member of Sigma Alpha Epsilon fraternity. Dur-ing his stay at Auburn he developed a love for the university that has contin-ued to last.

After graduation from Auburn, he worked with the Florida State Road Department as an engineer in train-ing and then as a project engineer. He then went to work for Cone Brothers Contracting Company of Tampa, Fla., as superintendent in charge of asphalt plants and all asphalt construction. In 1962, McCartney was convinced to return to Gadsden by his father, and he joined McCartney Construction Co., Inc. and Calhoun Asphalt Co., Inc. During the decade of the ’60s, the two companies were growing and partici-pated heavily in the Interstate program. During this period they were involved in paving I-59 as it passed from Bir-mingham to Chattanooga and the building of Neely Henry Dam. They also were a prime contractor in the construction of the rest areas on I-59, located at the St. Clair County line.

The company has played major roles in many highway construction projects. Today McCartney serves as president to both companies.

During his construction career, he has been an active participant in the road building industry. In 1974 he served as president of the Alabama Asphalt Pavement Association, and in 1975 he served as president of the Alabama Road Builders Association. He currently serves as the Alabama director for the National Asphalt Pave-

ment Association and has for the past 20 years. He also serves as a director of The Road Information Program (T.R.I.P.) McCartney played a signifi -cant role in bringing the National Cen-ter for Asphalt Technology to Auburn and has been a member of the center’s board since its inception. The center had become internationally known as the premier research institution focused on hot mix asphalt. During his tenure, N.C.A.T.’s annual budget grew from $300,000 to more than $2 mil-

Michael B. McCartney

800 Manufacturers Road • Chattanooga , TN 37405423-265-0600 • 800-272-7100 • ww w.roadtec.com

731-694-9061pav erman48@aol .com

Rick Stone

• Material Transfer Vehicles• Asphalt Pavers• Cold Planers


lion. The industry it serves is responsi-ble for more than $11 billion in annual revenues.

In 1979, he was appointed to a 12-year term on the Auburn Board of Trustees by Gov. Fob James, and in 1991 he was appointed to another 12-year term by Gov. Hunt. He served 14 years on the board and during his terms served as chairman of the bud-get and athletic committees. In 1988 he was elected president pro tem of the board, a position he held until 1993. He received numerous honors from Auburn, including a chapter honor membership from Chi Epsilon, the distinguished Auburn Engineer Award and Auburn’s highest honor, a Doctor of Science degree (Honoris Causa).

McCartney has a strong sense of civic responsibility and has served his community in numerous capacities. Among these include his service as a director of the Gadsden Chamber of Commerce, the Metropolitan Planning Commission and currently on the board of directors of the Wachovia Bank of Etowah County. He has also served as

captain of the Gadsden Quarterback Club. He is active in his church and has served as a member of the board for the First United Methodist Church of Gad-sden and as chairman of the Board of Trustees for the church.

Michael B. McCartney is a leader in advancing engineering technology within Alabama and nationally, and in 1998 was inducted into the Alabama Engineering Hall of Fame and served as chairman for two years. His efforts over the past 35 years have directly impact-ed millions of Americans using our nation’s roadways. Mike and his wife, Jane, reside in Gadsden, Ala. They have three children and eight grandchildren.

G. Mack Roberts began his career in the transportation industry in Febru-ary 1956 as an employee with the Ala-bama Highway Department. During his time there, he served in many capacities including project engineer, assistant division engineer, division engineer, state roadway and bridge maintenance engineer. In 1983 he became assistant highway director and served as depart-

ment liaison to the state Legislature and U.S. Congress. In 1987 he left the Highway Department and went to work for Ultrapave, Inc. as their national mar-keting manager. In 1990 he returned to the Alabama Highway Department as assistant director, once again act-ing as department liaison to the state Legislature and U.S. Congress. In 1992 Roberts was appointed to the position of highway director under Gov. Hunt and again by Gov. Folsom in 1993. In 1993 the Department changed from the Highway Department to the Depart-ment of Transportation. After the 1994 election he retired from ALDOT.

G. Mack Roberts

Congratulations to 2008 Alabama Roadbuilders

Hall of Fame Rec ipients!

3905 AIRPORT HIGHWAYP.O. BOX 11967

BIRMINGHAM, AL 35202(205) 592-3866

WWW.DUNNCONSTRUCTION.COM

376419_dunn.indd 1 4/15/08 7:53:24 PM

Traffic Control Equipmentand Services

www.protectionservices.com(717) 236-9307 635 Lucknow Road, Harrisburg, PA 17110

Solar Message CentersSolar Advance Warners

Solar Sign StandSigns & Sign Stands

Glare ScreenDelineatorsReflectors

Fitch Inertial BarriersPlastic Drums & Cones

Safety EquipmentBarricades

Warning Lights & BatteriesTruck-Mounted Attenuators

Temporary Pavement MarkingsPlastic Fencing

Work Area Lighting

Ed McCombs2501 Pawnee Village Rd.Birmingham, AL 35217

Ph. (205) 849-5750 Fax (205) 841-3236

Pensacola, FL (850) 983-0714

Over 50 Locations Serving25 States ProvideRound-The-ClockService

PROTECTIONSERVICES

INC.

375475_Protection.indd 1 5/30/08 9:45:12 AM


After his retirement from ALDOT, he returned to the private sector work-ing for United Toll Systems as the vice president, engineering, develop-ment and construction. The company was responsible for the construction of the Emerald Mountain Toll Bridges between Montgomery and Millbrook and the Tuscaloosa Bypass Toll Facil-ity. He was also a lobbyist in passage of legislation allowing privatization of toll facilities in the states of Ala-bama, Georgia and Louisiana. This was successful, and these privatiza-tion laws were passed. In 1999 Gov. Don Siegelman appointed Roberts as director for the Alabama Department of Transportation once again. He remained director until 2001 when he then went to work for Ultrapave, Inc. as vice president and general manag-er. He continued to work there until April 2007 when he joined Alinda Roads, LLC where he became vice president for acquisition and devel-opment for the company throughout the U.S.

He has used his vast knowledge

he acquired during his many years in the transportation industry to craft a career of excellence. During his ten-ure as transportation director, he was responsible for the supervision of the daily department activities, as well as the annual budget. The department let to contract about 540 construction projects under his watch. He continued the revitalized efforts of the ALDOT/ARBA Liaison Committee’s work. Roberts has always been a friend to our industry and especially to the Alabama Road Builders Association.

He attended Jacksonville State Uni-versity and the University of Alabama-Birmingham. In 1994 he was awarded the Governmental Offi cial Award for Alumni for Jacksonville State Univer-sity and presently serves on their Board of Trustees.

The song title “Old Man River” is symbolic of the late Isaac J. (Jud) Scott, Sr. of Scott Bridge Company of Opelika, Ala. Scott worked in the con-struction business for 55 years until his retirement in 1975. Most of his years

were spent building bridges. Another song title, “Deep Water” fi ts his com-pany as it specialized in bridges with piers in deep water, requiring “know how” in fl oating equipment, coffer-dams and mass concrete pours under-water. Standing Alabama monuments to this dedicated builder and his com-pany are: Interstate 85 twin bridges across the Chattahoochee River at Lanett, Ala.; the river piers in the Ten-nessee River at Whitesburg, south of Huntsville; the Stemley Bridge of Pell City over the Coosa River; the War-rior River Bridge of Pell City over the

Isaac J. (Jud) Scott, Sr.

YOURCONCRETEREINFORCING SOURCE…for reliability and expertprofessional service inreinforcing bars. We’ve beenserving the Alabama highwayindustry for over 40 years.Ed Boone - Marcus Capps.

GERDAU AMERISTEEL

Office andPlant: 3500 27th Ave. NorthBirmingham, AlabamaPhone: (205) 716-2304 or (205) 324-5561

BIRMINGHAM, AL 35207

At Jackson Thornton, we know construction. We know your job is much easier when you can

do what you’re actually contracted to do: build things. We know how much it means knowing

we’ve handled all the details – tax planning, surety requirements, auditing, licensing and

the rest of the paperwork. • So do what you do best. And we’ll back you up by doing what

we do best. Whether helping cut red tape now or helping you plan for the future,

Jackson Thornton Construction wants to build a relationship with you.

Montgomery 334.834.7660 . Dothan 334.793.7001 Prattvi l le 334.365.1445 . Wetumpka 334.567.3400 . www.jacksonthornton.com

302602_Jackson.indd 1 11/20/06 9:44:23 AM


Coosa River; the Warrior River Bridge in Jefferson County in Birmingham; the Warrior River piers at Elkahatchee Creek; the Tennessee River bridge at Guntersville; and most notably the Kowaliga Bridge over Lake Martin near Alexander City, Ala. (Scott built the deepest cofferdams in the U.S. on this project.) In addition, other projects include numerous major river bridges throughout Georgia and the 5,000-foot Hathaway Bridge in Florida between Panama City and the beach.

Scott started in the construction business in 1921 with Brooks Calloway Co. where he remained until 1927. He was associated with M.D. Morgan Co. from 1927 to 1932. In 1933 he became a member of Scott Construction Co. of Thomasville, Ga., with partners W.F. Scott and W.A. Britton, doing general construction such as highways, air-ports, dams while continuing to live in Opelika. During this time he built the Opelika dam and fi lter plant for its water reservoir.

Scott and his brothers divided the Scott Construction Company in 1957 and Scott formed his own company, The Scott Company, confi ning his operation to his specialty of bridge construction. The Scott Company became Scott Bridge Company, Inc. in 1965. At this time, Scott said he made the smartest personnel decision of his career when he hired Gerard Swarthout, Jr. to join the company as chief engineer, who later became pres-ident of the fi rm. Today Scott Bridge Company is led by Scott’s name-sake: I. (Ike) J. Scott, III and Gerard Swarthout’s son, Jack.

Jud Scott became a member of ARBA in 1957. He served as Board member and committee member. His greatest contribution to ARBA was through his political work with the executive and legislative branches of state government over three decades. He was dedicated in helping to cre-ate funds and build the state’s infra-structure, and he worked diligently to accomplish this.

Scott’s dedication wasn’t only to bridges alone. Born in Rockdale, Ga., he moved to Opelika and married an Opelika girl—Frances Morgan and lived there until his death in 1984. Through the years he was very civic-minded. The highest tribute a man can receive comes from the people where he has lived for many years. In 1975, Scott was named the “Distinguished Citizen of the Year” by the city of Ope-lika. Two items from his public state-ment made by the citizens of Opelika defi ne the man: “During World War II he bought the old armory building and rebuilt it for the use of the young people of Opelika as a recreation cen-ter” and “he also cleaned up and rebuilt many parts of the city making it a bet-ter place to live.”

Scott was committed to the highest principals of faith, family and freedom. He was an avid writer to the Opelika Daily news where he made his opin-ions, both serious and humorous, well known. He was a Democratic elector to two National Conventions in 1964 and 1968. After the Supreme Court threw prayer and the Ten Command-ments out of the public schools, Scott


founded Scott Preparatory School, which later became Lee-Scott Acad-emy, one of the leading independent schools in the state today. Of the many things that Scott committed his time to, none was more important than his church, First Baptist of Opelika where he served for many years as deacon and chairman of the building committee. At his death in 1984, he was survived by his wife, Frances, his son, I.J. Scott, Jr., his daughter, Marion, four grand-sons and three great-grandchildren. His family legacy today includes I. J. Scott, II, president of Scott Bridge Co. and ARBA Board member; Bill Scott, vice president of Scott Bridge Co.; and 10 great-grandchildren.

C.P. (Pat) Wilson, Sr. was born in Equality, Ala., in 1923 and raised on the family farm. In 1940 the fam-ily moved to Childersburg. Pat gradu-ated from Childersburg High in 1941 and married in 1942. Working briefl y with Mitchell Brothers at the Alabama Ordinance Plant in Childersburg, he fi nished the war years in Birmingham

with Bechtel-McCone, supervising the repair and refi tting of B-29 Bombers.

After the war, the Wilsons’ moved back to Childersburg, purchased a gro-cery store and gas station, and added a truck for a rolling store. In 1948 his brother Billy Smith joined Wilson in what would become Wilson Brothers. The body on the rolling store truck was exchanged for a dump bed and they were in the contracting business. Next they added another truck (this one had a cab) and then a loader. After a few additional pieces of equipment, Wilson Brothers Construction was ready for

the Farm-to-Market Highway Projects of the 1950s and early 1960s. During this time, Wilson Brothers constructed the longest Farm-to-Market roadway in the program’s history (18 miles from Childersburg to Talladega). With the end of the Farm-to-Market program, Wilson Brothers diversifi ed its con-struction operations to include grading, drainage, culverts, misc. concrete, base and paving.

During this time, (1960s) Wilson began his years of service with the Ala-bama Road Builders Association serving in nearly every position within the orga-nization, including president in 1976. Wilson Brothers continued to grow until it became a major force in highway and industrial construction in Alabama in the ’70s, ’80s, and ’90s. During this period, some of the major projects he was so proud to have completed are the Race Track Blvd. at Talladega, base and paving on AL 148 from Sylacauga to Millerville, construction of AL 77 from Talladega to Lincoln, construction of three sections of the Skyline Drive at Mt. Cheaha, and the Brook Highland

C. P. (Pat) Wilson, Sr.

380612_Ready.indd 1 4/26/08 11:37:56 AM


and Grandview projects in Birming-ham. Wilson was also active in his local community, his church, the Masons, the city council and as director in the local bank. Wilson retired in 1999 and passed on July 1, 2002.

Vulcan Materials Company, based in Birmingham, Ala., provides essen-tial infrastructure materials that are required by the American economy. Vulcan is the nation’s largest producer of construction aggregates and a leader in the production of other construc-tion materials including asphalt and ready-mixed concrete. In 2007 and for the seventh year, Vulcan was named to Fortune magazine’s list of America’s Most Admired Companies. Vulcan ranked fi rst in its business category and among the top 10 of all Fortune 1000 companies for both social responsibili-

ty and long-term investment and among the top 20 for both fi nancial soundness and use of corporate assets.

Vulcan is an S&P 500 company list-ed and traded on the New York Stock Exchange under the symbol VMC. Vulcan has about 11,000 employees nationwide. Vulcan’s construction aggregates business has a long histo-ry—one that dates back to 1909, the year in which Vulcan’s predecessor company, Birmingham Slag Company, was formed. In 1916, Charles Lincoln Ireland, a banker from Ohio, purchased Birmingham Slag Company. Under the Irelands, the company was consistently profi table except in 1932. Following the Great Depression, Birmingham Slag Company began to grow in ear-nest, primarily through joint ventures with other family-owned aggregates companies in the Southeast.

In the 1950s, the Irelands realized that Birmingham Slag would have to become a publicly held company—preferably through merger—to achieve the rapid expansion required to be a major supplier of aggregates for the

Eisenhower administration’s Federal Highway Program. It was during this era that Houston Blount, an Alabama Road Builders Hall of Fame inductee, joined the company. Bernard A. Mon-aghan, a prominent lawyer and Rho-des Scholar, engineered a merger with Vulcan Detinning Company of Sewar-en, N.J., in 1956. Birmingham Slag, renamed Vulcan Materials Company, became a publicly traded company with access to the capital markets that would facilitate its growth.

After the merger, Barney Monaghan joined the company, serving as execu-tive vice president and then president and chief executive offi cer. Houston Blount became CEO in 1979. He was followed by Herb Sklenar, who became CEO in 1986. Upon Herb Sklenar’s retirement in 1997, Don James was elected chairman and CEO. In the late 1950s a series of acquisitions brought numerous family owned aggregates companies under the Vulcan banner. In the years that followed, Vulcan greatly expanded its construction materials business. In 1999, Vulcan acquired

378939_Goodwyn.indd 1 4/24/08 11:15:52 AM

P.O. Box 2000Opelika, AL 36801

Phone (334) 749-5045Fax (334) 749-3936

Constructors/Engineers Since 1933www.scottbridge.com

Congratulations to the 2008

Hall of Fame Inductees

Celebrating

Anniversary75our th

375714_scott.indd 1 4/7/08 8:59:08 PM

NATIONAL CEMENT “The Cement of Choice for Building Success” National Cement Company of Alabama, Inc.

A Vicat Company

2000 SouthBridge ParkwaySuite 600Birmingham, Alabama 35209Direct: (205) 423-2600Fax: (205) 870-5777


HALL OF FAME SPONSORS

PATRON SPONSORSScott Bridge Company, Inc.Dunn Construction Co., Inc.Tractor & Equipment Co., Inc.Charles E. Watts, Inc.Newell Roadbuilders, Inc.Ala. Bridge Builders, Inc.East Alabama Paving Co., Inc.R.R. Dawson Bridge Co.HRCA, LLCWiregrass Construction Co., Inc.Volkert & Associates, Inc.S T Bunn Construction Co., Inc.Turner Insurance & Bonding Co., Inc.McCartney Construction Co., Inc.Vulcan Materials CompanyDavid B. AbramsonAPAC Mid-South, Inc.J. Smith Lanier & Co.Thompson Tractor Co., Inc.Abramson LLC

CONTRIBUTOR SPONSORSOzark Striping Co., Inc.Cowin Equipment Co., Inc.Ergon Asphalt & Emulsions, Inc.Goodwyn, Mills & Cawood, Inc.Strada Materials, LLCG.W. Norrell Contracting Co., Inc.

CalMat, the largest supplier of aggre-gates on the West Coast. In 2000, Vul-can acquired the aggregates facilities of Tarmac. In November 2007, Vulcan acquired Florida Rock Industries, Inc., in the largest acquisition in Vulcan’s 50-year history.

Vulcan remains the largest pro-ducer of construction aggregates in the United States, a position held by the company since the early 1960s. Vul-can operates 334 aggregates produc-tion facilities and sales yards. These operations provide a diversifi ed line of aggregates, other construction materi-als, and related services to all parts of the construction industry in 22 states, the District of Columbia, the Bahamas and Mexico. In 2007, Vulcan shipped 231 million tons of aggregates and had net sales of $3 billion. ❏

Allison. For transmissions with

a work ethic as strong as yours.

Williams. For sales and service

that always go the distance.

We know you’ve got a tough job to do. So we’reequipped and staffed to handle anything you throwour way. With factory-trained certified technicians,24-hour emergency service and fully equipped

service trucks. So when it’s time to go to work, call us. We’ll be ready.

w w w. w w w i l l i a m s . c o m

ALABAMA: Birmingham 800.365.3780 Montgomery 800.592.3413

OTHER LOCATIONS: Arizona, Georgia,Michigan, Nevada, Ohio and South Carolina

364683_WW.indd 1 1/16/08 10:17:44 AM

1940 Pinson Valley ParkwayBirmingham, AL 35217Office: (205) 849-1727

Fax: (205) 849-1726

348413_Apache.indd 1 11/16/07 3:28:55 PM


BuyingCOST SAVINGCOST SAVING


$martThe cost of doing business always seems to be going up. Sometimes we can keep pace, and other times it’s a

challenge. But one thing is for sure: It’s always wise to be on the lookout for ways to keep costs in check.

With that in mind, we checked with experts to get tips on how to save money, make the most economical choices, and get the best deals and benefi ts possible when it comes to equipment and materials.

Here’s a sampling of ideas:

EQUIPMENTMike Elliott is president of Pile Equipment, which leases

and sells pile driving equipment. Though located in Green Cove Springs, Fla., the company does about 20 percent of its business north of the border in Alabama.

When asked for cost-savings tips, Elliott had a few ideas. He noted that contractors often want to lease his equipment with an option to buy. They hope they’ll get another job beyond the one already planned and will need the equipment longer than origi-nally expected. But Elliott notes that the best purchase price, by far, goes to contractors who seek to buy very early on in the pro-cess. To the extent possible, planning ahead and being prepared to buy at the outset can lead to cost savings.

Another big factor: the way contractors do business. Clients who pay on time and take good care of leased equipment are val-ued. It’s also important that contractors do good work and earn a solid reputation from their own clients. “It all fl ows downhill,” Elliott said. In other words, if a contractor gets a bad name on a job site, people will (perhaps subconsciously) think less of the company whose name is on the pile driving equipment.

Everyone receives fair, honest and courteous service, but “they (the good customers) get a better price,” Elliott said.

Brian Laughlin is a paving products specialist at Thompson Tractor in Birmingham. His suggestion on saving money: Buy now.

If contractors are thinking about buying equipment, he said, now is the time to do it. In his part of the business, sales volumes

are relatively low and dealers have incentive to move product. “It’s (hitting) just about everyone,” he said.

Another advantage of buying now: The federal government is offering a 50 percent tax write-off for big equipment purchases during 2008.

The leasing climate is equally favorable, he said. Lending rates are good, you could have your equipment covered by warranty the entire time of the lease, and you can walk away from the equip-ment at the end of the lease and not worry about continuing main-tenance costs.

Being patient and keeping an eye out for the best deal also is advisable. “Equipment vendors come to us with offers, and if we need to purchase, we take the best offer available,” said Rock Nichols, the treasurer for ST Bunn, the western Alabama asphalt paving company. “The fi nancing is handled the same way. Several lending institutions offer us fi nancing, and we generally get good rates because of this. We have a primary bank, and the offers from others assure us of the best rates from them also.”

MATERIAL WORLDWhen a contractor bids a job, there are only so many factors he

can control. The price of materials usually isn’t one of them.Never has that been more true than in recent years. William

Buechner, a top offi cial with the American Road and Transporta-tion Builders Association, addressed this very topic in an article he wrote for the spring 2008 issue of The Alabama Roadbuilder.

He noted that construction material costs rose an average of 1.6 percent between 1990 and 2003. But then, thanks to increased demand from China and other developing nations and a boom in home construction, “this period of stable prices came to an abrupt end in 2004.”

“The average cost of highway construction materials is 40 per-cent higher today than in 2003,” Buechner wrote. Even though

How to make economical decisions about equipment and materialsBY JIM ROSS


labor and overhead didn’t increase nearly that quickly, the cost of highway construc-tion “has risen at least 25 to 30 percent in just the past four years,” Buechner wrote. During that same time, the Consumer Price Index rose just 12.5 percent.

(The price of materials varies from

state to state, but Joe McInnes, director of the Alabama Department of Trans-portation, wrote in the last The Alabama Roadbuilder that our state has seen a 40 percent increase in concrete, steel, asphalt and labor costs since 2003.)

What’s a contractor to do? Again, as

noted above, it’s best to look for cost-cutting measures and ways to be economical.

ARBA President Greg Abramson said that, to start, it’s best to go back to basics: Contractors should create long-term rela-tionships with suppliers. There’s noth-ing wrong with broadening your list and comparison shopping, but building and maintaining those lasting relationships should always be a priority.

That approach certainly has worked well for ST Bunn. “Generally, as far as one of our most costly materials, liquid asphalt, we are pretty much locked in to one supplier,” said Nichols. “However, they are locally owned and do negotiate prices and discounts with us.”

Abramson said it’s also a good idea to try and “plan ahead so you know the materials you’re going to need…(so you can) buy in bulk and buy ahead,” Abram-son said. Bulk buying usually correlates with more favorable rates, and early buy-ing allows you to lock in more favorable rates.

Unlike some industries, road building is limited in its ability to get creative and fi nd alternates when prices get high. Job specs spell out which materials must be used, and what components go into those products. If tomato prices skyrocket, the local hamburger stand can stop putting them on each sandwich. Road contractors have no such fl exibility.

The above-listed advice is solid in good times and bad times. But now is the time to consider these ideas, because materials costs are trending up, and there is no sign of relief. “We expect these commodity costs to remain elevated, and possibly continue expanding, in the near term,” the Federal Highway Administra-tion wrote in a September 2007 report.

The result: “A dollar will have lost between 37 and 60 percent of its value between 2005 and 2009 if highway proj-ect infl ation continues at its 2006 pace,” the federal agency predicted.

Those are daunting numbers, but nothing that can’t be handled. The road building industry is vigilant about recom-mending proper state and federal funding levels and making sure the most money possible goes to road and bridge construc-tion and maintenance. Contractors are just as careful about watching for their own cost effi ciencies, as well. ❏

(800) 737-0707www.shermandixie.com

Precast Civil-EngineeredSolutions, Sanitary andStorm Water Treatment,Detention,Drainage Systems

Plant Locations:Alabama, Tennessee,Kentucky, Ohio

Systems that last.Values that endure.

Hines, Ridolphi, Carper & Aman, Inc.Specializing in the Construction Industry

Insurance

Contract Surety

Risk Management

Montgomery Location4131 Carmichael Road

Suite AMontgomery, AL 36106

Ph.: 334.272.6200Fax: 334.272.4705

Birmingham Location5300 Cahaba River Road

Suite 150Birmingham, AL 35243

Ph.: 205.969.6115Fax: 205.969.6116

351907_hines.indd 1 10/29/07 6:23:07 PM

The Alabama Roadbuilder • Summer 2008 25ThThThThThThThThThhThThThThThThThhThThTThhThThe e e e e e ee eeeeeeeeee AlAlAlAlAlAlAlAlAlAAlAAAA ababababababababababa amamamamamamamammammamma a a a aa aa aaaa RoRoRoRoRoRoRRoRoRoRoRoRoRoRoRoRoRooRoRoRoRoRoRoRoRRoRoRoRoooRRoRRoRoRoRoRoRoRoRoRoRRRRoRoRoRoRoRRRRoRooRRoRooRRRoRoRRRRRRoRRRoadadadadadadadadadaaadadaaaaaaaaaaaaaaaaaaaaaaaa bubububububububububuuuuubuuillilililillilldedededededededeeedeeededededeeeeededdeed rr r r r rr r rrrrr rrr rr • • ••• • • • • ••• ••••• SuSuSuSuSuSuSuSuSuuuSuSuSuuSSuSSSummmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmeeerereererererererererererrrrreererereerererrreeerrrererererereerereerreeeeeererrrrerereererrreererrreeeeeeeeer 22 22 2 2 22 2 2222 22222 222 2 0000000000000000000000000000000000000088888888888888888888888 222222222222222222222222222222222222222 2 2 5555555555555555555555555555555555555555

ARTBA

Open up the dictionary to the word “grassroots” and you will see one of the synonyms

is “fundamental.” That’s very appropriate because effective grassroots advocacy will be

absolutely fundamental to the transportation design and construction industry’s success

in upcoming legislative battles.

BY PETER RUANEARTBA PRESIDENT & CEO

The American Road & Transportation Builders Association (ARTBA) advocates for the industry every day on Capitol Hill. They work to frame the legislative debate, provide expert policy counsel and economic analysis on transportation development issues, and make every argument possible to advance the industry’s interests. We are bold, non-parti-san and not afraid to fail! Moreover, ARTBA will never fail due to a lack of effort by the association’s offi cers, directors and staff.

The reality is that, while ARTBA provides the best advocacy in the business, only you and your employees are true voting constitu-ents for your two U.S. senators and member of the House of Representatives. You can—and must—complement efforts with your unique voice.

“EXECUTIVE LEVEL” GRASSROOTS: RELATIONSHIPS MATTER

As an executive at your fi rm or agency, you need to lead grassroots efforts by exam-ple. If you haven’t done so already, establish a relationship with your members of Congress and their senior staff, or at least their staff-ers who handle transportation issues. Make an appointment to visit their state or district offi ce. Get to know their state or district director and invite the elected offi cial to tour one of your projects or plants.

Longtime ARTBA Board member Pete Getchell, president of Newtown, Pennsyl-vania-based PKF-Mark III, Inc., is setting a great example that others in the industry can follow. Pete has made it his “personal mis-sion” to get to know and educate his fresh-

GrassrootsActivism: ‘Fundamental’ to Success


man member of Congress, Rep. Patrick Murphy (D), on the district’s transportation infrastructure needs.

Pete recently scheduled a meeting with the congressman and made a special trip to Washington, D.C. He described specifi c local bridges and other assets that need attention and investment, and presented ARTBA’s proposal to refocus and reform the federal programs as part of the next highway/transit investment bill. Clearly, Pete got Rep. Murphy’s atten-tion. Pete is now compiling a unique “photo album” showing those assets-in-need, which he will present to the congress-man during the upcoming ARTBA Federal Issues Program & Transportation Construction Coalition Washington Fly-In. You can bet that Rep. Murphy will be thinking of Pete and the district’s needs when the transportation funding debate accelerates in coming months.

“EMPLOYEE LEVEL” GRASSROOTS: HELP ARTBA HELP YOUThe most signifi cant grassroots weapon we have is the

industry’s millions of employees and their families. We must get them engaged. Many of them don’t understand the con-nection between federal transportation investment and their company’s future market opportunities. Many don’t like poli-tics, don’t think their opinions matter to their elected offi -cials, or just don’t want to take the time to speak out.

ARTBA is ready to help. Our award-winning “Mobilize!” grassroots legislative action program has all the tools you need to get your employees up to speed on these issues and ready to participate. The multimedia package is available to you free of charge by contacting ARTBA’s Hank Webster at [email protected] or 202-289-4434.

Beyond that, take advantage of ARTBA’s grassroots train-ing resources. The association features a skilled team with decades of collective experience in political campaigning and corporate grassroots activities. The next time you hold a meeting of managers or line employees, invite one of these ARTBA professionals to make a presentation. They will clearly explain the importance of coming legislative battles to your company and employees. They will also describe how your employees can make a difference by making a simple phone call.

Another ARTBA member fi rm in Pennsylvania: New Enter-prise Stone & Lime Co., recently held its biennial employee expo. ARTBA staff attended and helped set up a kiosk where the company’s employees composed and signed hundreds of letters to Pennsylvania’s U.S. senators advocating federal transportation investment. This is the third time that ARTBA has participated in this major event, with great success on each occasion. You’re encouraged to do the same. ❏

The most significant grassroots weapon we have is the industry’s millions of employees

and their families.

6772 Highway 79 NP.O. Box 728 • Pinson, AL 35126

Tel.: 205-681-3395 • Fax: [email protected]

Specializing in installation of highway guardrails, signs and fencing

314834_Alabamaguardrail.indd 1 2/16/07 6:00:25 PM

27

HEARD ALONG THE HIGHWAY

ARBA FALL GOLF TOURNAMENTMonday, Oct. 13, 2008 – Arrowhead Country ClubAnother great golf event is planned for this fall. Last fall, more than 200 golf-ers and guests joined ARBA for this fun event, and we expect another tremen-dous crowd this year. Mark your calen-dars and look for more information to come. We will play a scramble again. Prizes will be awarded to winning teams. Make your plans to join us!

PRESIDENT’S LUNCHEON AND ANNUAL MEETINGThe annual meeting and President’s Luncheon is scheduled for Friday, Sept. 26, 2008, at the Capital City Club. Make plans today to join us for this festive tradition as we honor our out-going president, Greg Abramson, and welcome incoming president, Sonny Bunn, and his board of directors.

ARBA MEETS WITH LEGISLATIVE JOINT TRANSPORTATION COMMITTEE

ARBA Board Members met with ALDOT Director Joe McInnes, Chief Engineer Don Vaughn and Alabama’s Legislative Joint Transportation Com-mittee to discuss issues of interest to our industry and specifi c legislation relat-ing to toll legislation. We are grateful to our friends in the Legislature who have a sincere interest in maintaining and growing the most important eco-nomic engine in Alabama—our road and bridge system.

SHERMAN-DIXIE CELEBRATES FACILITY EXPANSION

State and local leaders gathered with members of the Alabama transporta-tion, engineering and development communities at Sherman-Dixie Con-crete Industries’ Cullman manu-facturing facility on April 11 for an introduction to the newly expanded plant and an opportunity to learn about the value of time-tested products in an era when many states are grappling with public safety concerns posed by deteriorating infrastructure.

The concrete structures manufacturer, an Amer-ican-owned company headquartered in Nashville, invited statewide offi cials and industry professionals to a meet-and-greet barbeque that featured tours of the plant, which produces precast box culverts, aqua arches and precast drainage structures such as man-holes, catch basins, inlets, headwalls and structural BMPs, and distributes precast concrete pipe.

Among the nearly 200 guests attending the event was state Rep. James Fields, Cullman Mayor Don Green and representatives from Huntsville and Tuscaloosa. After lunch, guests toured the plant, whose expansion includes a 6,200 square-foot offi ce building and a total of 45,000 square feet of manufacturing space. New 15- and 35-ton cranes were in operation during the tours, moving recently constructed precast concrete structures as guests explored the expanded space.

“We are extremely proud of our Cullman facility and of the contribution Sher-man-Dixie makes to strong, reliable stormwater systems throughout the state of Alabama,” said Pete DeLay, president and CEO of Sherman-Dixie. “It was an honor to welcome guests from all over Alabama and show them the precision and professionalism that goes into our concrete structures, which add to the safety and value of Alabama’s infrastructure. We are also delighted to be a part of Ala-bama’s business community and were pleased to have an opportunity to celebrate with our neighbors.”

Sherman-Dixie offi cials said guests invited to the event are among the most critical decision-makers in the state when it comes to infrastructure. Outmoded infrastructure manufacturing techniques and the use of products inferior to con-crete often lead to infrastructure problems and even failure well before the struc-ture’s anticipated lifespan. Investing in tested, precast concrete structures plays an important role in the longevity of Alabama’s infrastructure, which is particu-larly signifi cant during unstable economic conditions when budgets do not allow for the regular repair of failing infrastructure, company offi cials said.

“Public offi cials, engineers, contractors, owners and developers all play criti-cal roles in ensuring that construction projects, particularly public infrastructure, effectively serve their purpose and protect the health, safety and welfare of their users,” said Mike Kusch, Sherman-Dixie’s director of technical marketing.

Nashville-based Sherman-Dixie services most of Alabama from its Cullman facility. All Sherman-Dixie products are custom-made for its customers. The company opened its Cullman, Ala., facility in 2003. The expansion doubles the size of the facility, allowing the company to grow its product line for the Ala-bama market and to better serve its customers. The company has served the Southeast for more than fi ve decades.

Pete DeLay, Sherman Dixie CEO, (center) gives an on-site demonstration.


PRODUCTS AND SERVICES MARKETPLACE

Visit our web site at PILE-EQP.NETE-mail [email protected]

(904) 284-1779 FAX (904) 284-2588 WATS (800) 367-9416

PILEMASTER AIR HAMMERwww.pilemaster.org

HPSI VIBRATORY PILE DRIVER/EXTRACTOR

ALSOHYDRAULIC AUGERS

EXCAVATORMOUNTEDVIBRATORY

DRIVER/EXTRACTORS

PILEMASTER

Celebrating

20Years in Business

303065_PileEquip.indd 1 10/6/06 12:01:21 PM


312508_PBSJ.indd 1 12/18/06 8:53:56 AM

S T Bunn Construction Company, Inc.

205-752-8195

S T Bunn Construction Company is one of the oldest, family owned construction businesses in the state of Alabama, founded in 1936.

Aside from actual pavement of roadways, S T Bunn operates five asphalt plants in the towns of Tuscaloosa, Demopolis, Fayette, Epes, and Guin. While most of the asphalt is utilized in their own projects, some of the product is sold to other contractors including state, county and municipal operations.

The company adheres to the codes of exemplary business conduct and the highest quality construction materials and processes. The result of this family approach to quality paving construction is visible for all to see on the interstates, roads and parking lots of West Alabama.

375753_STBunn.indd 1 5/12/08 7:17:26 PM

The McPhersonCompanies, Inc.Total Petroleum Management

“Serving Your Energy NeedsFuel, Lubricants, Waste Oil, Fuelman”

5051 Cardinal StreetTrussville, AL 35173

888-802-7500

[email protected]

Proud Member of ARBA

For John DeereSales and Service, Call On:

66 Industrial Park Dr.Monroeville, AL 36460

334/575-7111

2149 Hwy 31 SouthPelham, AL 35124

205/988-4472

2255 Hwy 21 SouthOxford, AL 36201

256/831-0921

6801 McFarland Blvd. WestNorthport, AL 35476

205/339-0300

Hwy 31 SouthAthens, AL 35611

256/233-1914

3540 Wetumpka HwyMontgomery, AL 36110

334/277-7260

334661_Warrior.indd 1 8/28/07 9:23:44 PM


INDEX TO ADVERTISERSADVERTISERS.COMAlabama Barricade, Inc. .................................................. 6www.alabamabarricade.comAlabama Guardrail, Inc. ................................................. 26n/aAlabama One Call .......................................................... 11www.al1call.comApache Construction ..................................................... 21n/aBurr & Forman, LLP ....................................................... 30www.burr.comChemical Lime ............................................................... 28www.chemicallime.comCowin Equipment ................................. Outside Back Coverwww.cowin.comCrumpler Plastic Pipe, Inc. ............................................ 26www.cpp-pipe.comDunn Construction Company, Inc. ................................ 16www.dunnconstruction.comEast Alabama Paving Company, Inc. ............................ 18n/aErgon Asphalt & Emulsions, Inc. ..................................... 4www.ergonasphalt.comGerdau Ameristeel ......................................................... 17n/aGoodwyn, Mills & Cawood ............................................. 20www.gmcnetwork.comHines, Ridolphi, Carper & Aman, LLC ............................ 24www.hrcallc.comJackson Thornton Construction .................................... 17www.jacksonthornton.comLafarge Aggregates Southeast........................................ 6www.lafargenorthamerica.comMartin Marietta Aggregates ............................................ 8www.martinmarietta.comThe McPherson Companies, Inc. ................................... 29www.mcphersonoil.comNational Cement Company ............................................ 20n/a

Palomar Insurance Corporation .................................... 28www.palomarins.comPBS&J............................................................................. 29n/aPile Equipment, Inc. ....................................................... 28www.pile-eqp.netProtection Services, Inc. ............................................... 16www.protectionservices.comReady Mix USA, Inc........................................................ 19www.rmusainc.comRoadtec, Inc. .................................................................. 15www.roadtec.comThe Rogers Group, Inc. .................................................. 11www.rogersgroupinc.comS T Bunn Construction Company .................................. 29n/aS. A. Graham Company, Inc. .......................................... 30www.sagraham.comSafety Coatings, Inc. ...................................................... 30www.safetycoatings.comScott Bridge Company, Inc. ........................................... 20www.scottbridge.comSherman Dixie Concrete Industries .............................. 24www.shermandixie.comSoutheast Materials Corporation .................................. 18n/aThompson Engineering .................................................. 26www.thompsonengineering.comThompson Tractor ........................................................... 3www.thompsontractor.comTurner Insurance & Bonding Company ... Inside Back Coverwww.tibcoinc.comVulcan Materials Company ....................Inside Front Coverwww.vulcanmaterials.comWarrior Tractor and Equipment .................................... 29n/aW.W. Williams ................................................................ 21www.wwwilliams.com

ACCOUNTING FIRMSJackson Thornton Construction ........................................ 17

AGGREGATESMartin Marietta Aggregates................................................ 8

AGGREGATES/CRUSHED STONELafarge Aggregates Southeast ........................................... 6Vulcan Materials Company ........................Inside Front Cover

ASPHALT CONTRACTORSEast Alabama Paving Company, Inc. ................................ 18

ASPHALT EMULSIONS OR EMULSIFYING AGENTSErgon Asphalt & Emulsions, Inc. ......................................... 4

ASPHALT PAVERSRoadtec, Inc..................................................................... 15

ATTORNEYSBurr & Forman, LLP ......................................................... 30

BRIDGE CONSTRUCTIONScott Bridge Company, Inc. .............................................. 20

CEMENTNational Cement Company ............................................... 20

CONSTRUCTION COMPANIESDunn Construction Company, Inc. .................................... 16S T Bunn Construction Company ...................................... 29

CONSTRUCTION EQUIPMENTCowin Equipment ................................... Outside Back Cover

CONSULTING ENGINEERSGoodwyn, Mills & Cawood................................................ 20

CRUSHED LIMESTONEThe Rogers Group, Inc. .................................................... 11

CRUSHED STONE/GRANITE/RIPRAPSoutheast Materials Corporation ...................................... 18

DRILLING & BLASTING CONTRACTORSApache Construction ........................................................ 21

EARTHWORK/GRADINGS. A. Graham Company, Inc. ............................................ 30

ENGINEERSPBS&J ............................................................................. 29Thompson Engineering .................................................... 26

EQUIPMENT RENTAL & SALESThompson Tractor ............................................................. 3Warrior Tractor and Equipment ........................................ 29

FUEL & LUBRICANTSThe McPherson Companies, Inc. ...................................... 29

GUARDRAILS & HIGHWAY SAFETYAlabama Guardrail, Inc. .................................................... 26

INSURANCEPalomar Insurance Corporation ........................................ 28

INSURANCE & BONDSHines, Ridolphi, Carper & Aman, LLC ............................... 24Turner Insurance & Bonding Company ...... Inside Back Cover

LIME/QUICKLIME/HYDRATED LIME SLURRYChemical Lime ................................................................. 28

PAINT SUPPLIERSSafety Coatings, Inc. ........................................................ 30

PILE DRIVING EQUIPMENTPile Equipment, Inc. ......................................................... 28

PIPE - MANUFACTURED PRODUCTSCrumpler Plastic Pipe, Inc. ............................................... 26

PRECAST CONCRETE PRODUCTSSherman Dixie Concrete Industries .................................. 24

READY-MIXReady Mix USA, Inc. ......................................................... 19

STEELGerdau Ameristeel ........................................................... 17

TRAFFIC CONTROL EQUIPMENTAlabama Barricade, Inc. ..................................................... 6

TRAFFIC CONTROL SIGNAGEProtection Services, Inc. .................................................. 16

TRUCK SALES, PARTS & SERVICESW.W. Williams .................................................................. 21

UNDERGROUND LINE LOCATORSAlabama One Call ............................................................ 11

ATTORNEYS

375229_Burr.indd 1 3/24/08 2:34:23 PM

Burr & Forman, LLP420 North Twentieth Street Suite 3400Birmingham, AL 35203Phone: (205) 251-3000Fax: (205) 458-5100Web: www.burr.comBurr & Forman LLP combines a 103-year history in the Southeast with a forward-thinking approach to providing legal solutions. With over 200 attorneys in offices in Alabama, Georgia, Mississippi and Tennessee, we offer a wide range of business and litigation services to diverse clients with local, national, and international interests.

PAINT SUPPLIERS

Safety Coatings, Inc.20180 Safety LaneP.O. Box 399Foley, AL 36536-0399Phone: (251) 943-1638Fax: (251) 943-3689E-mail: [email protected]: www.safetycoatings.comSafety Coatings manufactures all types of traffic paints, including DOT approved, Federal Specs, Parking lot paints, Hi-Build traffic paint, and Loop Sealant. We have been in business since 1979, and are known for our quality and service. Please call us for any of your traffic paint needs.

S.A. Graham Company, Inc.www.sagraham.com

6965 U.S. Highway 231 Office: 334-735-2362Post Office Box 726 Fax: 334-735-2363Brundidge, AL 36010 E-mail: [email protected]

381995_SAGraham.indd 1 5/8/08 11:39:53 PM

Montgomery Birmingham

363996_Turner.indd 1 1/3/08 8:27:59 PM

Volvo paving and compaction equipment isn’t beige anymore. It’s yellow.

But it takes more than paint to make it a Volvo. An extensive, global dealer network with superior parts, service, and industry knowledge will keep you on the job and your profits high. Our broad range of financial services will help you get the equipment you need. It’s the opportunity to own premium equipment and the comfort of knowing you have experts to back you up. Only then does it truly become a Volvo.

Experience our compaction, paving, and motor grader equipment packaged with everything Volvo offers. Because when you’ve got a road to build, we’re ready to get the job done.

Volvo Construction Equipment www.volvoce.com/naMORE CARE. BUILT IN.

BIRMINGHAM MOBILE MONTGOMERY HUNTSVILLE / DECATUR PENSACOLA OXFORD

www.cowin.comP: (205) 841-6666

800-239-2694F: (205) 841-2639

IT TAKES MORE THAN PAINT TO MAKE IT A VOLVO.

369569_Cowin.indd 1 2/29/08 3:15:09 PM

ROADBUILDERTHE ALABAMACOMMUNICATIONS DIRECTOR TERRI MITCHELL [email protected] ADMINISTRATIVE...

Documents

Transcript of ROADBUILDERTHE ALABAMACOMMUNICATIONS DIRECTOR TERRI MITCHELL [email protected] ADMINISTRATIVE...