Research Collection

Doctoral Thesis

A study of African cassava mosaic virus gene expression for thedevelopment of virus resistance

Author(s): Frey, Petra Maria

Publication Date: 2000

Permanent Link: https://doi.org/10.3929/ethz-a-003881275

Rights / License: In Copyright - Non-Commercial Use Permitted

This page was generated automatically upon download from the ETH Zurich Research Collection. For moreinformation please consult the Terms of use.

ETH Library

Diss. ETH Nr. 13 557

A study of African Cassava Mosaic Virus

gene expression for the development of

virus resistance

A dissertation submitted to the

Swiss Federal Institute of Technology Zürich

foi the degree of

Doctor of Natural Sciences

presented bv

Petra Maria Frey

Dipl. Natw. ETH

bom May L. 1972

citizen of Lanfen-Stadt. BL

accepted on the recommendation of

Prof, Dr. I. Potrykus, examiner

Prof. Dr. K. Apel, co-examiner

February 2000

to Reto

Acknowledgements

I would like to thank all the people who have helped me to accomplish the work

described in this thesis. Without them this work would not have been possible.

I am grateful to PD Dr. Johanna Puonti-Kaerlas, for giving me the opportunity

to work in her group, for her interest and support during this project and for care¬

fully reading this manuscript.

I would like to thank Prof. Dr. Ingo Potrvkus for accepting me as a PhD student

and for his constant support, Prof. Dr. K. Apel foi officiating as co-referent and

Prof. Dr. N. Amrhcin for his help during the last year of this thesis.

Thanks to all the past anel picsent members of the Potrvkus group and especially

of the cassava group for the help and advice, for many discussions and a friendly

working atmosphere. I especially want to thank Dr. Johannes Fiittcrcr for always

being willing to help and to discuss strange results and for his encouragement durin ^

all the bad times.

Very special thanks go to Dr. Nania Schärcr-Hernandez, for sharing with me

her enthusiasm for plant viruses, foi her constant, generous help anel interest, for

carefully correcting this manuscript, for all the good times in and out of the lab, for

the Sushi and for being such a great friend. (Grrrrrrrr!)

I am very grateful to Dr. Roland Bilang and Dr. Claudio Lupi for their friendship

and for all the lively discussions about science anel many other things. They made

working here so much more fun.

I would also like to thank PD Dr. Thomas Frischmuth and Margit Engel for

conducting the virus infection experiments in Stuttgart, anel for helpful discussions.

Christoph Lehmann (Guggu) is kindly acknowledged for being my personal

ÈvTt?X~ hotline.

Finally, special thanks go to mv parents anel to Mirjam and Matthias for their

interest in my work and their support during all mv studies and to Reto for his love,

his interest in my scientific problems and for always being thcie for me.

Contents

1 General Introduction I

1.1 Cassava (Manihot esciilenfa Crantz) 1

1.2 African cassava mosaic disease 2

1.3 African cassava mosaic virus 3

1.3.1 Genome organization 3

1.3.2 Viral replication 5

1.3.3 Gene regulation 5

1.4 Strategics for engineering virus resistance 7

1.5 Plant genetic engineering 9

1.5.1 Regeneration 9

1.5.2 Transformation 10

1.5.3 Cassava transformation anel regeneration 10

1.6 Lucifcrasc reporter genes 11

1.7 Aim of this thesis 12

2 ACMV Promoter Analysis 14

2.1 Abstract 14

2.2 Introduction 14

2.3 Materials and methods 17

2.3.1 Plant material 17

2.3.2 Bacterial strains 17

2.3.3 Construction of plasmids 17

2.3.4 Protoplast, isolation and transformation 19

2.3.5 Agrobactenvm-mediated seedling transformation of tobacco. .

20

2.3.6 DuabLuciferasclM reporter assav 20

2.3.7 Southern blot analysis 21

2.3.8 Virus infection of transgenic plants and assay of viral DNA

replication 21

2.4 Results 22

rr

2.4.i Expression of firefly and Rcmlla lucifcrase genes under the

control of ACMV promoters 22

2.4.2 Effect of the expression of viral ORFs on the activity of the

luciferase genes under the control of ACMV promoters ....24

2.4.3 Analysis of a short and a longer form of the DNA A promoter 27

2.4.4 Production of transgenic tobacco plants containing pACMVs

and pACMVlcaeler 28

2.5 Discussion 32

3 Developing a new ACMV resistance strategy by mimicking a hy¬

persensitive reaction using the barnase and barstar ORFs 39

3.1 Abstract 39

3.2 Introduction 40

3.3 Materials and methods 43

3.3.1 Plant material 43

3.3.2 Bacterial strains 43

3.3.3 Construction of plasmids 43

3.3.4 Tobacco mesophyll protoplast isolation, transformation and

regeneration 45

3.3.5 Agrobactcrium-mcdi&tcd seedling transformation of tobacco. .

46

3.3.6 Dual-Luciferase reporter assav 46

3.3.7 Molecular analysis 47

3.3.8 Replication assays 48

3.4 Results 49

3.4.1 Expression of active barnase can be enhanced transiently in

tobacco protoplasts 49

3.4.2 Analysis of transgenic tobacco plants containing a regulatable

barnase ORF 49

3.4.3 Viral replication in transient assays is reduced in transgenic

plants 51

3.5 Discussion 52

4 Cassava regeneration and transformation 55

4.1 Abstract 55

4.2 Introduction 55

4.3 Materials and methods 57

4.3.1 Plant material 57

4.3.2 Bacterial strains and constructs 58

m

4.3.3 Transformation 59

4.3.4 Molecular analysis of îesistant shoots 61

4.4 Results 62

4.4.1 TMS60444 transformation and regeneration via organogenesis 62

4.4.2 MCol22 transformation and regeneration via organogenesis . .63

4.4.3 Transformation and regeneration of suspension cultures....

64

4.5 Discussion 67

5 General Discussion 70

IV

Zusammenfassung

Maniok (Cassava, Manihot escvlenta Crantz) ist eine ausdauernde, buschige Pflanze

der Familie der Euphorbia ceae. Sie ist das Grundnahrungsmittel von über 500 Mil¬

lionen Menschen und somit eine der wichtigsten Nahrungsquellcn in den Tropen.

Eine der grössten Bedrohungen der Maniok-Produktion in Afrika ist die afrikani¬

sche Cassava-Mosaik-Krankhcit. Sic wird vom afrikanischen Cassava-Mosaik-Virus

(ACMV) verursacht, einem Geminivirus aus der Gruppe der Begomovircn. Diese

Gruppe beinhaltet Viren, welche ein ein- oder zweiterliges Genom besitzen (DNA A

und DNA B) und von weissen Fliegen überfragen werden. Es gibt zur Zeit keine voll¬

kommen virus-resistenten Manioksorten, und die einzige Möglichkeit, die Pflanzen

axrf dem Feld vor einer Infektion zu schützen, besteht darin, die Überträger mit

Chemikalien zu bekämpfen. Da die traditionelle Züchtung von Maniok schwierig

ist, könnte die Gentechnik bereits existierende Projekte zur Verbesserung von Ma¬

niok ergänzen und erweitern. Mit Hilfe der Gentechnik wurde in dieser Arbeit eine

neuartige Virusresistenz, welche auf dem regulierten Promotor des ACMV basiert,

erprobt.

Das Studium der beiden bidirektionalen viralen Promotoren mit Hilfe von zwei

verschiedenen Luciferase Genen war eine Voraussetzung für weitere Experimente.

Mit Hilfe viraler DNA A wurde eine Virus Infektion transient simuliert, womit

gezeigt werden konnte, dass der Promotor des Hüllproteins (AV-Promotoi) posi¬

tiv reguliert wird (ca. 50-fach), während der Promotor des Proteins, welches bei

der Replikation eine Rolle spielt. (AC-Promotor) negativ reguliert wird (ca. 2-fach).Dies konnte sowohl in Tabak- als auch in Maniok-Protoplastcn gezeigt werden. Der

Promotor eler DNA B ist, anders reguliert: In Tabak-Protoplasten wird die Expres¬

sion sowohl in C- wie auch in V-Richtung gleich staik erhöht, während in Maniok-

Protoplastcn die Expression in C-Richtung stärker erhöht wird als in V-Richtung.

Analoge Experimente wurden auch in transgenen Tabakpflanzcn durchgeführt, wel¬

che den ACMV Promotor mit den beiden Lucifcrase-Genen enthalten. Die Resultate

der transienten Experimente konnten dabei bestätigt werden, wobei jedoch die posi¬

tive Regulation des AV Promoters in transgcnen Pflanzen weniger ausgeprägt ist.

Aufgrund dieser Resultate wurde der ORF der Barnase, einer unspezifischen

RNAse von Bacillus arnylohqvefaciens, so klonicrt, dass er vom AV-Promotor kon¬

trolliert wird; der ORF der Barstar, des spezifischen Inhibitors eler Barnase, wird

vom AC-Promotor kontrolliert. Die einzigartige Regulation des ACMV-Promotors,

welche ausschliesslich vom Virus selbst induziert werden kann, und ein fein abge¬

stimmtes Toxin-/Anti-Toxin-Systcm sollten es möglich machen, eine hypersensitive

Reaktion zu simulieren. Da die Regeneration von transgcnen Pflanzen, welche eine

v

vollständige Kopie dieses Konstruktes enthalten, schwierig war, wurde ein kurzer

ORF vor die Barnase eingefügt. Dies bewirkt eine zusätzliche Reduktion der Trans¬

lation der giftigen Barnase. Transgene Pflanzen wurden mit Hilfe einer „Genkanone"

auf die Menge stattfindender viraler Replikation getestet. Eine Reduktion der vira¬

len Replikation konnte bei allen transgcnen Pflanzen gezeigt werden (1 - 30% der

Replikation, welche in Wildtvp Pflanzen gemessen wurde).

Als letzer Schritt wurde versucht, bereits publizierte Transformations- und R(j-

gcnerations-Protokolle an eine afrikanische Manioksorie anzupassen, um in naher

Zukunft neue ACMV-resisternte Manioksorten zu produzieren.

vi

Summary

Cassava (Manihot esculenta Crantz) is a perennial shrub, belonging to the family

Euphorbiaceae. It is one of the most important sources of calorics produced within

the tropics and provides food for over 500 million people. Also in Africa one of

the main staples is cassava, however, its production is now seriously threatened by

the African cassava mosaic disease. It is caused by African cassava mosaic virus

(ACMV), a gcminivirus of the Beqomovrms group, which comprises viruses having

a single or bipartite genome (DNA A and DNA B) transmitted by whitefly. Until

now there is no completelv ACMV-resistant cassava variety available, furthermore,

there is no method known to protect the plants in the field from the virus, except

by trying to control the spread of the vector using agrochemicals. Since traditional

breeding of cassava is constrained, genetic engineering could complement existing

breeding programs. Using genetic engineering, the feasibility of a novel virus resis¬

tance strategy based on the regulated ACMV promoter was assessed in this thesis.

As a prerequisite for this. ACMV promoter regulation was studied with two

different lucifcrase genes under the control of the bidirectional ACMV promoter.

Using viral DNA A for transient transformation experiments to mimic a viral in¬

fection, it could be shown that the coat protein promoter (AV promoter) is up-

regulated (around 50-fold), while the promoter of the replication associated protein

(AC promoter) is down-regulated (2-fold) by DNA A in both tobacco and cassava

protoplasts. The regulation of the DNA B promoter is different, as both v- and

c-sense expression are enhanced by the DNA A in tobacco protoplasts, while in

cassava protoplasts the expression in c-sensc was enhanced more than in v-sense.

Analogous experiments were performed in transgenic tobacco plants, containing the

ACMV-promotcr-luciferasc constructs. Transient results could be confirmed, but

the tip-regulation of the AV promoter was less pronounced.

Based on these results, the barnase ORF. producing an uuspecific ribonucleasc

of Bacillus arnyloliquefaciens. was cloned under the control of the AV promoter and

the barstar ORF, producing a specific inhibitor of the barnase, was cloned under

the control of the AC promoter. The unique properties of the regulation of the

ACMV promoter and its specificity for the virus should make it possible to mimic

a hypersensitive reaction bv using this finely tuned toxin/anti-toxin system. As

regeneration of plants containing complete copies of this construct proved difficult,

a sORF was inserted downstream of the barnase to reduce its translation. Transgenic

plants were tested in a viral replication assay using particle bombardment; for all

analyzed plants reduced viral replication (1 -- 30% of the replication in wild type

plants) could be shown.

vu

As a last, step the transferability and adaptability of published transformation

and regeneration protocols to an African cassava cultivar were assessed in order to

allow the engineering of African cassava mosaic virus resistant cassava in the near

future.

vm

Abbreviations

2,4-D

AC promoter

ACMD

ACMV

ATP

AV promoter

BA

BC promoter

BCTV

BMS

bp

BV promoter

CaMV

CBN

CIAT

CP

DI DNA

DIG

DNA

ds DNA

FAO

EEC

GA3

GFP

GUS

IBA

UTA

kb

kDa

LIR

MES

MPB

mRNA

NAA

NSP

ORF

2,4-clichlorophenoxy-acetic acid

DNA A promoter in c-sense

African cassava mosaic disease

African cassava mosaic virus

adenosine triphosphate

DNA A promoter in v-sensc

6-Benzylaminopurine

DNA B promoter in c-sense

beet, curiv top virus

basic MS medium

basepair

DNA B promoter in v-sense

cauliflower mosaic virus

Cassava Biotechnology Network

International renter for Tropical Agriculture, Columbia

coat protein

defective interfering DNA

digoxvgcnm

deoxyribonucleic acid

double-stranded DNA

Food and Agricultural Organization of the United Nations

friable embryogénie callus

gibberellic acid

green fluorescent protein

//-glucuronidase

indole-3-butyric acid

International Institute of Tropical Agriculture, Nigeria

kilobasc, kilobasc pairs

kilo Dalfon

large intergenic region

2-(N-morpholino)ethanesulfonic acid

movement protein

messenger RNA

O'-naphthalene acetic acid

nuclear shuttle protein

open reading frame

PCR polymerase chain reaction

PDR pathogen derived resistance

PEG Polyethylene glycole

PIG particle inflow gun

REn replication enhancer protein

Rep replication associated protein

RIP ribosome inactivating protein

RLU relative light units

RNA ribonucleic acid

RT room tempcratur

SAR scaffold attachment region

sORF short open reading frame

ss DNA single-stranded DNA

TGMV tomato golden mosaic virus

TMV tobacco mosaic viius

TrAP ri ansactivator protein

TYLCV tomato yellow leaf curl virus

WDV wheat dwar f virus

X

Chapter 1

General Introduction

1.1 Cassava (Manihot esculenta Crantz)

Cassava (Manihot esculenta Crantz), a member of the family Euplwrbiaceae, is a

woody perennial shrub. It originated in Latin America and was introduced to Africa

in the 16th cen+ury by Portuguese traders (Gold. 1994). Today it is cultivated world¬

wide between 30° south and 30° north of the Equator, providing basic staple food for

over 500 million people. Mostly it is grown for its tuberous roots, containing starch

up to 85% of their dry weight (Cock, 1982), but also for its protein rich leaves.

Cassava has the ability to grow on infertile soiP where no other crop could exist

without costly external inputs and therefore is the cheapest available food source in

many developing countries. It can survive seasonal drought and has the advantageof a highlv flexible harvesting time, making it, an excellent famine reserve. In Africa

it is mostly grown by small-scale farmers as a subsistence crop, providing up to 60%

of their daily caloric uptake. An average of 8 t/ha of cassava roots can be produced

in a 12-month growing season in Africa (world average is 10 t/ha) and more than

80% of the harvest rs used as food (FAO. 1989).

Due to the long culture period of cassava, various insect pests and diseases

represent serious challenges to its sustainable cultivation. It has been estimated

that around 50% or more of the potential harvest is lost every year (Roca et ab,

1992) as a result of viral diseases, bacterial blight disease, mealybugs and green

mites or other pests. Furthermore, cassava transport, storage and marketing is

complicated by postharvest deterioration. Roots can be kept on growing plants

long after the first harvest, but once harvested thev must, be processed within 2-7

days (Wenham, L995). Another constraint to cassava use is its cyanogenic nature.

To prevent cyanide poisoning, cyanogenic glucosides have to be removed and using

inadequately processed cassava can have fatal consequences (Akintowa el ah, 1993).

1

CHAPTER 1. GENERAL INTRODUCTION 2

Attempts to solve these problems bv traditional breeding of cassava plants have

had limited success. Traditional breeding in cassava is restricted due to cassava

being a highly heterozygous, allopolyploid plant with low natural fertility in many

cultivars. In addition the lack of icsistance genes in compatible germplasm further

complicates breeding improved cassava varieties. Biotechnology, therefore, could

provide an alternative approach and could complement efforts in traditional breeding

to contribute to a more profitable and sustainable agriculture in Africa by developing

improved cassava varieties.

1.2 African cassava mosaic disease

African cassava mosaic disease (ACMD), rated the most serious vector-borne plant

disease in Africa (Geddes, 1990). is a severe constraint, to cassava cultivation and

is an ideal target, for an approach combining genetic engineering and traditional

breeding. The disease is caused bv African cassava mosaic virus (ACMV), Avhich is

transmitted by whitcflies (Benri^/a tabaci) feeding on cassava leaves (Swanson and

Harrison, 1994). The viruses are able to persist in their insect vectors for many days

or even for the life of the insect, but, they do not replicate in their vectors (Shaw,

1996a). ACMV can also be transmitted during propagation via infected tools and

planting material, but, not via seed (Swanson and Harrison, 1994). Typical symp¬

toms of ACMD are the mosaic bleaching of the leaves, leaf deformation, stunted

groAvth and the loss of storage root formation. ACMD can cause local losses of

up to 80%, with losses throughout Africa reaching 36% of total cassava production

(Fargette et ab, 1988). The onlv way to protect, the plants in the field from being

infected is to control the spread of the whitcflies bv insecticides but, since whitcflies

have overlapping generations and move between cassava and weed hosts, they arc

not, an easy target (Fishpool anel Durban. 1994), Frequent spraying, which is envi¬

ronmentally unsound and too expensive for subsistence farmers, would be necessary.

Growth reduction of cultivated plants is not directly related to the yield loss due to

viral infection; this slows and complicates traditional bleeding, as evaluation of new

cultivars can only be done at the end of a growing season. To elate no completely

resistant cultivars haAT been produced by traditional breeding (Hahn et ab, L980;

Thresh and Otim-Nape, 1994), but in Uganda the use of improved cultivars and

virus-free planting material have secured and enhanced yields (Bock, 1994; Otim-

Nape et ab. 1994a; Fargette et ab. 1996: Otim-Nape et ab. 1997). Disease-frcc

planting material could increase vields Iavo to threefold (Lozano and Booth, 1974):but, due to the long groAving season of cassava, under high infection pressure, plants

CHAPTER L GENERAL INTRODUCTION 3

might be reinfected and the benefits of disease-free plants might be short-lived.

1.3 African cassava mosaic virus

The African cassava mosaic virus (ACMV, earlier called the cassava latent virus)is a Begomovirus of the family Gemimvindae (Frischmuth and Stanley, 1991; La-

zarowitz, 1992; Bisaro, 1996). Geminiviruses have attracted considerable interest

as pathogens attacking manv economically important crop plants worldAvide. They

are transmitted by insect, vectors to a variety of monocotylcdonous and dicotyle¬

donous plants. The geminivirus family is divided into three subgroups depend¬

ing on their genome structure and host range (Bisaro, 1996; Shaw, 1996b; Palmer

and Rybicki, 1997): The leafhoppcr-transmltted Mastreviruses (formerly subgroup

I viruses) like the wheat dwaif virus (WDV). the leaf- and grasshopper-transmitted

Curtoviruses (formerly subgroup II viruses) like the beet curly top virus (BCTV)and the Avhitefly-transmitted Begomouirines (fonneily subgroup III viruses). Mas¬

treviruses and Curtoviruses have onlv a single genomic component of approximately

2.7 kb; Bcgomovirvses mav have one or two components of the same size, one of

which is dependent on the other for replication.

1.3.1 Genome organization

Only two groups of plant viruses are known to contain DNA genomes: the pararetro-

viruscs and the geminiviruses. Unlike that of the pararetroviruscs, the genome of

the geminiviruses consists of one or two covalently closed, single-stranded DNA

molecules (Stanley and Gay. 1983) denoted DNA A and B. For bipartite viruses,

both components were sliOAvn to be required for systemic infection (Stanley, 1983).

Comparison of the DNA A and B has revealed a region of approximately 200

nucleotides with almost, identical sequences. The 5"-end of this common region has

been designated as the zero map unit of DNA A and B (Stanley, 1985). This

commorr region, AAdiich is located in the large inteigcnic region (LIR), is completely

different in its sequence among the diffeieut geminivirus strains with the exception

of a sequence element, of about 30 nucleotides. This element can form a hairpin

structure consisting of a GC-rich stem and an AT-rich loop (LazaroAvitz. 1992).

This structure contains the nonamer motif TAATATTAC. which is identical in all

geminiviruses (Laufs et ab. 1995a).

The seven genes, first identified as open reading frames (ORFs) and named ac¬

cording to their location on the genome anel direction of transcription (Stanley and

Gay, L983) and now renamed according to function, have had functions ascribed to

CHAPTER J. GENERAL INTRODUCTION 4

Figure 1.1: Genome map of ACMV DNA A and DNA B. The DNA is represented

by a thin line with the two arrowheads showing the extent of the large iutergenic region

(LIR) and the main ORFs are indicated bv thick airows. See text for details on gene

names.

them through the construction of mutants and theii analysis in infected and in trans¬

genic plants (sec Fig. [1.1]). The position of the ORFs relative to tue LIR. as well

as the polyadenvlation signals located on the opposite side of the genome (Buck,

1994), suggest that transcription occuis bidireetionally from the LIR (Townsendet al., 1985), The DNA A contains genes leqmred for encapsidation (CP or AVE

the coat protein gene), for viral replication (Rep or ACl, the replication associated

protein gene) and two regulator proteins (TrAP oi AC2, a replication transactiva tor

protein and REn or AC3, a replication enhancer protein), required for gene reg¬

ulation and for efficient replication (Townsend et ab, 1985; Etessami et ab, 1991;

Morris et, ab, 1991). The DNA B contains 1aa*o genes required for systemic movement

in the host plant (MPB or BCl. responsible for cell-to-cell movement and NSP or

BV1, a nuclear shuttle protein) and is probably responsible for symptom production

(Morris et ab. 1991; von Arnim et ab, 1993; Haley et ab, 1995; Sanclerfoot et ab,

1996; Ward et ab, 1997). A corresponding protein for AV2 has been reported in

tomato leaf curl virus but not foi ACMV (Padidam et ab, 1996). This ORF is only-

present in Old World begomoviruses (Hamilton et al., 1984). A major anel a minor

transcription start site have been mapped upstream of the coat protein and only

transcription from the major transcription start site would allow translation of the

AV2 protein (Davies et ab. 1987). Synthesis of AV2 would require ribosomes to

initiate on a very short leader of about 8 nucleotides, which might be expected to

result in a rather Ioav level of expression (Kozak, 1983). On the other hand, the coat

protein transcript, from the major transcription start site has a 160 bp untranslated

CHAPTER 1. GENERAL INTRODUCTION b

leader, containing four AUG triplets. tAvo in phase Avith the AV2 ORF and tAvo in

phase with termination codons upstream of the coat piotein (Stanley, 1985). Of

these only the coat protein initiation codon shows the preferred A at position -3

(Kozak, 1984), which mav be important, in its selective recognition (Davies et ab,

1987). So far little is known about the regulation of CP expression using the full

length promoter,

1.3.2 Viral replication

Geminivirus DNA has been shown to leplicatc through a circular double-stranded

(ds) DNA intermediate (Ikegami et ab. 1981) via a rolling-circle mechanism (La-

zarowitz, 1992). Apart boni a single viral-encoded protein, Rep, which is required

for DNA A replication in eis and for DNA B leplication in trans, replication re¬

lics entirely on the enzymes of the host plant. Knowm DNA polymerases have no

homology with the Rep protein, but Rep mav be related to proteins responsible

for DNA replication initiation of ss DNA plasmids (Ilyina and Koonin. 1992). The

rolling-circle replication is initiated by the Rep protein, which serves as the origin

recognition protein and as a site-specific endonuclease (Laufs et ab, 1995b; Orozco

and tlanley-Boweloin. 1996). The origin of replication has been mapped to the

conserved nonamer motif (TAATATT4-AC) Avitfiin the LIR (Hcyraud et ab, 1993),

the stem-loop structure of AAdiich is essential for replication as the Rep protein can

only nick ss DNA (Fontes et ab, 1994). Affei nicking, the polymerization of viral

strand DNA docs not only require Rep protein, but also host DNA polymerases,

that normally arc only active during S-phase of the cell cycle. As geminiviruses

infect differentiated cells, they have to re-activate cells to enter cell cycle. Con¬

sidering that the Rep protein possesses an ATP binding and hydrolyzing activity

and that Rep proteins of a wheat ebvaif geminivirus have been shown to form sta¬

ble complexes with proteins of the retinoblastoma family, it, can be speculated that

geminiviruses can modulate plant cell cycle (Laufs et ab. 1995a; Collin et ab, 1996).

Once a full-length copy of the viral DNA has been produced, it is cut anel ligated

to circular ss DNA. This new ss DNA can act as a template for further replication,

after complementary-sense DNA synthesis, or can be encapsidated and transportée!

out of the cell.

1.3.3 Gene regulation

During the viral infection cvcle. different gene products will be required at different

time points and in elifierent quantities. Viral RNAs aie polvadcnvlated and initiate

CilAPTER 1. GENERAL INTRODUCTION 6

downstream of TATA box motifs or initiator elements, which indicates that they

are transcribed by host RNA polymerase TL The regulation of transcription relies

on viral proteins as well as on host factors (Sunter and Bisaro, 1997).The replication-associated protein is not, onlv responsible for replication, the

N-tcrminus also acts as a primary regulator of its OAvn promoter. It, can reduce

complementary-sense transcription (Halev et ab. 1992; Hong and Stanley, 1995)

by binding between the TATA-box anel the transcription start site of its own gene

(Sunter et ab, 1993: Eagle and llanlev-BoAvdom, 1997: Gladfelter et ab, 1997). Re¬

duced c-sense transcription from the DNA B was observed for ACMV (Haley et ab,

1992), but not for tomato golden mosaic virus (TGMV), even though DNA A and B

promoters are similar also in TGMV. A possible explanation for this discrepancy is

the presence of a downstream transcription start site in the TGMV DNA B, which

allows the MPB gene to escape repression (Suntei et ab, 1993).TrAP is a nuclear protein (Sanderfoot and LazaroAvitz, 1995) that transactivatcs

virion-sense gene expression in the Begomovirus group (Sunter and Bisaro, 1991; Ha¬

ley et ab, 1992) at the level of tianscription (Sunter and Bisaro, 1992). In transgenic

plants containing AV promotcr-GUS fusions it could be shown, that TGMV TrAP

regulates expression through two different mechanisms: activating the promoter in

mesophyll cells and derepressing the piomotcr in phloem tissues (Sunter and Bisaro,

1997). Also TrAP of ACMV can enhance expression of transgenes under the control

of an AV promoter in transgenic plants (Hong et ab. 1996). Therefore, TrAP is able

to interact with a viral promoter integrated in the plant genome and might also

transactivate host genes during the infection caxIc. Little is known about the actual

mechanism of activation by TrAP, although it was demonstrated that it strongly

prefers binding ss DNA over ds DNA (Noris et ab, L996) and that both activities

are sequence independent. Further analysis of TrAP revealed a basic N-terminus,

an acidic C-terminus and a potential zinc-fingei motif. AAdiich might mediate DNA

binding (Sunter and Bisaro, 1992). The lack of sequence specificity is inconsistent

with TrAP's ability to specifically activate v-sense transcription. It has been spec¬

ulated that specific DNA binding requires post-tiauslational modifications or that

TrAP interacts with other proteins of the basal transcription apparatus to activate

RNA synthesis (Liu and Green, 1994: Noris et ab, 1996; Hanley-Bowdoin et ab,

1999). Also REn transactivatcs virion sense expiession at the level of transcription,

but, the effect is less pronounceel (Halev et ab. 1992). The mode of action here is

not known.

CHAPTER 1. GENERAL INTRODUCTION 7

1.4 Strategies for engineering virus resistance

Virus infections in plants can be controlled and suppressed through genes occurring

naturally within the plant or the virus. Advances in genetic engineering have led

to the development of different strategies to combat virus infections by manipulat¬

ing these natural processes and engineering a 'pathogen derived resistance1 (PDR)

(Sanford and Johnson. 1985). The idea originated from the observation of cross-

protection: a plant inoculated with one strain mav become resistant to a second

infection by a related strain of the same virus. This Avas used as a strategy of biolog¬

ical control, in spite of the risk of Afield losses due to the mild infection or of a severe

disease produced by the interaction between the mild strain and another virus. As a

result of these observations various stiatcgies based on PDR Avere developed. Genes

that confer viral PDR include those for coat pi olefins (Powell et ab, 1986). replicases

(Carr and Zaitlin, 1993). movement proteins (Beck et ab, 1994; üuan et ab, 1997)and for different untranslated nucleic acids (Hcmenway et ab, L988; Stanley, 1990:

Stanley et ab, 1990; Frisedimuth anel Stanley. 1991: Yepes et ab, 1996; Beachy, 1997:

Bendahmanc and Groenborn. 1997). Usually thes^ strategies arc more successful

for RNA viruses than for DNA viruses. More recently, new strategics, Avhich aie

not directly pathogen relateeb have been developed, using ribozymes or ribosome

inactivating proteins (Lodge et ab. 1993: Hong et ab, 1996; Hong et ab, 1997; Yang

et ab, 1997).

The first PDR was reported in the form of a coat protcin-meeliated resistance

(PoAA'ell et ab, 1986) that protects the plant from virus infection without the risk

of yield reduction. Since then there have been a number of examples of engineered

resistance in a variety of crops like tomato, potato, cucumber, rice and against,

viruses of different families (Beachy et ab. 1990: Fitchen and Beachy, 1993). Different

mechanisms may lead to coat, protein-mediated resistance, but usually the coat

protein prevents the disassembly of the viral capsid, an early event of the viral

infection (Beachy, 1997). This mechanism is supported by the fact that mostlv

coat protein-mediated resistance can be overcome by the inoculation of plants with

naked RNA (Powell et ab. 1986). Most, publications rcpoit effective resistance to

RNA viruses, Avhilc coat, protein-mediated resistance against DNA viruses is still

rare (Kunik et ab, 1994: Smistcrra et al.. 1999).

Sequences of complete or partial viral replicase proteins can confer a high level

of resistance to the virus. Rcplicasc-mediatcd resistance was first described against

tobacco mosaic virus (TMY) in transgenic plants expiessing a fragment of the repli¬

case. Although no protein fragment could be detected, plants Avere resistant. In

this case, the active molecule seems to be the produced mRNA (Carr and Zaitlin,

CHAPTER 1. GENERAL INTRODUCTION 8

1993). A similar approach provided resistance against a, tomato yelloAv leaf cuil

virus (TYLCV), which is a DNA geminivirus (Bendahmane and Grocnborn. 1997).The mechanism involved in replicasc-meeliated resistance has not been elucidated,

but it is speculated, that the expressed fragment interferes with viral replication. In

contrast to coat protein-mediated virus resistance, resistance can not be overcome

by inoculation with naked RNA. since the resistance is at the level of replication and

not at the level of uncoating. The replieasc-niediated resistance is quite specific.

Movement proteins enable viruses to move from cell to cell or spread SArstemically

in the plant by interacting with the cytoskcleton or plasmodesmata (Koonin et ab,

1991; Heinlein et ab, 1996: Sanderfoot and LazaroAvitz, 1996). Both in the case of

DNA and RNA viruses, mutated movement pioteins (expressed in plants can confer

variable levels of resistance against different related viruses (Beck et ah, 1994; Duan

et ab, 1997).

A variety of PDR stiatcgies are based on the expression of nucleic acids which

do not encode proteins. One of these approaches is the expression of antisense RNA

to reduce the replication of RNA and e\-en DNA AÙruses. Virus resistance in trans¬

genic model plants ranges from very Ioav to almost total inhibition of viral infection

(Hemenway et ab, 1988: Yepes et ab, 1996: Bendahmane anel Groenborn. 1997).Resistance can be clue to different mechanisms, cither to formation and subsequent

degradation of double-stranded RNA. to direct reduction of virus replication or gene

expression by high levels of antisense RNA or to gene silencing (Beachy, 1997). An¬

other approach is the use of defective interfering (DI) DNA (Stanley, 1990; Stanley

et ab. 1990; Frischmuth and Stanley. 1991: Fnschmuth et ab, 1997a). DI DNAs

can be found in plants during natural viral infection. They are partial genomes of

the virus which can redirect, replication from the viral genomes, thereby decreas¬

ing amounts of replicated viral DNA and at the same time reducing spread and

symptoms of the virus in the plants.

Other possible strategies for engineering viius resistance in plants include ribo-

zyme-mediated resistance (Yang et ab. 1997), where small RNA molecules with a

catalytic activity can specifically cleave viral RNA. Another kind of resistance is

conferred by an RNA satellite (Harrison et ab. 1987). RNA satellites do not have

any homology to the virus but thev arc replicated and encapsidated with the helpof the virus. Furthermore, the use of ribosome inactivating proteins (RIPs) has

shown to be a successful way of engineering virus resistance in plants (Lodge et ab,

1993; Hong et ab. 1996: Hong et ab. 1997). RIPs are naturally occurring plant

proteins, which have antiviral activity against a broad spectrum of plant viruses.

They catalyze the depurination of a specific adenine residue of the cucarvotic large

CHAPTER 1. GENERAL INTRODUCTION 9

subunit, ribosomal RNA, thereby blocking translation (Taylor et ab, 1994). The

activation of RIP expression during pathogen attack and release of RIPs into the

cytosol is speculated to lead to local cell death, which prevents replication anel spread

of the virus (Bonness et ab. 1994).

Engineering ACMV resistance would complement efforts in traditional breeding

and could provide a sustainable solution securing cassava yields. There arc indi¬

cations from the model plant Nicotiana bentharmana that, genetic engineering of

ACMV resistance is feasible. A number of transgenic model plants with a variable

increase in ACMV resistance have been lcported: Constitutive expression of de¬

fective viral DNA (Stanley and lAnvnsend. 19S5; Stanley et ah, 1990), of antisense

Rep gene (Day et ab, 1991). of defective Rep piotein (Hong and StanleA-, 1996), of

defective movement proteins (von Arnim and Stanley, 1992; Duan et ab, 1997). of

coat protein (Kunik et ab, 1994) and the virus-induced expression of dianthin in

stably transformed plants (Hong et ab. 1996). This suggests that resistant cassava

cultivars using analogous strategies could be obtained in the near future.

1.5 Plant genetic engineering

In order to apply biotechnology in plants, a regeneration system with a compati¬

ble transformation system that alloAvs regeneration of transgenic plants is required.

Plant cells are considered to be totipotent, and thus able to regenerate whole plants

from a single cell. This ability is, hoAATA"er. often limited to certain tissues anel devel¬

opmental stages. Further, an efficient transformation svstem, compatible with the

regeneration system, and a system for identifying and selecting transformed cells are

necessary.

1.5.1 Regeneration

Different regeneration systems have been reported for cassava using a variety of

starting materials (Roca. 1984: Puonti-Kaerlas. 1998). One of the earliest reports is

of a meristcm culture (Kartha, 1974) that can be used to obtain planting material

free of viruses and diseases (Kartha anel Gamborg. 1975). Now meristems can also

be used to multiply improved cassava varieties by inducing multiple shoot formation

on cytokinin-containing medium (Roca. 1984: Konan et ab. 1994). The most reliable

de novo regeneration system for cassava has been through somatic embryogenesis

and cyclic somatic embivogenesis (Stamp and Henshaw, 1982; Stamp and Henshaw,

1987a; Stamp anel Henshaw. 1987b) using different auxin-containing media to induce

primary embryogenesis in various cultivars. Maturing somatic embryos can produce

CHAPTER 1. GENERAL INTRODUCTION 10

friable embryogénie callus that can be used to establish suspension cultures (Tayloret ab, 1996). Alternatively, somatic embrvos can be germinated and the developing

cotyledons can be used for direct induction of shoot primorclia (Li et al., 1998).

1.5.2 Transformation

Gene transfer to plant cells can be obtained bv two different systems: direct gene

transfer or Agrobacterium-modràtcd gene transfei. The first plants expressing for¬

eign genes were tobacco plants transfoimed with Aqrobactcrium tumcfaciens (Baiton

et ab, 1983; Horsch et ab, 1985: DeBlock et ab, 1987). Aqrobactcrium has the unique

ability of transferring genes to eucarvotes in nature. This has been taken advan¬

tage of in genetic engineering bv using modified Aqrobactcrium, vectors to transfer

genes of interest to plant cells. Direct gene transfer methods, such as microin¬

jection, PEG treatment, calcium-phosphate precipitation or electroporafion mostly

need specific protocols to regenerate fertile plants from protoplasts (PaszkoAvskiet ab, 1984; Paszkowski et ab, 1986: Potrvkus. L991). Direct gene transfer through

bombarding small DNA coated paitides to intact cells can be used to transform

organized tissues (Klein et ab, 19S8). Under optimum conditions particles can pen¬

etrate the cell Avail and release the DNA for expiession and/or integration in the

plant genome. J. Finer et ab developed the svstem fmthcr and constructed the

Particle InfloAv Gun (PIG: (Finer et ab. 1992)). which is inexpensive anel simple

to use. Microtargeting can be particularly used to target a small, precise area of

organized tissue (Sautter et ab, 1991).As stable transformation frequencies are Ioav, different marker genes to identify

and select stably transformed cells are necessary. Usually an antibiotic resistance

gene is introduced to select for transformed cells. alloAving the cells containing the

transgenc to survive and proliferate. In some species (e.g. Dendrobivm) selection

with antibiotics mav not be possible, in this case a visual marker mav be used (Chia

et ab, 1994). ß-glucuronidase (GUS) (Jefferson. 1987), luciferasc (Ow et ab, 1986;

Mayeihofcr et ab, 1995) or green fluorescent piotein (GFP) (Sheen et ab, 1995)

may also be used to monitor transient transformation and to partially optimize

transformation conditions. While GUS assays aie lethal, both lucifcrase and GFP

expression can be studied in living material.

1.5.3 Cassava transformation and regeneration

Cassava regeneration and transient transformation have been reported using many

different, methods and taiget materials, but until recently no compatible systems

CHAPTER 1. GENERAL INTRODUCTION U

had been reported. Now first transgenic cassava plants have been produced using

different methods for regeneration and transformation (Li et ab, L996; Schöpkc

et ab, 1996; Gonzalez et ab, 1998). One svstem makes use of friable embryogénie

callus as starting material. Hie neAV cmbrvogenic units appear to be of single cell

origin, which makes them a good target for transformation (Taylor et ab, 1996).After transformation of embryogénie suspensions, transgenic plants of cassava could

be regenerated by selection for resistance to paromomycin (Gonzalez et ab, 1998)or using the visual selection system AArith firefly lucifciase (Raemakers et ab. 1996).The other system uses cotvledon expiants as stalling material and regenerates shoots

via organogenesis. Since shoots regcneiated via organogenesis develop mostly from

the cells close to the cut edges of the cotyledons, it makes this system ideal for

Agrobacterium-mcdxated transformation. Transgenic cassava shoots can then be

regenerated using hygromvein as a seleetiw agent (Li et ab. 1996). The advantage

of this system is the short amount of time neccssaiv in in vitro culture, which reduces

the risk of soma clonal variation.

1.6 Luciferase reporter genes

Reporter genes arc rourinelv used for transient studies of promoter regulation and

gene expression (Oav et ab, 1987: Maitin et ab. 1992; Arias-Garzon and Sayrc, 1993;

Freeman et ab, 1994; Srikantha et ab, 1996; Needham et ab, 1998). Studies of

gene and promoter regulation in ACMV Avere performed using the GUS reporter

gene svstem (Zhan et ab, 1991: Halev et ab, 1992). but since then new, improved,

reporter systems have been established. One commonly used is the firefly lucifcrase

gene and since recently this can be combined with a Rcnilla lucifcrase to measure

two different reactions in a single extract.

Firefly luciferase of the common Noith American firefly Photmus pymhs is the

most commonly used of the bioluminescent reporters (Oav et ab. 1986; de Wet, et ab,

1987). The luciferase is a monomelic enzvme of 61 kDa, which catalyzes a two-

stcp oxidation reaction emitting light in the vellow to green region (550-570 nm).

ALP, oxygen and luciferin are required as substrates. In order to generate a stable

luminescence signal, instead of an initial burst of light, coenzyme A is incorporated

in the assay solution to yield maximal luminescence intensity that slowly decays

over several minutes. None of these compounds aie toxic for plant cells and assavs

can be performed in vivo. Firefly luciferase assavs aie verv sensitive, allowing the

quantification of less than JO-20 moles of enzvme (Technical manual. Promega).Rcnilla lucifcrase, of the soft coral Renilla remformis, is a monomeric enzyme of

CHAPTER L GENERAL INTRODUCTION 12

31 kDa that catalyzes the oxidation of coelenterazine to yield coelentcramide and

blue light of 480 nm (Matthcnvs et ab, 1977; Maverhofer et ab, 1995). A limitation

of the Renilla luciferase is the presence of a Ioav level of nonenzymatic luminescence,

which reduces assay sensitivity bv about L0-fold compared with the firefly luciferase

assay.

With the Dual-Luciferase1" reporter assav it is possible to measure both lu-

ciferases individually within a single svstem. Since the firefly and the Rcnilla lu-

ciferascs are of distinct evolutionary origins and therefore have different enzyme

structures and different substrates, it is possible to discriminate between the two

reactions. The luminescence of the fiicflv lucifcrase can be quenched Avhile at the

same time the Rcnilla luciferase is actbvated bv its substrate. With these two genes,

it is now possible to measure the activity of two different promoters in a single rapid

assay with high sensitivity.

1.7 Aim of this thesis

African cassava mosaic virus disease is a major tin eat to African cassava production

despite efforts in traditional cassava breeding and genetic engineering of vims resis¬

tance in tobacco model plants. Engineering ACMV resistance is of high priority in

the genetic improvement of cassava. This will contribute to food security and sus¬

tainable agriculture in Africa and at the same time provide important, information

on both host-pathogen relationships and on virus piomoter regulation, ddic aim

of this thesis was to assess and develop ucav techniques and strategies to produce

ACMV resistant cassava.

The properties of regulation of the ACMV promoter make it possible to mimic

a hypersensitive reaction bv using a finely tuned toxin/anti-toxin system. The two

genes chosen for our system are the Bacillus amylohquefaciens barnase and its spe¬

cific inhibitor the barstar.

Tobacco Avas selected as a model plant because of the ease of its transformation

(as compared to cassava) and because it has been aheadv used in other ACMV

resistance strategies to studv ACMV promoter regulation in transiently and stably

transformed plants. For promoter regulation studies, the Dual-LuciferaselH reporter

assay was used, in order to measure the activity of Iavo different genes (v- anel c-sense

expression of the ACMV promoter) in a single rapid assay A transient assay system

using transformed cassava protoplasts Avas developed to test promoter regulation,not just in a model plant, but also in the nattual host of the virus. After the

promising results of the transient studies. ACMV-promofei -barnase constructs were

CHAPTER 1. GENERAL INTRODUCTION 13

transformed into tobacco to assess virus resistance. Transgenic plants were tested

using a replication assay to sIioav reduced viral replication in the transgenic plants

as compared to wildtype plants.

With the recently developed cassava transformation system, ACMV resistant

cassava can be produced. The transferability and adaptability of the current cassava

transformation and regeneiation Avere assessed for an African cultivar using the

tested ACVIV-promoter-barnase constructs. As cassava is grown as many local

cultivars it is crucial to adapt transformation to as many cultivars as possible in

order to engineer ACMV resistance in local varieties of cassava.

Chapter 2

A ^~i T\ TT T ~W~\ À Al®

ACMV Promoter Analysis

2.1 Abstract

African Cassava Mosaic Virus (ACMV) DNA A and DNA B promoters

were cloned together with the firefly luciferase and the Renilla luciferase

to study the regulation of viral genes. The relative activity of both sHes

of each promoter was tested in tobacco and cassava protoplasts and for

the DNA A promoter also in transgenic tobacco plants. Regulation of

the promoters was assessed by cotransforming individual ACMV open

reading frames (ORFs) or the complete DNA A with the luciferase con¬

structs. The transactivator protein (TrAP) activates coat protein (CP)and nuclear shuttle protein (NSP) gene expression in both cassava and

tobacco protoplasts, but not in transgenic tobacco plants, while DNA A

does activate CP expression also in transgenic plants. At the same time

DNA A reduces the expression of the replication-associated protein (Rep)but activates the expression of the movement protein (AIPB) in tobacco

and relatively more so in cassava. These results indicate that by using

this promoter, a new virus resistance strategy mimicking a hypersensitive

reaction could be designed.

2.2 Introduction

African cassava mosaic virus (ACMV) is a member of the Geminiviridae, a diverse

family of plant infectious agents characterized bv their circular single-stranded DNA

(ssDNA) cncapsidated in double icosahcdral paitides (Jlanlcy-BoAvdoin ct, ah, 1999;

LazaroAvitz, 1992; Stanley. L9S5). It, belongs to the Begomoviruses, which comprise

viruses transmitted bv Avhitefly having a mono- 01 bipartite genome (DNA A and

L4

CHAPTER 2. ACMV PROMOTER JiNALYSIS 15

Figure 2.1: Genome map of ACMV DNA A and DNA B. The DNA is represented

by a thin line with the two arrowheads showing the extent of the large intergcnic region

(LIR) and the main viral ORFs arc indicated by thick arrows. See text, for details on gene

names.

DNA B). ACMV replicates in the nuclei of host cells through double stranded DNA

intermediates via a rolling circle mechanism and it recruits most proteins of the

replication machinery from its hosts. The coat protein and all viral functions re¬

quired for replication arc encoded on the DNA A: CP. the coat protein (ToAvnscndet ab, 1985): Rep, the replication-associated protein (Etessami et ab, 1991), TrAP

(transactivator protein) and REn (replication enhancer protein), regulator proteins

(Halev et ab, 1992; Etessami et ab. 1991). DNA A. therefore, is capable of au¬

tonomous replication and encapsidation but is unable to infect, plants systemically

(Townsend et ab, 1986). NSP (nuclear shuttle piotein) and MPB (moving protein),the two genes positioned on DNA B. provide functions for virus movement (vonArnim et ab, 1993; Haley et ab, 1995). Both genomic components, DNA A and B,

arc required for infectivity (Stanley, 1983).

The arrangement of the open reading fiâmes (ORFs) of the DNA A and B (Fig.

[2.1]) shows that, they aie expressed in a bidiiectional maimer (Townsend et ab,

1985). The ORFs on both DNA A and B aie arranged similarly with divergent

transcription units separated by a large infeigenie legion that is highly conserved

between the tAA'o DNAs (Stanley and Gav. 1983). This segment also contains a

~30 nt sequence Avith the potential to foim a stem-loop structure that is conserved

among bipartite geminiviruses and has been associated with the start of rolling circle

replication (Lazarovritz. 1992). Fragments of DNA A (nucleotides 2759 to 282) and

DNA B (nucleotides 2705 to 5S1) have been shoAvn to act as inducible promoters

with relatively Ioav basal activity (further on referred to as AC and AV promoter for

CHAPTER 2. ACMV PROMOTER ANALYSIS 16

the DNA A in c- and v-sensc and BC and BV promoter for the DNA B promoters in

c- and v-sense) (Zhan et ab. 1991: Halev et ab. 1992). Studies of promoter regulation

have shown that, the AV, the BV and the BC promoters can be activated by TrAP

while the AC promoter is repressed bv its own gene product (Haley et, ab, 1992;

Hong and Stanley, 1995; Sunter and Bisaro. 1997). Both activation and repression

occur at the level of transcription (Sunter and Bisaro. 1992; Sunter et ab, 1993). Rep

is known to bind between the TATA-box and the transcription start site, thereby

probably hindering its own transcription by interfering Avith the RNA polymerase

(Haley et ab, 1992; Sunter et ab, 1993; Hong and Stanley, 1995). Up to elate there

is little information available on the molecular mechanisms responsible for promoter

activation by TrAP (Halev et ab. 1992; Suntei and Bisaro. 1997).

All published data on promoter regulation has been obtained from transient

expression experiments using only the u/clA (GUS) reporter gene (Jefferson et, ab,

1987). This has the disadvantage that only one promoter could be studied in each

experiment. The use of the firefly and the Rcnilla luciferase now permit the discrim¬

ination between the two reactions in a single extract and thereby make if possible to

measure t/wo different promoter acthaties in one experiment (Hannah et ab, 1998).This is due to the fact that the firefly and the Rcnilla lucifcrases are of distinct

ewjlutionary origins and therefore have differ en t enzvme structures and different

substrates. Moreover, both luciferases can be detected at Ioav levels in a fast and

simple assay.

Here we report the analysis of the activities of the ACMV promoters by quan¬

tifying transient expression of the firefly and Rcnilla lucifcrase reporter genes using

the Dual-Luciferase repoiter assay foi the first time in plant cells. We examined

the expression from both sides of the ACMV DNA A and DNA B promoters and the

regulation of these promoters by Rep and TiVP and the complete DNA A, simulat¬

ing a viral infection. To studv viral promotei activity in planta, transgenic plants

containing the luciferase constructs aatic infected Avith a geminivirus and analyzed.

The characteristics of the regulation of the bidirectional ACMV promoter indicate

that it might be a useful tool for the creation of a virus resistance strategy mimicking

hypersensitivity.

CHAPTER 2. ACMV PROMOTER ANALYSIS 17

2.3 Materials and methods

2.3.1 Plant material

Cassava (Manihot esculenta Crantz) Avas maintained as embryogénie suspension cul¬

tures. These Avere established from friable embryogénie calti of cultivar TMS 60444.

The suspensions were groAvn axcnicallv in 25 ml of modified liquid SH medium

(Schenk and Hildebrandt. 1972: Taylor et ab. 1996). at 30°C under continuous Ioav

light in a growth chamber (Infors Incnbatoi LIL04) on a rotary shaker (90 rpm). All

suspensions were subculturcd once a week.

Tobacco, Nicotian a tabacum L, cv. Petit Havanna Str-rl (SRI; (Maliga et ab,

1973)), was maintained as axenic shoot cultures. These were grown in vitro at 26DC

with a 16/8 h photoperiod on half-strength MS medium without growth regula¬

tors (Murashige and Skoog. 1962). SRI tobacco seedlings used for Agrobactervum-

mediated transformation were grown axcnicallv on filter paper wetted with sterile

water.

2.3.2 Bacterial strains

E. coli strain XLl-Blue was purchased from Stratagcnc (La Jolla, CA, USA). A.

turnefaciens strain GV3101, containing helper plasmid pGV2260 (Deblaere et ab,

1985) was kindly provided bv B. Tinland. Zürich.

2.3.3 Construction of plasmids

The plasmid pACMVA is a partial repeat (l.Smer) of DNA A (West Kenyan isolate

844 (Stanley and Gay, 1983)) in pBS KS- (Stratagcnc). The plasmid pACMVB is

a tandem repeat of DNA B (West Kenyan isolate 844 (Stanley anel Gay, 1983)) in

pAT153. The cloning of pACMVA and pACMVB has been described (Klinkenberget ab. 1989). Both plasmids were kindly provided by T. Fiischmuth, Stuttgart. The

ACMV ORFs Rep anel TiAP constructs (Halev et al.. 1992) were kindly provided

by B. Morris, Ncav Zealand.

All DNA manipulations were performed according to standard procedures (Ma-niatis et ab, 1982). Nucleotide numbering of the ACMV genome refcis to p.IS092

and p.JS094 (Stanley and Davies, 19S5). DNA A. DNA B and names of the open

reading frames arc according to suggested nomenclature (Davies and Stanley, 1989).In case the gene function is knoAvn. the name of the gene product is indicated, lire

bidirectional ACMV promoteis Avere produced bv PCR amplification of ACMV DNA

using primers ACMVc (GGAA -2755- GCTTTTTGACCAAGTCAATTGG -2776)

CHAPTER 2. ACMV PROMOTER ANALYSIS 18

and ACMVs (300-GTGGTACCCACTATTGCGCACTAGC -267) for the short ver¬

sion of the DNA A promoter, primers ACMVe and ACMVl (GGGGTACC -440-

AGCCCTGATAACTGAG -425) for the longei DNA A promoter. The DNA B

promoter (Zhan et ab, 1991) was amplified with primers ACMVBL (ATCCCGT-581- CAATGTATATACTTCC -564) and ACMVBR (GTTAGGCCATGG -2265-

TTCAACACTTTGAGTA1AAGC -2286). All versions of pACMV were obtained

by introducing the ACMV piomoters as Kpnl/Munl fragments in between the tAvo

tobacco scaffold attachment regions (SAR: (BiCA-ne et ab, 1992)) in the backbone of

pGluChi (Bliffeld et ab, 1999). The fireflv lucifeiase ((Ow et ab, 1986): kindly pro¬

vided by G. Ncuhaus-Urb Basel) together Avith a nos terminator was introduced as

an Ncol/Xbal fragment under the control of the AC or the BC promoter, Avhilc the

Rcnilla luciferase from pPCV702 (MaA-erhofer et ab. 1995) AAras introduced together

with a nos terminator as a blunt-ended iimdlll fragment under the control of the

AV or BV promoter.

A short and a longer version of the DNA A promoter were cloned. The shoit

version of the promoter ends at the major transcription start, site of the coat protein

while the longer version also includes the minor transcription start site of the coat

protein. Transcription from the majoi transcription start, site of the longer version

gives rise to a 160 nt-long leader fiagment upstieam of the Renilla luciferase gene.

The plasmids were called pACMVs. pACMVleadcr and pACMVB depending on the

inserted promoter (see also Fig. [2.2] and Fig. [2.3]). Each of the ACMV promoter

constructs created bv PCR amplification AA-as sequenced to ensure that no mutations

had been introduced. As positive conti ois both the Rcnilla and firefly luciferase

were separately cloned under the control of a truncated 35S promoter and a 35S

terminator ((Odell et ab. 1985); kindly provided bv S. Brunner, Zürich) rendering

plasmids pLucpos and pRcnpos. To reduce the luciferase expression, thereby making

measurement more convenient, the truncated 35S piomoter consisted of nucleotides

1 to 93 only.

In order to transform plants with Agrobactcniim. the luciferase construct con¬

taining the short, DNA A promoter was introduced into pNCl as a complete I-Scel-

fragnicnt. pNCL is a pCambiabSOO backbone (Gambia, Australia) with a pMCSb

(MoBiTec, Germany) polvlinker containing an I-Seel site. This plasmid, pNCsh,

Avas then electroporateel (Mattanovich et ab. 1989) into GV3101 (pGV2260) result¬

ing in strain AgNCsir.

CHAPTER 2. ACMV PROMOTER ANALYSIS 19

SAR. ànos firefly lnc

'

~~f DNA A { rauliahic fjnns j—M-| JaJ [4—

ffhir jo'e

Figure 2.2: Schematic representation of luciferase expression cassette. Luciferase

expression cassette showing the position of the cloned ACMV promoter (the short or the

longer version of the DNA A piomotcr or the DNA B promoter) between the Renilla

and the firefly luciferase genes. Both luciferase genes carry a nos terminator. The whole

expression cassette is flanked by scaffold attachment regions (SAR). The bar underneath

the map marks the position of the ffluc probe used for Southern hybridization analysis.

2.3.4 Protoplast isolation and transformation

Tobacco mesophyll protoplasts

Mesophyll protoplasts Avere isolated fionr in vitro-giown tobacco plants. Leaves were

cut into 1 cm2 pieces and digested overnight in PCN1 (Golds et ab, 1993) contain¬

ing 1% Cellulase Onozuka RIO (Yakult Pharmaceuticals Ind. Co., Ltd., Japan),0.5% Maccrozyme RIO (Yakult Pharmaceuticals Inch Co., Ltd., Japan) and 1 drop

TweenSO (Nagy and Maliga, 1976). The protoplast suspension was filtered through

a 100 /im steel mesh sicA'c. After collecting the protoplasts by floating on PCN1

they Avere Avashed tAvice with W5 (Menczel et ab. 1981) and then incubated in the

dark at 4°C for 1-2 hours. Samples of 250,000 to 500,000 protoplasts Avere resus-

pended in transformation buffer (15 mM MgCL. 0.1% MES 0.5 M mannitol, pH 5.8)and transformed with 20 fig of DNA using PEG (Negrutiu et ab, 1987). FolloAving

transformation, protoplasts were incubated in PCN2 (Golds et ab, 1993) at RT in

the dark.

After 24 hours protoplasts Avere harvested bv centrifugal ion and resusponded in

100 fj\ passive lysis buffer for the Dual-Luciferase"' Reporter assay (Promega,Catalys AG, Switzerland). Extiacts aattc stored at -S0TJ for up to one month.

Cassava protoplasts from embryogénie suspension cultures

Approximately 1 g of LMS 60444 embryogénie suspension culture was digested in

the dark during 20 h at 2S°C on a shaken (30 rpm). The enzyme solution and

the washing solution have been described (Sofiaii et ab. 1998). The digest was

then filtered thiough a 50 //in mesh sicA^e and L0 ml washing solution Avere added

through the filter. The fihrate Avas distributed in sterile tissue culture tubes and

CHAPTER 2. ACMV PROMOTER ANALYSIS 20

centrifugée! at 70 g (30%) for 7 min in a Hettich table centrifuge (Universal II).due supernatant was remoATcl and the pelleted protoplasts Avere Avashed twice and

resuspended in 10 ml Avashing solution. The piotoplasts were counted, stored and

transformed as described for tobacco protoplasts, llic protoplasts were incubated

at RT in the dark in TM2G (Shahim 1985) for 24 hours prior to harvesting and

resuspending in passive Ivsis buffer.

2.3.5 Agrobacterium-med'mtcd seedling transformation of

tobacco

Tobacco seedlings groAvn for 8 daA-s Avere transfoimed by vacuum infiltration as

described (Rossi ct ah. 1993) using an overnight culture of AgNCslr grown in 2

ml YEB (Vervliet et ab, 1975) containing the appropriate antibiotics. The seedlings

were cocultivated for 3 clays on solid MS medium and then washed in 10 mM MgSO |.

They were then placed on MS medium containing 0.1 //g/ml cv-naphtalene acetic

acid, 1/ig/ml benzylamino purine. 25 /yg/ml Irvgiourvcin, 500 /;g/ml cefotaxime

and 500 /ig/ml vancomycin. Seedlings wcic transferred to fresh plates evcrv Aveck.

After 7-8 weeks, shoots could be collected fioni single calli and transferred to MS

medium Avithout selection. After multiplying each plant line, rooted plantlets could

be transferred to soil or be kept as in vitro cultures.

2.3.6 Dnal-Luciferase1M reporter assay

Protoplast or leaf disc extracts Avere thawed and cell debris was collected by cen-

trifugation. Aliquots of 50 fi\ of Lucifeiase Assay Rcagentll (Promcga, Catalys

AG, SAvitzerland) Avere pro-dispensed into luminometcr tubes before adding 10 ft\of extract and mixing well with a pipette. Measurements of 5 seconds each were

performed with a luminometcr (Luinat, LB 9507. EG L G Berthold, Switzerland)Avith dual injectors. After measuring the luciferase activity, in 'relative light units'

(RLU), Stop and Glo'v Reagent Avas delivered into the tube bv automatic injection.

Measurement of the Rcnilla luminescence Avas started after a tAvo second delay. For

each experiment, background luciferase activity from protoplasts transformed with

a vector Avithout luciferase genes Avas subtracted throughout,. Protein concentration,

estimated using a Bio-Rad protein assay (Bio-Rad Laboratories, LISA) as described

(Bradford. 1976). A\*as used to normalize each measurement. All resulting values

were standardized to the positive control consisting of protoplasts transformed with

pLucpos and pRcnpos.

CHAPTER 2. ACMV PROMOTER ANALYSIS 21

2.3.7 Southern blot analysis

Total DNA from transgenic and untransformed control tobacco Avas extracted us¬

ing the NucleonPhytopure kit (Amcrsham Life Science. England) as described by

the manufacturer. Aliquots of fO fig DNA were digested Avith Ncol, resulting in

a single cut in the T-DNA. After electrophoresis, DNA was transferred to a pos¬

itively charged nylon membrane (Amersham Pharmacia Biotech, UK) by blotting

overnight as described (Sambrook ct ah. 1989). After a short AArashing of the mem¬

brane, the DNA AATas covalentlv bound to the membrane by exposure to UM light

(UV Stratalinker 1800. Stiatagcne). The membrane AA-as prehybiidizecl Avith 10 ml

DIG Easy HybrM (Roche Molecular Biochemicals. Switzerland). After one hour the

prehybridization solution Avas replaced Avith fresh h}bridization solution including

20 ng DIG-labeled probe and hybridization took place at 42TJ o\*ernight. DIG-

labeling of a 330 bp fragment of the luciferase gene Avas performed according to the

PCR DIG Probe Synthesis Kit " standard protocol (Roche Molecular Biochemicals,

Switzerland). After removal of unspecific hybridization and incubation in blocking

buffer, the anti-DIG antibodies Avere added. Folkrwiug Avashing and equilibration,

the DNA side of the membrane was ovorhrved Avith substrate solution (CDPstarTii,Roche Molecular Biochemicals. Switzerland). The damp membrane Avas scaled in

a plastic bag. fixed in a film cassette and exposed to X-ray film (BIOMAX MR"',

Kodak, Rochester NY, LTSA) for 1 hour at 37°C. The film Avas developed with a

developing machine (AGFA. Cuiix 60).

2.3.8 Virus infection of transgenic plants and assay of viral

DNA replication

Transgenic plants Avere groAvn in soil in a controlled growth chamber and inoculated

with A. tumcjaciens containing the viral DNA of ACMV or of Sida Goklen Mosaic

Virus (SiGMV, Colombian isolate) as described (Stanley et ab. 1990). All A. tumc¬

jaciens strains were kindly provided bv T. Frischmnlh. Stuttgart, and have been

described (Stanley et ab, 1990: Fnschmuth et ab. 1997b). Samples of leaves of three

different ages (leaf 1, leaf 3 or 4 and leaf 5 or 6: numbered from bottom to top) Avere

collected 24 days after infection. Luciferase extracts of infected and non infected

IcaA^es Avere measured.

CHAPTER 2. ACMV PROMOTER ANALYSIS 22

2.4 Results

2.4.1 Expression of firefly and Renilla luciferase genes un¬

der the control of ACMV promoters

The ACMV DNA A and DNA B promoters were cloned between two different lu¬

ciferase genes. This allowed the study of the actn-ation/doAvn-regulation of both

sides of the bidirectional promoteis in a single experiment. The firefly luciferase

gene was cloned under the contiol of the AC promotei (c-sense expression). Avhich

in the DNA A is the piomoter of the replication associated protein and in the DNA

B the promoter of the protein responsible for long distance movement. The Renilla

lucifcrase Avas cloned under the control of the VI promoter (v-sense expression),

which in DNA A is the promoter of the coat protein and in the DNA B the pro¬

moter of the nuclear shuttle piotein. For the DNA A promoter the Renilla lucifcrase

gene was cloned under the contiol of Iavo diffident versions of the VI promoter: a

short version, Avhich includes onlv the major tianseiiption start site at genome po¬

sition 278 (construct pACMYs). and a longer vcision (construct pACMVleadcr; sec

Fig.[2.3]), which enables tianseiiption from the major and the minor transcription

start, site (genome position 378; (Davies et al., 1987)). Transcription from the ma-

joi transcription start site of pACMVleadcr icsults in an RNA containing a L60

nt teacler sequence upsticam of the Renilla luciferase ORF, AAhich in this construct

replaces the ACMV coat protein ORF. In this leader two AUGs (at, 286 anel 305)are upstream of the initiation codon of the coat protein gene at nucleotide 446.

These additional AUGs are in frame Avith a small ORF V2. beginning 8 nucleotides

downstream of the major transcription start site and overlapping the ORF of the

coat protein, The existence of the ORF Y2 encoded protein for ACMV has not been

reported to elate, but a coiresponding protein for AY2 has been reported in tomato

leaf curl virus (Padidam et ab. 1996).

In different experiments \-atiable background levels for firefly luciferase (100 -

1000 RLUs) and Rcnilla luciferase (1500 - 30000 RLUs) were observed. Within

one experiment, these background lewels were quite constant and expression levels

Avere regarded as significant onlv when thev Avere at least, 3 times above this back¬

ground. Background levels Avere substracted from all values before standardization

against total protein content. The basal le\-els of the fireflv luciferase from pACMVs

and pACMVleadcr Avere around S000 RLUs. The Renilla luciferase from pACMVs

gave rise to values of about 50000 RLUs. while the activity bom pACMVleadcr was

higher, about 145000 RLUs. The fiieflv lucifeiase activity of pACMVB was com¬

parable to that from pACMYs. but the Renilla luciferase activity Avas on average

CHAPTER 2. ACMV PROMOTER ANALYSIS 23

ACMV DNA A

Rep

*-i rV_

pACMVleader

- SAR - nos firefh lue

*n r^iD\\ \ renilla lue nos - SAR

pACMYs

- SAR - nos firefh lue

i—"

DNA A ' renilla lue 'nos— SAR —

ACMV DNA B

MPB DN VB NSP

pACMVB

SAR - nos fircflv lue DN-VB renilla lue nos - SAR

Figure 2.3: Constructs used for ACMV promoter studios in comparison with

original ACMV DNA. Luciferase expression cassettes compared with ACMV DNA,

showing the position of the cloned ACMV promoter (the short or the longer version of the

DNA A promoter or the DNA B promoter) between the Renilla and the firefly lucifcrase

genes. Both luciferase genes carry a nos terminator. The whole expression cassette is

flanked by scaffold attachment regions (SARs).

25 times higher (fable 2.1). In our experimental system the Renilla and firefly lu¬

ciferase genes under the control of the same promoter produced RLUs that varied by

a factor of maximum 2.5 (data not shoAvn) and similar results ha\re been reported for

mammalian cells (Promega User Manual): theicfore, similar RLUs for Renilla and

firefly luciferase reflect, similar promoter strengths. All luciferase activities measured

for any of the ACMV promoteis Avere at least 100-fold and up to 2000-fold loAvcr

than activities obtained for the same hiciferases fused to a tiuncated (-1 to -93) 35S

promotei.

CHAPTER 2. ACMV PROMOTER ANALYSIS 24

Table 2.1:

Basal luciferase activities of pACMVs, pACMVleader and pACMVB

pACMVs pACMVleader pACMVB

firefly Rcnilla firefly Renilla firefly Renilla,

(c-sense) (v-sense) (c-sense) (v-sense) (c-scnsc) (v-sense)

RLU 6600 48200 13000 145000 4200 1220000

Standardized ° 100% 100% 195% 300% 63% 2500%

Relative6 100% 730% 100% 1100% 100% 29000%

"Luciferase activities ol pACMVleadcr and pACMVB were standardized to luciferase acti\ities

of pACMVs.6V-scnsc Ren/Ha luciferase acthities weie standardized to the respective c-sense firefly lurifeiase

activities.

2.4.2 Effect of the expression of viral ORFs on the activity

of the luciferase genes under the control of ACMV

promoters

The constructs pACMYs or pACMVB wore cotransformed into tobacco proto¬

plasts, either with equimolar amounts of the Rep construct (ACMV Rep ORF under

the control of a 35S promotei). TrAP construct (ACMV TrAP ORF under the con¬

trol of a 35S promoter). ACMV DNA A or with carrier DNA. All experiments aa'cic

repeated 4 to 6 times and the results are summarized in Fig. [2.4].Cotransformation with the TrAP construct increased \--sense expression (Renilla

lucifcrase) of pACMVs 16-fold and c-sense expression (firefly luciferase) 10-fold; co-

transformation with the Rep construct reduced c-sense expression about, 35-fold

but did not affect v-sense expression. Cotransformation Avith the complete DNA A

resulted in an almost 50-fold increase of v-sense expression and an approximately2-fold reduction of c-sense expression. Even in the cases of loAvest c-sense expression,

firefly luciferase activity remained significantly abowe background levels, indicating

that also under these conditions, the promoter maintains a basal activity. The îeg-

ulation of the B promoter bv the TrAP construct Avas similar; the Rep construct.

hoAvcver. shoAA"ed a stronger negative effect on v-sense expression (Renilla luciferase)and a slightly weaker negative effect on c-sense expression. The most, striking dif¬

ference Avas observed foi cotransfoimation Avith the DNA A. which led to a strong

activation of c-sense (20-fold) and v-sense (16-fold) expiession from the DNA B

promoter.

CHAPTER 2. ACMV PROMOTER ANALYSIS 25

miiieflv UReniUa

7000

6000

>- 5000

-S 2000

pACMVs ^Icp <-TiAP +DNAA pACMVB +Rcp

constmcts used foi transformation

'-TiAP HONAA

Figure 2.4: Effect of the expression of ACMV ORFs on the activity of fire¬

fly and Renilla luciferase under the control of ACMV promoters in tobacco

protoplasts. Luciferase constructs pACMYs and pACMVB were assayed in transient

for luciferase activity in tobacco SRI protoplasts following cotransformation with the Rep

construct, the TrAP construct or the complete DNA A. A value of 100% Avas assigned (o

the activity of each promoter construct alone. Columns represent the resulting luciferase

activity as a percentage of the basât activity and are the means of four to six independent

experiments; error bars represent standard deviation.

Analogous experiments aa-cic also peifoimed with cassava protoplasts (sec Fig.

[2.5]). The results avcic similar in as far as TrAP functioned as an activator of both

c- and v-sense expression with DNA A and B promoteis; the highest increase in

activity, hoAvever, was observed Avith the DNA BC piomoter in presence of TrAP

(57-fold). Like in tobacco protoplasts. Rep reduced c-seuse expression in general and

most, stronglv again in the case of the AC promoter (35-fold). The cotransformation

with DNA A resulted in a 20-fold increase of v-sense expression (Renilla luciferase)but had no significant, effect on the c-sense expression (firefly lucifcrase). The results

using pACMVB in cassava Avere again different from those in tobacco. In cassava

the increase of c-sense expression Avas much stionger (35-fold) as compared Avith

the 6-fold increase of v-sense expression. Avhile in tobacco both luciferase activities

increased to a similar extent.

CHAPTER 2. ACMV PROMOTER ANALYSIS 26

lfneflv DRenilla

7000

6000

5000

4000

3000

2000

1000

127

niiiil 1-

37 127

pACMVs l-Rep -TrAP JDXAA pACMVB +Rep

constiucts used foi trans (carnation

+TrAP tDNA A

Figure 2.5: Effect of the expression of ACMV ORFs on the activity of fire¬

fly and Renilla luciferase under the control of ACMV promoters in cassava

protoplasts. Luciferase constructs pACMVs and pACMVB were assayed in transient,

for luciferase activity in cassava SRI protoplasts folloAving cotransformation with the Rep

construct, the Tr'AP construct or the complete DNA A. A value of 100% was assigned to

the activity of each promoter construct alone. Columns represent the resulting lucifcrase

activity as a percentage of the basal activity and are the means of four to six independent

experiments; error bars represent standard deviation.

Furthermore pACMVs was cotransformed Avith the TrAP and Rep constructs to¬

gether using different amounts of DNA for each construct (f or 10 /ig each, sec Fig.

2.6]). As these cxpeiiments were perfoimecl separateR-, results AArere not combined

with experiments Avhere Rep and TrAP Avere cotransfoimcd individually. Transfor¬

mation with increasing amounts of the Rep construct reduced c-sense expression,

while v-sense expiession AA-as still enhanced even if TrAP Avas cotransformed at very

Ioav amounts (l /ig TrAP vs. 10 fig Rep construct). In the case Avhere equal amounts

of both constructs are transfoimecl. the inet case of v-sense expression together with

the decrease of c-sense expression icsembles a cotiansformatiou experiment using

DNA A.

CHAPTER 2. ACMV PROMOTER ANALYSIS 27

[nfneflv~UReniUa I

7000

6000

>

5000

GJ

CO

4000

u

>

5~i

3000

2000

IS I—EE—I 15 79

pACMVs +RepTi\P=0 10 -SRep TiAP=I 10 Rep 1 i \P = ] 0 10 -^Rep TiAP=10 1 'Rep I iA.P=10 0

constructs used foi tiansfoiniation

Figure 2.6: Effect of the combined expression of ACMV ORFs on the activity of

firefly and Renilla luciferase under the control of ACMV promoters in tobacco

protoplasts. Lucifcrase construct pACMVs was assayed in transient for fncifcrasc activity

in tobacco SRI protoplasts following cotransformation Avith different combinations of the

Rep and TrAP constructs. A value of 100% was assigned to the activity of pACMVs

alone. Columns represent, the resulting luciferase activity as a percentage of the basal

activity and are the means of four independent experiments: error bars represent, standard

deviation.

2.4.3 Analysis of a short and a longer form of the DNA A

promoter

The constructs with iavo different segments of the ACMV DNA A promoter pACMVs

and pACMVleader Avere cotransformed into tobacco protoplasts together Avith the

complete DNA A. A summary of the experiments is shown in Fig. [2.7]. When

cotransformed -with DNA A. the increase in v-sense expression (Renilla lucifcrase)from the short, version Avas much higher (58-fold) than the increase from the longer

version of the piomoter (6-fold). The reduction of c-sense expression (firefly lu¬

ciferase) was 4- to 10-fold for both the short and longer version of the DNA A

promoter.

1000

CHAPTER 2. ACMV PROMOTER ANALYSIS 28

'fflfiicflv URemlh

10000

9000

8000

» 7000

Î 6000

^ 5000CJ

2 4000

"~

3000

2000

1000

0

5if47

638

100 100 100 100 26T

10 1

p VCMVs p \CM\k ider pACMVs . DN A A.

constructs used foi ttanstoimation

pACMVieadei-DISAA

Figure 2.7: ACMV ORFs regulate luciferase expression from the short and

longer version of the ACMV DNA A promoter in tobacco protoplasts. pACMVs

and pACMVleader were cotransformed with the complete DNA A into tobacco protoplasts.

Luciferase activities were determined and are expressed as a percentage of the activity of

each promoter construct alone. Columns represent the mean values of four experiments:

error bars represent the standard deviation.

2.4.4 Production of transgenic tobacco plants containing

pACMVs and pACMVleader

To test whether the results from the transient expiession experiments in protoplasts

could be confirmed for stablv integrated genes, transgenic tobacco plants containing

pACMVs or pACMVleader Avere produced by Agrobactenum-modiated transforma¬

tion. Resistance to hvgromycin Avas used to select transgenic plants. The transgenic

nature of 10 independent lines Avas confirmed bv Southern blot analysis (see Fig.[2.8])

and luciferase assays of leaves. Of these 10 transgenic lines. 6 contained the short

version of the DNA A piomoter. while 4 contained the longer version of the pro¬

moter. All lines contained 2 - 10 copies of the T-DNA. Two of these lines shoAvcd

a 3 : f segregation pattern (sir 6 and sh 11). indicating a single locus integration.

All plants Avere grown as in vitro cultures as well as in the greenhouse. Avhere they

CHAPTER 2. ACMV PROMOTER ANALYSIS 29

N b Ö,^ Y ^ ^ b <^ C\ ^

£ # S- ^ >V ^ ^ v>> ^ ^ £

bp

8576__

7427 —

6106 —„

âklls«»

4399 — --««

3639 —- s *A

2799 —

1900 —

1482 —

992 —-

Figure 2.8: Southern analysis of ACMV luciferase transgenes in tobacco. South¬

ern blot of Ycol restriction fragments hybiiclizecl to the ffluc probe.

produced seeds normalh.

Regulation of the luciferase genes under the control of the ACMV pro¬

moter in transgenic tobacco

Mesophyll protoplasts aa'cic isolated from transgenic plants and transformed with

the Rep or TrAP construct or Avith the complete DNA A Piotoplast extiacts were

analyzed with the Dual-Lucifciase'1'1 assav and standardized Avith Bradford assays,

but, the variation of the relative values betAA'cen plants and experiments Avas high. A

représenta tree experiment Avith some of the plant lines and a wildtype SRI tobacco

(cotransformed with pACMYs oi with pACMYs Imeaiized outside of the expression

units) is shoAvn in table 2.2. Suipiismgly. c-sense expression (firefly luciferase), in the

transgenic plants. was much stronger than v-sense expression (Renilla luciferase) or

at least similar (sir 9). This is in conti ast Avith transient experiments, where v-sense

expression Avas ahvavs strongci. Also in conti ast to the eailiei cotransfoimation

experiments in protoplasts, TrAP did not function as an acth*ator in protoplasts

from transgenic plants. Onh* Avhen the complete DNA V AA-as used for transforma¬

tion, an increase of v-sense expression could be found. Avhile the c-sense expression

CHAPTER 2. ACMV PROMOTER ANALYSIS 30

Table 2.2:

Luciferase expression (in RLUs) of protoplasts from transgenic tobacco

plants after transient transformation with ACMV ORFs

conshucts used for transformation

plant line reporter gene

200000

Rep

2 10000

TrAP DNA A

sir 1 fireflv lucifcrase 260000 230000

sir 1 Rcnilla luciferase 6000 6200 7500 31000

sir 9 firefly luciferase 1870 2300 2200 2150

sir 9 Rcnilla luciferase 1150 2900 2500 UOOO

sir 11 firefly luciferase 13000 21000 22000 28000

sir 11 Rcnilla luciferase 3500 3800 4000 170000

llr 7 fireflv luciferase 16300 18000 15000 20400

llr 7 Renilla lucifcrase 3100 2800 2600 3800

llr 5b fireflv luciferase 2100 2900 2300 2700

llr 5b Ren ilia luciferase 1600 1300 930 1400

wt fireflv Incilerase a 660 88 4000 700

wt Rcnilla luciferase 7800 8900 78000 451000

wt, linear firefly luciferase h520 67 200 230

wt, linear Renilla lucifcrase 16000 L0400 16000 67500

"Wildtypc protoplasts weic cotiandoimcd A\itli pACMVs and the concsponding ACMV ORF

''Wildtype protoplasts, cotransformed \ufh tmeaiized pACMVs and the coiresponding ACMV

ORF.

remained unaffected. This incicase varied from 3- to 50-fold between different exper¬

iments. This same effect could also be obseiwcd Avhen using lincaiizcd pACMVs for

cotransfoimation studies, although heie TrAP shghtlv activated Renilla lucifetase

expression in some experiments (data not sIioami). As variation between experi¬

ments was much higher than between chfTeient lines, the degree of activation could

not be correlated to the gene copy number Also, in contiast to cotransfoimation

experiments desciibecl above, the expiession in both v- and c-sense from the longci

version of the DNA A promoter Avas not notably altered bv transformation Avith the

DNA A or the TiAP construct. When transformed with the TrAP constiuct even

a slight reduction of both lucifeiascs could be detected in piotoplasts of transgenic

plants containing the longer version of the DNA A piomoter.

CHAPTER 2. ACMV PROMOTER ANALYSIS 31

Infection of transgenic tobacco plants

Seeds from selfcd transgenic plants were collected, germinated and infected Avith

ACMV. Infected teaves of three different stages (leaf 1, leaf 3 or 4 and leaf 5 or

6) were analyzed for lucifcrase activity 24 days after infection, even though plants

shoAved no ACMD symptoms. Ten infected plants of five different, lines Avere tested

using uninfected plants of the same line as conti ois. Of these 50 plants onlv three

plants shoAved an activation of the Rcnilla lucifeiase expression after viral infection

(srl6-4, srl9-13 and srli 1-8). In order to assess the amount of viral DNA present.

DNA of infected plants Avas isolated and analyzed in a Southern blot. No viral DNA

could be detected in any of the plants tested. Therefoie. new plants were germinated

and infected with SiGMV (Colombian isolate). All plants sIioavccI typical mosaic

bleaching of leaves, indicating an infection rate of 100%. Tlucc infected - and three

non-infected plants of 5 different, lines were tested. All of these plants showed verv

high lucifcrase activities but Renilla activities Aveie hardly above background eAren if

the plant was infected (data not shewn). A relative activation of Renilla luciferase

activity and down-regulation of fireflv luciferase activity (2- to 5-fold) could be

observed in all tested lines.

CHAPTER 2. ACMV PROMOTER ANALYSIS 32

2.5 Discussion

The large intergenic region of the geminivirus genome contains c?'s-acting elements

that arc important for the regulation of vital gene expression and viral replication.

A regulatcel, bidirectional piomoter is situated Avithin this intergenic region (Stanleyand Gay, 1983; ToAvnsend et ab. 1985: Haley et, ab, 1992; Eagle and Hanley-BoAvdoin,

1997; Orozco et ah. 1998). Pievious studies on geminivirus promoter regulation in¬

vestigated mainly promotcr-GUS fusions, testing the transcriptional activity for each

direction of the promoter separately (Zhan et ab. 1991; Monis et, ab, 1991: Brough

et ab, 1992; Haley et ab. 1992: Snntei et ab. L993: Zhan et ab. 1993; Gröning et ab,

1994; Hong and Stanley, 1995: Sunter and Bisaro. 1997: Gooding et ab, 1999: Ruiz-

Medrano et ab, 1999). Owoiall. the results obtained with Begomovirus promoters

revealed a similar regulation pattern: the TrAP protein Avas found to induce v-sense

transcription while Rep doAvn-regulates c-sense transcription (Haley et ab, 1992).

However, details of basal promotei sticngth and the degree of activation or repression

by viral proteins varied considerably. It remained unclear whether these variations

reflect differences of the respective assav SA-stcms (e.g. plant matciial, incubation

time of transformed protoplasts, exact promoter sequences, etc.) or, alternatively,

differences in the replication cycle of the respective viruses. Tomato golden mosaic

virus (TGMV), for example, staits leplicating after 18 - 24 hours in protoplasts

(Brough et, ah, 1992), while in AC MA' or beef cm ly fop virus (BCTV) infected cells,

replicating DNA can only be detected 2 - 3 days after infection (Townsend et ab,

1986; Briddon et ah. 1989).

We intended to use the regulation mode of the ACMV promoter for a novel

strategy for engineered virus-inducible Alius resistance, which required a more de¬

tailed knowledge of the relative strengths of the Iaa'o promoter directions in absence

and presence of viral gene products. In older to studv simultaneously transeiiption

from both sides of the promoter (further on referred to as AC and AV promoter for

the DNA A and BC and BA" promotei for the DNA B promoters), the promoter

fragments Avere fused to the fiieflv luciferase gene in c-sense orientation (AC and

BC promoters) and to the Renilla luciferase gene in A'-scnse oiientation (AV and

BV promoters). Since several start sites have been reported (Davies et ab, 1987) for

the DNA A v-sense transcription. Ave also tested both a short promoter, covering

only the start site upstream of the AY2 gene, and a longer version of the promoter,

covering all the stait sites upstream of the coat piotein gene (see Fig.[2.3]). The

two different hiciferases can be tested in the same icaction mixture and should,

therefore, alloAv a precise compaiison of promotei activities. Using reference con¬

structs containing either one luciferase unci«- the contiol of a truncated (1-93) 35S

CHAPTER 2. ACMV PROMOTER ANALYSIS 33

promoter, we could establish that similai amounts of light units aie produced bv

both hiciferases from these constructs, indicating that light units can be dncctlv

related to promoter activhY.

An additional advantage of the lucifeiasc reporter genes is the shorter half-life

(for Rcnilla luciferase onlv reported in mammalian cells) of both proteins (and pos¬

sibly mRNAs) compared to the piCA-iouslv used GUS reporter proteins (Thompsonct ah, 1991; Martin et, ab. 1992). This allows a bettei evaluation of gene induction

or repression.

In tobacco or cassava protoplasts transformed \vith plasmid DNA. the strongest

expression from anv of the introduced genes under the control of an ACMV pro¬

moter Avas still considerably 1oaa*ci- than the expression obtained with a truncated 35S

promoter, which again was about 3-fold weaker than from the full-length promotei

(data not shown). Thus, in our assay system, the ACMV promoters arc about, 300-

to 6000-fold weaker than the 35S CaMY piomoter. in contrast to previous reports,

which stated a 10- to 40-fold loAvcr activity of the ACMV promoter (Zhan et ab.

1991; Hong and Stanley. 199-5). The activity of a TGMV AV promoter on a replicon

was repoited to be even 60- to 90-fold stronger than that of a 35S promoter and

without replication, the activity of the FGAIA* piomoter was still comparable to

that of the 35S promoter (Biough ct ah. 1992).

In contrast to earlier reports. Avhere the basal expression from the AC promoter

was considerably stronger than from the other thiee promoters, we find that in

transient assays c-sense expression is always loAvcr than Ar-scnse expression (see table

2.1). In transgenic plants, on the other hand, the AC promoter leads to higher

expression rates than the VA" promoter, although the differences of lucifcrase activity

between separate plant lines and experiments A-aried strongb-. This could be clue to

the different availability of host factois in the whole plant, or clue to the higher

stability of the firefly luciferase compared to the Renilla, luciferase. To date nothing

is knoAvn about the half-life of Rcnilla lucifeiasc in plant cells.

For the repressing effect of the Rep and the activating effect of TrAP avc found

quantitative differences to published data. Both, the 10- to 20-fold repression of c-

sensc expression by Rep and the 10- to f5-fold stimulation of v-sense expression by

TrAP are more similar to values previously found for ITJAiA'" (Giöning et ab, 1994;

Sunter et ab, 1993) than to the much smaller values reported for ACMV (Haleyet ab. 1992; Hong and Stanley, 1995). These results ate in agreement with a model

of carlv/latc gene regulation: since Rep is needed foi replication, it Avili be expiesscd

early in the infection cycle but repressed later on. On the other hand, expression of

the coat, protein (CP protein), which will be îequired in high amounts later on in

CHAPTER 2. ACMV PROMOTER ANALYSIS 34

the infection cycle once the replicated DNA is ready for encapsulation, is activated

by TrAP (Stanley, 1985).

Rep also repressed BC expression 2- to 3-fold, but, as expected, had no or only

small effects on v-sense expression. Surprisingly, TrAP also activated DNA A c-

sense expression by about 10-fold, a property not, previously recognized. Activation

by TrAP was also strong for the DNA B promotei in both orientations in tobacco

protoplasts, but in cassava protoplasts a high disparity of activation between the

two DNA B promoters Avas obscrwed: the activation of the BC promoter was much

higher than that of the RA* promotei. Otherwise, the two protoplast systems reacted

similarly. The regulation of the DNA B promotei in cassava is in accordance with

the role of the Pwo DNA B proteins: NSP has been reported to bind newly replicated

ssDNA and to move the DNA out of the nucleus (Sandetfoot et ai., 1996) while the

MPB forms encloplasmatic rcticulum-derived tubules which extend through the cell

wall to the next cell (Sanderfoot and LazaroAvitz. 1995: Sanderfoot et ab, L996; Ward

et ab, 1997). The nuclear shuttle piotein expressed individually, is localized in the

nucleus, however when MPB is coexprcssccl. it is relocalizecl to the cell pciipheiy

(Sanderfoot and LazaroAvitz. 1996; La/aiowitz and Beachv. 1999). The results ob¬

tained for cassava suggest a regulation of targeting NSP: early in the infection cycle

more NSP will be produced which will favor localization in the nucleus. Later, after

activation of c-sense expiession. the excess of AlPB will icdirect NSP. together with

the bound viral DNA to the periphciy of the cell, and facilitate its movement across

the cell wall, This model does not incoipoiate the encapsiclation step which, how¬

ever, is not necessarv for systemic moA-cment of ACMV in the plant (Sandcifoof, anel

LazaroAvitz, 1996); it is only necessary for the transmission via the whitcfly vector

(LazaroAvitz, 1992).

Since the regulation of the DNA B promoter is different in cassava and tobacco

it follows, that, not, onlv the viral pioteins but also cellular factors play a role in the

regulation of the ACAIA" promoters. Spccies-specihc variation in the availability of

such factors could account foi the lower activation of the BV promoter in cassava

protoplasts as compared to tobacco protoplasts. This further shows the importance

of testing the obtained results in the natural host of the virus.

To mimic a viiaf infection, reporter gene constructs Avere cotransformed Avith

the complete ACAIA* DNA A. which should express legulatorv proteins under viral

expression signals and viral control. DNA A pioved to be a more efficient inducer of

v-sense expression than TrAP and a less efficient repressor of c-sense expression than

Rep for the DNA A promoters. It appeals that the repressive effect of the DN.A A

is dominant for the AC promoter, Avhile the induch-c effect is dominant for the AV

CHAPTER 2. ACMV PROMOTER ANALYSIS 35

promoter. This dominance was also apparent in cotransformation experiments with

different ratios of Rep anel TrAP. where a small amount of TrAP expressing plasmid

Avas sufficient to suppress the repressing effect of Rep on v-sense expression (sec

Fig. 2.6]). The strength of the activation of v-sense expression is surprising since in

the cotransformation of single genes, these genes were under the control of the 35S

promoter, which should produce much higher levels of protein. Possibly the complete

DNA A contains additional activating sequences, which cither allow more efficient

TrAP production or Avhich pioducc additional proteins or protein variants with

activation potential. Another possibility is that the replication associated protein

induces cell cycle factors that could increase the expression of the reporter gene

(Ruiz-Medrano et ab, 1999). In contrast to the differential effect, on the DNA A

promoter, both DN.A B promoters Avere strongly stimulated by DNA A, suggesting

that the stimulatoiy effect of TrAP (and/or othei proteins) is dominant for both

the BC and BV* promoters.

The longer version of the DNA A promotei was activated much less efficiently

and even considering the 3-fold higher basal activity, the final expression lewels of

Renilla luciferase (v-sense expression) remained loAvcr than tltosc from the short

promoter. According to published transciipt analyses, the major transcription start

site is located upstream of the AUG coclon of the coat protein ORF, implying that

Renilla, luciferase fusions to the downstream coat protein ORF, like in the construct,

pACMVleadcr, Avould be less efficiently translated due to the presence of upstream,

out-of-frame start codons. It aa-ouIcL therefore, be expected that expression from

the short promoter is more efficient than fiom the longer version of the promoter.

The observed lower activation of Renilla luciferase expression could be explained

by assuming that only transcription at the major start site is activated by DNA A.

According to this model, using pACMAleader moie of the longer mRNA (containingthe 160 bp leader sequence) is produced while the level of the short, mRNA, tran¬

scribed from the minor transcription site, should not be affected. Since translation

of the longer mRNA is piobablv not verv efficient due to out-of-frame start, codons

in the leader sequence upstream of the CP ORF (Fütterer and Hohn, 1992), it will

not give rise to a high level of luciferase activity. On the other hand, with pACMVs,

transcription of the leaderless mRNA will be enhanced and translation can take

place efficiently, resulting in a much higher level of luciferase activity. We have not

been able to detect the corresponding mRNAs bv RNase protection assav (resultsnot shown). This is probably due to the instability of the luciferase mRNAs. It

therefore remains unclear Avhich transcripts are pioduced Avith the different expres¬

sion constructs in our assav system.

CHAPTER 2. ACMV PROMOTER ANALYSIS 36

For the envisaged virus resistance strategies the use of a promoter integrated

in the plant, genome is necessary. The studies performed Avith the free plasmid

in protoplasts might be close to the situation of a virus infecting a cetl, but the

regulation of a promoter integrated in the chromatin could be very different, hi

parallel experiments we compared the effects of Rep, TrAP or DNA A on reporter

expression from cotransformed or integrated copies of pACMVs or pACMVleader.

Interestingly, the absolute values of these transformation experiments are very dif¬

ferent in individual plant lines. Foi example, line sir f shows a much higher basal

c-sense expression (fuefiv luciferase) than \--sense expression (Renilla lucifeiasc) in

mesophyll protoplasts, while line sh 9 exhibits a slightly higher basal v-sense than

c-sense expression. It seems that, expression is not ontv regulated by the ACAIA'*

promoter but that also the integration site plavs a role in the regulation of gene

expression, despite the presence of SARs.

After cotransformation with DNA A the relathe increase of expression of the

wildtypc is higher than that of all the other upregulated transgenic plants. The

stronger increase of v-sense expiession in the cotransformed Avilcltype plants could be

due to a different regulation of the integrated vims promoter versus a virus promoter-

localized in a plasmid. At the same time this could piovidc an explanation for the

fact that, unlike in AvildtA-pc protoplasts, no increase of expression can be detected

after transformation with the TrAP construct. Using the longer version of the

promoter, activation of v-sense expression could be observed neither when using

TrAP nor DN.A A for cotransformation. Alreach- in the transient assay the increase

of v-sense expression from the longer promotei upon transformation Avith DN.A A

is lower than that from the short A'crsion. As this increase of v-sense expression

from pACMVs is 4-fold loAA-er in the transgenic plants as compared to the transient

assay, the increase from pACMAloader in transgenic plants is haidly above the basal

act ivitA".

During the manv repetitions performed in the course of these experiments, the

results involving transactivation of reporter activity paiticnlarlv shoAved a relatively

largc variability. Insufficient control of DNA structure cluiing the experiments could

be one reason for this variability and possibly for differences between our data and

those reported previously. Importance of DNA structure was first suggested by re¬

sults obtained with piotoplasts fiom transgenic tobacco plants haiboring the same

reporter genes as used for the tiansient assavs. DNA unvatuic has been implicated

in control of replication and possibly tianscription foi the Avheat chvaif geminivirus

(Gutierrez et ab. 1995: Gooding et ab. 1999). Avhere the expiession of a reporter

gene from introduced plasmid DNA was different from that fiom in p/ar/ia-generated

CHAPTER 2. ACMV PROMOTER ANALYSIS 37

replicons. The authors speculate, that the effect could be clue to the activation states

of the chromatin or the different methvlation states. Such features Avould almost

certainly be different on a supereoilecl plasmid and on integrated DNA, as the latter

will probably be associated with nuclcosomes differently. To verify this, we trans¬

formed protoplasts Avith reporter DNA that was linearized outside of the expression

units. In these experiments, expression from hneai DNA was hardly activated by

TrAP protein, whereas this process was efficient with circular DNA (see table 2 2).

Also the activation of Rcnilla lucifcrase expiession with DNA A was less efficient

using linear DNA than circular DNA. It can also be speculated, that additionally a

viral protein, e.g. Rep. interacting with host transcription factors (Hanlcv-BoAvdoinet ah, 1999; Liu et ab. 1999: Ruiz-Medrano et ab, 1999), is required for maximum

virion sense expression, even though the protein itself is not an activator. In this case

transformation Avith TrAP might not be sufficient for activation when the promoter

is integrated in the genome.

As a logical step after transient assavs transgenic plants were infected with

ACMV. Unexpectedly. ACAIA* Avas not able to infect tobacco SRI plants, there¬

fore, another gcminiviius. the Sicla Golden Alosaie Virus (SiGMV) Avas used for

infection studies. Typical symptoms could be detected on infected plants after 2

to 3 Aveeks, indicating a svstcmic infection. HoAvcA'er, quantification of tuciferase

activities in different leaves of infected plants revealed that, Renilla expression Avas

only slightly aboA*e background, cwen in infected plants. Possibly, SiGMV is not

related closely enough to ACAIA* to activate its promoter properfv. The viability

of pseudorecombinants produced by reassort ment of genome components of ACMV,

Squash Leaf Cuil Alius or Tomato Golden Alosaie Ahrus implies that trans-acting

functions are interchangeable (Stanley et ab. 1985: Lazarowitz, 1991). Nevertheless,

it has been shoAvn that viruses of the Ncaa* Woild have a more limited ability to rec¬

ognize and functionally interact with DNA of other geminiviruses than viruses from

the Old World (Frischmufh et ab. 1993b). Avhich is in agi cement with our results.

An approach in which the unique properties of this promoter were exploited

has already been published (Hong ct ah. 1996). There expression of a ribosome

iuactivating protein Avas induced upon vims infection. Since the AV promoter is

slightly leakv, as shown bv using the GUS reporter system (Hong et ab. 1996).this might, lead to abnormal or reduced growth, when using a toxic gene under the

control of the AV promoter. Theiefore. in addition to using the upregulation of

the AV promotei. we propose to also use the doAvniegulation of the AC promoter:

the AC promoter could regulate the expression of the inhibitor of a toxin which

is under the control of the AA" promoter. As long as no infection occurs, more

CHAPTER 2. ACMV PROMOTER ANALYSIS 38

inhibitor than toxin will be produced. Onlv if the cell is infected, the balance will

be shifted towards more toxin production. Consequently a hypersensitive reaction

could be mimicked thereby protecting the plants fiom viral infection. The results of

our studies on ACMV promoter regulation are of practical significance for designing

new virus resistance strategies in the future.

Chapter 3

Developing a new ACMV

resistance strategy by mimicking a

hypersensitive reaction using the

barnase and barstar ORFs

o.JL _r\DSTrû.Cti

Barnase is an unspecific ribonriclease of Bacillus amyloliquefaciens which

has a specific inhibitor, the barstar. Here the RNase activity of the

barnase was exploited to engineer resistance to a DNA plant virus, the

African cassava mosaic virus in transgenic Nicotiana tabacum SRI. For

this purpose the barnase ORF was cloned under the ACMV virion-sense

promoter, which is f-rans-aetivated by the TrAP, a viral protein. Ad¬

ditionally, the barstar was introduced under the control of the ACAIV

complementary-sense promoter to counteract basal expression of barnase.

Upon viral infection the ratio of barnase/barstar would be expected to

shift in favor of the barnase due to the viral protein TrAP, resulting in lo¬

cal cell death before the virus can spread to adjacent cells. A replication

assay using leaves of transgenic plants compared with wildtype plants

could show a 3- to 100-fold reduction of viral replication in transgenic

leaves.

39

ACMV Resistance 40

Figure 3.1: Genome map of ACMV DNA A and DNA B. The DNA is represented

by a thin line with the two arroAvhcads showing the exterrt of the large intergenic region

(LIR) and the main viral ORFs aie indicated by thick arrows. See text for ctetails on gene

names.

3.2 Introduction

African cassava mosaic disease (ACMD) has been rated one of the most important

and devastating diseases of cassava in Africa (Geclcles, 1990). It Avas first reported in

1884 (Warburg, 1894) and seweial serious outbieaks have been reported since then

(Thresh et ab, 1994). At present, a paiticuhulv severe epidemic of the disease is

spreading in central and eastern Africa (Gibson et ab, 1996) causing local losses of

up to 80%, while losses throughout Afiica reach 36% of total cassava production

(Fargette et ab, 1988). Cassava (Manihot cHculanla Crantz) is a major food crop in

Africa, grown for its tuberous roots containing up to 85% starch (dry weight) and for

its protein-rich leaves. It is the basic staple food foi over 200 million people in Sub-

Saharan Africa, Avhere the majorité of cassava is produced bv small-scale farmers

on a subsistence basis. Conventional breeding to control African cassaA-a mosaic

disease by inter- and intraspecific crosses A\lth plants having a natural resistance

but a limited agricultural value, is still difficult due to the Ioav fertility of many local

varieties (Hahn et ab, L9S0: Thresh and Otim-Nape, 1994). Genetic engineering is a

poAverful tool to complement these efforts bv extending the gene pool for useful gene

sources over species ban ici s and bv engineering single, desirable traits precisely.

ACA4D is caused bv a Avhitefly-transraitted vims of the family Geminwiridac:

the African cassava mosaic vims or ACAIA* (Briddon et ab. 1998). The ACMV

genome is composed of Iavo circular single-stranded DNA molecules, DNA A and B

(see Fig. [3.1]). The larger of the tAvo components. DNA A (2779 bp). encodes the

coat protein (CP or AA'l) and all viral functions required for viral replication (Rep

ACMV Resistance 41

or ACl, replication associated protein. TrAP or AC2 and REn or AC3, regulator

proteins). DNA A is therefore capable of autonomous replication and encapsulation

(Townsend et ab, 1986), but incapable of moving from cell to cell in the host plant.

The second component, DNA B (2724 bp), encoding two proteins (MPB or BCl and

NSP or BV1) that are itrvolvcd in cell-to-cell movement in the plant (von Arnim

et ah, L993; Halev et ab, 1995). is requited for a full svstemic infection. Transcription

occurs in a bidirectional manner from the huge intergenic region (LIR). which is

highly conserved between DNA A and DN A B.

Increasing knowledge of the functions of ACMA" genes and their regulation has

led to the development of virus resistant transgenic model plants. Transgenic con¬

stitutive expression of defective vital DNA (Stanley and ToAvnscnd, 1985: Stanlev

et ah, 1990), of antisense Rep gene (Dav et ab. 1991). of defective Rep protein (Hong

and Stanley, 1996), of defective movement proteins (von Arnim and Stanley, 1992:

Duan et ah, 1997), of coat piotein (Kunik et ab. 1994) or the virus-induced expres¬

sion of dianthin in stablv transformed plants (Hong ct ah, 1996) has shown to confer

geminivirus resistance. As shown with the libosome-inactivating protein dianthin,

the regulatable ACAIA* promoter can be used for the controlled expression of highlv

toxic genes that otherwise AA'ould be lethal or lead to abnormal development of the

transgenic plants, thus limiting their cffcctrvcncss as antiviral agents (Hong et ab,

1996).

The unique properties of the regulation of the ACAIA" promoter should make it,

possible to mimic a hvpeisensitive reaction by using a finely tuned toxin/anti-toxin

system. It, is knoAvn that a basal Ioav level of tianscription fakes place from both

sides of the ACMA'* promoter (Hong et ab. 1996). Therefoie, basal expression of

the toxin has to be counteracted Avith basal expiession of the anti-toxin. Upon viral

infection of transgenic plants, expiession of the toxin under the control of the AV

promoter would be aeth-ated specifically in virus infected cells, thus overriding the

effect of the anti-toxin under the contiol of the VC piomoter.

Barnase, the ribonuclcase produced Ida' Bacillus amijloliquefacieris (Mariani et, ab,

1990; Mariani et ab. 1992), and ifs specific inhibitoi, barstar, could be applied in the

aforementioned virus resistance strategy. Due to the high toxicity of the barnase,

further doAvn-regulation of its production might prove necessary. This could be

achieved by introducing additional short open reading frames (sORF), upstream of

the barnase gene, to dcnvii-regulate its translation (Fütteret and Holm, 1992; Ruan

et ab. 1996; Alizé et ab. 1998).

AVc report here the cloning and transfoimation of such constructs into A*, iabacum,

SRI in order to analyze the influence of the regulated barnase expression on plant

ACMV Resistance 42

development, to assess the reduction of viial replication in transgenic plants tran¬

siently and to study the effect of the tiansactiA'ation of the barnase gene upon viral

infection.

ACMV Resistance 43

3.3 Materials and methods

3.3.1 Plant material

Tobacco, Nicoiiana tabacum L. cv. Petit Havanna Str-rl (SRI) (Maliga ct ah.

1973), was maintained as axcnic shoot, cultures. These AA'ere groAvn in, vitro at 26°C

Avith 16 h light per dav on half-strength MS medium Avithout growth regulators

(Murashige and Skoog. 1962). Tobacco seedlings used for Aqrobactcrium-mediated

transformation were giown on filter paper wetted with sterile tap Avalen- for 8 davs

prior to use.

3.3.2 Bacterial strains

E. coli strain XLl-Blue Avas purchased from Stratagcnc (La Jolla, CA, USA). A.

turnefaciens strain GV31Û1, containing helper plasmid pGA'2260 (Deblaere ct ah,

1985) was kindly provided bv B. 'Finland. Zürich.

3.3.3 Construction of plasmids

Plasmid pACMV A is a partial repeat (1.3mei) of DNA A (West Kenyan isolate

844 (Stanley and Gav. 1983)) in pBS II KS-. The cloning of the J.Smer of DNA A

has been described (Klinkenbeig et ab, 1989).

All DNA manipulations Avère pciformed according to standard procedures (Ma-

niatis et ah, 1982). Nucleotide numbering of the \CMV genome refers to p.IS092 and

pJS09f (Stanley and Davies, 1985). DNA A and names of the open reading frames

are according to suggested nomenclature (DaAdes and Stanley, 1989), unless the

function of a gene is knoAvn. In this case the name of the gene product, is indicated.

The bidirectional ACAIA' promoter Avas produced lw PCR amplification of ACMV

DNA A using primers ACAIA'c (GGAA -2755- GCTTTTTGACCAAGTCAATT-

GG -2776) and ACAlA's (300-GTGGTACCCACTATTGCGCACTAGC -267). The

ACMA* promoter was introduced as a Kpnlf Muni fragment between the two to¬

bacco scaffold attachment legions (SAR) (Brevnc et ab. 1992) in the backbone of

pGluChi (Bhffcld et ab. 1999). The barstar ORF (Hartley, 1988) was cloned under

the control of the AC promoter as an Ncol/Psll fiagment ,Avhile the barnase ORF

(Hartley. 1988) (both kindly provided by J. Fiitteicr. Zürich) Avas introduced as a

blunt-end fragment into the blunt Spel site under the contiol of the AVI promoter.

Both ORFs Avere cloned together with a 35 S teiminator. The hvgromycin resis¬

tance cassette Avas cloned as a blunt end fragment cloAvnstream of the barstar gene,

ACMV Resistance 44

Table 3.1

Number of ORFs in different constructs, depending on oligo-nucleotide

sequence

Ncol site ß'coRA* site no. of sORFs

+ -T- one (6 aa)

y - tAA"o, overlapping

4 none

- - one (7 aa)

resulting in plasmid pACAIA'bb (sec also Fig. [3.2]). Correct cloning of inserts into

the vector was confhmccl Ida- restriction digests and sequencing.

In order to regulate barnase expression also at the translational level, vari¬

ous short ORFs Avere cloned bctAA'ccu the ACMY promoter and the barnase gene

(Ruan et ah, 1996). For the introduction of these sORFs it was necessary to sub¬

clone the Ihn dill fragment of p.ACAfA<*bb into pGN35Sluc+ (kindly provided by G.

Ncuhatis. Basel). Primers sORFJ (CGAACGGATCAACCAT(G/A)GCCGGCG-

AT(A/G)TCAGCTAGCT) and sORF2 (AGCTGA(C/T)ATCGCCGGC(T/C)AT-

GGTTCATCCGTTCGGTAC) were annealed and ligated to the Kpnl and Sad

sites of the Ihndlll fragment. This resulted in four different sORF constructs de¬

pending on AAdiich of the degenerated oligonucleotides AA-as introduced. These sORFs

could be discriminated by an AYR site (present in the primer with G in the hist

degenerate position) and an iYoRA* site (present in the primer Avith A in the second

degenerate position; see also table 3.1).

As a positive control the fireflv luciferase and the Rcnilla lucifcrase were cloned

under the control of a 35S promoter and a 35S tciminator (kindly provided by S.

Brunner, Zürich) rendering plasmid pLucpos and pRenpos respectively (see Chapter

2). To reduce the lucifeiasc activity and thereby make measurement more conve¬

nient, the 35S promoter only contained nucleotides 1 to 93. As a non-replicating

negative control, pACMA" AACl. a part of a 1.3nier of the DNA A, Avithout the

fragment containing the DNA A from bp 2732 OA'er 2779/1 until bp L868, in which

most of the Rep ORF (bp 1680 to 2756) is excised. Avas used. This plasmid Avas

kindly provided by II. Wohlwend. Zürich.

In order to transform plants Avith Agrobactci /utn. the bainase construct was intro¬

duced into pNCl as a complete I-Seel-fragment. p.NCf is a pCambial-300 backbone

with a pMCSö polylinker (MoBiTcc. Germany) containing an I-Seel site. The re¬

sulting plasmid, pNCbb. Avas then electioporatcd (Alattanovich et ab, 1989) into

ACMV Resistance 45

« 1 ^ -Sf« t 'S g. g 5$

-jj SAR~~}|iSS HEärnäis^ }j ACMVfJBres""^ hpt fcjiä^' SAB. }—

Figure 3.2: Schematic representation of barnase expression cassette. Barnase

expression cassette shoAving the position of the cloned ACAIA7' DNA A promoter between

the barnase and the barstar ORFs. The barnase ORF contains the iutron from rice tungro

bacilliform virus; both ORFs cany a 35S terminator (35S). An hpt ORF under the control

of a 35S promoter (35SP). with a not terminator (nos') is included as a selectable marker.

The whole expression cassette is flanked by scaffold attachment regions (SAR). The bar

over the map represents the position of the barnase probe used for Sorrthern hybridization

analysis.

GV3101 (pGV2260) resulting in strain GA*bainase for agroinoculation of seedlings.

3.3.4 Tobacco mesophyll protoplast isolation, transforma¬

tion and regeneration

Mesophyll protoplasts Avere isolated from in vitro-grown tobacco plants. Leaves

were cut into 1 cm2 pieces and digested overnight in PCN1 (Golds et ab, 1993)

containing 1% Cellulase Onozuka RIO (Yakult Pharmaceuticals Inch Co.. Ltd.,

Japan), 0.5% Alacero/vme RIO (Yakult Pharmaceuticals Inch Co.. Ltd.. Japan) and

1 drop TweenSO (Nagy and Alaliga. L976). The protoplast suspension was filtered

through a 100-//m steel mesh sicA-e. After collecting the protoplasts by floating on

PCN1 they Acere AATcshcd tAvice Avith W3 (Alenc/el et ab. 1981) and then incubated

in the dark at 4°C for 1-2 hours. Samples of 250.000 to 500.000 protoplasts were

resuspended in transformation buffer (15 mAl AlgCL. 0,1% VIES 0.5 A4 mannitol,

pH 5.8) and transformed with 20 rig of DNA using PEG (Negrufiu et, ab. 1987).

PCN2 (Golds et ab. 1993) AA-as added to the transfoimcd protoplasts before thcy

AA'crc incubated at RT in the dark.

After 21 hours protoplasts Avere harvested bv centrifugation and rcsuspended in

100 fil passive lysis buffer for the Dual-Luciferasel!i reporter assay (Promega, Catalvs

AG, Switzerland). Extracts avcic stored at -80°C for up to one month.

For stable transformation, protoplasts avcic Avashed after the transformation and

rcsuspended in 0.5 ml of PCN2. Afiquots of 4.5 mf AA-aim PCN2 containing 0.6%

seaplaqtic agarose Avere caicfullv mixed with the transformed protoplasts in a 6 cm-

Falcon petri dish. Aftei solidification of the agarose, the piotoplasts Avere cultured

ACMV Resistance 46

in the dark for 24 hours and in semi-daikness for the following Aveek. The agarose

disc was then cut in half and each half immersed into 30 ml of medium A (Caboche,

1980) containing the appropriate selective agent. Bead cultures Avere incubated on

a rotary shaker with 80 rpm until resistant colonies could be seen after 3-4 weeks.

One week later, these were placed on solid MS moipho medium (Spangcnbcrg et ab,

1990) where shoot, development took place after 2-6 Aveeks. Fully developed shoots

were transferred to MS medium Avithout hoimones. After establishment of a root

system, plantlets could be kept as stciile cultures or transplanted to soil in the

greenhouse.

3.3.5 Agrobacterium-medmtcd seedling transformation of

tobacco

Eight-day-old tobacco seedlings were transformed bv A-acuum infiltration (Rossi

ct ah, 1993) using an overnight, culture of GA'bainasc groAvn in 2 mi YEB (AVrvlietet ah, 1975) containing the appropriate antibiotics. The seedlings were cocultivated

for 3 days on solid MS medium (Alurashigc and Skoog, 1962) aid then Avashed

in 10 rail AlgSOt. They avcic then placed on MS medium containing 0.1 /ig/ml

NAA, l/ig/ml BA. 25 //g/ml hvgronrvcin. 500 fig/ml cefotaxime and 500 /ig/ml

A'ancomyein. Seedlings AA-ere tiansfcired to fresh plates cA-erv Aveek. After 7-8 Aveeks,

shoots could be collected from single calli and transferred to MS medium without

selection. After multiplying each plant line, rooted plantlets could be transferred to

soil or kept as in vitro cultures.

3.3.6 Dual-Luciferasem reporter assay

Protoplast extracts Avere tlnrwed and cell clebiis Avas collected by centrifugation. 50 /d

of Luciferase Assay Rcagentlt (Piomega. Catalvs, Switzeiiand) Avere pro-dispensed

into luminometcr tubes before adding 10 //I of extract and mixing Avell with a

pipette. Measurements Avere peifoimed Avith a luminometer (Lumat LB 9507. EG &

G Berchthold, SAvitzerland) Avith dual injectors dining 5 seconds each. After mea¬

suring the luciferase activity, in 'relative light units' (RLU). Stop and Glo Reagent

was delivered into the tube by automatic injection. Measurement of the Renilla lu¬

minescence was started after a tAvo second delay. Foi each experiment, background

luciferase activity from protoplasts transformed Avith a A'ector Avithout lucifcrase

genes was subtracted throughout. Protein concentiation. estimated using a Bio-Rad

protein assay as desciibed (Bradford. 1976), Avas used to normalize each measure¬

ment. All resulting valuer Aveie standardized to the positive control consisting of

ACMV Resistance 47

protoplasts transformed with pLucpos and pRenpos.

3.3.7 Molecular analysis

PCR

Total DNA from transgenic tobaccos and an untiansformed control Avas extracted

using the NucleonPhytopurc kit (Amersham Life Science, England) as described by

the manufacturer. PCR reactions (Mullh and Faloona, 1987) Avere performed in

a final volume of 50 /d using J //g of plant DNA and 5 units of Taq polymerase

(QIAGEN, Hilden, Germany). Primers avcic added to a final concentration of 1/jJM

each and dNTPs (Boehiinger Mannheim. Gcimauv) Avere used at a concentration of

250 ßM. PCR cycles consisted of a 1 min clenaturation at 95 °C a 1 min annealing

at around 60 °C (depending on GC content and length of primer) and an elongation

period of 1 min at 72 °C. After 25 cycles, amplified piociucts were sepaiated by

agarose gel electrophoresis. In order to detect the bainase gene, a 600 bp fragment of

the barnase and of part of the ACAIA' promoter AA-as amplified using primers ACMVF

(5'-CCACTATATACTTACAGCCC-3") and baniaseF(5;-C ATGTTCGTCCGCTT-

TTGCC-3'). To verify the presence of the hvgromvein resistance cassette, a 550 bp

fragment was amplified with primers 35Shpt5 (5'-G AAAAGGAAGGTGGCTCC-3")and hpt3 (5YAATAGGTCAGGCTCTCGC-3').

Southern blot

Total DNA from transgenic tobaccos and an untransfoimed control was extracted

using the NucleonPhytopurc kit (Amersham Life Science, England) as described

by the manufacturer. Aliquots of 10 fig of this DNA Avere digested either Avith

RstL expected to give lise to a fiagment containing the complete barnase-ACMV

promoter-barstar (around 1.5 kb) or H//?clIII. Avhich should result in a fragment

of around 700 bp and a single cut in the T-DNA leading to the plant DNA. Af¬

ter agarose gel electrophoresis. DNA Avas transferred to a positively charged nylon

membrane (HybondN. Amersham) bv blotting overnight as described (Sambrooket ah. 1989). After a shoit Avashing of the mombiane. the DNA was coA^alently

bound bv exposure to UA* (LA* Stratalinker 1800. Stratagcnc). The membrane Avas

prehybriclized at 42°C with 10 ml DIG Easy Ha-Id1" (Roche .Molecular Biochemicals,

Switzerland). After one hour the prehybiidization solution Avas replaced Avith fresh

hybridization solution including 20 ng DIG-labeled probe and hybridization took

place at 42°C overnight. DIG-labeding of the DNA Ava-, performed according to the

PCR DIG Probe SAmthesis Kit ' standard protocol (Roche Molecular Biochemicals,

ACMV Resistance 48

Switzerland). A 600 bp fragment of the bainase anel part of the AC.VfV promotei Avas

amplified. After remoA'at of unspecific Irvbridization and an incubation in blocking

buffer, the anti-DIG antibodies avcic added. FolloAving equilibration, the DNA side

of the membrane was OA'erlaycd Avith substrate solution (CDPstarlM, Roche Molecu¬

lar Biochemicals, Switzerland). The damp membrane AA-as sealed in a hybridization

bag, fixed in a film cassette anel exposed to X-ray film (BIOMAX AIRY Kodak,

Rochester NN", USA) for f hour at 37°C. The film Avas developed with a developing

machine (AGFA, Cmix CO).

3.3.8 Replication assays

Transforrnation of tobacco leaf discs by particle bombardment

Tavo hours before bombai ciment leaf discs of 2 cm in diameter were placed on MS

medium, pH 5.8, supplemented Avith 10% sucrose and solidified Avith 0.8% agar. Tavo

/d DNA (0.1 fig/fd) were added into a tube containing 25 /d of gold-particle suspen¬

sion (50 fig/fd) and DNA AA-as precipitated on particles using CaCL, spermidine and

ethanol (Klein et ab, 1988). Aliquots of 5 //I Avere used for bombardment. A nylon

baffle grid (500 //m mesh) AA-as placed betAA'cen the filter and the target at 10 cm

fiom the filter, in order to reduce gas impact on the thsue. The target Avas placed at

12.5 cm from the filter. The chamber Avas evacuated to 100 mbar and the particles

AArcre accelerated bv a helium jet generated bv 6-7 bar pressure for 50 milliseconds.

Tavo hours after bombardment leaf discs AA-ere transferred to MS medium Avithout

groAvth regulators containing 2% suciose and incubated in the light at 24°C for six

days.

Analysis of ACMV DNA replication

Total DNA from bombarded leaf discs Avas isolated as described (Soni and Mur¬

ray-, 1994). Aliquots of 5 fig of total DNA from each sample weic digested with

Mlul/Dpnl and Avith Mlul/Dpnl/Mbol. The restricted samples were clcctiophoresed

through 1% agarose gels and transferred to nylon membranes (Hybond N, Amer¬

sham). ACAIA* replicated DNA \vas detected by hybridization to an AVI probe

labeled with digoxigenin-tl-dUTP. Labeling, hybridization and chcmiluminescent

detection were peiformed according to the instiuctions of the manufacturer (RocheMolecular Diagnostics). p.VCAlAA. lestiicted Avith Mini, resulting in a hybridizing

fragment of 2.7 kb. Avas used as a positive contiol.

ACMV Resistance 49

3.4 Results

3.4.1 Expression of active barnase can be enhanced tran¬

siently in tobacco protoplasts

In order to test the activity of the barnase and to assess the ACMV promoter regu¬

lation, tobacco protoplasts aatic cotransformed Avith pLucpos. pACMVbb and Avith

or Avithout complete DNA A. theiebv mimicking a viral infection. As expected.

the luciferase activity in protoplasts in which the barnase expression AA-as activated

(cotransformed Avith DNA Ah Avas much Icwcr (30% of the luciferase activity in

protoplast in AAdiich barnase was not activated) than in protoplasts cotransformed

only Avith the barnase and the luciferase constructs. Due to the high toxicity of

the barnase, it was expected, that additional doAvmegulation of barnase expression

might be necessary. Different sORFs (see table 3.1) AA-ere introduced upstream of

the barnase to reduce translation. Four different constructs containing sORFs avcic

tested. Also with these constructs a reduction of luciferase activity could be ob¬

served upon cotransfoimation AA'ith the complet" DNA A, although this reduction

was slightly less marked (45 - 50%, of the lucifcrase acthdt\- in protoplasts in Avhich

barnase was not activated).

3.4.2 Analysis of transgenic tobacco plants containing a reg¬

ulatable barnase ORF

Tobacco plants were transformed with p.ACAIA'bb via Agrobaderium-mediatcd seed¬

ling transformation. Resistant plants were analyzed bv PCR, amplifying a 600 bp

fragment of the barnase anel part of the ACAfA" piomoter or a 550 bp fragment, of the

hvgromycin resistance cassette. PCR results iCA-ealecl that even though all plants

contained the hygromycin gene, no plants contained the barnase gene. In order to

examine this partial integration of p.ACAfA*bb. plants were analyzed additionally

by Southern blot. Of the analyzed plants onlv one plant contained the complete

fragment liberated by Pstl (sbbl7), but at least 4 plants contained rearranged in¬

serts AAuth only part of the barnase gene present. Since transformation efficiency

seemed Ioav and onlv few plants could be icgeneratcd, a neAv appioach Avas tested,

transforming plants with p.ACAIA'bb containing diffeicnt sORFs. These sORFs have

been shoAvn to down-regulate gene expiession in mammalian, veast and plant cells

8- and 20-fold (Fütterer and Hohn. 1992: Ruan et ab. 1996; Afize et ab, 1998).Transgenic tobacco plants Avere pioduced via PEG-mediated protoplast transforma¬

tion. Upon analysis wit h PCR, transformed plants icgeneratcd from protopfasts

ACMV Resistance 50

sbbl? +-f4 ++10 + -10 + -11PHPITPHPHPII

-+5 wt

kbpHPIIPHPHPII

P H P H

8.6

4-é

6.0

4.8

3.5

2.7

1.9

1.5

1.4

1.2

1.0

0.7 — m&

Figure 3.3: Southern analysis of barnase transgenes in tobacco. Southern blot

of ffmdITT (H) and Pstl (P) restriction fragments hybiiclized to the barnase probe. To¬

tal DNA of transgenic plants digested with Pstl gives rise to a fragment containing the

complete barnase-ACMV promoter-barstai fragment (around 1.5 kb), while digests with

ffindlll result in a fragment of around 700 bp and a single cut in the T-DNA leading to

the plant DNA. Names of plant lines are according to the respective sORF (see table 3.1).

were negative for amplification of the barnase gene but positive for amplification of

the hvgromycin resistance gene. When the same plants were analyzed by South¬

ern blots, most sliOAA-ed rearrangements AA'hen hybridized with the barnase probe.

Only 6 plants that contained the complete Pstl fiagment avcic found (see Fig. [3.3])in addition to sbb!7. AAdiich had been transformed earlier via Agrobacterium. The

7 plant lines were groAvn and multiplied as in vitro shoot cultures and developed

normally except for plants of line sbb!7. On older leaves, these plants developed

necrotic lesions that gradually spread over the complete leaf and also to younger

leaves. Plant growth was reduced after the first lesions were visible. 3-6 Aveeks

after subculturing.

ACMV Resistance 51

Mini Dpnl MlulDpnlMbol

sbbl? -+5 wt sbbl7 -+5 wt

kb A AACt 0 A AACt 0 A AAC1 0 A AAC1 0 A AAC1 0 A AAC10

4.8—

3.5 —

2.7—

Figure 3.4: Leaf replication assay. Total DNA of shot leaves of plants sbb!7, - +5 and

wildtype tobacco was isolated and equal amounts Avere digested either with Mlul/Dpnl or

with Mlul/Dpnl/Mbol. Viral replication occurred only Avhen leaves were shot, with DNA

A and was reduced in transgenic plants.

3.4.3 Viral replication in transient assays is reduced in trans¬

genic plants

Plants containing the complete barnase and baistar genes and untransformed control

plants were used for replication assays to test the inhibition of viral replication in

these plants. Leaf discs avcic transformed bv particle bombardment with p.ACMV

A, pACMVAACl, a replication defective DNA A. or with a control vector Avithout

viral DNA A. Standard amounts of total DNA, isolated after 6 days, were digested

Avith Mlul/Dpnl or with Mlul/Dpnl and Mbol. Taking advantage of the mcthylation

sensitivity of Dpnl (active onlv if DNA is methylated) and Mbol (active only if DNA

is not methylated) it is possible to distinguish between input DNA (methylated) and

de-novo synthesized viral DNA (not methylated). In the restriction digest Avithout

Mbol a viral band AA-as detected only if viral replication occurred in the leaf. This

band disappeared upon additional digestion Avith Mbol, confirming the viral nature

of this DNA. Input DNA Avas completely digested in both cases. Compared to

replication in wildtype plants (100%). viral replication in leaves of plants sbbl7,

sORF-+5 and sORF-+Ll transfoimed with pACMV A was much loAver at 13%,

30% and less than 1% lespectivcly (see representative example in Fig.[3.4]). No

replication occurred in leaA-es transformed Avith p.ACA'IA* AACl or with an empty-

vector. A repetition of this expeiiment could confirm the reduced viral replication

in transgenic plants.

ACMV Resistance 52

3.5 Discussion

Barnase, an RNase of Bacillus amyloliqucfacieiis, is able to efficiently trigger cell

death and can be specifically inhibited by the barstar in plants (Mariani et ab,

1990; Mariani et ab, L992). As expression of a dianthin gene under the control of the

regulatable ACMV AV promoter has been shown to confer ACMV resistance (Hong

et at., L996), our strategy, using the ACAIA* promoter together with the barnase and

barstar to confer virus resistance, should be feasible. The system tested here is more

advanced, since beside the barnase. undei the contiol of the ACMV AV promoter,

also the barstar, under the control of the ACAIA* AC promoter, plays an integral

role, inhibiting the Ioav level of produced bainasc in non-infected plants.

The fact that the bainasc is active and that its expression can be activated Avas

demonstrated with transient experiments in protoplasts using the lucifcrase as a re¬

porter gene. The luciferase activity in protoplasts cotransformed Avith pACMVshvg

and pLucpos was higher than that of piotoplasts cotransformed Avith pACMVshyg,

pLucpos and ACA'IA" DN.A A. indicating that barnase expression AA'as activated by

the DNA A and that the increase of barnase production did actually reduce RNA.

This could be seen for barnase constructs both with and without sORFs.

Stable transformation of tobacco plants with these constructs proved to be diffi¬

cult even though, initialh, the regeneration frequency of hvgromycin resistant plants

seemed normal. I4oweA-er, Avhen analyzed bv PCR, no fragment could be amplified

from any of the regenerated plants. Onlv Avhen analyzed bv Southern blot could

the presence of the AA1CA* piomoter and the barstar ORF be confirmed. Secondary-

structures of the ACAIA* promoter sequence and the barstar ORF with high melt¬

ing temperatures of 6LC and 58°C respectivclv, might be the reason for the false

negative results of the PCR. Since these secondary structures did not melt at the

annealing temperatures required by the primeis chosen for PCR analysis, primer

annealing and subsequent polymerization AA-ere very inefficient and no PCR product

could be detected.

Only one plant containing the complete barnase-ACMA* promoter-barstar frag¬

ment could be identified from the first 8 transformation experiments. It has been

shoAvn for tomato golden mosaic vhus that repression of v-sensc transcription is not

maintained in unorganized tissue (Sunter and Bisaro, 1997). This could explain the

Ioav yield of plants containing the complete insert: most plants containing a com¬

plete insert did not survive regeneration via organogenesis, since this comprises a

callus phase. Consequently, a reduction of barnase expression from the uninduced

promoter was nceessan-. For this purpose, four diffeient, ORFs. Avhich in another

system (Ruan et ah. 1996: Afize et ab, 1998) inhibit translation of downstream ORFs

ACMV Resistance 53

between 8- and 20-fold, were introduced upstieam of the barnase ORF. The yield

of plants containing the complete insert AA-as slightly better in these transformation

experiments. A total of 6 plants containing the barnasc-ACMV promoter-barstar

fragment with a sORF could be regenerated, but still the amount of plants with

rearranged copies of the transformed plasmid was higher than expected. Probably,

these plants would usually regenerate slower than plants containing a normal copy

of the transformed plasmid and would not be detected in an experiment Avithout

toxic genes involved. Since in this case, a genie leading to the production of a toxin.

the barnase, was used for transfoimation. plants containing rearranged copies of

the barnase ORF might have an ach-antage and might regenerate faster and more

successfully compared Avith plants aaIUi a complete bainasc ORF. Furthermore, the

variability of transgene expression, as demonstrated bv the higher activity of Rcnilla,

luciferase (corresponding to barnase) as compared to firefly luciferase (correspond¬

ing to barstar) observed in line sir9 (sec Chapter 2), could be another explanation

for the Ioav number of plants regenerated containing an intact copy of the transgene.

If at one stage during regeneration more barnase than barstar is present, in the cell,

no plants will be able to regenerate fiom these cells.

The regeneration of plants containing an intact copy of the transgene, was sloA\rcr

when compared to wildtypc regeneiation. but all plants developed normally, except

for those of line sbb!7. The observed random pattern of brown spots spreading

on older leaves of sbbl7 seems to be due to bainasc activity. As these spots first

appear on older leaves, it could be speculated that barnase is slightly more stable

than barstar and slowlv accumulates until more barnase than barstar is present in

the cell. The death of such a single cell might also affect surrounding cells either

directly through the barnase or bv initiating a hypersensith'c response. It is also

possible, that the rclath-c kwel of barnase1 to baistai expression is not exactly the

same in all the cells of a plant, that some produce shghtlv more barnase than others,

leading to stress and consequently to a hypersensitive response. As these broAvn

spots were not observed in anv of the other tiansgenic lines, it can be assumed,

that line sbbl7 has the most fragile balance of barnase to barstar and that in ail

the other lines relatively less barnase is produced. That such a variation is likely to

occur can be concluded from results obtained Avith tiansgenic plants containing the

ACMV-luciferase construct (see Chapter 2).

The results of the replication assavs with leaves of transgenic plants compared

to AAdldtype leaves cleailv show that leplication of viral DNA is severely reduced in

transgenic plants of all tested lines. The highest i eduction of replication was seen for

plants of line sORF-+ll and sbbl7. which does suggest that the balance between

ACMV Resistance 54

barnase and barstar is actually more fragile in these plant, lines than in the others

containing sORFs. It cannot be expected that replication of viral DNA is completely

abolished due to the barnase. As long as the barnase is activated before the virus

can spread out of the infected cell, the plant would still be resistant even if some

replication occurs. In order to find an optimum balance of a high and fast barnase

production which the plant can still support even in older leaves, more transgenic

plants need to be regenerated.

Since Nicotian a taba cum SRI plants could not be agioinoculated with ACAIA*.

even though replication in SRI protoplasts Avas shcnvii. it Avas not possible to test

whether also the spreading of the virus avouIcI be icduced or inhibited. HoAveArer,

the obseiwed resistance of plants containing the dianthin under the control of the

ACYIV promoter (Hong et ab, 1996; Hong et ab. 1997), strongly suggests that our

approach could provide resistance against ACAIA* in the future.

Chapter 4

Cassava regeneration and

transformation

4.1 Abstract

Transforrnation and regeneration of cassava (Manihot esculanta Crantz),

an integral plant for food security in developing countries, using different

systems has been published before. These protocols are all developed for

two cassava model cultivars. Since cassava is grown as many different

land races, it is crucial to adapt these methods to various cultivars. The

adaptability of transformation systems based on Agrobacterium or par¬

ticle bombardment to an African cultivar and the changes needed in the

published protocols for regeneration of transgenic plants of this cultivar

were assessed in this work.

4.2 Introduction

Cassava (Manihot esculcnta Crantz) is a perennial shiub, belonging to the family

Evphorbiaceae. It is one of the most important sources of calories produced within

the tropics (Cock, 1982: Puonti-lvaerlas, 1998) and provides food for OA-er 500 million

people. Cassava roots can be processed into a Avide vaiiety of products for food and

inclustiial uses and since most, of the processing can be clone locally, it provides rural

jobs and income (Henry et ah, 1995). Cassava is grown because of its robustness and

its reliability as a superior producer of carbohydrates even on poor soil and for its

ability to survive seasonal diought and othei aclveisc environmental conditions (Thro

et ah, 1995). Up to 80 t/ha loots can be produced nuclei optimal conditions in a 12

month growing season, but yields arc severely reduced by insect pests and diseases,

o5

CHAPTER 4. CASSAVA REGENERATION AND TRANSFORMATION 56

that cause up to 70 - 80% losses locally (Roca et ab. 1992). During the last decade the

interest in cassaA^a breeding has groAvn and it has been recognized that biotechnology-

might be a useful tool for genetic improvement of cassava; especially since traditional

breeding is very difficult. High heterozygosity, irregular flowering, Ioav seed set and

variable germination rates constrain the crossing of different cassava cultivars to

combine desirable traits. Genetically engineered plants could complement, these

efforts and contribute to a sustainable agricnltuie and an improved diet in the third

world countries.

Gene transfer to plant cells can be performed by tAvo different systems: di¬

rect gene transfer or Agrobacferivm-mQdiatQd gene transfer. Direct gene transfer

methods, such as microinjection, PEG ticatmcnt. calcium-phosphate precipitation

or electroporation. mostly need specific protocols to regenerate fertile plants from

protoplasts. On the other hand, cliiect gene transfer through bombarding small

DNA-coated particles to intact, cells can be used to transform organized tissues

(Klein et ah, 1988). One of the devices that Avere developed for biolistic transfor¬

mation is the Particle InfloAV Gun. Avhich is inexpensive and simple to use (Finer

et ah, 1992). Both methods have been used to transform cassava: cotyledons from

somatic embryos were transformed via Aqrobactenum, and particle bombardment (Lict ah, 1996; Legris et ah, 1998) and embiwogenic suspensions AArcrc transformed via

Agrobacterivm, and particle bombardment (Schöpke et, ab, 1996; Raemakers et ab,

1996; Gonzalez et ab, 1998).

As cassaAra is groAvn as manv different land races, it is crucial that these regener¬

ation and transformation systems can be applied to a Aviclc range of cultivars. The

transferability and adaptability to an African cassava cultivar were assessed in order

to engineer African cassava mosaic vims resistant cassava.

CHAPTER 4. CASSAVA REGENERATION AND TRANSFORMATION 57

4.3 Materials and methods

4.3.1 Plant material

In vitro culture of cassava (Manihot esculenta Crantz)

Cassava cultivars TMS 60114 (kincllv provided by UTA) and YlCol22 (kindly pro¬

vided by CIAT) were maintained as shoot, cultures in Magenta-vessels on basic

medium BMS (MS salts and vitamins (Alurashige and Skoog, 1962) Avith 2% su¬

crose, supplemented Avith 2 //Al C11SO4 (Schopkc ct ah, 1993) and solidified with

0.7% agar, pH 5.8). The cultures Avere kept at 25 "C at an 18 h photoperiod anel

subcultured every 8 weeks, transferring the shoot apexes to fresh medium.

Suspension cultures

Embryogénie suspension cultures avcic established from fiiable embryogénie calli of

cultivar TMS 60444. The suspensions Avere grown axcnicallv in liquid SH medium

(SH salts with AIS vitamins. 6% sucrose and 12 mg/1 picloram. pH 5.8 (Schenkand Hildebrandt, 1972; Taylor et ah. 1996)) on a rotaiy shaker (80 rpm) under

continuous Ioav light in a groAvth chamber (Infors Incubator HT04). Suspensions

Avere subcultured once to twice a week depending on the desired growth rate. Every

four Aveeks the suspensions were filtered through a 1 mm2 mesh sicA^e and larger

particles were discarded. For matination. the suspensions Avere transferred to solid

maturation medium (BAIS with 4% sucrose and supplemented with 1 mg/1 picloram)and subcultured CA-erv Iaa-cd weeks as described (Racmakcrs et ah, 1996). Variations

of maturation medium consisted of BMS supplemented Avith 0.5 mg/1 picloram, 2

mg/1 picloram L mg/1 NAA or no picloram. A [attire embryos were transferred to

germination medium (BAfS supplemented Avith 1 mg/1 BA) for shoot, development.

Regeneration via organogenesis

Cassava mcristems Avere excised from shoot cultures and transferred to BMS con¬

taining 12mg/l picloram (Taylor et ah. 1993) to induce embryo development. To

remove faster groAving callus, somatic embryos AA-ere subcultured every 4 Aveeks,

therebv establishing a evelic somatic embryo system. Mature somatic embryos Avere

harvested and transferred to maturation medium (BMS supplemented Avith 0.1 mg/1

BA). Green cotyledons from mat ruing embtwos Avere cut into pieces of 1 - 3 mm2

and transferred to organogenesis medium (BAfS supplemented with 1 mg/1 BA and

0.5 mg/1 IBA). After 20 da\'s of induction, shoots or organogenic structures could

be detached and transferied to elongation medium (BAfS supplemented with 0.4

CHAPTER 4. CASSAVA REGENERATION AND TRANSFORMATION 58

mg/1 BA). Elongated shoots Avere moved to BALS for rooting. Additional shoots

could be harvested until up to three months after induction. In order to enhance

regeneration, various organogenesis and elongation media AA-ere tested. Organogen¬

esis medium Avith different auxins (0.1 mg/1 IB A, 0.25 mg/1 IBA, 0. L mg/1 NAA or

0.25 mg/1 NAA), with different concentiations of BA and IBA (1.5 mg/1 BA with 1

mg/1 IBA, 1 mg/1 BA with 0.8 mg/1 IBA, 0.5 mg/1 BA with 0.1 rag/1 IBA and 0.5

mg/l GA.3 or 1 mg/1 BA Avithout, IBA) and organogenesis medium prepared Avith B5

salts (Gamborg ct ah. 1968) Avere tested in different experiments. Furthermore, an

elongation medium with additional GA^ at 0.1 mg/1 was tested. Recent, results aris¬

ing during the course of these experiments shoAved that AgNOs had a positive effect

on organogenesis of cassava (P. Zhang, pers. connu.), therefore, AgN03 AA-as added

routinely to organogenesis medium at a concentiation of 4 mg/1 in later experiments.

4.3.2 Bacterial strains and constructs

E. coli strain XLl-Bluc Avas purchased fiom Stiatagcnc (La Jolla, CA, USA). A.

tumejacicns strain GA*3101, containing helper plasmid pGV2260 (Dcblacre ct ah,

1985) was kindly provided bv B. "Finland. Ziiiich.

All DNA manipulations weic peiformed according to standard procedures (Ma-niatis et ah, 1982). Nucleotide numbeiing of the ACMA* genome refers to pJS092

and pJS094 (Stanley and Davies. L985). DNA A and names of the open reading

frames are according to suggested nomenclature (Davies and Stanley, 1989), unless

the gene function is known. In this case the name of the gene product is indicated.

The bidirectional ACAIA* piomoter was pioduced bv PCR amplification of ACMA'*

DNA A using primers ACAfA'c (GGAA -2755- GCTTTTTGACCAAGTCAATT-

GG -2776) and ACMVs (300-GTGGTACCCACTATTGCGCACTAGC -267). The

ACMA* promoter AA-as introduced as a Kpnl/Munl fiagment bctAvccn the two to¬

bacco scaffold attachment legions (SAR) (Brevnc et ab. 1992) in the backbone of

pGluChi (Bliffcld et ab, 1999). flic baistar ORF (Haitley, 1988) was introduced as

an Ncol/Psll fragment under the contiol of the AC I promoter, Avhile the barnase

ORF (Hartley, 1988) (both kincllv provided by .1. Fütteret. Ziiiich) Avas introduced as

a blunt-end fiagment into the blunt Spel site tinclci the control of the AVI promoter.

Both ORFs Avere introduced together with a 35S terminator. The hvgromycin resis¬

tance cassette AA-as cloned as a blunt-end fiagment downsticam of the barstar gene,

resulting in plasmid pACAlVbb (see also Fig. "4.1"). Correct cloning of inserts into

the vector Avas confirmed bv restriction digests and sequencing.

In order to transform plants with Agrobaclcrium. the barnase construct Avas intro¬

duced into pNCl as a complete l-oYel-fiagment. pNCl is a pCambial300 backbone

CHAPTER 4. CASSAVA REGENERATION AND TRANSFORMATION 59

t-3

Hi

"a *3 ^

i< do^

~H SAlY~}[35S|JBia-nase| rjTACftlV [fil^^ hpt H^C/^^%)—

Figure 4.L: Schematic representation of barnase expression cassette. Barnase

expression cassette showing the position of the cloned ACMV DNA A promoter between

the barnase and the barstar ORFs. The barnase ORF contains the intron from rice tungro

bacilli form virus; both ORFs can a* a 35S terminator (35S). An hpt ORF under the control

of a 35S promoter(35SP), Avith a nos terminator (nos1) is included as a selectable marker.

The whole expression cassette is Hanked by scaffold attachment regions (SAR). The bar

over the map represents the fragment amplified by PCR.

Avith a pMCS5 polylinker (AfoBiTec. Germany) containing an LoYel site. The re¬

sulting plasmid, pNCbb. AA-as then elcctroporaled (Alattanovich et ab, 1989) into

GV3101 (pGV2260) resulting in strain GA'barnase for agroinoculation of seedlings.

A defective interfering (Dl) DNA (Stanley et ab. 1990; Frischmtith and Stanley,

1991), kindly proA-idecl bv T. Frischmuth. Stuttgart, Avas cloned together with a

hvgromycin resistance gene under the contiol of a 35S promoter (construct pNPf).The hvgromycin resistance cassette Avas introduced as a Sail/BamUl fragment into

the Xhol and BamYLl sites of the DI DNA construct. For construct pDIluc, the

same DI DNA Avas combined as a Sad fragment, Avith a 35S-luciferase cassette as a

Hin dill/Aalll fragment in a pSP72 vector (purchased from Promega, Catalys AG,

Switzerland).

4.3.3 Transformation

Particle bombardment

Cotyledon explants Avere harvested from secondai'}' embrwos and transferred to trans¬

formation medium (BMS Avith 10% sucrose) 18 - 2 f h prioi to particle bombardment.

Embryogénie clusters avcic collected from suspension cultures and spread on sterile

filter papers on transformation medium L8 - 24 h before transformation. The particle

infloAv gun used is a microptojectilc accelerator (Finer ct ah, 1992), AAdiich is equipped

Avith a 2-Avay solenoid valve Lucifer E121K14 instead of the described one (ASCO,Floiham Park. N.T. Red Hat II). Commeiciallv aATtilable gold-particles (Aldrich or

BioRael) were coated with DNA using a protocol modified from EMBO Advanced

Laboratory Course (Potrvkus et ab. 1993). Briefly, 2 /d DNA (0.1 //g//d) were added

into a tube containing 25 /d of gold-particle suspension (50 /yg//d) and DNA Avas

CHAPTER 4. CASSAVA REGENERATION AND TRANSFORMATION 60

precipitated on particles using CaCR- spermidine and ethanol. The DNA-particle

solution Avas vortexed shortly before loading 4.5 /d per shot. For bombardment,

helium pressure Avas kept constant at 5 bar. the target plate was positioned at, a

distance of 15 cm and the 500 //hi mesh stopping grid at a distance of 10 cm. Some

parameters for transformation of cassa\-a cotyledons have been partially optimized

by monitoring of tiansient GLAS expiession (Legris et ab, 1998). The bombarded

cotyledons or suspensions Aveie transferred to organogenesis or SH medium respec¬

tively 4 - 26 h after shooting and hvgromvein, at a concentration of 15 or 17.5 mg/1,Avas added 3 days after bombai ciment of the cotAledons. Emerging shoots could be

transferred to BMS between 20 elavs and 3 months after transformation.

Luciferase selection of transformed suspensions was performed using a sloAV-scan

CCD camera (CCD 3200 LN/C, Astrocam Ltd, Cambridge, UK) that detects pho¬

tons, which are emitted clue to the turnover of the luciferin substrate by the lu¬

ciferase. The luciferin substrate mixture (liquid BMS supplemented Avith 1 mM

click beetle luciferin (Promega) and ImAf YTP (Kost et ab. 1995)) was applied im¬

mediately before taking images on suspensions that AA-ere spread as a thin layer on

solid SH medium. Reference images, to localize the emitted light, fiom the expiants,

were taken by exposing the chip for 100 msec to i effected light. For bioluminescence

images, the time with an open diaphiagm. AA*as L0 min. Lucifcrase detection for

selection Avas performed every 3 to 4 Aveeks. Lucifcrase positive embryonic clusters

Avere isolated and either tiansferred to fresh SH medium for further multiplication

or transferred to maturation medium and subcultured every 2 Aveeks.

Agrobacterium-mediated transformation

Strain OA'barnase was groAvn for 2 davs in liquid AB medium (Chilton et ab, 1974)

containing the appropriate antibiotics at 28 °C on a rotary shaker (280 rpm). Before

cocultivation, the bacteria aati-c diluted to OD-fa0 0.5 and preindueed for 5 hours in

liquid BMS supplemented with 200 mAI aeetosviingonc. pbl 5.2. Cotyledon expiants

from secondary embryos Avere inoculated with Aqrobactenum, for 30 min, transferred

to cocultivation medium (BAfS supplemented with 100 mM acetosyringone, 1 mg/1BA and 0.1 mg/1 IBA) and cocultured for 3 cbrvs. Expiants were washed with

liquid BA4S, blotted dry on filter paper and tiansferred to organogenesis medium

supplemented with 500 mg/1 carbenicillin and 10.5 mg/1 hvgromycin. After 20 clays

the first developing shoots aa'Cic transferied to BAIS.

CHAPTER 4. CASSAVA REGENERATION AND TRANSFORMATION 6L

4.3.4 Molecular analysis of resistant shoots

Total DNA from regenerated shoots and a Avildtvpe control Avas extracted using the

NucleonPhytopurc kit (Amersham Life Science, England) as described by the man¬

ufacturer. PCR reactions (Alullis and Faloona, 1987) using L rtg of plant DNA, were

performed in a final volume of 50 fd using 5 units of Taq polymerase (QIAGEN,

Hilden, Germany). Primers were added to a final concentration of 1 /.dYl each and

clNTPs (Boehiinger Alannhcim, Germany) AA'erc used at a concentration of 250 pM.

PCR cycles consisted of a 1 min clenatutation period at, 95 °C, a I min annealing

period at around 60 °C (depending on GC content and length of primer) and an elon¬

gation period of 1 min at 72 TJ. Amplified products Avere separated by electrophore¬

sis through an agarose gel. Primers AA-ere designed to amplify a 600 bp fragment

of the barnase ORF and of part of the ACAIA* promoter (ACMVF (5:-CCACTA-

TATACTTACAGGCC-3') and bamaseF (5'-C.ATGTTCGTCCGCTTTTGCC-3'))and a 550 bp fragment of the lrvgromvein resistance cassette (35Shpt5 (5'-GAA-

AAGGAAGGTGGCTCC-3") and hpt3 (5'-AATAGGTCAGGCTCTCGC-3')). As

internal control primeis Q3 (5'-TGACGGAGTAACATCAATGT-3') and Q4 (3"-

TACAATGGCTTGGTCATGAC-3": kmdlv provided by S.Bohl, Zürich) were used

to amplify a 380 bp fragment of the branching enzyme (Kallak et ah, 1997).

CHAPTER 4. CASSAVA REGENERATION AND TRANSFORMATION 62

4.4 Results

4.4.1 TMS60444 transformation and regeneration via organo¬

genesis

Somatic embryos AA-erc subcultured cwerv four weeks cither to fresh embryo induction

medium or to maturation medium. Cotvleclon expiants AA-ere harvested for particle

bombardment after 10 to 14 clavs oi as soon as cotyledons were light green and

around 5 - 10 mm2. Three clavs aftci bombai ciment with pACMVbb or pNPi,

selection using hygromvein was started at a concentration of 15 mg/1. The first

organogenic structures could be seen after I to 6 Aveeks on organogenesis medium

in about, 90% of the expiants, although these structures looked slightly different

from organogenic structures of AICA122 (-,ee Fig.[4.2]). resembling primary embryos

emerging from a green, elongated structure. When these structures Avere transferred

to elongation medium, no shoots emerged and the embiyo-like bulbs eventually dried

out. Subculturing to fresh organogenesis medium also had the same effect. None

of the tested organogenesis media induced production of any structures similar to

organogenesis of AICol22. neither did the elongation medium supplemented with

GA}, improve regeneration. A summary of some of the tested media is shown in

table 4.1. Organogenesis medium wit h onlv 0.5 mg/1 BA (instead of 1 mg/1) or

Avithout IBA produced roots on 2% of the expiants while higher concentrations of

BA (2 mg/1) produced mostly callus anel foAv organogenic structures. Root forma¬

tion Avas inhibited if expiants were kept in the daik but callus formation was further

enhanced. The most, expiants Avith organogenic stiuctures (85%) Avere observed on a

medium containing 1.5 mg/1 BA with 0.5 mg/1 IBA cultured in the light and on the

standard medium (95%). but no shoots could be regenerated. In addition, exper¬

iments with organogenesis in the daik and the different transformation conditions

tested (variable times of pre- and postplasmolvsis) did not have any positive effect

on the regeneration of shoots. At least 50 explants Avere used for each individual

treatment and out of a total of around 8000 bombarded expiants only 4 lines could

be regenerated and rooted. All four lines Avere regenerated using the standard pro¬

tocol, with two lines bombarded Avith the barnase construct and two Avith the DI

construct. Neither the presence of the barnase genc/DI DNA, nor the hvgromycin

resistance gene could be confirmed bv PCR analysis. The internal control, part of

the branching enzyme, Avas correctly amplified foi all four plants.

CHAPTER 4 CiSSAViRFGLNERATIOA IAD 1R AN3I0RM iTION (O

Figuie 1 2 Organogenic structures of cassava cultivars TMS6Ö444 and MCol22

(A) Oiganogcmc structures on TMSbOill (ot\l(don iftcr 20 davs on organogenesis

medium (B) Organogenic stiurtuie on AlCol22 cotA l< don after 11 davs on organogenesis

medium

4.4.2 MCol22 transformation and regeneration via organo¬

genesis

Vs regeneiation of 1AIS60441 pioAecl \<i\ drffrc ult if awis decided to use eultuai

MC0I22 for huilier expeiiments Secondan somatic ombnos of AfCol22 (kmdh

provided by S Phansm Bangkok) aacic geimmated and bombaided using PIG 01

m one evpeimrent ( ">(!(.) expiants) [qiobadrniim Since non-transgeme plants legen-

eiated under selee hon a higher com entiation ot h\giom\cra awis used for selection

(17 5 nig 1) and also \g\0> AAas added loutmeh to the oiganogenesis medium

Organogenic stiuctuies could be detected as soon as 3 aaccYs after bombardment

and shoots could be hanested until up to 5 months latei Out of 6200 expiants

bombarded with p ACMA bb 7 lines ( ould be icgennated and of 2700 expiants bom¬

barded AAifh pNPI I lines < ould b< legeneiated \o shoots could be icgeneiated

(10m the» iqiobadniiiin-medxàïed tiansfoimation oxpeuitin nts Fach organogenic,

stiuctme (oiigm of one- plant Inn) produced more than one shoot (see Fig [ 1 I])

The 11 regenerating lines produced about 50 shoots m total of A\hieh about 90%

could be looted 111 BAfS Aeithei tlie bainasc» OR! nor the DI DA \ noi the h\-

gionnun resistance gene could be detected m am of the lines Ida PCR anahsis

CHAPTER 4. CASSAVA REGENERATION AND TRANSFORMATION 64

Table 4.1:

Influence of different hormone concentrations In the organo-

genesis medium on the formation _of organogenic structures.

Hormone cone, (mg/1) % of expiants with org. structure

BA IBA light dark

1 0.5

0.5 0.5

1.5 0.5

2 0.5

1 0

"additional root, formation

The expected part of the branching enzvme a\xis correctly amplified in all lines as

an internal control. An example of a PCR with some of the shoots bombarded with

the barnase constmct is shoAvn in Fig.[4.3].

4.4.3 Transformation and regeneration of suspension cul¬

tures

Suspension cultures of cultivar TA1S6041 f Avere established from friable cmbrvogerric

callus (FEC) and maintained as described (Taylor et ah. 1996). Freshly filtered sus¬

pensions Avere used for transfoimation. spreading a thin layer of suspension on a

filter paper of 2 cm diameter on transformation medium. All suspensions were bom¬

barded using the particle infioAv gun and the construct pDIhrc. After transfoimation,

the suspension cells of one experiment (10-20 dishes) AA'crc combined and transferred

back to liquid SH medium. Three to four weeks after bombai ciment, suspensions

were spread on solid SH medium and analyzed for lucifcrase activity. A 1 cm2 region

of suspension around the luciferase positive spot Avas isolated anel cultured individ¬

ually in liquid SH medium. Only after the second round of selection these luciferase

positive foci were transferred to solid maturation medium. All tiansformecl suspen¬

sions (200 dishes in 10 experiments) had single lucifcrase positive spots 3-4 weeks

after transformation (around 10 - 20 spots per experiment), however, about 50% of

these were not positive when tested for the second time. Furthermore, around 20 -

30% of the isolated luciferase positive suspensions turned Avhitc and stopped dividingafter the luciferase assav. Theicfore. in later expeiimcnts. transformed suspensions

were tested for luciferase activity onlv 2 months after bombardment, before transfer

to maturation medium. In these cases onlv very few luciferase positive spots (1 -

95

50

85

80

10

55

60

30

50

0

CHAPTER 4. CASSAVA REGENERATION AND TRANSFORMATION 65

Internal control Barnase

bp sA sC sD sE sH sK sL sM sN It?C) sA sC sD sE sit sK sL sMsN + II2O bp

Figure 4.3: Gel electrophoresis of PCR analysis of cassava transformed with

pACMVbb. No amplified product of the barnase could be detected in any of the tested

shoots. As an internal control, a 380 bp fragment of the branching enzyme was amplified

for all shoots. 10 ng of pACMVbb avcic used as a positive control for the barnase PCR:

sterile water served as a negative control.

2 per experiment) could be detected. Four experiments still had luciferase positive

cell clusters 4 months after transformation (2 months on maturation medium), but

none of these could be regenerated. Maturation of cmbrvos was achieved onlv in

one experiment (luc-5) but. Avhen transfeired to germination medium, these embryos

did not develop further. No improA-ement of matmation could be observed Avith the

various tested hormone concentrations in the medium. Only in maturation medium

containing 1 mg/1 NAA two embiwos Avith green cotyledons were found, but after-

transfer to germination medium both of these turned white and did not develop

further.

CHAPTER 4, CASSAVA REGENERATION AND TRANSFORMATION 66

Figure 4.4: Regeneration of multiple shoots from organogenic structure of

MCol22 after 3 months on elongation medium.

CHAPTER 4. CASSAVA REGENERATION AND TRANSFORMATION 67

4.5 Discussion

Production of transgenic cassava plants has been reported using both Agrobactenum

and particle bombardment (Li et ah, 1996: Raemakers et ah, 1996; Gonzalez et ah,

1998) and regeneration via organogenesis of cotvledon expiants or via germination

of embryogénie suspensions. Applying these transformation systems to different

cultivars of cassava is important as cassa\*a is gioAvn as manv land races and often

exhibits Ioav fertility. Therefore, crossing of iicav genes into focal varieties might be

difficult. The goal of this Avork AA'as to strich" the applicability of the biolistic trans¬

formation system together with the icgeneration via organogenesis to the African

cultivar TMS60444.

The regeneration frequency of cassava cult ivai TMS60444 Avas low under all the

different conditions tested and onlv fecw shoots could be regenerated and rooted.

This could be due to different, reasons. Genotype dependent variations of regen¬

eration have been reported befoie (Kartha. 1971: Kallak et ah, 1997), therefore it

is not, surprising that a protocol established for organogenesis of AfCol22 does not

apply to the organogenesis of TAIS60441. More profound adjustments would be

needed, since our results demonstrate that minor changes in hormone concentra¬

tions of the standard media could not enhance regeneration. Preliminary results

in our laboratory show a considerable effect, of AgNYly on the regeneration of this

cultivar (P. Zhang, pcrs. comm.), hoAvevcr, at the time of these experiments, these

resutts were not available. The positive effect of AgNO^ on organogenesis of oil

seed Brassica, species (Eapen and George. 1997) and on icgeneration on a variety of

plants (Songstad et ah, 1988; Chi et ah. 1990) has been reported before, although

the actual mode of action has not vet been elucidated.

Regeneration of AJCol22 proA-ecl to be mote efficient, especially in combination

with particle bombardment, which in fact enhanced the formation of organogenic

structures. The Avounding of cells by particle bombardment and the thereby trig¬

gered wound reaction could be responsible for this effect. Nevertheless, not all

organogenic structures could be regcneiated to shoots. The step between the first

small shoot primordia and the complete shoot is the bottleneck in the regeneration

via organogenesis. Therefore, optimization of the protocol should not only be con¬

centrated on the organogenesis medium, but also on the elongation medium and on

the timing of transfer of organogenic structures to elongation medium. Our results

indicate that it is crucial to use only 10- to 14-dav-old cotyledons for transformation,

since older cotyledons form less organogenic struetuies and cannot be regenerated

to shoots, and younger cotyledons are too small to be used.

Regenerated shoots of both TMS60 144 anel MCol22 were not transgenic, as

CHAPTER 4. CASSAVA REGENERATION AND TRANSFORMATION 68

shown by PCR analysis. Transformation Avith barnase - even in combination with

barstar - can be difficult (see Chapter 3: (Mariani et ab, 1990)) due to its high

toxicity, which leads to earlv loss of transformed cells. Also Dl DNA, consisting

of part of the ACMV DNA B. might have a negative effect on plant cells. As the

presence of the hygromvein resistance gene could not be proA^en either, the regen¬

erated shoots must have escaped selection. Selection with a higher concentration

of hygromvein (17.5 mg/1) could not prevent the regeneration of untrans formed

shoots cither, even though shoot regeneiation could be efficiently suppressed in con¬

trol expiants. It, appears that transformation via particle bombardment requites

a tighter selection system, since rccoA-civ of non-transgenic plants Avas not a se¬

vere problem after Agrobacteri um-mediated transformation (Li et ab, 1996). This

problem could be partlv clue to the enhanced icgeneration observed after bombard¬

ment, or to the smaller sectors transformed bv panicle bombardment as compared

to Agrobacterium-mediatcd transformation. As shoots regenerated Ala organogene¬

sis do not, originate fiom a single cell, it is less likely that a completely transgenic

shoot primordia is formed by biohstic transformation and small transformed sectors

could be lost after partial shoot formation due to the negative effect of the barnase

gene. Since cassava is groAvn as many landraces, biolistic transformation, which is

less genotype-dependant, may still be desirable to complement transformation us¬

ing Agrobactenum,. Further method clcA-elopment will be needed and selection will

have to be optimized. A selection system using luciferase expression in addition to

antibiotic selection for monitoring transgenic shoots has been proposed. Luciferase-

based selection has the advantage that no non-tiansgcnic shoots will be regenerated,

Avithout further enhancing stress due to high antibiotic concentrations.

A luciferase-based selection system Avas applied for the regeneration of trans¬

genic plants from suspensions. Luciferase positive embryogénie clusters could still

be obseiwecl up to fom months aftei transfoimation, but, also here regeneration to

complete shoots proA'ecl to be difficult. Diffeicnt factors may have influenced the

regeneration frequency. One is the age of the suspension culture used, since voungcr

suspension cultures seem to regenerate more easily and less somaclonal variation,

due to a prolonged time in tissue culture, would be expected. Our experiments

indicate a connection between suspension age and regeneration capacity (data not

shown, P. Zhang, pers. coinm.). Furthermore, the stress caused by lucifcrase expres¬

sion, which requires ATP. might affect transformed cells negatively in comparison

to untransformed cells. These avouIcI then groAA- faster and supersede the luciferase

positive cells. Culturing smaller A-olumes of suspensions (i.e. transferring less tin-

transformed cells after the luciferase assav) is not optimal, since a certain density

CHAPTER 4. CASSAVA REGENERATION AND TRANSFORMATION 69

of cell volume in the liquid medium is required for the survival of the suspension.

Regeneration has uoav been enhanced by using 1 mg/l NAA instead of picloram in

the maturation medium and bv transferring cotAdcdons of regenerated mature em¬

bryos to organogenesis medium, instead of germinating embryos directly at a loAver

frequency (P. Zhang, pcrs.comm.). This transformation system has been further im¬

proved by selecting with 50 mg/l hygromvein and transforming with Agrobaderium,

and is now applied routinely in our laboratory (P. Zhang, in prep.).

Chapter 5

General Discussion

Hunger and malnutrition are among the most severe problems in many areas of the

world, particularly in Africa. At present, over 800 million people are starving every

year while the Avorld population incicascs bv 85 million people (FAO, 1998). It has

been estimated that food production has to be doubled during the next 25 years in

order to keep up with the world population gicnvth. As the land available for agricul¬

ture is declining clue to urbanization, soil erosion and salinization (Brown and Kane,

1994), the future increase in food production must, come from higher productivity

and more efficient use of the existing resources under sustainable conditions.

Among the traits to engineer in cas^rva. resistance against African cassaA-a mosaic

virus (ACAIV) has been listed as the highest pnoiity in the Cassava Biotechnology-

Network (CBN, 1995). which was confirmed again at the CBN meeting in Uganda

1996. ACA4D is the most dewastating disease in cassava, leading to total crop fail¬

ures locally and also threatening ccitain varieties with extinction. The benefits of

virus resistant cassava can onlv be calculated appioximately by using the figures of

estimated losses. Avhich e.g. in 1993 in Uganda reached LIS$ 180 million per year

(Otim-Nape et, ah. 1994b). In case of subsistence farmers, at present severely threat¬

ened in their existence Ida- acute food shortage, the cost in human lives cannot be

estimated in dollars.

The goal of this thesis was to develop and evaluate a hcav ACA4V resistance

strategy in a model system and to assess the possibility of transferring this resistance

to an African cassava cultivar. The resistance is based on a regulatable toxin/anti¬toxin system mimicking a hypersensitive reaction by using the regulated ACAIA*

promoter in combination Avifh the barnase. an RNase of Bacillus amyloliqvcjaciens.

and its specific inhibitor, the baistar (Haitlcv. 1989).

The properties of ACAIA* piomoter regulation Aveie first studied transiently in

tobacco and cassava protoplasts and in stably tiansformed tobacco as a model plant,

70

CHAPTER 5. GENERAL DISCUSSION 71

system using two different hiciferases as reporter genes. The bidirectional promoter

of African cassava mosaic virus is regulated bv viral proteins during the infection cy¬

cle, permitting a discrimination between carlv and late genes. The following model

has been proposed: Earlv after infection the complementary-sense gene products

of Rep (replication associated protein), TrAP (transcription activator protein) and

REn (replication enhancer piotein) are produced. Rep then reduces its OAvn tran¬

scription while REn enhances replication and TrAP activates virion-sensc tianseiip¬

tion. The late genes CP (coat protein) and NSP (mo\-ement protein) arc produced

and encapsidation and spread of viral DNA begins (Frischmuth, 1999). The results

on promoter regulation piescntecl in this thesis aie essentially in agreement Avith

and confirm the presented model, but in addition clraAv a more differentiated picture

of ACMV promoter regulation. It could be shoAvn that TrAP not only activates

expression of the v-sense ORFs but also of c-sense ORFs (see Figs. [2.4] and [2.5])and that, activation of c-sense expression is inhibited by small amounts of Rep. Our

results using the complete DNA A for cotransfoimation can confirm the aforemen¬

tioned model: a doAvnregulation of c-sense expression and a strong upregulation of

v-sense expression.

Surprisingly, the regulation of the DNA B promoter in cassava proved to be

the opposite fiom that of the DNA A promotei. Avith no significant effect on v-

sense expression and an upregulation of c-sense expression. NSP has been shoAvn

to transport the DNA out of the nucleus (Sanderfoot et ab, L996) while the MPB

forms encloplasmatic retictilum-dorh-ed tubules that extend through the cell Avail

to the next cell (Ward et ab. 1997). In the case in Avhich only NSP is transiently

expressed in protoplasts, the protein can be observed solely in the nucleus, while,

when cotransformed Avith AIPB, it can be found also in the cytoplasm (Sanderfootand LazaroAvitz, 1996: Lazarcnvitz and Beachy. 1999). It, can be speculated that,

the enhanced production of movement piotein helps relocating the nuclear shuttle

protein NSP with bound viral DNA to the cvtoplasm, Avhere it can be tiansferred

to adjacent cells, thus spreading viral DNA.

On the other hand, the upregulation of A'-scnse expression is not as pronounced

in tobacco cefls, therefore, host factors, which are different in cassava and in to¬

bacco, seem to have an influence on the promotei regulation. Similar observations

of different results from infection of a model plant as compared to the natural host,

arc reported for Beet curlv top virus infecting A*, tabacinu and B. vulgaris, respec¬

tively (Frischmuth cd ab. 1993a). This illustrates the limitation of model systems

and emphazises the necessity of an assay system that actually reflects the natural

situation. All transient assavs reported here. Avere peiformed in protoplasts oiigi-

CHAPTER 5. GENERAL DISCUSSION 72

nating either from mesophyll cells, for tobacco, or from suspension cells, for cassava.

This method is extremely convenient since it is simple, fast, and has the advantage

that the cells used are quite uniform. Nevertheless, the behavior of a whole plant

cannot be entirely infeired from the results obtained from protoplasts, Avhich arc

single cells subjected to stress dining protoplast isolation and transformation.

A logical step to folloAv up transient expiession assays is the stable integration of

reporter genes to studv promoter regulation on the whole plant level. As it Avas tech¬

nically impossible to produce transgenic cassava plants, wc again relied on tobacco

as a model plant, in spite of the limitations of this system. In cxpciintents with to¬

bacco plants containing the ACAIA'-lucifcrasc constructs, several discrepancies Avith

earlier transient expression studies could be found. First, the basal firefly lucifeiasc

expression in transgenic plants Avas higher than the expression of Renilla, luciferase,

Avhilc in transient expiession assavs in piotoplasts this relation Avas inversée!. These

results seem very promising for our intended vims resistance strategy, since this

would indicate, that expression of the bainase and barstar from the ACAIY pro¬

moter could be tolerated in transgenic plants, as more barstar than barnase would

be produced in a non-infected cell. Second, in protoplasts of tiansgenic plants, the

activation of lucifcrase expression by TrAP alone could not be observed anvmore. It

appears as if the regulation of the integrated ACAIA/* promoter did not correspond

to that of the viral promoter dining a natural infection. For our purpose of devel¬

oping a virus resistance strategy using the integrated, regulatable ACMV promoter,

however, it was necessary to sIioav that DNA A can still regulate an integrated pro¬

moter, litis was confirmed bv our results. Additionally, our results from different

plant, lines illustrate the necessity for the production of many different transgenic

lines with the same construct, since basal levels of repoiter gene expression and

subsequent upregulation \-aried strongly betAA-een separate lines. The variation in

expression could be due to different integration sites in the genome, but, also to the

number of transgencs integrated. Judging from our results, further testing of the

regulation of the ACAIA" promoter in transgenic cassava plants avouIc! be required,

although results fiom cassava protoplasts and from transgenic tobacco plants indi¬

cate that the ACMV promoter can still be regulated, even Avhen integrated in the

plant genome. Since the cassava transformation system is not routine enough yet,

production of large numbers of transgenic plants with the lucifeiasc construct Avas

not feasible during the course of this thesis.

Another important factor to consider is that the DNA structuic of the integrated

promoter is different fiom the one of an infecting virus. That this aspect has to be

considered could be sIioavu bv experiments eompaiing linear and supercoiled input,

CHAPTER 5. GENERAL DISCUSSION 73

DNA. We could show that when linear DNA was used for cotransformation TrAP

did not, function as an activator anymoie and only Avhen the complete DNA A

Avas used for transformation, a slight increase of A'-sense expression could be found.

The structure anel context of the DNA is important in promoter regulation and

transcription (Gutierrez et ab, 1995: Frv and Farnham, 1999; Muro-Pastor et ah,

1999). It might be possible, that a certain bending of the DNA is needed in order

to bind TrAP. On the other hand. Avhen the complete DNA A is expressed, other

proteins, like the Rep or the REn. might help to icmoclel the promoter DNA. such

that TrAP can activate transcription.

It is shoAvn in transient protoplast assays, that Rep cloAvnrcgulatcs both v- and

c-sense transcription, while TrAP enhances transcription from both sides. Only

when both proteins are present, aftei cotransfoimation with the DNA A, a side

specific regulation of transcription can be obseived. This can be explained by the

fact that there is either an interaction bctAvecn Rep and TrAP or that also the REn

is necessary for viral promoter regulation. The fine tuning of this system seems to be

very delicate, as results gained bv cotransforming vaiious ratios of the Rep and TrAP

constructs Avith the p.ACAfA*s shoved a high vaiiation. Furthermore, the effect of

REn, AAdiich might still play a role in the regulation process. AA-as not systematically

studied in these experiments. It could be speculated that by enhancing replication,

the transcription rate might be altered due to a shift, in the availability of certain

viral or host factors.

The results on promoter regulation presented in this thesis show that a viral pro¬

moter integrated in the plant genome can be regulated bv the ACMV DNA A. This

may indicate that an infecting Alms could achicA-e an analogous result. Furthermore,

it could be shown that in transgenic plants, the basal level of c-sense tianscription

is higher than v-sense transcription, indicating, that in plants transformed Avith

pACMVbb, more barstar than barnase aa-ou1cI be produced, therebv neutralizing the

toxic effect of the barnase. The presented results imply that, the ACMV promoter

is usable in the intended strategy of mimicking a hypersensitive reaction.

Obviously, many parameters of the presented Alms resistance strategy cannot

be simulated using reporter genes. Therefore, tobacco Avas chosen for pACMVbb

transformation, although even this proved to be problematical. Of the first 8 trans¬

formation experiments, only one plant containing the complete insert could be re¬

generated. Possibly, in most lines the bainasc Avas expressed at higher levels than

the barstar even from an uninduced promoter and. theicfore. onlv those Avith par¬

tial copies of the barnase could be regenerated. Another possible explanation is the

different regulation or non-existent regulation of the ACAIA* piomoter at the callus

CHAPTER 5. GENERAL DISCUSSION 74

level. For tomato golden mosaic virus it has been shown that repression of v-sense

transcription is not maintained in unorganized tissue (Sunter and Bisaro, 1997). As

transgenic tobacco plants are regenerated through a callus phase with subsequent

organogenesis, it, could be that expiants containing an intact copy of the barnase are

lost at, this stage due to uncontrolled production of barnase. The further downrcg-

ulation of barnase translation, using different shoit ORFs upstream of the barnase

ORF, enabled the regeneration of further transgenic plants. Nonetheless, regenera¬

tion frequencies were still lower than usual, and manv lines containing incomplete

barnase ORFs could be detected by Southern blot (data not shown).

Regenerated plants, containing the complete gene fiagment, Avere tested in a

transient ACMA-* replication assay bv shooting autonomously rcplicatablc ACMV

DNA A into leaf pieces. The amount of replicated viral DNA in shot Avildtype lea\*cs

and in shot transgenic leaves could then be compaied. In all tested transgenic lines,

viral replication was considerably reduced. shoAvmg that, due to the regulation of

the ACA4V promoter, barnase production is in fact enhanced. Beside presenting the

first indications that this system could generate virus resistant, plants, this assay-

can also be used to identify Eansgcnic plants which are silenced or plants in Avhich

the barnase expression cannot be upregulatecl sufficiently. Results from replication

assays, hoAvcver, do not give any indication on the kinetics of gene regulation leading

to barnase production. It cannot be concluded that plants exhibiting reduced viial

replication will actually be virus resistant in the held. For our purpose it is impoitant

to confine the virus to as few cells as possible and cause local cell death before

viral replication and viral movement fakes place. Otherwise, cell death due to

barnase expression will spread along the leaf together with the virus. It, is possible

to specifically destroy infected cells using the ACAIA* promoter before the virus can

spread to adjacent cells, as has been shown before Avith dianthin (Hong et ah, 1996;

Hong et al., 1997). Our system is shghtlv more sophisticated, however: the barnase

first has to overcome its antitoxin barstar. which alieadv is present in the cells at a

Ioav concentration. Whether the retardation of the barnase clue to the presence of

barstar is crucial cannot be deduced fiom results obtained with reporter genes or

the replication assav. Although, consideiing the high variation of responses in the

different plant lines containing the ACAIA*-lucifcrase construct, if can be expected

that some of the generated ACAlA*-barnase plants will be able to produce enough

barnase to overcome the antitoxin and tiigger cell death before the vims is able to

replicate and spread.

It is unclear, Avhy Y. tabacum SRI plants could not be infected with ACMV.

N. tabacum cvs. Samstm and Nanthi plants have been previously used in infection

CHAPTER 5. GENERAL DISCUSSION 75

studies (Frischmuth et ah, 1993b). nevertheless, no viral DNA could be detected in

agroinoculatccl SRI tobacco plants 2 - 3 Aveeks after transformation. As Ave have

shoAA'n in the replication assays that replication of ACMV DNA A does take place

in SRI plants, it has to be assumed, that the movement of the virus is impaired

in these plants. Whether the inability of systemic movement is due to MPB or

NSP can only be speculated since both movement proteins have to interact with

components of the host cell. Also the infection Avith another geminivirus did not

provide any conclusive results. Possibly. SiGAIA*. a virus from the New World, Avas

not closely related enough to regulate the ACAIA* promoter.

A next logical step in testing Alms resistant plants, would be the infection

through the natural vector, the B. tabaci. The icsults from these experiments could

still be slightly elifierent than after agroinoculation. since then the virus is inoculated

directly in the leaf mesoptrvll cells and not through the phloem. Furthermore, the

DNA introduced through agroinoculation has to excise itself from the plant genome,

resulting directly in a double-stranded DNA, Avhile naturally introduced viral DNA

is single-stranded and transcription cannot occur directly. Replicated ACAIA'* DNA

can only be found 2-3 davs after inoculation, -while lucifcrase expression driven by

thc ACMV promoter can be measured alieadv after 21 hours. It thus appears that

gene transcription and subsequent promoter regulation occur before viral replica¬

tion. These results, hoAvevcr, Avere obtained in transient, assavs Avith double-stranded

viral DNA, and it is not clear Avhethcr the single-stranded form of naturally occur-

ring viral DNA would behave differenttw Moreover. Avhiteflies can feed in more than

one site on a cassava leaf and theiebv deposit ACAIA/* in various cells across the leaf.

Depending on hewv far the virus can spread and Iicdav fast it can replicate before local

cell death due to the barnase can prevent further spreading and replication, but also

depending on Iioav far flic induced local cell death spreads due to barnase to adjacent

cells, damage might be considerable, even if systemic infection is prevented. Once

more, it is expected, that under a huge number of tiansgenic lines, the ideal tuning

of the toxin/anti-toxin system can be found.

Provided that the transgenic plants pioducecl during the course of this thesis

are Alms resistant, the next question is Iioav easily this resistance could be overcome

in the field. The ACAIA* promotei used in this strategy is conserved between the

DNA A and DNA B. In order to inactivate the integrated promoter between the

barnase and barstar, a mutation avouIcI need to take place in the promoter of both

genomic components. Aforeover mutations in both Rep and TrAP would then be

necessary to regulate this hcav. mutated promoter but not the original promoter.

The likelihood for this is statistically minimal. Another possibility for the virus to

CHAPTER 5. GENERAL DISCUSSION 76

overcome this resistance would be to accelerate replication and spread to adjacent

cells before the barnase can overcome the barstar and cause local cell death. It, can

be assumed, that, these faster viruses avouIcI spread through the leaf, initiating cell

death in infected cells on their way and thereby destroying the plant before they

can be spread to other plants through feeding whiteflies, thus becoming extinct in

a fast manner.

As mentioned before, it is necessary to geneiate many different transgenic ACM V-

barnase lines because the A-anation of tiansgene expression and viral transgene reg¬

ulation between different lines is high. The cassaA-a transformation svstem is still

being improved and transgenic plants cannot be produced routinely yet. Given that

the regeneration frequency of ACAW-barnasc tobaccos containing an intact bainasc

ORF Avas very Ioav (around 10% of all regenerated plants), it cannot be expected that

transgenic cassava plants containing this construct can be produced at this stage.

Not only Avould the necessary tissue culture AA-ork exceed our limits, also the molecu¬

lar analysis would be labor-intensive for cassava, as long as selection is not improved.

At present, too many non-transgenic plants can suiaIvc the selection scheme. These

constraints in cassava transformation and regeneration should be overcome in the

near future. The transfoimation system used now. has been improved, and more

transgenic plants aie being produced in our laboratory. Selection is tighter and at

the same time the regeneiation frequency could be improved. Therefore, it should

be possible to generate vims resistant cassava employing the promising strategy

presented in this thesis in the near future. These plants should then be tested not

only by agroinoculation of the vims, but also by exposure to the whrteflv vector and

later, in the field. In case the in, vitro lesults reported in this thesis can be matched

in the field, the same construct can either be introduced directly or through tradi¬

tional breeding into other local A-arictics. As soon as other mechanisms of ACMV

resistance are introduced in cassava, these different transgencs could be pyramided,

resulting in broader range of resistance and in a more reliable resistance also un¬

der high infection pressure in the field, thereby contributing to a future sustainable

cassaA-a cultivation and to food secmitv in Africa.

Bibliography

Akintowa, A., Ttnrwashe. 0.. and Oui fade. A. (1993) Fatal and non-fatal acute

poisoning attributed to cassava based meal. Ada Horticulturae, 375:285-288.

Arias-Garzon, D. and Savrc, R. (J 993). Tissue specific inhibition of transient gene

expression in cassava (Manihot etcvlcnta Crantz). Plant Science, 93(L-2):12L—130.

Barton, A., Binns, A.. Alatzke. !.. and Chilton. Al. D. (1983). Regeneration of intact

tobacco plants containing full length copies of genetically engineered T-DNA,

and transmission of T-DNA to Rl progeny. Cell, 32:1033-1043.

Beachy, R., Loesch-Fries. S.. and Turner. N. (1990). Coat, protein-mediated re¬

sistance: a novel type of virus resistance in transgenic plants? Trends in

Microbiology. 2:60-62.

Beachy, R. N. (1997). Mechanisms and applications of pathogen-derived resistance

in transgenic plants. Current Opinion in, Biotechnology, 8:215-220.

Beck, D., Aim Dollcrwccrd. C. Lough. T.. Balmoii. E., Afoot, D., Andersen. Ab,

O'Brien, E., and Forst er. L. (1994). Disruption of aIius moA-ement confers

broad-spectrum resistance against systemic infection by plant viruses with a

triple gene block. Proceedings of the National Academy of Sciences (USA),91:10310-10314.

Bendahmane, M. and Gioenborn. B. (1997). Engineering resistance against tomato

yelloAv leaf curl aIius (TYLCA") using antisense RNA. Plant Molecular Biology,

33:351-357.

Bisaro, D. (1996). Geminivirus DNA leplication. In DePamphilis. AL, editor, DNA

replication in eucaryotic celh. pages 833-851. Cold S pi ing Llaibor Laboratory

Press. Cold Spring Haibor. NY.

11

BIBLIOGRAPHY 78

Bliffeld, M., Munely, L, Potrvkus. I., and Fiitteier. J. (1999). Genetic engineering

of Avheat for increased resistance to poAvcleiy mildcAv disease. Theoretical and

Applied Genetics, 98:1079-1086.

Bock. K. R. (1994). Control of African cassava mosaic geminivirus by using virus-free

planting material. Tropical Science. 3i(l):102-lf)9.

Bonncss, M., Reach/. AL. Irvin. L. and Alabiv. T. (1994). PokeAveed antiviral protein

inactivates pokeweed tibosomes: implications for the antiviral mechanism. The

Plant Journal, 5:173-183.

Bradford, M. ( 1976). A rapid and sensitive method foi the quantitation of microgram

quantities of protein utilizing the principle of protein dye binding. Analytical

Biochemistry, 72:248-254.

Brcyne, P., VanMontagu. AL. and Ghevsen. G. (1992). Characterization of a plant

scaffold attachment region in a DNA fragment that, normalizes transgene ex¬

pression in tobacco. Plant Cell. 1:463-47L.

Briddon, R., Liu, S., Pinner. AL. anel Maikham. P. (1998). Infectivity of African

cassava mosaic Alms clones to cassaA-a bv biolistic inoculation. Archives of

Virology, 143:2487-2492.

Briddon, R., Watts, L, Maikham. P.. and Stanley. J. (1989). The coat protein of

beet, cuily top virus is essential for infectivity. Virology. 172:628-633.

Brotigh, C, Sunter. G.. Gardiner, W.. and Bisaro, D. (1992). Kinetics of tomato

golden mosaic virus DN.A replication and coat, protein promoter activity in

Nicotian a tabacum piotoplasts. Viroloqy, 187:1-9.

BroAvn, L. and Kane. H. (1994). Full Ilou^e, Reassessing the earth's population

carrying capacity. Noiten and Company. Ncav Yoik.

Buck, K. (1994). Geminiviruses. In Webster. R. and Granoff, A., editors, Encyclo¬

pedia oj virology, pages 517-524. Academic Press. London.

Caboche, M. (1980). Nutritional requirements of protoplast-derived haploid tobacco

cells groAvn at Ioav densities in liquid medium. Planta. 119:7-18.

Carr, J. and Zaitlin. AI. (1993). Replicase-mediated icsistance. Seminars m Virology,

4:339-347.

CBN (1995). NcAvslettcr. Technical Report 3. Cassava Biotechnology Network.

BIBLIOGRAPHY 79

Chi, G., Barfield, D., Sim, G., and Pua. E. (1990). Effect of silver nitrate and

aminoethoxyvinylglycine on m vitro shoot and root organogenesis from seedling

explants of recalcitrant Brassica genotypes. Plant Cell Reports, 9:195-198.

Chia, T., Chan, Y., and Chua, N. ( 1991). The fireflv lucifcrase gene as a non-invasive

reporter for Dendrobiurn tiansformation. The Plant Journal 6:441-416.

Chilton, M., Chilton. AL, Currier. T.. Faiiancl. S.. Benclich, A.. Gordon, AL. and

Nester, E. (1974). Aqrobactcrium tuinefueiem DNA and ps8 bactciiophage

DNA not detected in ciown gall tumors. Proceedings oj the National, Academy

of Sciences (USA). 71:3672-3676.

Cock, J. (1982). CassaA-a: a basic energy source in the tropics. Science, 218:755-762.

Collin, S., Fernanclez-Lobato. Ah. Gooding. P.. Mullineaux, P., and Fenoll, C.

(1996). The two nonstructural proteins from Avheat dwarf vims involved in

viral gene expression and replication aie îetinoblastoma-bindiiig proteins. Vi¬

rology, 219(1) :324-329.

Davies, J. and Stanley. .1. (1989). Geminivirus genes and vectors. Trends in, Genetics,

5(3):77 81.

Davies, L, Townsend, R., and Stanley. 1. (1987). The structure, expression, function

and posssible exploitation of geminivirus genomes. In Plant DNA Infectious

Agents. Springer A'erlag. Alenna.

Day, A., Bejarano, E.. Buck, K.. Burrcll. XL. and Lichtenstein. C. (1991). Expression

of an antisense Alral gene in transgenic tobacco confers resistance to the DNA

virus tomato golden mosaic vims. Proceedings of the National Academy of

Sciences (USA). 88:6721-6725.

de Wet, L, Wood, K.. cle buca. AL. Helinski. D.. and Subramani. S. (1987). Firefly

luciferase gene: structure anel expression in mammalian cells. Molecular and

Cellular Biology. 7(2):725-737.

Deblaere, R., Bvtebier. B.. De Grève. H.. Deboeck, F.. Schell, J., AYn Montagu.

M., anel Leemans. .1. (1985). Efficient octopine Ti plasmid-clcrived vectors

for Agrobacterni m-mediated gene transfer to plants. Nucleic Acids Research,

13:4777-4788.

DeBlock, AL, Botteraiann. L. A andeAvielc, AL. Dock, L. Thoen, C, Rao Mova,

NY Thompson. C, van Montagu, AL, and Leemans. J. (1987). Engineering

BIBLIOGRAPHY 80

herbicide resistance in plants by expression of a detoxifying enzyme. The EMBO

Journal, 6(9):2513- 2518.

Duan, Y.-P., Powell, C. Webb. S.. Pnrcifull. D.. and Hiebert, E. (1997). Geminivirus

resistance in transgenic tobacco expressing mutated BC1 protein. Molecular

Plant-Microbe Interactions. 10(5):617-623.

Eagle, P. and Hanley-BoAAxloin. L. (1997). Ce elements that contribute to gemi¬

nivirus transcriptional regulation and the efficiency of DNA replication. Journal

of Virology, 71:6947-6955.

Eapen, S. and George. L. (1997). Plant icgcueiation from peduncle segments of oil

seed brassica species: influence of silver nitrate and silver thiosulfate. Plant

Cell Tissue and Organ Culture 51:220-232.

Etessami, P.. Saunders. K.. Watts, J., and Stanley. J. (1991). Mutational analysis

of complementary-sense genes of African cassava mosaic virus DNA A. Journal

of General Virology, 72:1005-1012.

FAO (1989). Production vcar book. Technical report.

FAO (1998). Worl food summit, factsheets.

Fargette. D., Colon. L. T.. Bouveau. R.. and Fauquet. C. (1996). Components of

resistance of cassaA-a to African cassaA'a mosaic vhus. European Journal Of

Plant Pathology. 102(7):645-654.

Fargette, F., Fauquct. C, and Thoirvenel. J.-C. (1988). Yield losses induced by-

African cassava mosaic Alms in relation to the mode anel the date of infection.

Tropical Pest Management. 3-L89- 91.

Finer, J., Vain, P.. Jones, AL, and AlcAIulleu. Af. (1992). Development of the particle

infloAV gun for DNA delivery to plant cells. Plant Cell Reports. 11:323-328.

Fishpool. L. and Buiban, C. (1994). Bemisia tabaci: the Avhitefly vector of African

cassava mosaic geminivirus. Tropical Science. 34:55-72.

Fitchen. J. and Beachy. R. (1993). Genetically engineered protection against viruses

in transgenic plants. Annual Review of Microbiology. 47:739-763.

Fontes. E., Gladfelter. H., Schaffer. R.. Petty. I., and Ilanlev-BoAvdoin, L. (1991).Geminivirus replication origins have a modulai organization. Plant Cell, 6:405-

416.

BIBLIOGRAPHE 81

Freeman, J., Goodchild, N., and Mager. D. (1994). Normalization of GUS by lu¬

ciferase activity from the same cell extract 1 educes transformation variability.

BioTediniques, 17(l):53-57.

Frischmuth, S., Frischmuth, T.. Latham. J., and Stanley, J. (1993a). Transcrip¬

tional analysis of the virion-sense genes of the geminivirus beet curly top virus.

Virology, 197:312-319.

Frischmuth, T. (1999). DNA viral genome. In Mandahar, C, editor. Molec¬

ular Biology of plant, viruses, pages 1-21. KltiAver Academic Publishers,

Boston/Dordrecht/London,

Frischmuth. T., Engel, AL. and Jeske. H. (1997a). Beet, curly top virus DI DNA-

mediated resistance is linked to its size. Molecular Breeding, 3:213-217.

Frischmuth, T., Engel. AL. Lauster. S., anel Jeske. H. (1997b). Nucleotide se¬

quence evidence for the occurrence of three distinct AAdiitefly-transmitted Sida-

infecting bipartite geminivnuses in Central Ameiica. Journal of General Virol¬

ogy, 78:2675-2682.

Fiischmuth. T.. Roberts. S.. addii Armin. A., and Stanley. J. (1993b). Specificity of

bipartite geminivirus movement proteins. Virology. 196:666 673.

Frischmuth, T. and Stanley. J. (1991). Afiican cassava mosaic virus DI DNA inter¬

feres Avith the replication of both genomic components. Virology. 183:539-544.

Fry, C. and Farnham. P. (1999). Context-dependent transcriptional regulation. The

Journal, of Biological Chemistry, 274(42):29533-29586.

Füttercr. J. and Hohn. T. (1992). Role of an upstream open reading frame in

the translation of polveistronic mRNAs in plant cells. Nucleic Acids Research,

20:3851-3857.

Gamborg, O., Miller. R.. and Ojima. K. (1968). Autrient requirement of suspension

cultures of soybean root cells. Evperimenial, Cell Research, 50:15 L.

Gcdcles, A. (L990). The relative importance of crop pests in, sub-Saharan Africa.

PhD thesis, Natuial Resomces Institute. Chatham. UK.

Gibsoti, R. WY Legg, L. and Otim-Nape, G. (1996). Unusually severe symptoms

arc a characteristic of the current epidemic of mosaic virus disease of cassava

in Uganda. Annah of Applied Biology, 128:179-490.

BIBLIOGRAPHY 82

Gladfelter, H., Eagle, P., Fontes, E., Batts. L.. and Ilantcy-BoAvdom. L. (1997). Tavo

domains of the ALI protein mediate geminivirus origin recognition. Virology.

239:186-197.

Gold, C. (1994). The effects of cropping systems on cassava whitcflies in Colombia:

implications for control of African cassava mosaic virus disease. African, Crop

Science Journal 2(4):423-436

Gotds, T., Afaliga, P., and Koop, H. L*. (1993). Stable plastic! transformation in

PEG-treatcd protoplasts of Nicotiana tabacum. Biotechnology, 11:95-97.

Gonzalez, A., Schöpkc. C. Tavlor. NY Beaclrv, R.. and Fauquet. C. (1998). Regener¬

ation of transgenic cassava plants (Manihot esculenta Crantz) through Agrobac-

terium-mediated transformation of embryogénie suspension cultures. Plant Cell

Reports, 17:827-831.

Gooding, P. S., Batty. N. P.. Goldsbrough. A. P.. and Afullincaux, P. Af. (1999).Plant cell-directed contiol of virion sense gene expression in AA'heat dwarf virus.

Nucleic Acids Research. 27(7): L709-1718.

Gröliing, B., Llaves, R.. and Buck. K. (1994). Simultaneous regulation of tomato

golden mosaic Alms coat piotein and ALI gene expression: expression of the

AL4 gene may contribute to suppression of the ALI gene. Journal, of General

Virology, 75:721—726.

Gutierrez, C, Suarez-Lopez. P.. Ramircz-Parra. E.. Sanz-Burgos, A., Pöliiiiiigcr, J.,

and Nie, Q. (1995). DNA bending as a potential regulato! y as-acting element

of the gcminiAlrus intcigenie legion. Agronomic, 15:415-420.

Hahn. S., Terry E.. and Leusehner. K, (1980). Biceding cassava for resistance to

cassava mosaic disease. Euphyhca. 29:673-683.

Haley, A., Richardson, K.. Zhan. X.. and Morris, B. (1995). Mutagenesis of the BCl

and BAT genes of African cassava mosaic vims identifies conserved amino acids

that arc essential for spread. Journal of General, Virology, 76:1291-1298.

Haley. A.. Zhan. X., Richaidson. K., Head. K.. and Monis, B. (1992). Regulation

of the activities of African cassava mosaic vims promoteis bv the ACL AC2,

and AC3 gene products. Virology. 188:905-909.

Hamilton, \Y, Stein. A*.. Contts. R.. and Buck, K. (1981). Complete nucleotide

sequence of the infectious cloned DNA components of tomato golden mosaic

BIBLIOGRAPHY 83

virus: potential coding regions and icgulateuv sequences. The EMBO Journal,

3:2197-2205.

Hanlcy-BoAvdoin, L., Settlage. S.. Orozco. B., Nagar. S., and Robertson, D. (1999).Geminivirus: models for plant DNA replication, transcription, and cell cycle

regulation. Critical Reviews In Plant Sciences, 18(1):71-L06.

Hannah, R., Jemmems-Clough. AL. and Wood. K. (1998). Rapid luciferase reporter-

assays systems for high throughput studies. Promega Notes, 65:9-13.

Harrison, B., Mayo, Ab, and Baulcombe. D. (1987). A'irus resistance in transgenic

plants that express cucumber mosaic virus satellite RNA. Nature, 328:799-802.

Hartley, R. (1988). Barnase and barstar: Expression of its cloned inhibitor permits

expression of a cloned ribonuelease. Journal of Molecular Biology, 202:913-915.

Hartley, R. (1989). Barnase and baistar: two small pioteins to fold and fit togcthei.

Trends in, Biochemical Science?, 14:450-454.

Heinlein, VI., Epel. B., Padgett. I~L. and Beachv. R. (1996). Interaction of to-

bamovirus mo\-ement proteins Avith the plant cvtoskeleton. Science, 270:1983-

1985.

Hemenway, C, Fang. R-X.. KanicAvski, AA*.. Chua, N.-H.. and Turner, N. (1988).

Analysis of the mechanism of protection in transgenic plants expressing the

potato virus N coat protein or its antisense RNA. The EMBO Journal,

7(5): 1273-1280.

Henry, G., Thro, A., and Lvnam, J. (1995). Cassava biotechnology priority setting:old hat for a iicav tool. In The Cassava Biotichnology network, volume 150,

pages 3-16.

Heyraud, F., Alatzeit. A*.. Kammann. AL. Schaefei. S.. Scheit. J., and Groncnboin,

S. (1993). The conseiA-ed nonanucleoticle motif of the geminivirus stem-loop se¬

quence promotes repiicatlonal release of vims molecules fiom redundant copies.

Biochimie. 75:605-615.

Hong, A*., Saunders, K.. Hartley. AL. and Stanley. J. (1996). Resistance to gemi¬

nivirus infection bv virus-induced expression of dianthin in transgenic plants.

Virology. 220:119-127.

Hong, A*.. Saunders. K.. and Stanley, J. (1997). Transactivation of dianthin trans¬

gene expression by African cassava mosaic virus AC2. Virology, 228:383- 387.

BIBLIOGRAPHY 84

Hong, Y. and Stanley, J. (1995). Regulation of African cassava mosaic

virus complemeirtarv-sensc gene expression by N-terminal sequences of the

replication-associated protein ACl. Journal of General, Virology, 76:2415-2422.

Hong, Y. and Stanley, J. (1996). Alms resistance in Nicoticn,a bentliarniana conferred

by African cassava mosaic vims lephcation-associated protein (ACl) transgene.

Molecular Plant-Microbe Interactions. 9:219-225.

Horsch, R., Fry. J., Hoffmann. NY Eichhotz. D.. Rogeis. S., and Fraley, R. (1985). A

simple and general method foi transferring genes into plants. Science. 227:1229—

1231.

Ikegami, M., Haber, S., and Dooman. R. (1981). Isolation and characterization of

virus specific double-stranded DNA fiom tissues infected bv bean golden mosaic

virus. Proceedings of the National Academy of Sciences (USA). 78:1102.

Ilyina, T. and Koonin. E. (1992). ConseiA-cd sequence motifs in the initiator proteins

for rolling-circle DNA replication encoded Ida- dh-crsc rcplicons from cubactcria.

eucarvotes and archacbacteiia. Nucleic Acids Research, 20:3279-3285.

Jefferson, R. (1987). Assaying chimeric genes in plants: The GUS gene fusion system.

Plant Molecular Biology Reporter. 5-387-l05.

Jefferson, R., Kavanagh. T.. and Bcvan. AL (1987). GUS fusions: /^-glucuronidase

as a sensitive and versatile gene fusion marker in higher plants. The EMBO

Journal, 6:3901-3907.

Kallak, H., Rciella. Ab, Hilpus. I., and Alrumae. K. (1997). Effects of genotype,

expiant source and groAvth regulators on organogenesis in carnation callus. Plant

Cell, Tissue and Organ Culture. 51:127-135.

Kartha. K. (1974). Regeneration of cassaA-a plants from apical meristems. Plant

Science Letters, 2:107 113.

Kartha, K. and Gamborg. O. (1975). Elimination of cassava mosaic disease by

meristcm culture. Phytopathology, 65(7):826-828.

Klein. T.. Gradziel, T.. Fromm. Ab. and Sanfoid. J. (19S8). Factors influencing

gene dclh'cry into Zea mag? by high-veloeitv micioprojectiles. Bio/Technology,6:559-563.

BIBLIOGRAPHY 85

Klinkenberg, F., Ellwood. S., and StanlcA'. J. (1989). Fate of African cassava mosaic

virus coat protein deletion mutants after agroinoculation. Journal of General

Virology, 70:1837-1844.

Konan, N. K.. Sangwan, R. S.. and SangAA-an Norrecl, B. S. (1994). Efficient, in

vitro shoot-regeneration systems in cassava (Manihot esculenta Crantz). Plant

breeding, 113(3):227 236.

Koonin, E., Vlushegian. A.. Rvabov. E.. and Dolja, A'*. (1991). Diverse groups of

plant RNA and DNA viruses share related movement proteins that mav possess

chap crone-like activity. Journal of General Virology, 72:2895-2903.

Kost, B., Galli, A., Potrvkus, I., and Neuhaus. G. (1995). High efficiency- transient

and stable transformation by optimized DNA microinjection into Nicohana

tabacum, protoplasts. Journal of Erpcri mental Botany. 16(290): 1457—L167.

Kozak, M. (1983). Comparison of initiation of piotein synthesis in procaiyotes.

eucaryotes and organelles. Microbiological Reviews. 17:1-45.

Kozak. VI. (1984). A compilation and analysis of sequences upstream from the

translational stait site in cucarvotic mRNAs. Nucleic Acids Research, 12:857-

872.

Kunik, T., Salomon, R.. Zamir. D.. Navot. NY Zeiclan. Ab, Alichelson, I., Gafni,

Y., and Czosnek, H. (1994). Tiansgenic tomato plants expressing the tomato

yellow leaf curl virus capsid protein are resistant to the aIius. Bio/Technology,12:500 504.

LazaroAvitz, S. (L992). Geminiviruses: Genome structure and gene function. Critical

Reviews in, Plant Sciences. 11 ( 0:327—349.

Laufs. J., Jupin, I.. David. C. Schumacher. S.. Heyraud-Nitschkc, F., and Groncn-

born, B. (1995a). Geminivirus replication: Genetic and biochemical character¬

ization of Rep protein function, a revicAV. Biochimie 77:765-773.

Laufs. L, Traut, AY. Hevraud. F.. Alatzcit. V.. Rogers. G.. Schell, J.. and Groncn-

born, B. (1995b). In vitro cleavage and joining at the viral origin of replication

by the replication initiator protein of tomato vcIIoav leaf curl virus. Proceedings

of the National Academy of Science^ (USA). 92-3879-3883.

LazaroAvitz. S. (1991). Ahdccnlar characterization of Iavo bipartite geminiviruses

causing squash leaf curi disease: îolc of viral leplication and movement functions

in determining host range. Virology, 180:70-80.

BIBLIOGRAPHY 86

Lazarowitz, S. and Bcachv. R. (1999) Altai movement proteins as piobes for intra¬

cellular and intercellular trafficking in plants. The Plant Cell, fl(f):535 518.

Legris, G., Potrykus, I., and Puonti-Kaeilas. J. (1998). Optimising conditions for

biolistic transformation of casscwa Brazilian Cassava, Journal, 17:30.

Li, H., Huang, 1*.. Liang. C. Guo, J.. Liu. IT. Potiwkus, L, and Puonti-Kaerlas,

•I. (1998). Regeneration of cassaA-a plants via shoot organogenesis. Plant Cell

Reports, 17:410-414.

Li, H.-Q., Sautter, C. Potrvkus. L. and Puonti-Kaeilas. J. (1996). Genetic transfor¬

mation of cassava (Manihot Cöculenta Crantz). Nature Biotechnology. 14:736—

740.

Liu, F. and Green, AL (1994) Promoter targeting bv adenovirus Ela through

interaction with different celtulai DNA-bmdmg domains. Nature, 368:520-525.

Liu, L., Saunders. K.. Thomas. C. DaAies. L. and Stanley. J. (1999). Bean vcllow

dwarf virus RepA. but not Rep binds ro maize lctinoblastoma protein, and the

virus tolerates mutations m the consensus binding motif. Virology, 256:270-279.

Lodge, J., KanicAvski. W. and Turner. N. (1993). Bioad-spcctium vims resistance

in tiansgenic plants expiessnig pokcAveed antiviral protein. Proceedings of the

National Academy of Selects (USA). 90-7089-7093.

Lozano, J. and Booth, R. (1971) Diseases of cassava. Proceedings of the National

Academy of Sciences (USA). 20'30 54.

Maliga, P., Bieznovitz. A., and Marlon. L. (1973) Stieptomycin-rcsistant plants

from callus eulttucs of haploid tobacco. Nature New Biology, 244:29-30.

Maniatis, T.. Fritsch. E.. and Sanibiook. I (1982) Molecular cloning: A laboralory

manual. CSH Laboratory Piess. Cold Spimg Harbor,NY.

Mariani, C, De Beuckeleei. AL. Littettnei. J.. Leemans. L. and Goldberg, R. B.

(1990). Induction of male sterility in plants Ida a chimaeric ribonriclease gene.

Nature 347:737-741.

Mariani, C. Gossele. A*.. De Beuckeleei. AL. De Block. AL. Goldberg, R. B..

De Grecf, AV.. and Leemans, J (1992) A chimaeuc ubonuclcase-inhibitor gene

restores fertility to male steulc plants. Nature 357-384—387.

BIBLIOGRAPHY 87

Martin, T., Wohner, R., Hummel. S., AVillmitzei. L.. anel Frommer, W. (1992). The

GUS reporter system as a tool to strich' plant gene expression. In Gallaghct. S.,

editor, GUS protocols: Using the GUS gene as a reporter of gene expression,

pages 23-43. Academic Press. San Diego, CA.

Mattanovich, D., Rueker. F.. da Camara Machado, A., Laimcr, AL, Regner, F.,

Steinkcllncr. H.. Himmler. G., and Katingcr. H. (1989). Efficient transformation

of Agrobaderium spp. bv electropoiarion. Nucleic Acids Research, 17:6747-

6752.

Matthews, J. C, Hoii, KY and Cmmier. AL J. (1977). Purification and pioperties

of Renilla, reinformis lucifeiase. Biochemistry. 16:85-91.

Vlayerhofer, R., Langiidge. AAA. Cormier. AL. and Szalay, A. (1995). Expression of

recombinant Renilla luciferase in transgenic plants results in high levels of light

emission. The Plant Journal 7(6): 1031—1038.

Mcnczel, L., Nagy, F.. Kiss, Z. R.. and Alaliga. P. (1981). Streptomycin-resistant,

and sensitive somatic hvbiicls of Nicoiiana tabacum plus Nicotiana knightiancH-:

Correlation of resistance to Nicotiana tabacum plasticls. Theoretical and Applied,

Genetics, 59(3): 194-495.

Alize. G., Ruan, PL. Low. L. and Monds. D. (1998). The inhibitory upstream open

reading frame from mammalian S-adenosylmethioninc decarboxylase mRNA

has a strict sequence specificity in critical positions. Journal of Biological Chem¬

istry, 273(4) :32500-32505.

Morris. B., Richardson, K.. Eddy. P.. Zhan. N.. ffalev. A., and Gardner. R. (199L).

Mutagenesis of the AC3 open reading frame of African cassava mosaic virus

DNA A reduces DNA B replication and amelioiates disease symptoms. Journal

of General Virology. 72:1203-1213.

Mullis, K. and Faloona. F. (1987), Specific synthesis of DNA in, vitro via a

pofymerasc-catalyzcd chain reaction. Methods in Enzymology, 155:335-350.

A'furashige, TA and Skoog. F. (1962). A revised medium for rapid growth and bioas-

says Avith tobacco tissue cultures. Physioloqia Plantarem. 15:473-497.

Muro-Pastor, AL. Gonzales. R., Strauss. J.. Naiendja. F.. and Scazzocchio, C.

(1999). The GATA factor AreA is essential for chromatin remodelling in a

cukarotic bidirectional promoter. The EMBO Journal. 18(6):1581-1597.

BIBLIOGRAPHY 88

Nagy, J. and Maliga, P. (1976). Callus induction and plant icgeneration from mes¬

ophyll protoplasts of Nicotiana sylvestris. Zeitschrift für Pflanzenphysiologie,

78:453-455.

Ncedham, P., Atkinson, R.. Monis, B., Gardner. R., and Cleave, A. (1998). GUS

expression patterns from a tobacco yellow dwarf virus-based episomal vector.

Plant Cell Reports. 17:631-639.

Negrutiu, I., Shilifo, R.. Potrvkus. L, Biasim. G.. and Sala, F. (1987). Llybrid

genes in the analysis of tiansfoimation conditions. Plant Molecular Biology.

8:363-373.

Noris, E., Jupin, I., Accotto. G.. and Gronenbotn. B. (1996). DNA-binding activity

of the C2 protein of tomato velloAv leaf curl geminivirus. Virology. 217:607-612.

Odell, T, Nagy, F., and Chua. N.-H. (1985). Identification of DNA sequences

required for activity of the cauliffoAATr mosaic virus 35S promoter. Nature.

313:810-812.

Orozco, B., Glaclfcltcr. PL. Settlagc. S.. Eagle. P.. Gentry. R., and LLanley-Bowdoin.

L. (1998). Alultiple eis elements contribute to geminivirus origin function.

Virology, 242:316-356.

Orozco, B. and Hanlev-Bowdoin. L. (1996). A DNA structure is required for gemi¬

nivirus replication origin function. Journal of Virology, 70:148—158.

Otim-Nape, G., Bua, A., and Baguma. Y. (1994a). Accelerating the transfer of

improved production technologies: Contiolling African cassava mosaic virus

disease epidemics in Uganda. African Crop Science Journal, 2:479-495.

Otim-Nape, G., Thresh, L. and Shaw. AT (1997). The effects of cassava mosaic

virus disease on vield and compensation in mixed stands of healthy and infected

cassava. Annals of Applied Biology. 130:503-521.

Otim-Nape, G. W, Shaw. Al. W. and Thresh, J. AT (1994b). The effects of African

cassava mosaic geminivirus on the groAvth and yield of cassava in Uganda. Trop¬

ical sciences, 34(l):43-54.

Oav, D., Jacobs. J., and HoavcII. S. (1987). Functional regions of the cauliilower

mosaic vims 35S RNA promoter detcimined bv the use of the fireflv luciferase

gene as a reporter of piomotei activity. Proceedings of the National Academy

of Saeces (USA). 81:4870-4874.

BIBLIOGRAPHY 89

0w, D., Wood, K., DeLtica. AP. DcWet. T. Hclinski. D., and Howell, S. (1986).Transient and stable expression of the fireflv luciferase gene in plant, cells and

transgenic plants. Science 234:856-859.

Padidam, AL, Beachy, R., and Fauquet, C. (1996). The role of AV2 ("precoat") and

coat, protein in viral replication and movement in tomato leaf curl geminivirus.

Virology, 224:390-404.

Palmer, K. and Rybicki. E. (1997), The use of geminiviruses in biotechnology- and

plant molecular biology, with paiticular focus on mastreviruses. Plant Science,

129:115-130.

PaszkoAvski. J., Pisan, B.. Shillito. R.. Prolin. T.. Hohn, B.. and Potrvkus, b (1986).Genetic transformation of Brassica rapa piotoplasts with an engineered CaMV

genome. Plant Molecular Biologg. 6'303-312.

Paszkowski, J., Shillito, R.. Saul. AP, Afanclk, A*.. Holm. T., Hohn. B., and Potrvkus.

1. (1984). Direct gene tiansfcr to plants. The EMBO Journal, 3:2717-2722.

Potrvkus, I. (1991). Gene transfer to plants; assessment and perspectives. Physi-

ologia Plantarum. 79:125 134.

Potrvkus. L, Bilang, R.. Sautter. C. and Spangenberg. G. (1993). Gene Transfer

to plants. ETPI Ziiiich, Switzeiland.

PoAvell, A., Nelson. R.. De. B., Hoffmann. NY Rogers, S., Fraley, R., and Beachy,

R. (1986). Delay of disease development in tiansgenic plants that, express the

tobacco mosaic virus coat protein gene. Science. 232:738-743.

Puonti-Kaerlas, J. (1998). CassaA-a biotechnology. Biotechnology and Genetic Engi¬

neering Reviews. 15:329-363.

Raemakers, C. Sofiari. E.. Tavlor. NY HenshaAv. G., Jacobson, E., anel Visser. R.

(1996). Production of tiansgenic cassava (Manihot escvlenta Crantz) plants bv

paiticle bombardment using luciferase as selection marker. Molecular Breeding,

2:339-319.

Roca, W. (1984). Cassava. In Sharp. AA*.. Evans. P).. Ammirato. P., and A'amada,

Y.. editors, Handbook of Plant Cell Culture pages 269-301.

Roca, W, Henry, G.. Angel. F.. and Sania. R. (1992). Biotechnology research ap¬

plied to cassava improvement at the international centei of tropical agriculture

(CIAT). AgBiolcch News unci Information. f(10):303N-308N.

BIBLIOGRAPHY 90

Rossi, L., Escudero, J., Holm. B., and Tmlancl. B. (1993). Efficient and sensitive

assay for T-DNA dependent transient gene expiession. Plant Molecular Biology

Reporter, 12:345—353.

Ruan, H., Shantz, L., Pegg. A., and Monis. D. (1996). The upstream open

reading frame of the mRNA encoded S-adenosylmethionine decarboxylase is

a polyamhic-respoiisiA-e translational control clement. Journal of Biological

Chemistry, 271(47)29576-29582.

Ruiz-Aledrano, R.. Guevara-Gonzalez. R.. Argiiello-Astorga, G., and AlonsaPve-

Fonnegra, Z. (1999). Identification of a sequence element invoved in AC2-

mediated transactivation of the pepper huasteco virus coat protein gene. Vi¬

rology, 253:162-169.

Sambrook, L, Fritsch. E., and Alaniatis. T. (1989). Molecular cloning: A laboratory

manual CSH Laboiatorv Piess. Cold Spring Haiboi. NY, 2nd edition.

Sanderfoot, A., Ingham. D.. and LazaroAvitz. S. (1996). A viral movement protein

as a nuclear shuttle: the geminivirus BRI movement protein contains domains

essential for interaction wrht BIT and nuclear localization. Plant Physiology.

110:23-33.

Sanderfoot, A. and Lazaicwitz. S. (1995). Coopeiation in viral movement: the

geminivirus BLl moA-ement protein interacts Avith BRI and redirects it from

the nucleus to the cell periphery. Plant Cell 7:1185-1194.

Sandeifoot, A. and LazaroAvitz. S. (1996). Getting it, together in plant virus move¬

ment: cooperative interactions betAA-een bipartite geminivirus movement pro¬

teins. Trends in Cell Biology. 6:353-358.

Sanford. J. and Johnson. S. (1985). The concept of parasite-derived resistance-

deriving resistance genes from the parasite's oavh genome. Journal, of Theoretical

Biology, 113:395-105.

Sautter. C, Waldner. Id.. Ncuhaus-Uil. G.. Galli, A., Neuhaus, G., and Potrvkus,

I. (1991). Micro-targeting: high efficiency gene transfer using a novel approach

for the acceleration of micro-projectiles. Biotechnology. 9:1080-1085.

Schenk, R. U. and Ilildcbrairdt. A. C. (1972). Medium and techniques for induc¬

tion anel groAvth of monocotvleclonous and dicotyledonous plant cell cultures.

Canadian Journal of Botany. 50:199-204.

BIBLIOGRAPHE 91

Schöpke, C, Chavarriaga, A. P.. Fauquet. C. AT. and Beachv. R. N. (1993), Cas¬

sava tissue culture and transformation: impiovoment of culture media and the

effect of different antibiotics on leaf tissues. In Roca, W. and Thro, A., edi¬

tors, the First international scientific meeting cassava biotechnology network,

pages 140- 145, Cartagena. Colombia 25-28 August 1992. Ccntro Internacional

dc Agricultura Tropical. Cali (Colombia). AVoiking document 123.

Schöpke, C, Tavlor. N., Cârcamo. R.. Konan. K.. Alarmev, P., HenshaAv, G.. Beachv.

R., and Fauquet, C. (1996). Regeneiation of transgenic cassava plants (Manihotesculenta Crantz) from microbombarded ombiyonic suspension cultures. Nature

Biotechnology. 14:731-735.

Shahin, E. (1985). Totipotcncv of tomato protoplasts. Theoretical Applied Genetics,

69:235-210.

Shaw, J. (1996a). Plant viruses. In Fields. B.. Knipe, D., HoavIcv, P., Chanock,

R., Melnick, J., Alonath. T.. Roizman. B.. and Straus, S., editois, Fundamental

virology, pages 367-400. Lippincott-Ravcn Publishers, Ph'hrdelphia. 3 edition.

ShaAv, J. (1996b). Plant viruses. In Fields. B.. Knipe, D., Howlev, P., Chanock, R..

Melnick. -b, Alonath. TY Roizman. B.« and Straus. S.. editois, Fields Virology,

pages 499 532. Lippincot f-Raven Publishers. Philadelphia, PA, 3 edition.

Sheen, J.. Hwang. S.. Nhva. A*., Kobavashi. H.. and Galbraith, D. (1995). Green-

fluorescent protein as a new vital marker in plant cells. Plant Journal. 8:777-

784.

Sinistena. N. PL. Polston. J. E„ Abouzid, A. AP. and Phebert, E. S. 0. (1999).Tobacco plants transformed Avith a modified coat piotein of tomato mottle

begomovirus sIkdav resistance to virus infection. Phytopathology, 89(8):70f-706.

Sofiari, E., Raemakers. C. Reigervoet, !.. Jacobsen. E.. and Ausser, R. (1998).Plant regeneration fiom piotoplasts isolated fiom friable embryogénie callus of

cassava. Plant Cell Reports. dS: 159-16-5.

Songstad, D.. Duncan. D.. and Widholm. J. (1988). Effect of 1-amino cvclopropane-

1-carboxyllic acid, silver nitrate and noiboindiene on plant rcgneration from

maize callus cultures. Plant Cell Reports. 7:262-265.

Soni, R. and Aluirav, J. (199 I). Isolation of intact DNA and RNA from plant tissues.

Analytical Biochemistry. 218:474-476.

BIBLIOGRAPHY 92

Spangenberg, G., Osuskv, AT. Olivciia. AT. FicacII. E. Nagel, J., Pais, AP, and

Potrvkus, I. (1990). Somatic hybridization bv microfusion of defined protoplast

pairs in Nicotiana: morphological, genetic and molcdular characterization. 'The¬

oretical and, Applied Genetics, 80:577-587.

Srikantha, T., Klapach. A.. Lorenz. AA*. AY, Tsai. L. K., Laughlin, L. A., Goiman,

J. A., and Soil. D. R. (1996). The sea pansv Renilla reniformis lucifcrase serves

as a sensitive bioluminescent reporter for diffeientiat gene expression in Candida

albicans. Journal, of Bacteriology. 178(1)121-129.

Stamp, J. and Henslurw, G. (1982). Somatic embryogenesis in cassava. Zeitschrift

für Pfl,anzenphysiologie 105:183-187.

Stamp, J. and Henshaw, G. (1987a). Secondary somatic embryogenesis and plant

regeneration in cassava. Plant Cell Tissue and Organ Culture, 10(3):227—233.

Stamp, J. and HenshaAV, G. (1987b). Somatic embryogenesis fiom clonal leaf tissues

of cassava. Annals of Botany. 59(4):445- 150.

Stanley, J. (1983). Infectivity of the cloned geminivirus genome requires sequences

from both DNAs. Nahire. 305:643-645.

Stanley. J. (1985). The molecular biology of geminiviiuses. Advances in Virus

Research. 30:139-173.

Stanley, J. (1990). Chaiacteiisation and exploitation of plant virus DI DNA. Aspects

of Applied Biology. 24.

Stanlev. J. and Davies. J. AY (1985). Structure and function of the DNA genome of

geminiviruses. Plant Molecular Virology. 2:191—218.

Stanley, T, Frischmuth. T.. and Ellwood. S. (1990). Defective viral DNA amelio¬

rates symptoms of geminivirus infection in transgenic plants. Proceedings of the

National Academy of Scicces (USA). 87:6291-6295.

Stanley. J. and Gay Ah (1983). Nucleotide sequence of cassava latent virus DNA.

Nahire. 301:260-262.

Stanley, J. and Townsend. R. (1985). Charactensafion of DNA forms associated

AA-ith cassava latent Alms infection. Nucleic Acids Research, 13(7):2189—2206.

Stanley. T. Townsend. R.. and Curson. S. (1985). Pseudorecombinants between

cloned DNAs of Iavo isolates of cassava latent vims. Journal of General Virology.

66:1055-1061.

BIBLIOGRAPHE 93

Sunter, G. and Bisaro, D. (1991). Fransactivation in a gemimvirus: AT2 gene

product is needed for coat protein expression. Virology. 180: 116-419.

Sunter. G. and Bisaro, D. (1992). Transactivation of geminivirus ARl and BRf gene

expression by the viral AT2 gene pioduct occurs at the level of transcription.

Plant Cell, 4:1321-1331.

Sunter, G. and Bisaro, D. (1997). Regulation of a geminivirus coat, protein promoter

by AL2 protein (TrAP): evidence for activation and derepression mechanisms.

Virology, 232:269-280.

Sunter, G., Hartitz. AP. and Bisaro. D. (1993). Tomato golden mosaic virus leftward

gene expression: autoregulation of geminivims replication protein. Virology,

195:275- 280.

Swanson, AL and LIarrison. B. (L991). Properties, relationships and distribution of

cassava mosaic geminiviruses. Tropical Science 31:15-25.

Taylor, N., EchA-ards. AP. Kiernan. R.. DaA-ev. C Blakeslev, D., and Henshaw, G.

(1996). Development of friable embivogenic callus and embryogénie suspension

culture systems in cassava (Manihot esculent a Ciantz). Nature Biotechnology,

14:726-730.

Taylor, N. L, Claike. AP. and HenshaAV. 0. G. (1993). The induction of somatic em¬

bryogenesis in fifteen African and one South American cassava cultivars expres¬

sion in cassava loot and leaf tissues. In Roca. AA*. and Thro, A., editors, the First

international scientific meeting cassava biotechnology network, pages 134-139,

Cartagena, Colombia 25-28 August 1992. Centro Intcrnacional de Agiiculttira

Tropical, Cali (Colombia). Working document 123.

Taylor. S., Afassiah, A.. Tomonossoff. 0.. Roberts. L.. Lord. J., and Hartley, Af.

(1994). Correlation between the activities office ribosome-inactivating proteins

in depurination of tobacco libosomes and inhibition of tobacco mosaic virus

infection. Plant Journal 5(6):827—S35.

Thompson, L, Haves. T.. and Lovcl. D. ( 199ll. Modulation of firefly luciferase

stability and impact on studies of gene regulation. Gene 103:171 -177.

Thresh, J., Fargette. D.. and Otim-Nape. G. (1994). The viruses and vims diseases

of cassava in Africa. African Crop Science Journal 2(4):459-478.

BIBLIOGRAPHY 94

Thresh, J. and Otim-Nape, G. (1994). Stiategies for controlling African cassava

mosaic geminivirus. In Advances m Disease Vector Research, volume 10, pages

215 - 236. Springer-Aforlag New A oik, Inc.

Thro, A.. Bonicrbalc, AT, Roca. AV., Best. R.. and Henry, R. (1995). Why, what,

who and when: An oveivieAv of the cassava biotechnology network (CBN) and

current cassava biotechnology research worldAvide. In Proceedings of the second

international scientific meeting, volume 150. pages 3 15.

Townsend, R.. Stanley, ,b. Curson. S.. and Shoit. Ai. (1985). Major polyadcirOatcd

transcripts of cassava latent virus and location of the gene encoding coat protein.

The EMBO Journal 4(l):33-3S.

ToAvnscnd, R., Watts, J., and Stanley. J. (1986). Synthesis of viral DNA forms

in Nicotiana plumbaginifoha protoplasts inoculated with cassava latent virus

(CLV); evidence for the independent replication of one component of the CTY

genome. Nucleic Acids Rc^eaich. 14:1253-1265.

Vcrvlict, G., Holsters, AL. Teuchv. H.. A*an "Montagu. AT, and Schell, J. (1975).Characterization of different plaque-foiming and defective temperate phages in

Agrobaderium, strains. Journal of General Virology. 26:33-48.

von Arnim, A., Frischmuth. T.. and Stanley. J. (1993). Detection and possible

functions of African cassava mosaic vims DNA B gene products. Virology,

192:264-272.

von Arnim. A. and Stanley. J. (1992). Inhibition of African cassava mosaic virus

svstemic infection bv a movement protein from the related geminivirus tomato

golden mosaic virus. Vnology. 187:555-564.

Warburg. 0. (1894). Die Kultuipflanzen Usambaias. Annals of Applied, Biology,

25:790 806.

Ward. B.. Medville. R.. PazaroAvitz. S.. and Tuigeon, R. (1997). The gemi¬

nivirus BT1 movement protein is associated with endoplasmic rcticulum-dcrived

tubules in developing phloem cells. Journal of Virology. 5(3726-3733).

Wenham, J. (1995). Post-harvest deterioration of cassava. A biotechnology perspec¬

tive. FAO Plant Production and Protection Paper. 130.

Yang, N., Ale. Y.. Zhu, PY Aide. T., Kang. P.. Wang. N.. anel Tien, P. (1997).Ribozv-me-mecliatecl resistance against potato spindle tuber viroiel in transgenic

potatoes. Proceedings of the National Academy of Scieces (USA), 94:48604865.

BIBLIOGRAPHY 95

Yepes, L., Fuchs, AL, Slightom. L. and Gonsalves. D. (1996). Sense and antisense

coat protein gene constructs confer high levels of resistance to tomato ringspot

nepovirus in transgenic Nicotiana species. Phytopathology, 86(4):417-424.

Zhan, X., Haley, A., Richardson. K., and Aloiris. B. (1991). Analysis of the potential

promoter sequences of African cassaA-a mosaic virus by transient expression of

the /"»-glucuronidase gene. Journal of General Virology, 72:2849-2852.

Zhan, X., Richardson. K. A., and .Monis. B. A. AP (1993). The activity of the coat

protein promoter of chloiis stiiate mosaic virus is enhanced by its oavii C1-C2

gene products. Virology. 193:198-502.

Curriculum vitae

Name: Petra Alalia Frcv

Date of birth: May 1st, 1972

Place of birth: Lucerne, SAvitzerland

1979 - 1982 Primary school. Rothenburg

1982 - 1985 German SaaIss International School. Hong Kong

1985 - 1992 Kantonsschtile Reussbühl: Marina Tvpe C (nattual sciences)

1989 - 1990 Arirden Collegiate Instil ute. Alanitoba, Canada: Pligh School Giaduation

1992 - 1996 Studv of Experiment af Biology at the Depaitnicnt of Biology, ETTI Zürich

Diploma thesis at the Institute foi Plant, Sciences:

'ToAvards regeneration and transfoimation of cassava meristems"

1996 - 2000 Research work for PhD thesis at the Institute for Plant Sciences,

ETH Zürich, SAvitzeiland. in the group of Prof. I. Potrvkus