lable at ScienceDirect

Biomaterials 35 (2014) 8621e8634

Contents lists avai

Biomaterials

journal homepage: www.elsevier .com/locate/biomater ia ls

Restoration of chemosensitivity by multifunctional micelles mediatedby P-gp siRNA to reverse MDR

Jie Shen a, b, QiwenWang a, c, Qida Hu d, Yongbing Li a, b, Guping Tang a, b, **, Paul K. Chu b, *

a Institute of Chemical Biology and Pharmaceutical Chemistry, Zhejiang University, Hangzhou 310028, PR Chinab Department of Physics & Materials Science, City University of Hong Kong, Tat Chee Avenue, Kowloon, Hong Kong, Chinac Department of Cardiology, The First Affiliated Hospital, Zhejiang University, School of Medicine, Hangzhou 310003, PR Chinad Department of Hepatobiliary and Pancreatic Surgery, The Second Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou 310009, PR China

a r t i c l e i n f o

Article history:Received 9 June 2014Accepted 17 June 2014Available online 4 July 2014

Keywords:MDRMicellessiRNADoxorubicin

* Corresponding author. Tel.: þ852 34427724; fax:** Corresponding author. Tel./fax: 86 571 88273284.

E-mail addresses: tangguping@zju.edu.cn (G. T(P.K. Chu).

http://dx.doi.org/10.1016/j.biomaterials.2014.06.0350142-9612/© 2014 Elsevier Ltd. All rights reserved.

a b s t r a c t

One of the main obstacles in tumor therapy is multiple drug resistance (MDR) and an underlyingmechanism of MDR is up-regulation of the transmembrane ATP-binding cassette (ABC) transporterproteins, especially P-glycoprotein (P-gp). In the synergistic treatment of siRNA and anti-cancer drugdoxorubicin, it is crucial that both the siRNA and doxorubicin are simultaneously delivered to the tumorcells and the siRNA can fleetly down-regulate P-g before doxorubicin inactivates the P-gp and is pumpedout. Herein, a type of micelles comprising a polycationic PEI-CyD shell to condense the siRNA and hy-drophobic core to package doxorubicin is reported. The structure of the polymer is determined by 1HNMR, FT-IR, DSC, and XRD and the micelles are characterized by DLS, 2D-NOESY NMR, and TEM to studythe self-assembly of the micelles with siRNA and drugs. In vitro studies demonstrate controlled releaseand temporal enhancement of the therapeutic efficacy of P-gp siRNA and doxorubicin. Release of siRNAdown-regulates the mRNA and protein levels of P-gp in the MCF-7/ADR cell lines effectively and theaccumulated doxorubicin facilitates apoptosis of the cells to reverse MDR. Moreover, in vivo researchreveals that the siRNA and doxorubicin loaded micelles induce tumor cell apoptosis and inhibit thegrowth of MDR tumor. The western blotting and RT-PCR results illustrate that the synergistic treatmentof siRNA and doxorubicin leads to efficient reduction of the P-gp expression as well as cell apoptoticinduction in MDR tumors at a small dosage of 0.5 mg/kg. The micelles have large clinical potential indrug/RNAi synergistic treatment via restoration of the chemosensitivity in MDR cancer therapy.

© 2014 Elsevier Ltd. All rights reserved.

1. Introduction

Chemotherapy is one of the preferred techniques in cancertreatment but its success is often limited because of the phenom-enon of multiple drug resistance (MDR). MDR is related to theresistance of tumor cells to many chemotherapy drugs withdifferent structures and cellular targets. There are at least twounderlying molecular mechanisms responsible for MDR. The firstone is detoxification as well as inactivation of apoptosis pathwayswith parallel activation of anti-apoptotic cellular defense modal-ities, whereas the second one is the transport of drugs includingdecreased drug influx and increased drug efflux [1]. ATP-binding

þ852 34420542.

ang), paul.chu@cityu.edu.hk

cassette (ABC) transporters are a kind of transmembrane proteinswhich transport a wide variety of substrates across extra- andintracellular membranes including drugs. P-glycoprotein (P-gp)known as multidrug resistance protein 1 (MDR1) or ATP-bindingcassette sub-family B member 1 (ABCB1) is a well-characterizedABC-transporter and found to over-express in many human can-cers such as breast carcinoma and leukemia leading to a MDR [2,3].Nowadays, the combination of RNA interference (RNAi) technologyand chemotherapy is widely used to overcome MDR. RNAi isgenerally mediated by short hairpin RNAs (shRNA) or small inter-fering RNAs (siRNA) and the shRNA is expressed after nuclear de-livery of shRNA-expressing plasmid DNA (pDNA). In comparison,siRNA delivery avoids the process of nuclear delivery and siRNAfunctions directly in the cytosol [4e8].

To achieve simultaneous delivery of nucleic acid and anti-cancerdrugs, functional vehicles are widely used. Vectors such as poly-mers, liposomes, peptides, and mesoporous silica have been re-ported to deliver genes and/or drugs [9e14]. In particular, many

mailto:tangguping@zju.edu.cnmailto:paul.chu@cityu.edu.hkhttp://crossmark.crossref.org/dialog/?doi=10.1016/j.biomaterials.2014.06.035&domain=pdfwww.sciencedirect.com/science/journal/01429612http://www.elsevier.com/locate/biomaterialshttp://dx.doi.org/10.1016/j.biomaterials.2014.06.035http://dx.doi.org/10.1016/j.biomaterials.2014.06.035http://dx.doi.org/10.1016/j.biomaterials.2014.06.035

J. Shen et al. / Biomaterials 35 (2014) 8621e86348622

multifunctional micelles have been developed for intelligent tar-geted delivery of nucleic acid and drugs [1,15e17]. The functions ofdrugs and DNA/RNA loading, passive and active cancer targeting,cell membrane translocation, reduction, and pH sensitive releaseare integrated in the micelles. Consequently, multifunctionalpolymeric micelles can provide delivery of drugs and genes to thecellular and molecular targets in tumor therapy. However, in orderto achieve the combination of a chemotherapeutic drug with P-gpsiRNA to reverse MDR, the prerequisite is a carrier which releasesthe siRNA earlier than the chemotherapeutic drug so that P-gp isinactivated and the drug is subsequently inhibited from beingpumped out [18]. In this work, a type of self-assembled micellescomprising the hydrophilic end of b-cyclodextrin-poly-ethyl-enimine (PEI-CyD) and hydrophobic end of cholesterol is reported.The hydrophobic core is capable of encapsulating the P-gp sub-strate doxorubicin (DOX) and meanwhile, the outer PEI-CyD iscondensed with siRNA by electrostatic interaction. This doublelayer structure allows sequential release of siRNA and drug to in-crease the drug concentration in cytosol and restore the sensitivityof doxorubicin in the MDR cells. The physicochemical propertiessuch as morphology, size, as well as release properties are deter-mined and the ability and synergistic therapeutic effects of co-delivering DOX and siRNA to MDR tumor cells are assessedin vitro and in vivo.

2. Materials and methods

2.1. Materials

Polyethyleneimine (branched PEI, MW 600 Da and 25 KD), b-cyclodextrin (b-CyD, MW 1135), 1,10-carbonyldiimidazole (CDI, MW 162.15), dimethyl sulfoxide(DMSO, �99.5%), [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide](MTT, MW 218.1), triethylamine (TEA, �99%), and cholesterol chloroformate (MW449.11) were obtained from Sigma (St. Louis, MO, USA). Doxorubicin hydrochloride(DOX$HCl, MW 543.52) was purchased from Haida Pharmaceutical Co., Ltd.(Hangzhou, Zhejiang, China) and DAPI was bought from the Beyotime Institute ofBiotechnology (Haimen, Jiangsu, China). The negative control siRNA (siNC) andsiRNA targeting green fluorescent protein (GFP-22) were purchased from Qiagen(Dusseldorf, Germany) and fluorescein-tagged negative-control siRNA (FAM-siRNA)was purchased from Biomics Biotechnologies Co., Ltd. (Nantong, Jiangsu, China). Allthe siRNAs and shRNA targeting ABCB1 (MDR1) were obtained from Genechem Co.,Ltd. (Shanghai, China), including siRNA-1: GAACACATTGGAAGGAAAT (targetingsequence); siRNA-2: ACAGAATAGTAACTTGTTT (targeting sequence); siRNA-3:TCATCGTTTGTCTACAGTT (targeting sequence). The FITC-labeled P-gp antibodywas supplied by eBioscience (San Diego, CA, USA).

2.2. Cells and animals

Two types of human breast cancer cells, MCF-7 and MCF-7/ADR, were acquiredfrom the American Type Culture Collection (ATCC, MD, USA) and the GFP expressionMCF-7 cells (MCF-7/GFP) were provided by Prof. JunWang (University of Science andTechnology of China, Hefei, China). TheMCF-7was cultured in the RPMI 1640 culturemedium supplemented with 10% fetal bovine serum (FBS) in a humidified incubatorat 37 �C and 5% CO2. The MCF-7/GFP andMCF-7/ADR (DOX-resistant MCF-7 cell line)were cultured in Dulbecco's modified eagle medium (DMEM) with 10% fetal bovineserum (FBS) and MCF-7/ADR was maintained with free DOX at 500 ng/mL.

Athymic female mice (BALB/c strain) (3e4weeks old，12e14 g) were purchasedfrom the Zhejiang Chinese Medical University and maintained in a pathogen-freeenvironment under controlled humidity and temperature. The animal experi-ments were performed in accordance with the CAPN (China Animal Protection Law).

2.3. Synthesis and characterization of PEI-CyD-Cholesterol (PCC)

The PEI-CyD (PC) backbone was synthesized as described previously [19] andsynthesis of PCC is described in the following [20]. 120 mg of PC were stirred on icein a mixture of 15 mL of anhydrous methylene chloride and 200 mL of triethylamine(TEA) for 30 min. Cholesterol chloroformate (6 mg, 12 mg, 24 mg) was dissolved in5 mL of anhydrous ice-cold methylene chloride and then slowly added to the PCsolution. The solution was stirred overnight on ice. The resulting product was driedon a rotary evaporator and then dissolved in distilled water. The solution wasextracted with methylene chloride to remove the unreacted cholesterol chlor-oformate, filtered, and freeze-dried.

The 1H nuclear magnetic resonance (1H NMR) spectra were recorded on a UnityInova 400 spectrometer at 400 MHz. The polymers were dissolved in 0.5 mL of D2Oand 1H NMR was performed on the Varian 400 MHz spectrometer for 32 scans atroom temperature.

The chemical structure of the polymers was determined by Fourier-transforminfrared spectroscopy (FT-IR, Varian, Excalibur™, USA), X-ray powder diffraction(MAX 2550/PC, Rigaku, JAPAN), and thermogravimetric analysis (SDT Q600 Ther-mogravimetric Analyzer, USA).

2.4. Characterization of PCC micelles

The critical micelle concentration (CMC) was determined using pyrene as afluorescence probe [21]. The samples were prepared by adding a known amount ofpyrene in acetone to a series of 10 mL vials and then removing the acetone byevaporation. Various concentrations of PCC ranging from 1 �10�4 to 1 mg/mL wereadded to each vial and the final pyrene concentrationwas 0.6 mM. The solutions wereincubated overnight at room temperature in darkness to allow equilibration. Thefluorescence excitation spectra of pyrenewere recorded from 300 to 360 nm using afluorescence spectrophotometer (RF-5301PC, Shimadzu, Japan) with an emissionwavelength of 395 nm. The intensity ratios of I339/I334 from the excitation spectrawere plotted against the polymer concentration to determine the CMC.

The particle size and zeta potential of the free PCC micelles and PCC/plasmidcomplex were analyzed at 25 �C by dynamic light scattering (DLS) on the Zetasizer3000 (Malvern Instruments, Worcestershire, UK). Gel electrophoresis was per-formed at room temperature in the TAE buffer in 1% (w/w) agarose gel at 80 V for40 min. The complexes of PCCs and plasmid at various w/w ratios were separatelyelectrophoresed in the agarose gel with the naked DNA serving as a reference. Theplasmid was visualized by a UV (254 nm) illuminator.

The DOX-loaded micelles were prepared by the emulsion method. Briefly,2.5 mg of DOX$HCl were dissolved in 2 mL of chloroformwith 3.0 equivalent of TEAto remove the hydrochloric acid [22]. The oil phase was slowly injected into 20mL ofa stirred aqueous solution of 7.5 mg PCC. The mixture was stirred overnight indarkness and open atmosphere conditions at 25 �C allowing the chloroform toevaporate. The solutionwas filtered by 0.45 mm filters and freeze-dried to obtain theDOX-loaded PCC micelles.

The drug loading content was measured by a UV-vis spectrophotometer (UV-2800, Hitachi, Japan). 2.5 mg of the freeze-dried PCC/DOXmicelles were dissolved in25 mL of DMSO and were assessed at l ¼ 482 nm. The calibration curve wasestablished under the same conditions. The drug loading content (LC) of PCC/DOXmicelles for DOX was calculated by the following formula:

LC ¼ mass of DOX encapsulated in micelles=mass of micelles� 100%:The 2D-NOESY NMR spectra of the PCC/DOXmicelles were acquired on a Bruker

AVANCE III 500 spectrometer (Bruker, Ettlingen, Germany) at room temperatureusing D2O as the solvent.

The morphology of the free PCC micelles, PCC/plasmid complex, DOX-loadedmicelles, and PCC/DOX/plasmid was examined by transmission electron micro-scopy (TEM, HT-7700, Hitachi, Japan). And the morphology of PCC/DOX/siRNA wasimaged by confocal microscopy. Briefly, PCC/DOX/siRNA was prepared by mixingPCC/DOX micelle with FAM-NC for about 30 min. Then 10 mL of the sample was firstimmobilized by mixing with 10 mL of 2% low melting point agarose on a standardglass slide. When the agarose gel solidified, the confocal images were immediatelycollected using Zeiss LSM software on a Zeiss LSM 510 inverted microscope equip-ped with a �100 apochromatic oil objective. Volocity 3D Image Analysis Software(PerkinElmer) was used for three dimensional reconstructions.

The in vitro release behavior of the DOX-loaded micelles was monitored as fol-lows. 1 mg of PCC/DOX or PCC/DOXwith plasmid complex (w/w¼ 10) was dissolvedin 2 mL of PBS at pH values of 5.0 and 7.4 and sealed in dialysis bags (MCWO8000e14,000). The solutions were dialyzed against 25 mL of PBS at 37 �C understirring at 100 rpm on an orbital shaker. At defined time points, 2 mL of the mediumwere taken out and replenished with an equal volume of the fresh medium. Theamount of DOX released was measured by fluorescence spectrophotometer (RF-5301PC, Shimadzu, Japan) at an emission wavelength of 558 nm and excitationwavelength of 502 nm. The standard curves at different pH values were alsoestablished.

2.5. In vitro biological characterization of PCC

The cytotoxicity of the PCC was evaluated by the MTT assay using MCF-7 andMCF-7/ADR cells. Generally, the cells were seeded on a 96-well tissue culture plate ata density of 1 � 104 cells/well in 200 mL of 1640 or DMEM medium containing 10%serum for 18 h separately. The mediumwas replaced with 200 mL of serum-free onecontaining serial dilutions of polymer solutions for 4 h. The solutions were thenreplaced with 100 mL of the serum-free medium containing 0.5 mg/mL MTT andincubated for another 4 h. Finally, each well was replaced with 100 mL of DMSO andmeasured spectrophotometrically on an ELISA plate reader (Model 550, Bio-Rad) at awavelength 570 nm. The relative cell growth (%) related to control cells cultured inthe media without the polymer was calculated by the following formula:

V% ¼ ð½A�experimental � ½A�blankÞ=ð½A�control� ½A�blankÞ � 100%:The cellular uptake and distribution of micelles were examined by confocal

microscopy using the MCF-7 andMCF-7/ADR cell lines. The cells were seeded on 24-well plates and grown for 18 h. The medium was changed to serum-free 1640 or

J. Shen et al. / Biomaterials 35 (2014) 8621e8634 8623

DMEM containing micelles pre-mixed with 0.3 mg of FAM-NC (DOX at a concen-tration of 2.5 mg/mL). At the designed time points, the cells were rinsed with PBS,fixed with fresh 4% paraformaldehyde, and treated with DAPI for 10 min. Theconfocal images were acquired on a scanning laser confocal microscope (Leica SPE).

2.6. Inhibition of ABCB1 expression by the micelle/siRNA complex

The silence efficiency of siRNA-1/-2/-3 was determined by flow cytometricanalysis using the immunofluorescence method [23]. The MCF-7/ADR cells wereincubated on 24-well plates as described above. 0.33 mg siRNA-1/-2/-3 or siNC weremixed with PCC micelle at a w/w ratio of 10 for 30 min and then the cells wereincubated with the siRNA/micelle complex solution for 4 h and grown for additional24 h. The FITC-labeled P-gp antibody was added to the cells according to theestablished protocol (eBioscience, CA, USA). The cells were washed by PBS, trypsi-nized, and suspended in PBS and the amount of P-gp in cells was quantified by a flowcytometer (BeckmaneCoulter, USA) using the FL-1 detection channel. The mean

Scheme 1. Schematic illustration of combination of

fluorescence of the FL1 population (an indicative of P-gp amount in all cells) wasnormalized against the mean fluorescence of the control and used as %P-gpexpression.

In the green fluorescent protein (GFP) silencing study, GFP-expressing MCF-7 cells (MCF-7/GFP) were used as a model. The siRNA complex formation and de-livery to cells were performed as described above utilizing GFP specific siRNA (GFP-22) and negative control (siNC) [24]. GFP silencing was assessed by flow cytometryafter cell fixation and the Geo mean was used to calculate the decrease in greenfluorescence of GFP.

The DOX accumulation in MCF-7/ADR cells was first shown by in vitro cellularassay [25]. The MCF-7/ADR cells were seeded on 24-well plate at a density of 5�104in DMEM medium containing 10% FBS for 18 h. The medium was then replaced by1 mL of DMEM (serum free), free DOX, PCC/DOX, PCC/DOX/siRNA, and PCC/DOX/shRNA-plasmid and incubated for 4 h at a DOX concentration of 100 mg/mL. Afterthe medium was taken out, the cells were washed and replenished with 1 mL offresh DMEM (containing serum) at defined time points. The fluorescence intensity of

siRNA and DOX using a multifunctional micelle.

J. Shen et al. / Biomaterials 35 (2014) 8621e86348624

DOX in the mediumwas measured by fluorescence spectrophotometry (RF-5301PC,Shimadzu, Japan) and DOX accumulation was also detected by confocal microscopy[26]. The cells were incubated with the serum-free medium containing the PCC/DOX/siRNA complex (0.33 mg siRNA, DOX concentrationwas 2.5 mg/mL) or PCC/DOX,rinsed, fixed, and stained at indicated time points. Moreover, the cells with the sametreatment were washed, trypsinized, and collected for flow cytometric analysis afterincubation for 24 h.

Quantitative reverse transcription (RT)-PCR was used in the analysis of the MCF-7 andMCF-7/ADR cell lines expression of genes encoding P-gp and apoptosis-relatedproteins such as Bcl-2 and Bax. The cells were treated with the PCC/DOX/siRNAcomplex, PCC/DOX, and free DOX as described above, respectively. The mediumwasreplaced by fresh DMEM containing 10% FBS after incubation for 4 h and the cellswere incubated for another 48 h, collected to extract mRNA, and reverse-transcribedinto cDNA. The following pairs of primers were used (50e30): ABCB1 d AACG-GAAGCCAGAACATTCC (sense), AGGCTTCCTGTGGCAAAGAG (antisense); Bcl-2 dGTGGAGGAGCTCTTCAGGGA (sense), AGGCACCCAGGGTGATGCAA (antisense); Baxd GGCCCACCAGCTCTGAGCAGA (sense), GCCACGTGGGCGTCCCAAAGT (antisense);GAPDH (internal standard) d AAGGTCGGAGTCAACGGATTT (sense), AGATGAT-GACCCTTTTGGCTC (antisense). The PCR parameters consisted of 5 min of Taq acti-vation at 95 �C, followed by 32 cycles of 95 �C � 30 s, 56 �C � 45 s, and 72 �C � 45 s.

Fig. 1. (a) Synthesis route of PEI-CyD-cholesterol (PCC). (b) 1H NMR s

The relative gene expression values were determined using the BandScan4.3 soft-ware and the data presenting the MDR1, Bcl-2, and Bax expressionwere normalizedto the housekeeping gene GAPDH as the endogenous reference.

In the western blotting analysis, the cell proteins were extracted after the sametreatment as RT-PCR and the total protein was quantified by the BCA protein assaykit (Promega, USA). An equal amount of protein was separated on the SDS-PAGE,transferred onto the nitro-cellulose membrane, blocked, and incubated overnightwith monoclonal antibodies against P-gp, Bcl-2 and Bax. After washing, the mem-brane was incubated with the HRP-conjugated secondary antibody for 2 h at roomtemperature. The bands were visualized using the Westzol enhanced chem-iluminescence kit (Intron, Sungnam, Korea) and the expression was normalized tothe housekeeping gene expression.

2.7. In vivo tumor therapy

The MCF-7 and MCF-7/ADR cells were inoculated subcutaneously at an injec-tion volume of 0.1 mL containing 5 � 106 and 1 � 107 cells at the abdominal ofBALB/c nude mice, respectively. The mice were assigned to four groups and treatedwith the PCC/DOX/siRNA complex, PCC/DOX, free DOX, and PBS at 0.5 mg/kgequivalent DOX and 6.5 mg of siRNA-3 via intra-tumor injection when the tumor

pectra of PCCs in D2O. (c) Fluorescence intensity I339/I334 of PCCs.

Table 1Physicochemical parameters of PCCs.

Graft degree (%) CMC (mg/ml) Size (nm) Zeta-potential (mV) Drug loadingcontent (w/w, %)

PCC-1 5.2 ± 1.1% 0.040 ± 0.001 242.2 ± 23.4 28.4 ± 1.53 5.43 ± 1.28PCC-2 7.9 ± 2.3% 0.039 ± 0.001 213.8 ± 60.3 23.3 ± 0.53 7.44 ± 2.15PCC-3 18.6 ± 3.3% 0.033 þ 0.002 232.3 ± 22.6 28.3 ± 1.96 12.83 ± 2.04

J. Shen et al. / Biomaterials 35 (2014) 8621e8634 8625

grew to a diameter of around 5 mm. Each treatment group was composed of eightmice (n ¼ 8) for antitumor therapy and three mice (n ¼ 3) for RT-PCR and westernblotting analysis.

The treatment was performed twice a week for 2 weeks and tumor growth wasalso monitored by calipers twice a week. The tumor volume (V) was calculated bythe following formula: tumor volume V (mm3)¼ p/6� length (mm)�width (mm)2.Relative Tumor Volume (RTV) ¼ V0/Vd. In the RT-PCR and western blotting analysis,

Fig. 2. (a) XRD patterns of cholesterol chloroformate, PC and PCC. (b) FT-IR spectra of cholecholesterol chloroformate, PC and PCC.

the mice from each group were sacrificed 48 h after the last injection. Their tumorswere extracted and the other approach was the same as described above.

2.8. Statistical analysis

The data were expressed as means ± standard deviation. The statistical signi-ficance (p< 0.05) was evaluated by the Student t-test or one-way analysis of variance

sterol chloroformate, PC and PCC. (c) Differential scanning calorimetry (DSC) curves of

Fig. 3. (a) TEM images of PCC micelle, PCC/plasmid complex at w/w ratio of 10, DOX-loaded PCC micelle, and DOX-loaded PCC micelle mixed with plasmid at w/w ratio of 10. (b)Particle size of PCC/plasmid complexes at different w/w ratios. (c) Release of DOX from PCC micelle and PCC/plasmid complex at pH value of 5.0 and 7.4. Data are shown asmean ± SD (n ¼ 3).

Fig. 4. 2D-NOESY NMR spectrum of PCC/DOX in D2O.

J. Shen et al. / Biomaterials 35 (2014) 8621e86348626

(ANOVA) followed by Bonferroni's post hoc test. In all the tests, the statistical sig-nificance was set at p < 0.05.

3. Results

3.1. Formation and characterization of PCC micelles

The functions of the PCC micelles formed with DOX and siRNAare to release siRNA, down-regulate P-gp firstly to inhibit themultiple drug resistance (MDR), and then restore doxorubicinchemosensitivity when it is released thereafter (Scheme 1). Theamphiphilic polycationic PCC is synthesized in two steps usingPEI (Mw ¼ 600 Da), b-CyD, and cholesterol chloroformate. Thecopolymer PC is synthesized and conjugated with cholesterolchloroformate via amide linkage (Fig. 1a). According to the 1HNMR spectrum of PCC (Fig. 1b.), PCC is successfully synthesized.The multiple peaks at d 2.3e2.8 ppm are attributed to the protonsof eCH2-CH2-N in PEI 600. The protons at d 4.8 ppm are associ-ated with the H (c) in b-CyD and those at d 3.0e4.0 ppm areassociated with the methoxyl groups of b-CyD. The weak andmultiple peaks at d 0.7e1.3 ppm are methyl, methylene, andmethane in cholesterol [20,27]. Based on the peak area of H (c) inb-CyD (d 4.8 ppm) and protons in cholesterol (H (a), H (b)), thegraft ratio of cholesterol in the polymer is estimated and listed inTable 1.

To assess the feasibility of co-delivery of drug and siRNA by thepolymer, several physicochemical properties are determined. The

Fig. 5. Fluorescent confocal microscopic images of PCC/DOX/siRNA. The FAM-siRNA is shown in green and the drug DOX is shown in red (For interpretation of the references to colorin this figure legend, the reader is referred to the web version of this article.).

J. Shen et al. / Biomaterials 35 (2014) 8621e8634 8627

critical micelle concentration (CMC) of PCC in distilled water isdetermined to be between 0.03 mg/mL and 0.04 mg/mL (Fig. 1c.),indicating that themicelles are self-assembled inwater. PCC-3 has asmaller CMC due to the larger hydrophobic interaction in the sys-tem (Table 1). The zeta-potential and average hydrodynamicdiameter are shown in Table 1, demonstrating that regardless of thegrafting degree, there are few significant differences among thethree polymers.

The structure is determined by XRD, FT-IR and DSC and Fig. 2shows the difference between cholesterol, PC, and synthesizedPCC. XRD is used to confirm the crystal structure. As cholesterol isconjugated with PC, the crystal structure of cholesterol chlor-oformate disappears from PCC. There are a few differences betweenPC and PCC confirming the presence of cholesterol in PCC (Fig. 2a).In the FT-IR spectra, the carbonyl band at 1776 cm�1 in Fig. 2b arisesfrom the stretching vibration of C]O in cholesterol chloroformate.After conjugation, a new carbonyl band appears at 1633 cm�1,confirming the presence of newly formed acylamino in PCC. Thestretching vibration at ~1705 cm�1 suggests the existence of estercarbonyl and acylamino in PC. The DSC curves provide additionalevidence of the formation of PCC and the degradation temperatureof PCC is about 10 �C lower than that of PC (Fig. 2c).

In the gene binding capability study, migration in agarose gel isshown in Fig. S1. The results show that PCC-1, PCC-2, and PCC-3 canfully retard migration of plasmid in the agarose gel at w/w ratios of0.88, 1.04 and 1.36, respectively. Obviously, when cholesterol is

grafted, the amino groups react and decrease and the datademonstrate that the plasmid binding ability depends on theamount of amino groups.

The in vitro cytotoxicity is investigated to ensure the biocom-patibility of the polymer (Fig. S2). All PCCs exhibit a low cytotoxicityin both MCF-7 and MCF-7/ADR cells. In our previous study, back-bone PC shows excellent biocompatibility both in vitro and in vivo[28,29]. After cholesterol is grafted, the cytotoxicity of the micellesis the same or slightly smaller than that of PC. This may benefit fromthe characteristics of cholesterol, a lipid molecule existing widely inanimal tissues. It is an essential structural component of animal cellmembranes required to establish the proper membrane perme-ability and fluidity. Therefore, the introduction of cholesterol in-creases the membrane compatibility of the polymer and mitigatesthe cytotoxicity slightly.

In the designed micelle system, cholesterol and DOX constitutethe core due to the hydrophobic interaction. The DOX-loaded mi-celles are prepared by the emulsion method and the drug loadingcapacity of PCC with different grafted degree is displayed in Table 1.The loading capacity of PCC-3 micelles which have a highercholesterol graft degree is larger than the others. Therefore,considering the physicochemical properties and cytotoxicity, PCCwith the largest graft degree (PCC-3) is the optimal one to form astable and functional micelle vector.

Fig. 3a and b provides the visual morphological evidence andparticle size about the formation of PCC-3 micelles. As shown in

Fig. 6. Fluorescent confocal microscopic images of in vitro cellular uptake of MCF-7 and MCF-7/ADR cell lines treated with free FAM-siRNA, free DOX, PCC/FAM-siRNA complex,DOX-loaded PCC micelle, PCC/DOX/FAM-siRNA for 4 h and 24 h, where the FAM-siRNA is shown in green, the drug DOX is shown in red, and the DAPI nuclear stain is shown in blue(For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.).

J. Shen et al. / Biomaterials 35 (2014) 8621e86348628

Fig. 3a, the polymer PCC-3mixedwith either plasmid or drug resultsin a size increase and the TEM image of PCC/DOX shows differentdensities in the core and shell. However, these differences in densityare not found from the photograph of PCC/DOX/plasmid as theintroduction of plasmid provides electrostatic interaction in theshell and compacts the micelle. This PCC-3 forms a stable complexwith plasmid in the aqueous solution at the w/w of 10 (Fig. 3b).

The in vitro drug release behavior of either DOX or gene/DOXcontaining PCC micelles is verified and compared in aqueoussolutions at pH of 7.4 and 5.0. As shown in Fig. 3c, DOX exhibits

pH-dependent dissociation which shows a smaller release rate atthe blood pH (pH ¼ 7.4) and larger rate at lower pH (pH ¼ 5.0) inthe lysosomal environment. The gene/DOX double-loaded mi-celles exhibit a hysteretic release behavior in comparison withthe micelles loaded DOX. The accumulative release rate of thePCC/DOX/plasmid micelle at 48 h is similar to that of the PCC/DOX micelle at 12 h at a pH of 5.0. It can be explained by thatwhen the gene and cationic polymer are twinned at the outerlayer of the micelle, they cover the core compactly and delay therelease of DOX.

Fig. 7. (a,b) Silence efficiency of siRNA-1/-2/-3 determined by flow cytometer analysis using the immunofluorescence method. (c,d) Down-regulation of green fluorescent protein(GFP) determined by flow cytometry in MCF-7/GFP cells treated with the PCC/GFP-22 complex at different w/w ratios.

J. Shen et al. / Biomaterials 35 (2014) 8621e8634 8629

The 2D-NOESY NMR spectrum confirms the interaction betweenthe drug and cholesterol core in the PCC/DOX micelle. From thespectrum (Fig. 4), the signals of the methyl, methylene andmethane in cholesterol are correlated with the protons of doxoru-bicin at d 3.0e4.0 ppm. The confocal image of PCC/DOX/siRNA alsoprovides evidence about the 3D morphology of drug/gene co-delivery micelle. The subglobular micelle in Fig. 5 shows a 3Dstructure of PCC/DOX/siRNA. The red DOX distributes in the centreof the micelle and green siRNA is around (white circle).

3.2. Synergistic effects of P-gp siRNA and DOX in vitro

In the attempt to visualize the distribution of siRNA and drugafter incubating for different time durations, cellular uptake of PCC-3/DOX/FAM-siRNA is performed and imaged (DOX: red; FAM-siRNA: green; nucleus: blue). Fig. 6 suggests that the complexmicelle is able to co-deliver the drug and siRNA to one cell effi-ciently in comparison to free DOX or siRNA. Moreover, the drug andsiRNA delivered by the micelle simultaneously remain in the cellsfor over 24 h during incubation giving rise to cooperative effects onthe cancer cells.

To select an optimal siRNA from the three siRNAs, the FITC-labeled P-gp antibody is used to quantify the amount of P-gp onthe cell membrane based on the antigeneantibody reaction [23].The suppression of P-gp by the three different siRNAs is shown in

Fig. 7a and b. The siRNA-3 is the best among the three siRNAs andthe GFP silencing assay is used to obtain the optimal condition inRNA interference. According to Fig. 7c and d, the expression of GFPat 48 h is lower than that at 24 h and the most efficient w/w ratio is10.

The combination of DOX and siRNA-3 is initially reflected by thedrug accumulation (Fig. 8). The DOX amount in the medium ofsiRNA and shRNA-plasmid mediated MCF-7/ADR cell is a littlesmaller than PCC/DOX, indicating the RNAi successfully silences theABCB1 gene and avoids DOX from being pumped out by P-gp. In thefirst two days, in contrast to the cells incubated with shRNA-plasmid, a slighter efflux of DOX in MCF-7/ADR induced by siRNAis achieved from the faster and direct effect of siRNA in the cytosol(Fig. 8a). In the confocal microscopic results (Fig. 8b), the siRNAtreated MCF-7/ADR cells show stronger red fluorescence than thecells in the absence of siRNA. The quantity of DOX accumulation at24 h is estimated by flow cytometry (Fig. S3). The mean fluores-cence from the DOX-positive MCF-7/ADR cells treated with PCC/DOX or PCC/DOX/siRNA are 25.54 and 28.41, respectively. The dataare consistent with the confocal microscopy images in Fig. 8b,demonstrating that the siRNA coordinated with DOX enhances thedrug concentration in cells.

To obtain further insights into the synergistic effects of themicelle co-delivering DOX and siRNA-3, the mRNA and proteinlevel of P-gp, Bcl-2 and Bax are assessed after incubation for 48 h

J. Shen et al. / Biomaterials 35 (2014) 8621e86348630

Fig. 9 presents the results of western blotting and RT-PCR. The p-gpin the MCF-7/ADR cells is over-expressed in comparison with theMCF-7 cell line because MCF-7/ADR is a kind of MDR cells. Thetreatment of cells with micelles in the absence of siRNA does notlead to P-gp suppression. The protein and mRNA level of ABCB1 arereduced in both the MCF-7 and MCF-7/ADR cells by treatment ofPCC/siRNA and PCC/DOX/siRNA due to gene-silencing mediated bysiRNA. The protein and mRNA levels of Bcl-2 and Bax are separatelydecreased and increased, resulting in decreasing Bcl-2/Bax ratioswhen the cells are fed with DOX-loaded micelles.

Fig. 8. DOX accumulation in MCF-7/ADR cells in the present of siMDR1. (a) Red fluo-rescence intensity changes of the medium in the presence of free DOX, PCC/DOX, PCC/DOX/siRNA, and PCC/DOX/shRNA-plasmid (at 100 mg/mL equivalent DOX concentra-tion). Data are shown as mean ± SD (n ¼ 3). (b) Fluorescent confocal microscopicimages of MCF-7/ADR cells incubated with PCC/DOX and PCC/DOX/siRNA for 12, 24,and 48 h.

3.3. In vivo MDR tumor therapy

Whether or not the synergistic effects translate into MDR tumorgrowth inhibition in vivo is investigated. Mice bearing MCF-7 andMCF-7/ADR xenografts are treated with the PCC/DOX/siRNA andvarious other formulations by intratumoral injection twice a weekfor 2 weeks. The four mice groups are tested, including PBS, freeDOX, PCC/DOX and PCC/DOX/siRNA complex. A representativemouse in each group is pictured at day 0 and 7 and three mice arefor WB and RT-PCR. The PCC/DOX/siRNA treated group shows themost effective inhibition in tumor growth (Fig. 10). At a DOX dosageof 0.5 mg/kg, free DOX has few suppression of MDR tumor. How-ever, the PCC/DOX/siRNA complex (DOX dosage of 0.5 mg/kg) suf-ficiently inhibits the tumor growth at day 10 (Fig. 10b). As the MCF-7 tumor grows faster than MCF-7/ADR tumor, the PBS treated micebearing MCF-7 xenografts show rapid death at day 17. The survivalrates of mice bearing the MCF-7 and MCF-7/ADR tumors treatedwith PCC/DOX/siRNA are 100%, but a small dose of DOX stimulatesthe growth of drug resistance tumor so that the free DOX groupexhibits a small quantity of death (Fig. S4).

The results of WB and RT-PCR are similar to the in vitro data,revealing the same mechanism of siRNA and DOX combinationin vivo (Fig. 11.). Briefly, the siRNA interferes with the expression ofP-gp leading to an enhancement in the drug sensitivity in the tu-mor cells. As shown in Fig. 11a, the expression of P-gp in theMCF-7/ADR tumor is much higher than that in theMCF-7 tumor. The groupmediated by siRNA shows the most obvious changes in both MDRand apoptosis-related proteins.

4. Discussion

In our previous research, polycationic PEI-CyD (PC) is shown topossess the functions of drug, plasmid, and RNA delivery [30e32].In this work, the PC is first used as a hydrophilic group andconjugated with cholesterol. The PEI-CyD-cholesterol (PCC)micelle is self-assembled by a hydrophobic core and cationic shellin an aqueous solution. The cholesterol core encapsulates thelipid-soluble drug and the cationic shell interacts with the nega-tively charged siRNA due to the positive charge of PEI. The CyDexposed on the surface improves the biocompatibility of thismicelle.

To select a stable and functional PCC, polymers with differentgraft degree of cholesterol are synthesized and characterized. CMCis an important parameter of an amphiphilic copolymer in theformation of coreeshell structured micelles. PCC-3 with a lowerCMC of 0.033 mg/mL (Table 1) can self-assemble more stably insolutions than PCC-1 and PCC-2. The positive charge and suitablesize of the polymers are prerequisites to delivering gene across thecell membrane. As shown in Table 1, the particle size of these threePCCs is around 250 nm which is suitable for endocytosis. Benefit-ting from the positive charge of PEI, the gene binding capability ofpolymers has a w/w ratio of about 1. In addition, the cytotoxicity ofall three polymers is similar. Overall, by considering the higher

stability, similar gene binding capability, and cytotoxicity, PCC-3 isan optimal polymer to achieve the co-delivery of drug and gene.

We then investigate if the drug/gene co-delivery micelle canachieve the release behavior as designed. Fig. 3c shows the dif-ference in the drug release between the gene-loading and normalparticles. The hysteretic release of DOX in the gene encapsulatedmicelle is explained by the electrostatic interaction of cationicPEI-CyD and negative charged gene. It enables better accumula-tion of DOX after siRNA release. The structure is also determinedby TEM, 2D-NOESY NMR, and confocal microscopy. As shown inFig. 4, the signals of cholesterol and DOX are well correlated,indicating the formation of hydrophobic core. According to theTEM image (Fig. 3a), the size increases and density changes afterco-delivering drug and gene. Afterwards, the confocal imageprovides visible evidence about the 3D structure of the drug/geneco-delivery micelle. A hydrophobic core comprising DOX isobviously presented and green siRNA is distributed around thecore (Fig. 5).

Based on the results obtained from the structural and releasebehavior studies, we verify the synergistic functions of siRNA andDOX. Functional siRNA is used to silence the expression of P-gp, themost common and important protein involved in ATP-dependentefflux of drugs. The P-gp has a broad substrate family of drugssuch as anthracyclines, taxanes, vinca alkaloids, and epipodophyllotoxin [33]. DOX, a nonselective class I anthracycline, is an effectivesubstrate of P-gp. Thus, the hypothesized mechanism is that themicelle delivered to the cells releases the surface siRNA and knocks

Fig. 9. (a) Representative P-gp, Bcl-2 and Bax protein expression determined by Western blot analysis in MCF-7 and MCF-7/ADR cell lines at 48 h. (b) Analysis of light intensities ofP-gp, Bcl-2 and Bax protein expression in MCF-7 and MCF-7/ADR from Western blot results. (c) Expression of P-gp, Bcl-2 and Bax mRNA in MCF-7 and MCF-7/ADR determined byquantitative real-time PCR at 48 h. The data are shown as mean ± SD (n ¼ 3) and *p < 0.05 versus the control.

J. Shen et al. / Biomaterials 35 (2014) 8621e8634 8631

Fig. 10. Antitumoral therapeutic effects of PBS, free DOX, PCC/DOX, PCC/DOX/siRNA complexes in tumor-bearing BALB/c: (a) Images of in vivo tumor growth. (b) Relative tumorvolume (RTV) with increasing time.

J. Shen et al. / Biomaterials 35 (2014) 8621e86348632

down the expression of P-gp. DOX then accumulates at anenhanced concentration resulting in restoration of chemo-sensitivity and damaging the cell. We then examine the DOX con-centration in cytoplasm after mediated by PCC/DOX/siRNA. Theimages shown in Fig. 8b suggest that DOX accumulates in the celllonger when siRNA is present. Fig. 8a shows the difference betweenfree DOX and encapsulated DOX in the culture medium, demon-strating that endocytosis of polymer particle can avoid efflux ofdrugs. A small difference between siRNA and shRNA is found fromFig. 8a maybe because of the different mechanisms of siRNA andshRNA as mentioned above.

More studies are carried out to confirm the synergistic therapyand restoration of chemosensitivity. The in vitro and in vivo resultsof WB and RT-PCR reveal the process of restoration of chemo-sensitivity (Figs. 9 and 11). DOX binds to DNA-associated enzymesand can intercalate the base pairs of the DNA double helix. Bybinding to multiple molecular targets such as topoisomerase en-zymes I and II, many cytotoxic effects occur resulting in DNAdamage. The apoptosis pathway is triggered when the attempt torepair the breaks in DNA fails [34]. The Bcl-2 and Bax genes are themembers of the Bcl-2 family of the regulatory proteins that regulatecell apoptosis. The Bcl-2 gene has been identified as a cause ofresistance to cancer treatment because of the antiapoptotic activityof Bcl-2 protein, and Bax promotes apoptosis by competing withBcl-2 [35,36]. Therefore, the Bcl-2/Bax ratio is identified as arheostat that determines the susceptibility to cell apoptosis [37].

Overall, DOX leads to cell apoptosis and then Bcl-2 and Bax aredetected as indicators of apoptotic response. We compare theprotein and mRNA levels of Bcl-2 and Bax of cells fed with DOX-loaded micelles and discover that although PCC/DOX also in-creases the concentration of DOX (Fig. 8a), introduction of siRNA ismore important to the restoration of the DOX sensitivity (Figs. 9and 11). The P-gp is down-regulated as a result of siRNAsilencing. Briefly, when siRNA is delivered to the cytoplasm, it isactivated by binding to the RNA induced silencing complex (RISC).An oligonucleotide is produced and binds to a specific sequence onthe P-gp mRNA, causing cleavage and disposal of the P-gp mRNA[33]. Consequently, the synergistic use of PCC/DOX/siRNA yields themost obvious function of MDR reversal via the following process.The drug efflux pump, P-gp, is knocked down mediated by siRNA,DOX accumulates and functions in the DOX resistant cells, and cellapoptosis occurs. Afterwards, tumor therapy experiment shows theefficacy of PCC/DOX/siRNA again (Fig. 10). Therefore, this micellesystem has large potential with regard to MDR reversal inchemotherapy.

5. Conclusion

A multifunctional micelle is designed and produced to achievecombined delivery of drug and gene to reverse MDR. The micellespossess excellent ability in the in vitro study. The PCC/DOX/siRNAsystem can produce early release of siRNA to knock down the

Fig. 11. (a) Representative P-gp, Bcl-2 and Bax protein expression determined byWestern blot analysis in MCF-7 and MCF-7/ADR tumors 48 h after last injection. (b) Analysis of lightintensities of P-gp, Bcl-2 and Bax protein expression fromWestern blot results. (c) Expression of P-gp, Bcl-2 and Bax mRNA in tumors determined by quantitative real-time PCR 48 hafter the last injection. The data are shown as mean ± SD (n ¼ 3) and *p < 0.05 versus the control.

J. Shen et al. / Biomaterials 35 (2014) 8621e8634 8633

J. Shen et al. / Biomaterials 35 (2014) 8621e86348634

ABCB1 gene and avoid DOX efflux. Hysteretic release of DOX in-creases the intracellular drug concentration. These two stepsrestore the chemosensitivity of DOX in the MDR cells and accom-plish reversal of MDR. Consequently, the PCC/DOX/siRNA systemresults in large cell apoptosis in vitro. As apoptosis benefits tumorinhibition, in vivo experiments using MCF-7 and MCF-7/ADR tumordemonstrate that the micelles influence the relative proteins fromthe gene level and inhibit tumor growth. The drug/siRNA co-delivery micelles are useful to combination therapy for MDRreversal.

Acknowledgments

This work was jointly supported by National Natural ScienceFoundation of China (Grant no. 21374098), National Program onKey Basic Research Project (2014CB931901), as well as Hong KongResearch Grants Council (RGC) General Research Funds (GRF) No.112212.

Appendix A. Supplementary data

Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.biomaterials.2014.06.035.

References

[1] Shapira A, Livney YD, Broxterman HJ, Assaraf YG. Nanomedicine for targetedcancer therapy: towards the overcoming of drug resistance. Drug Resist Updat2011;14:150e63.

[2] Gottesman MM, Fojo T, Bates SE. Multidrug resistance in cancer: role of ATP-dependent transporters. Nat Rev Cancer 2002;2:48e58.

[3] Lebedeva IV, Pande P, Patton WF. Sensitive and specific fluorescent probes forfunctional analysis of the three major types of mammalian ABC transporters.PLoS One 2011;6:e22429.

[4] Stege A, Kruhn A, Lage H. Overcoming multidrug resistance by RNA interfer-ence. Methods Mol Biol 2010;596:447e65.

[5] Hannon GJ. RNA interference. Nature 2002;418:244e51.[6] Wu H, Hait WN, Yang JM. Small interfering RNA-induced suppression of MDR1

(P-glycoprotein) restores sensitivity to multidrug-resistant cancer cells. Can-cer Res 2003;63:1515e9.

[7] Aagaard L, Rossi JJ. RNAi therapeutics: principles, prospects and challenges.Adv Drug Deliv Rev 2007;59:75e86.

[8] Takahashi Y, Nishikawa M, Takakura Y. Nonviral vector-mediated RNAinterference: its gene silencing characteristics and important factors to ach-ieve RNAi-based gene therapy. Adv Drug Deliv Rev 2009;61:760e6.

[9] Abbasi M, Lavasanifar A, Berthiaume LG, Weinfeld M, Uludag H. Cationicpolymer-mediated small interfering RNA delivery for P-glycoprotein down-regulation in tumor cells. Cancer 2010;116:5544e54.

[10] Navarro G, Sawant RR, Biswas S, Essex S, Tros de Ilarduya C, Torchilin VP. P-glycoprotein silencing with siRNA delivered by DOPE-modified PEI overcomesdoxorubicin resistance inbreast cancer cells.Nanomedicine (Lond)2012;7:65e78.

[11] Saad M, Garbuzenko OB, Minko T. Co-delivery of siRNA and an anticancerdrug for treatment of multidrug-resistant cancer. Nanomedicine (Lond)2008;3:761e76.

[12] Iyer AK, Singh A, Ganta S, Amiji MM. Role of integrated cancer nanomedicinein overcoming drug resistance. Adv Drug Deliv Rev 2013;65:1784e802.

[13] Meng H, Mai WX, Zhang HY, Xue M, Xia T, Lin SJ, et al. Codelivery of anoptimal drug/siRNA combination using mesoporous silica nanoparticles toovercome drug resistance in breast cancer in vitro and in vivo. ACS Nano2013;7:994e1005.

[14] Li J, Wang Y, Zhu Y, Oupicky D. Recent advances in delivery of drug-nucleicacid combinations for cancer treatment. J Control Release 2013;172:589e600.

[15] Dai J, Lin S, Cheng D, Zou S, Shuai X. Interlayer-crosslinked micelle withpartially hydrated core showing reduction and pH dual sensitivity for pin-pointed intracellular drug release. Angew Chem Int Ed Engl 2011;50:9404e8.

[16] Chen W, Yuan Y, Cheng D, Chen J, Wang L, Shuai X. Co-delivery of doxorubicinand siRNA with reduction and pH dually sensitive nanocarrier for synergisticcancer therapy. Small 2014;10. http://dx.doi.org/10.1002/smll.201303951.published online.

[17] Xiong XB, Lavasanifar A. Traceable multifunctional micellar nanocarriers forcancer-targeted co-delivery of MDR-1 siRNA and doxorubicin. ACS Nano2011;5:5202e13.

[18] Duan X, Xiao J, Yin Q, Zhang Z, Yu H, Mao S, et al. Smart pH-sensitive andtemporal-controlled polymeric micelles for effective combination therapy ofdoxorubicin and disulfiram. ACS Nano 2013;7:5858e69.

[19] Tang GP, Guo HY, Alexis F, Wang X, Zeng S, Lim TM, et al. Low molecularweight polyethylenimines linked by beta-cyclodextrin for gene transfer intothe nervous system. J Gene Med 2006;8:736e44.

[20] Han S, Mahato RI, Kim SW. Water-soluble lipopolymer for gene delivery.Bioconjug Chem 2001;12:337e45.

[21] WilhelmM, Zhao CL, Wang YC, Xu RL, Winnik MA, Mura JL, et al. Poly(styrene-ethylene oxide) block copolymer micelle formation in water: a fluorescenceprobe study. Macromolecules 1991;24:1033e40.

[22] Kataoka K, Matsumoto T, Yokoyama M, Okano T, Sakurai Y, Fukushima S, et al.Doxorubicin-loaded poly(ethylene glycol)-poly(beta-benzyl-L-aspartate)copolymer micelles: their pharmaceutical characteristics and biological sig-nificance. J Control Release 2000;64:143e53.

[23] Abbasi M, Aliabadi HM, Moase EH, Lavasanifar A, Kaur K, Lai R, et al. siRNA-mediated down-regulation of P-glycoprotein in a Xenograft tumor model inNOD-SCID mice. Pharm Res 2011;28:2516e29.

[24] Landry B, Aliabadi HM, Samuel A, Gul-Uludag H, Jiang X, Kutsch O, et al.Effective non-viral delivery of siRNA to acute myeloid leukemia cells withlipid-substituted polyethylenimines. PLoS One 2012;7:e44197.

[25] Mao Z, Cartier R, Hohl A, Farinacci M, Dorhoi A, Nguyen TL, et al. Cells asfactories for humanized encapsulation. Nano Lett 2011;11:2152e6.

[26] Ke CJ, Chiang WL, Liao ZX, Chen HL, Lai PS, Sun JS, et al. Real-time visualizationof pH-responsive PLGA hollow particles containing a gas-generating agenttargeted for acidic organelles for overcoming multi-drug resistance. Bio-materials 2013;34:1e10.

[27] Liu L, Guo K, Lu J, Venkatraman SS, Luo D, Ng KC, et al. Biologically active core/shell nanoparticles self-assembled from cholesterol-terminated PEG-TAT fordrug delivery across the blood-brain barrier. Biomaterials 2008;29:1509e17.

[28] Hu Q, Wang J, Shen J, Liu M, Jin X, Tang G, et al. Intracellular pathways andnuclear localization signal peptide-mediated gene transfection by cationicpolymeric nanovectors. Biomaterials 2012;33:1135e45.

[29] Jiang QY, Lai LH, Shen J, Wang QQ, Xu FJ, Tang GP. Gene delivery to tumor cellsby cationic polymeric nanovectors coupled to folic acid and the cell-penetrating peptide octaarginine. Biomaterials 2011;32:7253e62.

[30] Hu QL, Jiang QY, Jin X, Shen J, Wang K, Li YB, et al. Cationic microRNA-delivering nanovectors with bifunctional peptides for efficient treatment ofPANC-1 xenograft model. Biomaterials 2013;34:2265e76.

[31] Fan H, Hu QD, Xu FJ, LiangWQ, Tang GP, YangWT. In vivo treatment of tumorsusing host-guest conjugated nanoparticles functionalized with doxorubicinand therapeutic gene pTRAIL. Biomaterials 2012;33:1428e36.

[32] Hu Q, Li W, Hu X, Shen J, Jin X, Zhou J, et al. Synergistic treatment of ovariancancer by co-delivery of survivin shRNA and paclitaxel via supramolecularmicellar assembly. Biomaterials 2012;33:6580e91.

[33] Abbasi M, Lavasanifar A, Uludag H. Recent attempts at RNAi-mediated P-glycoprotein downregulation for reversal of multidrug resistance in cancer.Med Res Rev 2013;33:33e53.

[34] Tacar O, Sriamornsak P, Dass CR. Doxorubicin: an update on anticancer mo-lecular action, toxicity and novel drug delivery systems. J Pharm Pharmacol2013;65:157e70.

[35] Cleary ML, Smith SD, Sklar J. Cloning and structural analysis of cDNAs for bcl-2and a hybrid bcl-2/immunoglobulin transcript resulting from the t(14;18)translocation. Cell 1986;47:19e28.

[36] Oltvai ZN, Milliman CL, Korsmeyer SJ. Bcl-2 heterodimerizes in vivo with aconserved homolog, Bax, that accelerates programmed cell death. Cell1993;74:609e19.

[37] Korsmeyer SJ, Shutter JR, Veis DJ, Merry DE, Oltvai ZN. Bcl-2/Bax: a rheostatthat regulates an anti-oxidant pathway and cell death. Semin Cancer Biol1993;4:327e32.

http://dx.doi.org/10.1016/j.biomaterials.2014.06.035http://dx.doi.org/10.1016/j.biomaterials.2014.06.035http://refhub.elsevier.com/S0142-9612(14)00726-1/sref1http://refhub.elsevier.com/S0142-9612(14)00726-1/sref1http://refhub.elsevier.com/S0142-9612(14)00726-1/sref1http://refhub.elsevier.com/S0142-9612(14)00726-1/sref1http://refhub.elsevier.com/S0142-9612(14)00726-1/sref2http://refhub.elsevier.com/S0142-9612(14)00726-1/sref2http://refhub.elsevier.com/S0142-9612(14)00726-1/sref2http://refhub.elsevier.com/S0142-9612(14)00726-1/sref3http://refhub.elsevier.com/S0142-9612(14)00726-1/sref3http://refhub.elsevier.com/S0142-9612(14)00726-1/sref3http://refhub.elsevier.com/S0142-9612(14)00726-1/sref4http://refhub.elsevier.com/S0142-9612(14)00726-1/sref4http://refhub.elsevier.com/S0142-9612(14)00726-1/sref4http://refhub.elsevier.com/S0142-9612(14)00726-1/sref5http://refhub.elsevier.com/S0142-9612(14)00726-1/sref5http://refhub.elsevier.com/S0142-9612(14)00726-1/sref6http://refhub.elsevier.com/S0142-9612(14)00726-1/sref6http://refhub.elsevier.com/S0142-9612(14)00726-1/sref6http://refhub.elsevier.com/S0142-9612(14)00726-1/sref6http://refhub.elsevier.com/S0142-9612(14)00726-1/sref7http://refhub.elsevier.com/S0142-9612(14)00726-1/sref7http://refhub.elsevier.com/S0142-9612(14)00726-1/sref7http://refhub.elsevier.com/S0142-9612(14)00726-1/sref8http://refhub.elsevier.com/S0142-9612(14)00726-1/sref8http://refhub.elsevier.com/S0142-9612(14)00726-1/sref8http://refhub.elsevier.com/S0142-9612(14)00726-1/sref8http://refhub.elsevier.com/S0142-9612(14)00726-1/sref9http://refhub.elsevier.com/S0142-9612(14)00726-1/sref9http://refhub.elsevier.com/S0142-9612(14)00726-1/sref9http://refhub.elsevier.com/S0142-9612(14)00726-1/sref9http://refhub.elsevier.com/S0142-9612(14)00726-1/sref10http://refhub.elsevier.com/S0142-9612(14)00726-1/sref10http://refhub.elsevier.com/S0142-9612(14)00726-1/sref10http://refhub.elsevier.com/S0142-9612(14)00726-1/sref10http://refhub.elsevier.com/S0142-9612(14)00726-1/sref11http://refhub.elsevier.com/S0142-9612(14)00726-1/sref11http://refhub.elsevier.com/S0142-9612(14)00726-1/sref11http://refhub.elsevier.com/S0142-9612(14)00726-1/sref11http://refhub.elsevier.com/S0142-9612(14)00726-1/sref12http://refhub.elsevier.com/S0142-9612(14)00726-1/sref12http://refhub.elsevier.com/S0142-9612(14)00726-1/sref12http://refhub.elsevier.com/S0142-9612(14)00726-1/sref13http://refhub.elsevier.com/S0142-9612(14)00726-1/sref13http://refhub.elsevier.com/S0142-9612(14)00726-1/sref13http://refhub.elsevier.com/S0142-9612(14)00726-1/sref13http://refhub.elsevier.com/S0142-9612(14)00726-1/sref13http://refhub.elsevier.com/S0142-9612(14)00726-1/sref14http://refhub.elsevier.com/S0142-9612(14)00726-1/sref14http://refhub.elsevier.com/S0142-9612(14)00726-1/sref14http://refhub.elsevier.com/S0142-9612(14)00726-1/sref15http://refhub.elsevier.com/S0142-9612(14)00726-1/sref15http://refhub.elsevier.com/S0142-9612(14)00726-1/sref15http://refhub.elsevier.com/S0142-9612(14)00726-1/sref15http://dx.doi.org/10.1002/smll.201303951http://refhub.elsevier.com/S0142-9612(14)00726-1/sref17http://refhub.elsevier.com/S0142-9612(14)00726-1/sref17http://refhub.elsevier.com/S0142-9612(14)00726-1/sref17http://refhub.elsevier.com/S0142-9612(14)00726-1/sref17http://refhub.elsevier.com/S0142-9612(14)00726-1/sref18http://refhub.elsevier.com/S0142-9612(14)00726-1/sref18http://refhub.elsevier.com/S0142-9612(14)00726-1/sref18http://refhub.elsevier.com/S0142-9612(14)00726-1/sref18http://refhub.elsevier.com/S0142-9612(14)00726-1/sref19http://refhub.elsevier.com/S0142-9612(14)00726-1/sref19http://refhub.elsevier.com/S0142-9612(14)00726-1/sref19http://refhub.elsevier.com/S0142-9612(14)00726-1/sref19http://refhub.elsevier.com/S0142-9612(14)00726-1/sref20http://refhub.elsevier.com/S0142-9612(14)00726-1/sref20http://refhub.elsevier.com/S0142-9612(14)00726-1/sref20http://refhub.elsevier.com/S0142-9612(14)00726-1/sref21http://refhub.elsevier.com/S0142-9612(14)00726-1/sref21http://refhub.elsevier.com/S0142-9612(14)00726-1/sref21http://refhub.elsevier.com/S0142-9612(14)00726-1/sref21http://refhub.elsevier.com/S0142-9612(14)00726-1/sref22http://refhub.elsevier.com/S0142-9612(14)00726-1/sref22http://refhub.elsevier.com/S0142-9612(14)00726-1/sref22http://refhub.elsevier.com/S0142-9612(14)00726-1/sref22http://refhub.elsevier.com/S0142-9612(14)00726-1/sref22http://refhub.elsevier.com/S0142-9612(14)00726-1/sref23http://refhub.elsevier.com/S0142-9612(14)00726-1/sref23http://refhub.elsevier.com/S0142-9612(14)00726-1/sref23http://refhub.elsevier.com/S0142-9612(14)00726-1/sref23http://refhub.elsevier.com/S0142-9612(14)00726-1/sref24http://refhub.elsevier.com/S0142-9612(14)00726-1/sref24http://refhub.elsevier.com/S0142-9612(14)00726-1/sref24http://refhub.elsevier.com/S0142-9612(14)00726-1/sref25http://refhub.elsevier.com/S0142-9612(14)00726-1/sref25http://refhub.elsevier.com/S0142-9612(14)00726-1/sref25http://refhub.elsevier.com/S0142-9612(14)00726-1/sref26http://refhub.elsevier.com/S0142-9612(14)00726-1/sref26http://refhub.elsevier.com/S0142-9612(14)00726-1/sref26http://refhub.elsevier.com/S0142-9612(14)00726-1/sref26http://refhub.elsevier.com/S0142-9612(14)00726-1/sref26http://refhub.elsevier.com/S0142-9612(14)00726-1/sref27http://refhub.elsevier.com/S0142-9612(14)00726-1/sref27http://refhub.elsevier.com/S0142-9612(14)00726-1/sref27http://refhub.elsevier.com/S0142-9612(14)00726-1/sref27http://refhub.elsevier.com/S0142-9612(14)00726-1/sref28http://refhub.elsevier.com/S0142-9612(14)00726-1/sref28http://refhub.elsevier.com/S0142-9612(14)00726-1/sref28http://refhub.elsevier.com/S0142-9612(14)00726-1/sref28http://refhub.elsevier.com/S0142-9612(14)00726-1/sref29http://refhub.elsevier.com/S0142-9612(14)00726-1/sref29http://refhub.elsevier.com/S0142-9612(14)00726-1/sref29http://refhub.elsevier.com/S0142-9612(14)00726-1/sref29http://refhub.elsevier.com/S0142-9612(14)00726-1/sref30http://refhub.elsevier.com/S0142-9612(14)00726-1/sref30http://refhub.elsevier.com/S0142-9612(14)00726-1/sref30http://refhub.elsevier.com/S0142-9612(14)00726-1/sref30http://refhub.elsevier.com/S0142-9612(14)00726-1/sref31http://refhub.elsevier.com/S0142-9612(14)00726-1/sref31http://refhub.elsevier.com/S0142-9612(14)00726-1/sref31http://refhub.elsevier.com/S0142-9612(14)00726-1/sref31http://refhub.elsevier.com/S0142-9612(14)00726-1/sref32http://refhub.elsevier.com/S0142-9612(14)00726-1/sref32http://refhub.elsevier.com/S0142-9612(14)00726-1/sref32http://refhub.elsevier.com/S0142-9612(14)00726-1/sref32http://refhub.elsevier.com/S0142-9612(14)00726-1/sref33http://refhub.elsevier.com/S0142-9612(14)00726-1/sref33http://refhub.elsevier.com/S0142-9612(14)00726-1/sref33http://refhub.elsevier.com/S0142-9612(14)00726-1/sref33http://refhub.elsevier.com/S0142-9612(14)00726-1/sref34http://refhub.elsevier.com/S0142-9612(14)00726-1/sref34http://refhub.elsevier.com/S0142-9612(14)00726-1/sref34http://refhub.elsevier.com/S0142-9612(14)00726-1/sref34http://refhub.elsevier.com/S0142-9612(14)00726-1/sref35http://refhub.elsevier.com/S0142-9612(14)00726-1/sref35http://refhub.elsevier.com/S0142-9612(14)00726-1/sref35http://refhub.elsevier.com/S0142-9612(14)00726-1/sref35http://refhub.elsevier.com/S0142-9612(14)00726-1/sref36http://refhub.elsevier.com/S0142-9612(14)00726-1/sref36http://refhub.elsevier.com/S0142-9612(14)00726-1/sref36http://refhub.elsevier.com/S0142-9612(14)00726-1/sref36http://refhub.elsevier.com/S0142-9612(14)00726-1/sref37http://refhub.elsevier.com/S0142-9612(14)00726-1/sref37http://refhub.elsevier.com/S0142-9612(14)00726-1/sref37http://refhub.elsevier.com/S0142-9612(14)00726-1/sref37

Restoration of chemosensitivity by multifunctional micelles mediated by P-gp siRNA to reverse MDR1 Introduction2 Materials and methods2.1 Materials2.2 Cells and animals2.3 Synthesis and characterization of PEI-CyD-Cholesterol (PCC)2.4 Characterization of PCC micelles2.5 In vitro biological characterization of PCC2.6 Inhibition of ABCB1 expression by the micelle/siRNA complex2.7 In vivo tumor therapy2.8 Statistical analysis

3 Results3.1 Formation and characterization of PCC micelles3.2 Synergistic effects of P-gp siRNA and DOX in vitro3.3 In vivo MDR tumor therapy

4 Discussion5 ConclusionAcknowledgmentsAppendix A Supplementary dataReferences