Gene 563 (2015) 63–71

Contents lists available at ScienceDirect

Gene

j ourna l homepage: www.e lsev ie r .com/ locate /gene

Research paper

Isolation and characterization of a catalase gene “HuCAT3” from pitaya(Hylocereus undatus) and its expression under abiotic stress

Qiong Nie a,b, Guo-Li Gao a, Qing-jie Fan a, Guang Qiao a, Xiao-Peng Wen a,⁎, Tao Liu c,Zhi-Jun Peng c, Yong-Qiang Cai c

a Key Laboratory of Plant Resources Conservation and Germplasm Innovation in Mountainous Region (Guizhou University), Ministry of Education, Institute of Agro-bioengineering, GuizhouUniversity, Guiyang 550025, Guizhou Province, PR Chinab College of Agriculture, Guizhou University, Guiyang 550025, Guizhou Province, PR Chinac Guizhou Institute of Fruit Tree Science, Guiyang 550006, Guizhou Province, PR China

Abbreviations: CAT, catalase; HuCAT3, catalase geneHuCAT, catalase in pitaya; ROS, reactive oxygen species; Hdifferentially expressedgenes;ESTs, expressedsequence taMS,Murashige and Skoogmedium; NAA, naphthalene acePEG, polyethylene glycol; RACE, rapid amplification of cframe; qRT-PCR, quantitative real-time PCR; RT-PCR, revchain reaction; CAM, CAT activity motif; HBS, heme-bitargeting sequence 1.⁎ Corresponding author.

E-mail address: xpwensc@hotmail.com (X.-P. Wen).

http://dx.doi.org/10.1016/j.gene.2015.03.0070378-1119/© 2015 Elsevier B.V. All rights reserved.

a b s t r a c t

a r t i c l e i n f o

Article history:Received 6 October 2014Received in revised form 14 February 2015Accepted 4 March 2015Available online 6 March 2015

Keywords:Abiotic stressCatalase activityGene expressionHuCATPitaya

Abiotic stresses usually cause H2O2 accumulation, with harmful effects, in plants. Catalase may play a key protec-tive role in plant cells by detoxifying this excess H2O2. Pitaya (Hylocereus undatus) shows broad ecological adap-tation due to its high tolerance to abiotic stresses, e.g. drought, heat and poor soil. However, involvement of thepitaya catalase gene (HuCAT) in tolerance to abiotic stresses is unknown. In the present study, a full-lengthHuCAT3 cDNA (1870 bp) was isolated from pitaya based on our previous microarray data and RACE method.The cDNA sequence and deduced amino acid sequence shared 73–77% and 75–80% identity with other plant cat-alases, respectively. HuCAT3 contains conserved catalase family domain and catalytic sites. Pairwise comparisonand phylogenetic analysis indicated that HuCAT3 is most similar to Eriobotrya japonica CAT, followed byDimocarpus longan CAT and Nicotiana tabacum CAT1. Expression profile analysis demonstrated that HuCAT3 ismainly expressed in green cotyledons and mature stems, and was regulated by H2O2, drought, cold and saltstress, whereas, its expression patterns andmaximum expression levels varied with stress types. HuCAT activityincreased as exposure to the tested stresses, and the fluctuation of HuCAT activity was consistent with HuCAT3mRNA abundance (except for 0.5 days upon drought stress). HuCAT3 mRNA elevations and HuCAT activitieschanges under cold stress were also in conformity with the cold tolerances among the four genotypes. The ob-tained results confirmed amajor role ofHuCAT3 in abiotic stress response of pitaya. This may prove useful in un-derstanding pitaya's high tolerance to abiotic stresses at molecular level.

© 2015 Elsevier B.V. All rights reserved.

1. Introduction

Plants are frequently exposed to harsh environmental conditions,such as drought, cold, and salt, which can potentially lead to metabolicdysfunction and death. Abiotic stress causes the generation of reactiveoxygen species (ROS), which can damage plant cell membranes and es-sentialmacromolecules, including proteins, DNA, and lipids (Ashraf andAli, 2008).Moreover, ROS serve as signalmolecules that can trigger a se-ries of cell responses via the expression of certain genes to produce sec-ondarymetabolites that will protect the cells (Chen et al., 2008; Cavatte

in pitaya (Hylocereus undatus);2O2, hydrogen peroxide; DEGs,gs;GSPs, gene-specificprimers;tic acid; 6-BA, 6-benzyladenine;DNA ends; ORF, open readingerse transcriptase polymerasending site; PTS1, peroxisomal

et al., 2012; Niu et al., 2013; Safari et al., 2013a, 2013b). Therefore, theaccumulation of ROS and ROS-induced changes in cellular redox stateare a central theme in many abiotic stress responses (Foyer andNoctor, 2005; Mhamdi et al., 2010; Shi et al., 2012). Once the redox bal-ance is disrupted, oxidative damage occurs, resulting in cellular dys-function (Reddy et al., 2004). ROS include free radicals such assuperoxide and the hydroxyl radical, as well as non-radicals like singletoxygen and hydrogen peroxide (H2O2) (Chaves and Oliveira, 2004).

The antioxidative system is an important defense mechanism, withantioxidant enzymes that are highly efficient against oxidative stress(Farooq et al., 2008). Plants contain several types of enzymes, amongthem catalase (CAT, EC 1.11.1.6), ascorbate peroxidase, glutathione re-ductase and glutathione S-transferase, which can metabolize peroxidessuch as H2O2 (Mittler, 2002; Iqbal et al., 2006). H2O2 homeostasis ismainly due to the scavenging and regulatory functions of CAT under abi-otic stress (Sairam et al., 2005; Safari et al., 2013a, 2013b). CATs are tet-rameric heme-containing enzymes with high activity and present inperoxisomes, glyoxysomes, and related organelles inwhichH2O2 is gen-erated (Agrawal et al., 2009). CATs do not require cellular reductantswhen they primarily catalyze a dismutase reaction, and one molecule

Table 1Primers used in the full-length cloning of HuCAT and its expression analysis.

Use Name Sequence (5′–3′)

First strand cDNA synthesis GSP1 TCCCTGTTGATGAAGC5′ RACE GSP2 CTGTAGTCCTGGGGGATGCC

GSP3 GAGGCTCTCTGGGTGATGCG3′ RACE GSP4 CTCCAGTGCCGTGTCTTTGCGTATG

GSP5 ACCGGCTTGGGGCTAACTACATGATFull-length F TCCAGGCTTCCTTGCTAACC

R GTCATGATGCCCCCAAAACAExpression analysis HuCat1f AATAGATCCCAGGAACCACCA

HuCat1r ACCCAGAGAGCCTCAACACCHuCat2f CCACGCATTCAAGCCAAACCHuCat2r CCCACATCGTCGAAGAGCCA

Internal control HuActin1 TCTGCTGAGCGAGAAATHuActin2 AGCCACCACTAAGAACAATHuUBQ1 TGAATCATCCGACACCATHuUBQ2 TCCTCTTCTTAGCACCACC

64 Q. Nie et al. / Gene 563 (2015) 63–71

of CAT can convert around 6 ×106 molecules of H2O2 to H2O and O2 perminute (Gill and Tuteja, 2010). Therefore, CATs demonstrate high spec-ificity for H2O2 scavenging, and play a key role in detoxifying excessH2O2 (König et al., 2002; Shi et al., 2012).

There are numerous reports concerning CAT expression in responseto various stresses. CAT expression has been shown to increase in re-sponse to drought (Svetlana et al., 2011; Shi et al., 2012), cold (Duet al., 2008; Luis et al., 2012), salinity (Yang et al., 2006), low-intensityultrasound (Masoumeh et al., 2013) and heat stresses (Lin et al., 2010;Shi et al., 2012). High levels of CAT expression, either constitutive or in-ducible, are important to enduring short- and long-term stresses inwheat (Svetlana et al., 2011), triticale (Baczek-kwinta et al., 2006),arabidopsis (Mhamdi et al., 2010) and hazel (Safari et al., 2013a,2013b). CAT expression is strongly induced by H2O2 treatment inarabidopsis seedlings (Xing et al., 2008). A recent study reported a 2-fold increase in extractable H2O2 in a CAT-deficient arabidopsis plant(Hu et al., 2010). Furthermore, higher CAT activities in high-temperature-treated plants might reduce H2O2 accumulation and alle-viate damage to the cellmembranes in broccoli (Lin et al., 2010). CAT ac-tivity is considered an indicator of tolerance to oxidative stress(Baczek-kwinta et al., 2006; Lin et al., 2010). Therefore, CAT may playa key role in the response of plants to abiotic stresses, and may protectplant cells from the toxic effects of peroxides through regulation ofCAT gene expression and protein activity (Svetlana et al., 2011;Cavatte et al., 2012; Shi et al., 2012), although CAT expression and CATactivity show variable trends under different abiotic stresses.

Moreover, bacterial CAT targeted to transgenic plants was able to re-move H2O2 and to protect the photosynthetic apparatus from oxidativestress (Miyagawa et al., 2000). Overexpression of the Escherichia coliCAT katE enhanced tolerance to salinity stress in the transgenic indicarice cultivar, and the CAT conferring drought tolerance in tobacco(Miyagawa et al., 2000) could increase salt tolerance in transgenic rice(Moriwaki et al., 2008). Wheat CAT expressed in transgenic rice im-proved its tolerance to low-temperature stress (Matsumura et al.,2002), indicating that CAT is an important gene related to abiotic stress-es and that it can be used to improve plant stress tolerance.

Pitaya (Hylocereus undatus), a tropical and subtropical fruit in thefamily Cactaceae, is characterized by its high nutritional, economic andmedical values (Vaillant et al., 2005; Jaafar et al., 2009; Zhuang et al.,2012). It is cultivated commercially in Thailand, Philippines, Taiwan,Malaysia and southern China etc. Moreover, pitaya is adapted to awide ecological range due to its high tolerance to drought, heat andpoor soil (Lim, 2012). By elucidating the roles and regulatory mecha-nisms of defense-related genes in adapting to abiotic stresses, we cancome to understand the mechanism governing the plant tolerance toadversity. Nevertheless, molecular information on pitaya adaptative re-sponses to adversity is highly limited. In a previous work, we identifiedseveral differentially expressed genes that were implicated in thedrought response in pitaya, one of whichwas CAT—by suppression sub-tractive hybridization and cDNA microarray analysis (Fan et al., 2014).To further understand the antioxidant roles of pitaya CAT in abioticstress response, a full-length CAT gene (HuCAT3) was isolated basedon themicroarray data from pitaya, and its responses to abiotic stresses(H2O2, drought, cold and salt) were elucidated at both themRNA abun-dance and enzyme activity levels. The results, as documented in pitaya,might provide a better understanding of themolecular basis of plant an-tioxidant responses to abiotic stress.

2. Materials and methods

2.1. Plant material and stress treatments

Four pitaya genotypes, i.e. ‘Zihonglong’, ‘Honglongguo’, B4 and ZY,were used. To ensure the consistency of the material, stem buds fromthe same clone as explantsweremicropropagated in vitro onMurashigeand Skoog (MS) medium with 0.1 mM naphthalene acetic acid (NAA)

and 2 mM 6-benzyladenine (6-BA) for one month under a 14 h light/10 h dark photoperiod at 25 °C, then shoots were transferred to a 1/2MS medium containing 0.1 mM NAA for root regeneration for twomonths (5–6 cm in height). To analyze the response of the clonedgene to H2O2, drought and salt stress, the rooted plantlets (with age-matched shoots, 5–6 cm in height) were transplanted in the 1/2MS liq-uid medium supplemented with or without (stress-free, control)10 mM H2O2 for 0, 6, 12, 24 and 60 h, 10% polyethylene glycol (PEG,MW 6000) for 0, 0.5, 1, 3, 5, 7, 10 and 15 days, or 200 mM NaCl for 0,6, 12, 24 and 48 h. To analyze the response of the cloned gene to coldstress, the in vitro-grown shoots (age-matched, 5–6 cm in height)were exposed to −2 °C for 0, 6, 12, 24 and 48 h. At the end of each ex-posure, shoots were harvested, immediately frozen in liquid nitrogenand stored at −80 °C for further analysis. Roots, cotyledons andcaulicles from potted plants that had grown in a greenhouse for3 months, as well as mature stems, flowers, fruits from the 6-year-oldfield-grown plants (‘Zihonglong’) were harvested, immediately frozenin liquid nitrogen and stored at −80 °C for spatial expressionevaluation.

2.2. RNA isolation

Total RNAwas isolated from shoots of the plant using TransZol PlantRNA Extraction Kit (Tiangen, China) according to themanufacturer's in-structions. All RNA sampleswere evaluated by a ratio of 260/280 nmab-sorption and their integrity was determined by visualizing the bands ona 1% agarose gel with ethidium bromide staining.

2.3. Rapid amplification of cDNA ends (RACE)

Based on the expressed sequence tags (ESTs) of HuCAT3, gene-specific primers (GSPs, Table 1) were designed for cloning the 5′ and3′ ends by RACE from ‘Zihongling’ total RNA of unstressed shoots.First-strand cDNA was synthesized from 5 μg total RNA using Super-script II reverse transcriptase and the GSP1 primer (Table 1). 5′-RACEand 3′-RACE were performed using 5′ RACE SYSTEM VERSION 2.0(Invitrogen, USA) with two specific primers GSP2 and GSP3 (Table 1)and a SMARTer™ RACE cDNA Amplification Kit (Clontech, USA) withtwo primers GSP4 and GSP5 (Table 1), respectively, according to themanufacturers' instructions. PCR products of the expected sizes wereexcised, purified with Agarose Gel DNA Fragment Recovery Kit(Roche, USA), then inserted into the pMD18-T vector (Invitrogen,USA), amplified in E. coli and sequenced. Then, the putative 3′ and 5′-RACE cDNAs and the EST were overlapped using DNAstar to form acDNA contig (Wu et al., 2014), which was used to determine the puta-tive translation–initiation codon (ATG) and open reading frame (ORF).To obtain the full-length cDNA of HuCAT3, a pair of full-length primersF and R (Table 1) was designed to cover the region from the start to

65Q. Nie et al. / Gene 563 (2015) 63–71

stop codons according to the contig. The full lengthwas obtained by am-plification and sequencing.

2.4. Bioinformatics analysis of HuCAT3

Similarity search for nucleotide and amino acid sequences ofHuCAT3were conducted using BLASTn and BLASTp (http://blast.ncbi.nlm.nih.gov/Blast.cgi), respectively. The ORF and the deduced amino acid se-quence were analyzed using ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). Molecular weight (MW), isoelectric point (pI)and instability index of HuCAT3 were calculated with ExPASy ToolProtParam (http://web.expasy.org/protparam/). Conserved domains ofthe deduced HuCAT3 sequence were identified with CDD Tool CD-Search (http://www.ncbi.nlm.nih.gov/Structure/cdd/docs/cdd_search.html). Transmembrane regions were predicted with a TmPredalgorithm (http://www.ch.embnet.org/software/TMPRED_form.html).Multiple sequence alignment and pairwise comparison of amino acidsequences were made with a Clustal W2 program (http://www.ebi.ac.uk/Tools/msa/clustalw2/) using default parameters. The amino acid se-quences of HuCAT3 and 17 CATs from other organisms were used forpairwise identities and phylogenetic analysis. Phylogenetic trees wasconstructed using Mega Package Version 5.2 (Cultrera et al., 2014)with the neighbor-joining algorithm method with 1000 permutations.

2.5. HuCAT3 expression analysis

RT-PCR analysis was employed to quantify and validate the relativechanges in HuCAT3 expression upon exposure to H2O2, drought, coldor salt stress. First-strand cDNA of each RNA sample (stress and control)was synthesized using Quantscript RT Kit (Tiangen, China) according tothe manufacturer's instructions. Two pairs of specific primers—HuCat1and HuCat2 (Table 1) were designed from the full-length cDNA se-quences using Primer 5.0 software, and were used to detect HuCAT3expression for fragments of 468 bp and 117 bp, respectively. Semiquan-titative RT-PCR was performed using 2 × Taq PCR Mastermix (Tiangen,China). The PCR consisted of 50 ng cDNA, 5 μM of each HuCat1 primer,5 μL Mastermix (containing 0.1 U μL−1 Taq polymerase, 500 μM dNTP,20mM Tris–HCl pH 8.3, 100 mMKCl, 3 mMMgCl2 and other stabilizersand intensifiers), brought to 10 μL with ddH2O. PCR amplification wascarried out as follows: 3 min at 94 °C, 24 cycles of 40 s at 94 °C, 40 s at57 °C, 1 min at 72 °C, and a final extension for 5 min at 72 °C. The tran-script levels of HuCAT3 were normalized against the expression of theinternal controls including HuActin and HuUBQ, which were amplifiedusing primers HuActin1, 2 and HuUBQ1, 2 (Table 1). The amplifiedproducts were electrophoresed on a 1% agarose gel and viewed underUV light after standard staining with ethidium bromide.

Quantitative real-time PCR (qRT-PCR) analysis was performed usingSYBR Green Master Mix (Tiangen, China) on an ABI 7500 sequence de-tection system. The PCR consisted of 10 μL SYBR Premix Ex Taq, 50 ngcDNA, and 4 μM of each HuCat2 primer, brought to 20 μL with ddH2O.The PCR amplification was carried out as follows: 95 °C pre-denaturization for 3 min, then 40 cycles of 95 °C for 20 s, 60 °C for15 s and 72 °C for 30 s. A comparative threshold cycle (Ct) was usedto determine gene expression, and the Ct value of each sample was nor-malized to the geometric mean of the Ct values of two internal controlgenes (HuActin and HuUBQ). The stress-free shoots cDNA of the sametime point were used as negative controls. The relative expressions ofHuCAT3under different stresseswere calculatedusing the 2−ΔΔCtmethod(Livak and Schmittgen, 2001), where ΔCt = Cttarget gene − Ctreference gene,ΔΔCt = ΔCtstress − ΔCtstress-free.

2.6. CAT activity assay

Samples (ca. 0.2 g) of stressed and control in vitro-grown shootswere homogenized in 2 ml of sodium phosphate buffer (25 mM,pH 7.0) containing 1% (w/v) soluble polyvinylpyrrolidine. The

homogenate was centrifuged at 4000 g for 15 min at 4 °C. Soluble pro-tein content was determined by Coomassie blue dye binding methodwith a standard curve of bovine serum albumin (Sedmak andGrossberg, 1977). CAT activity was monitored by measuring decreaseof absorbance at 405 nm due to H2O2 consumption, against milligramof protein (Ashraf and Ali, 2008). H2O2 utilization was quantified at405nmusing a catalase assay kit (Nanjing Jiangcheng, China), accordingto the manufacturer's instructions.

2.7. Statistical analyses

All treatments were carried out at least in duplicate with three rep-etitions consisting of nine in vitro-grown shoots; one experimentconsisted of three shoots. Measurements were repeated three times,and representative data are presented. Significant differences were an-alyzed using DPS 7.05 software (China). Observations were expressedas mean ± SE. Observations were considered significantly different atP b 0.05 (n = 3).

3. Results

3.1. Cloning and characterization of HuCAT3

The full-length cDNA sequence of HuCAT3 was obtained from thetotal RNA (‘Zihonglong’, unstress) by RACE and PCR based on a 698-bppitaya EST. The sequence was 1870 bp in length and contained a1479-bpORF, a 109-bp 5′-UTR and a 282-bp 3′-UTRwith a poly A signal“AATAAA”, and the G+C content of theORFwas 50.1%. The similar per-oxisomal targeting sequence 1 (PTS1) and PTS1 motif (T-R-L) werefound in the extreme C-terminus (Fig. S). The cDNA sequence character-ized is in Supplementary Fig. S. TheHuCAT3 cDNA sequencewas depos-ited in GenBank with accession number KF887150.1.

The full-length cDNA encoded a predicted protein of 492 aminoacids (Figs. S, 1B), and thepredictedMWandpI of the deduced polypep-tide were 57.03 kDa and 7.03, respectively, indicating a stable, non-transmembrane protein. A search of the NCBI conserved domain data-base (CDD) indicated the presence of conserved heme-binding pocket(chemical binding site) and tetramer interface (polypeptide bindingsite), belonging to catalase_clade_1 (Fig. 1A). Seven residues of the con-served heme-binding pocket and 76 residues of the conserved tetramerinterface were mapped to the HuCAT3 sequence (Figs. S, 1B). Multiplesequence alignment of HuCAT3 with CATs from Arabidopsis thaliana(AtCAT; CAA64220.1), Pseudomonas syringae (PsCAT; 1M7S_A),Chlamydomonas reinhardtii (CrCAT; AAB70006) and Oryza sativa(OsCAT; AAQ19030.1) revealed highly conserved signature domains(Fig. 1B). The seven residues composing the heme-binding pocketwere quite well conserved, consisting of the distal residues 65 (H),104 (S), 138 (N), 143 (F), 151 (F), and the proximal residues 344(R) and heme ligand 348 (Y) (Figs. S, 1B), which play important rolesin catalytic function and the heme ligand. The conserved sequencealso showed the CAT activity motif (CAM, FHRERIPERIVHARGAS) andCAT heme-binding site (HBS, RVFAYGDAQ) (Figs. S, 1B), indicatingthat HuCAT3 is a typical CAT.

3.2. Sequence and phylogenetic analysis

Sequence analysis by BLASTn and BLASTp in the NCBI database re-vealed 73–77% identity of the cDNA sequence, and 75–80% identity ofthe deduced amino acid sequence with the CATs from other plant spe-cies. Based on cDNA sequences,HuCAT3was 74%, 74% and 73% identicalto CAT1 (NM_101914.3), CAT2 (NM_001036714.5) and CAT3 (NM_202144.2) of A. thaliana, respectively, and the deduced amino acid se-quence of HuCAT3 shared 75.8%, 77.4% and 76.2% identity to AtCAT1(NP_564121.1), AtCAT2 (NP_195235.1) andAtCAT3 (NP_564120.1), re-spectively (Fig. 2), indicating that this gene wasmost close to AtCAT2 inboth cDNA and deduced amino acid sequences.

Fig. 1. A. Conserved domains of the HuCAT3 protein as determined using the NCBI conserved domain database. B. Alignment of deduced amino acid sequence of HuCAT3with those ofdiverse organisms. “–”, “*”, “:” and “.” indicated gaps introduced for optimal alignment, identical, conserved and semi-conserved amino acid residues in all sequences, respectively;boxed amino acid residues of the conserved heme-binding pocket indicated 100% sequence identity. The CAM, HBS and PTS1 were overlined.

66 Q. Nie et al. / Gene 563 (2015) 63–71

To analyze the phylogenetic relationship betweenHuCAT3 and CATsfromother organisms, pairwise identities (Fig. 2) and phylogenetic rela-tionships (Fig. 3) among the CAT sequences from 17 organisms wereestablished. CAT sequences from prokaryotes and eukaryotes, includingbacteria, chlorella and plants, were used. Higher conservation among

Fig. 2. Pairwise amino acid sequence comparison of HuCAT3 with CATs from other organisms.(EjCAT, AGC65520.1), M. crystallinum (McCAT, AAC19397.1), N. tabacum (NtCAT1, CCP37651.S. salsa (SsCAT, AAK67359.2), A. thaliana (AtCAT1, NP_564121.1; AtCAT2, NP_195235.1; AtCAZ. mays (ZmCAT1, CAA42720; ZmCAT2, P12365.3), C. reinhardtii (CrCAT, AAB70006) and P. syvalues are represented by a blue-to-white color gradient. Blue color represents high percent id

sequences suggested a lower evolutionary level. HuCAT3 containedthe well-conserved sequences of the heme-binding pocket, the tetra-mer interface, CAM and HBS (Fig. 1B). However, HuCAT3 shared46.6%, 69.9% and 74.69–80.1% amino acid sequence identity with CATsfrom P. syringae, C. reinhardtii and the other plant CATs, respectively

The other CATs included in the alignment: from D. longan (DlCAT, ACJ76836.3), E. japonica1; NtCAT3, CCP37652.1), R. australe (RaCAT, ACH63223.1), Z. Jujuba (ZjCAT, AET97564.1),T3, NP_564120.1), O. sativa (OsCAT, BAA34205.1), Z. aethiopica (ZaCAT1, AAF19965.1),ringae (PsCAT, 1M7S_A). Values present percent sequence identity. The percent identityentity whereas white represents low percent identity between the sequences.

Fig. 3. Neighbor-joining phylogenetic tree constructed by the Mega 5.2 beta programbased on the pairwise alignments of the amino acid sequences. Numbers above thebranches indicate bootstrap values (bootstrap analysis with 1000 replicates).

67Q. Nie et al. / Gene 563 (2015) 63–71

(Fig. 2), such as those from Zeamays (ZmCAT2, 74.9%), O. sativa (OsCAT,77.4%), D. longan (DlCAT, 78.7%), Mesembryanthemum crystallinum(McCAT, 79.3%) and E. japonica (EjCAT, 80.1%); the CAT fromP. syringae and plants shared only 46–49.4% amino acid sequence iden-tity. Pairwise comparison indicated that HuCAT3 is most similar toEjCAT, followed by McCAT and DlCAT.

The phylogenetic tree was grouped into four branches: dicotyledon,monocotyledon, chlorella and bacterium (Fig. 3). Twelve CAT aminoacid sequences, including that of HuCAT3, were grouped into the dicot-yledon subcluster, and high amino acid-sequence divergence was ob-served between dicotyledonous and monocotyledonous CATs. Thiswas in accordance with their traditional phylogenetic relationship,probably reflecting the presence of CAT genes early on in the evolutionof plant species. PsCAT was used as an outgroup for the rooted treesince the amino acid sequence of the bacterial CAT differed significantlyfrom that of plant and C. reinhardtii CATs. The lower similarity of PsCATto plant CATs, compared to that between CrCAT and plant CATs (Figs. 2,3), suggested that during the course of evolution, bacterial and plantCATs diverged earlier than chlorella and plant CATs. The phylogeneticanalysis clustered HuCAT3 with CATs from E. japonica, D. longan,N. tabacum (NtCAT1) and A. thaliana (AtCAT3) in the same subcluster;HuCAT3 did not cluster with CATs of the same Order, i.e. McCAT,Rheum australe CAT and Suaeda salsa CAT.

Fig. 4.Expressionprofile ofHuCAT3 in thepresence of exogenously appliedH2O2. A. Transcript abunfree shoots cDNA of the same time point were used as negative controls. Error bars are shown forsignificant difference between stressed and control samples at each stage at P b 0.05.

3.3. Effect of H2O2 on HuCAT3 transcription

To explore the effect of exogenous H2O2 on HuCAT3 transcription,the level of HuCAT3 mRNA expression in H2O2-treated and untreated(control) samples (‘Zihonglong’) were investigated by RT-PCR andqRT-PCR. HuCAT3 expression was strongly up-regulated by H2O2 treat-ment in comparison with that of the control. It increased rapidly duringthe first 24 h and then decreased slowly with treatment duration(Fig. 4). The relative expression level of HuCAT3 mRNA at the 24thhour was approximately 8-fold as high as that of the control (P b 0.05,Fig. 4B), indicating that exogenousH2O2 enhancesHuCAT3 transcriptionin the pitaya. Interestingly, the mRNA level of HuCAT3 also increased at12 h (0.5 days) in the control (Figs. 4A, 5A-a).

3.4. Transcriptional profile of HuCAT3 under abiotic stresses

To unravel the transcriptional profile of HuCAT3 under exposure tostresses, semiquantitative and qRT-PCR were carried out with the totalRNA of the test samples (‘Zihonglong’). Expression of HuCAT3 was up-regulated by drought, cold and salt stresses, but the expression patternsand peak expression levels differed among the types of stress (Fig. 5A,B). The expression level ofHuCAT3mRNA showed no significant changeduring the first 5 days of exposure to drought, then it increased to ca. 8-fold than the control level on day 7 (P b 0.05, Fig. 5B-a). Thereafter, it de-creased gradually to ca. 2-fold than the control level on day 15(P b 0.05). Upon exposure to NaCl, HuCAT3 mRNA expression levelpeaked at 6 h, was 15-fold higher than that of the control (P b 0.05,Fig. 5B-b). It then declined gradually with duration of the salt stress,and was close to the control at 48 h. HuCAT3 expression was also obvi-ously enhanced under cold stress, and peaked at 48 h, with ca. 9-foldas high as that of the control (P b 0.05, Fig. 5B-b).

3.5. Changes in HuCAT activity under abiotic stress

The responses of HuCAT activity to drought, cold and salt stress wereinvestigated in pitaya (‘Zihonglong’). Relative to the control, HuCAT ac-tivity increased with duration of exposure to the tested abiotic stresses;however, response patterns varied with the type of stress (Fig. 5C).Under drought stress, CAT activity showed “M” type asymmetry(Fig. 5C-a): firstly increased (at 0.5 d), and then decreased after 1 dayof exposure to the stress, followed by a gradual increase from 3 daysto 7 days, with the highest value (1.8-fold as the control) at day 7(P b 0.05), finally declined. As exposure to cold stress (−2 °C), CAT ac-tivity also significantly increased after 6 h, and then decreased slightly,followed by a gradually increase from 24 h to 48 h (Fig. 5C-b), and the

dance ofHuCAT3byRT-PCR. B. Relative expression profiles ofHuCAT3byqRT-PCR. The stress-multiple replicates of the assay. Values are presented as means ± SD (n= 3). “*” stands for

Fig. 5. Expression profile ofHuCAT3 under drought, cold and salt stress. A. Transcript abundance of HuCAT3 by RT-PCR. B. Relative expression profiles by qRT-PCR, the 2−ΔΔCt method wasused tomeasure the relative expression levels of the target gene in stressed and control shoots at the same time point. C. Catalase activity (ΔA405 permg protein). Error bars are shown formultiple replicates of the assay. Values are presented as means ± SD (n = 3). “*” stands for significant difference between stressed and control samples at each stage at P b 0.05.

68 Q. Nie et al. / Gene 563 (2015) 63–71

relative activity levels peaked at 48 h, at ca. 1.6-fold the control activity(P b 0.05). In addition, CAT activity reached its peak (1.9-fold that of thecontrol, P b 0.05) after 6 h exposure to 200mMNaCl, then gradually de-creased (Fig. 5C-b).

3.6. HuCAT3 responsiveness to cold stress among genotypes

To further estimate the function of HuCAT3, we analyzed its expres-sion patterns at transcript and protein levels in four pitaya genotypesunder cold stress (−2 °C for 6 h and 48 h) compared to controls(25 °C) (Fig. 6). qRT-PCR data suggested that HuCAT3 expression is in-duced by cold stress. HuCAT3mRNA expression levels increased signifi-cantly in all tested genotypes after 6 h treatment, i.e. 7.0-, 6.1-, 3.0- and2.9-fold in ‘Zihonglong’, ‘Honglongguo’, B4 and ZY, respectively, relativeto controls (Fig. 6A). The expression levels peaked at 48 h in‘Zihonglong’ and ‘Honglongguo’, at ca. 9.2- and 6.7-fold that of controls(P b 0.05), respectively, whereas it decreased in B4 and ZY at this time

Fig. 6. The expression profiles of HuCAT3 among genotypes under low-temperature stress. A. R(error bars) for three replicates. *Significant difference between stressed and control samples a

point, being only about half of the control (P b 0.05). HuCAT activityalso increased significantly in the four genotypes under low-temperature stress (except for ZY at 48 h). The activity levels peakedat 48 h in ‘Zihonglong’ and ‘Honglongguo’, approximately two timeshigher than the control (P b 0.05), whereas it was remarkably decreasedin B4 and ZY in comparison with the control (P b 0.05). As showed byFig. 6B, HuCAT activity order of the tested genotypes after 48 h stresswas ‘Zihonglong’ N ‘Honglongguo’ N B4 N ZY.

3.7. Expression of HuCAT3 mRNA in different tissues of pitaya

Real-time PCR quantification showed that HuCAT3mRNA expressedin a clearly tissue-specific pattern (Fig. 7). The lowest expression leveloccurred in the young fruit (normalized to 1.00) and the relatively ex-pression levels followed the order: mature stem (27.56) N cotyledon(4.93) N flower (4.09) N caulicle (2.49) N root (1.83) N fruit (1.00), sug-gesting that expression ofHuCAT3wasmost abundant in mature stems,

elative mRNA expression by qRT-PCR. B. Catalase activity. Values are shown as mean± SDt each stage at P b 0.05.

Fig. 7. The spatial expression profiles of HuCAT3 in pitaya by qRT-PCR.

69Q. Nie et al. / Gene 563 (2015) 63–71

and roots and young fruit had low levels of CAT3 mRNA. Interestingly,higher levels of HuCAT3 mRNA were investigated in green cotyledonsand mature stem, whose chlorophyll contents were considerably highin comparison with that of roots and fruits, reflecting that HuCAT3might play an important role in the scavenging of H2O2 generated byphotorespiration of pitaya.

4. Discussion

4.1. Plant CATs

The complex antioxidant defense system in plants is mainly com-posed of antioxidant enzymes. Of these, the CATs were the first to bediscovered and characterized, and verified as essential for the removalof H2O2 produced in the peroxisomes by photorespiration (Noctoret al., 2000). Their major function is to maintain the redox balancein vivo and protect plants from oxidative damage under abiotic stress(Magbanua et al., 2007). Higher plants contain several CATs, which areencoded by a small family of three genes (Li and Liu, 2009; Mhamdiet al., 2010). The CAT sequences have high similarity, with translationproducts that are 492 amino acids in length (Hu et al., 2010). DifferentCATs are differentially regulated, exhibit various functions, and aremainly expressed in different cells (Zimmermann et al., 2006). Manyplant CATs have been cloned and characterized, such as those frompumpkin (Muneharu et al., 1997), Nicotiana plumbaginifolia(Willekens et al., 1994), rice (Iwamoto et al., 2000; Li and Liu, 2009),A. thaliana (Mhamdi et al., 2010) and broccoli (Lin et al., 2010), indicat-ing that plants have evolvedmultiple CAT isoforms to regulate develop-ment in various tissues, and to adapt to a variety of environmentalstresses (Li and Liu, 2009).

Here, for the first time, a full-length CAT gene (HuCAT3) was clonedand characterized from pitaya. The deduced amino acid sequence in-cluded the conserved heme binding pocket, tetramer structure, CAT ac-tivity motif and CAT heme-binding site, belonging to the catalase family(Fig. 1). The similar PTS1 and its motif (T-R-L) at the extreme C-terminus ofHuCAT3 (Figs. S, 1B), whichmay act to allow or enhance im-port of CAT into peroxisomes, i.e. as targeting signals for peroxisomes(Kaur et al., 2009), indicated that HuCAT3 was a typical CAT gene, andmay encode a biologically active protein. According to the classificationbased on catalase expression patterns and functional analysis(Willekens et al., 1995), HuCAT3 corresponds to Class II catalases,which is mainly expressed in green cotyledons and mature stems(Fig. 7), might play an important role in the scavenging of H2O2 gener-ated by photorespiration of pitaya. Phylogenetic analysis resultsreflected the presence of CAT genes early in the evolutionary history,

and a possible correlation between their classification and function.For example, CATs from thermophilous plants with a higher tempera-ture requirement, i.e. HuCAT3, EjCAT, DlCAT, NtCAT1 and AtCAT3, clus-tered into the same subcluster. Similarly, the Caryophyllales CATs (fromM. crystallinum, R. australe and S. salsa, plants that are distributedmainlyin alpine regions) clustered into another subcluster (Fig. 3). The diversi-ty of CAT genes is probably an adaptive function to keep up with therapid evolution of plants over the adverse environments (Lin et al.,2010).

In addition, HuCAT3 showed higher identity to AtCAT2 than toAtCAT3 on deduced amino acid sequences (Fig. 2), however, HuCAT3and AtCAT3 were in the same subcluster in the phylogenetic tree(Fig. 3), therefore HuCAT was named as “HuCAT3” herein. The discrep-ancymight be ascribed to the fact that the phylogenetic treewas gener-ated based on the distance of multiple alignments among the differentsequences, which was calculated by the number of mutations betweenthe sequences via taking an average number of mutations for thepairwise comprision (Saitou et al., 1987).

4.2. The response of HuCAT3 to abiotic stresses

Numerous studies of plant responses to abiotic stresses have includ-ed data on changes in CAT expression or scavenger activity (Baczek-kwinta et al., 2006; Svetlana et al., 2011; Safari et al., 2013a, 2013b).CAT expression is affected by many factors, such as subcellular localiza-tion, activity of other antioxidant enzymes, stress conditions and devel-opmental stage (Mhamdi et al., 2010). There is some evidence of CATexpression and CAT activity being induced by abiotic stresses(Vandenabeele et al., 2004; Luna et al., 2005; Yang et al., 2006; Duet al., 2008). It recently reported that drought, salt and cold stress en-hanced the CAT activity (Du et al., 2008; Song et al., 2014). Conversely,CAT activity in plants has also been reported to be down-regulatedunder stress conditions, e.g. cold, salt, and high light (Mhamdi et al.,2010). Therefore, the responses varied depending upon stress typesand plant species (Luna et al., 2005).

In this study, HuCAT3 expression was strongly induced by H2O2

treatment (Fig. 4), and its mRNA levels and enzyme activities were reg-ulated under drought, cold and salt stress (Fig. 5). Nevertheless, the ex-pression patterns varied with the type of stresses. The fluctuating trendof HuCAT activity was in accordance with that of HuCAT3 transcript(Figs. 5, 6), indicating that the changes of HuCAT activity under the test-ed stresses were as least mainly ascribed to the elevated expression ofHuCAT3. The expression levels of HuCAT3 showed no obvious increaseuntil 7 day exposure to the drought stress (Fig. 5A, B), revealing thatHuCAT3 was related to tolerance to severe dehydration stress, therebyhigher HuCAT3mRNA levels were induced by long-term drought stress.However, HuCAT3 expression increased markedly at 6 h exposure tocold and salt stress (Fig. 5A, B), after which expression levels increasedgradually with the progression of cold stress, but declined graduallyunder the salt stress. HuCAT3 mRNA expression and enzyme activitypeaked after 7 days drought, 48 h cold stress and 6 h salt stress. There-fore, HuCAT3 played an important role in response to environmentalstresses.

In addition, the mRNA level of HuCAT3 increased sharply at 12 h(0.5 days) in the control (Figs. 4A, 5A-a). The similar case was also doc-umented in Arabidopsis, whose transcripts revealed a markedphotosynthetic-type rhythm (Zhong et al., 1994; Mhamdi et al., 2010).In the current case, the trials were circadianly subjected to dark condi-tion from the 10th to 20th hour after treatment, thus, the expressionof HuCAT3 also probably demonstrated in light effect, which should befurther verified in the subsequent work. As exposure to drought stress,HuCAT3 transcript expression was almost similar to the control at0.5 days (Fig. 5B-a), conversely, its enzyme activity increased signifi-cantly (Fig. 5C-a), which was probably due to the up-regulation ofother HuCATs by dark condition under drought stress, because it hadbeen verified that AtCAT2 and AtCAT3 showed a contrasting day–night

70 Q. Nie et al. / Gene 563 (2015) 63–71

rhythm in transcript abundance (Mhamdi et al., 2010). In maize, CAT3transcripts show a circadian rhythm, which have a peak expression atthe night/day transition (Redinbaugh et al., 1990).

The responses of HuCAT3 to cold stress were investigated in fourpitaya genotypes. HuCAT3 transcripts changed significantly in all testedgenotypes at the 6th hour and 48th hour cold stresses, the transcript ex-pressions order ‘Zihonglong’ N ‘Honglongguo’ N B4 N ZY (Fig. 6A). Also,their HuCAT activities at the 6th hour and 48th hour diversely increased(Fig. 6B). Nevertheless, HuCAT3mRNA elevations and enzyme activitieschanges under cold stress were consistent with the order of their coldtolerance (Gao et al., 2014). In regard to CAT activity, cold tolerant ricegenotype showed a larger change than cold sensitive genotype after48 h of cold stress (Zhang et al., 2012), and wheat CAT expressed intransgenic rice might improve tolerance against low temperature stress(Matsumura et al., 2002). Therefore, the current evidences proved thatup-regulation ofHuCAT3mRNA andHuCAT activity could better protectpitaya cells from cold stress-induced oxidative damage.

In conclusion, HuCAT3 were differentially regulated with regard tothe type of tissue or the genotypes, as well as by a variety of environ-mental stresses (Figs. 4, 5, 6, 7). The changes in HuCAT3 expressionlevel and HuCAT activity under various stresses shed light on the poten-tial message: pitaya may possess the differential endurance ability todrought, cold or salt damage, which was at least considerably ascribedto the enhanced expression of HuCAT3 as exposure to these abioticstresses. The cloned and characterized HuCAT3 should be also usefulfor further elucidating its biological role in plants.

To the best of our knowledge, this is the first report on the involve-ment of HuCAT3 in abiotic stress response in pitaya, even in the familyCactaceae, which may provide new insight into further understandingof molecular mechanism governing tolerance to adversity in this spe-cies, and facilitate genetic improvement for abiotic stress tolerance viaCAT transformation.

Supplementary data to this article can be found online at http://dx.doi.org/10.1016/j.gene.2015.03.007.

Author contribution statement

Conception and design: NQ, QG, WXPAnalysis and interpretation: NQData collection: NQ, GGL, FQJProvide the materials: LT, PZJ, CYQWriting the article: NQCritical revision of the article: WXPFinal approval of the article: WXP

Conflict of interest

All authors have no conflict of interest.

Acknowledgments

The project is supported by grants from the National Natural ScienceFoundation of China (Project nos. 31260464, 31060256), the Core Pro-gram of Educational Department of Guizhou Province, P. R. China (Pro-ject no. 20090134), the Special Core Program of Guizhou Province, P. R.China (Project no. 20126006–01), aswell as the Science and TechnologyActivity Program (2013-04) for the returned overseas Chinese scholarsof Guizhou Province, P. R. Chinese (201304).

References

Agrawal, S.B., Singh, S., Agrawal, M., 2009. Ultraviolet-B induced changes in gene expres-sion and antioxidants in plants. Adv. Bot. Res. 52, 48–86.

Ashraf, M., Ali, Q., 2008. Relative membrane permeability and activities of some antioxi-dant enzymes as the key determinants of salt tolerance in canola (Brassica napusL.). Environ. Exp. Bot. 63, 266–273.

Baczek-kwinta, R., Filek, W., Grzesiak, S., Hura, T., 2006. The effect of soil drought and re-hydration on growth and antioxidative activity in flag leaves of triticale. Biol. Plant.50, 55–60.

Cavatte, P.C., Martins, S.C.V., Morais, L.E., Silva, P.E.M., DaMatta, F.M., 2012. The physiologyof abiotic stresses. Plant Breeding for Abiotic Stress Tolerance. Springer-Verlag, BerlinHeidelberg, pp. 21–51.

Chaves, M.M., Oliveira, M.M., 2004. Mechanisms underlying plant resilience to water def-icits: prospects for water-saving agriculture. J. Exp. Bot. 55, 2365–2384.

Chen, B., Huang, J., Wang, J., Huang, L., 2008. Ultrasound effects on the antioxidative de-fense systems of Porphyridium cruentum. Colloids Surf. B 16, 88–92.

Cultrera, N.G.M., Alagna, F., Mariotti, R., Marchis, F.D., Pompa, A., Bellucci, M., Baldoni, L.,2014. Isolation and molecular characterization of three acyl carrier protein genes inolive (Olea europaea L.). Tree Genet. Genomes http://dx.doi.org/10.1007/s11295-014-0730-4.

Du, Y.Y., Wang, P.C., Chen, J., Song, C.P., 2008. Comprehensive functional analysis of thecatalase gene family in Arabidopsis thaliana. J. Integr. Plant Biol. 50, 1318–1326.

Fan, Q.J., Yan, F.X., Qiao, G., Zhang, B.X., Wen, X.P., 2014. Identification of differentially-expressed genes potentially implicated in drought response in pitaya (Hylocereusundatus) by suppression subtractive hybridization and cDNA microarray analysis.Gene 533, 322–331.

Farooq, M., Aziz, T., Basra, S.M.A., Cheema, M.A., Rehamn, H., 2008. Chilling tolerance inhybrid maize induced by seed priming with salicylic acid. J. Agron. Crop Sci. 194,161–168.

Foyer, C.H., Noctor, G., 2005. Redox homeostasis and antioxidant signaling: a metabolicinterface between stress perception and physiological responses. Plant Cell 17,1866–1875.

Gao, G.L., Zhang, B.X., Qiao, G., Liu, T., Peng, Z.J., Wang, B., Cai, Y.Q., Wen, X.P., 2014. Iden-tification of the cold tolerance of pitaya germplasms and their physiological and bio-chemical responses to low temperature. J. Huazhong Agric. Univ. 03, 26–32 (inChinese with English Abstract).

Gill, S.S., Tuteja, N., 2010. Reactive oxygen species and antioxidant machinery in abioticstress tolerance in crop plants. Plant Physiol. Biochem. 48, 909–930.

Hu, Y.Q., Liu, S., Yuan, H.M., Li, J., Yan, D.W., Zhang, J.F., Lu, Y.T., 2010. Functional compar-ison of catalase genes in the elimination of photorespiratory H2O2 using promoter-and 3′-untranslated region exchange experiments in the Arabidopsis cat2photorespiratory mutant. Plant Cell Environ. 33, 1656–1670.

Iqbal, A., Yabuta, Y., Takeda, T., Nakano, Y., Shigeoka, S., 2006. Hydroperoxide reduction bythioredoxin-specific glutathione peroxidase isoenzymes of Arabidopsis thaliana. FEBSJ. 24, 5589–5597.

Iwamoto, M., Higo, H., Higo, K., 2000. Differential diurnal expression of rice catalasegenes: the 5′-flanking region of CatA is not sufficient for circadian control. Plant Sci.151, 39–46.

Jaafar, R.A., Abdul Rahman, A.R.B., Che Mahmod, N.Z., Vasudevan, R., 2009. Proximateanalysis of dragon fruit Hylocereus polyhizus). Am. J. Appl. Sci. 6, 1341–1346.

Kaur, N., Reumann, S., Hu, J., 2009. Peroxisome biogenesis and function. The Arabidopsisbook. American Society of Plant Biologists, Rockville, USA.

König, J., Baier, M., Horling, F., Kahmann, U., Harris, G., Schürmann, P., Dietz, K.J., 2002. Theplant-specific function of 2-Cys peroxiredoxin-mediated detoxification of peroxidesin the redox hierarchy of photosynthetic electron flux. Proc. Natl. Acad. Sci. U. S. A.99, 5738–5743.

Li, Y.W., Liu, S.K., 2009. Isoenzyme of Catalase (CAT) in rice in response to stresses and theenzymes activity. Genomics Appl. Biol. 28, 509–514.

Lim, T.K., 2012. Edible medicinal and non-medicinal plants. Fruits vol. 1. SpringerScience + Business Media B.V., pp. 643–655.

Lin, K.H., Huang, H.C., Lin, C.Y., 2010. Cloning, expression and physiological analysis ofbroccoli catalase gene and Chinese cabbage ascorbate peroxidase gene under heatstress. Plant Cell Rep. 29, 575–593.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods 25, 402–408.

Luis, F.Y., Julia, C.S., Enrique, C., Ana-Ly, A.H., Jose, H.C.V., Felipe, S.T., Rodolfo, L.G., César,D.L.S.B., Luis, R.Z., 2012. Phylogenetic relationships and expression in response tolow temperature of a catalase gene in banana (Musa acuminata Grand Nain) fruit.Plant Cell Tiss. Org. 109, 429–438.

Luna, C.M., Pastory, G.M., Driscoll, S., Groten, K., 2005. Drought control on H2O2 accumu-lation, catalase CAT) activity and CAT gene expression in wheat. J. Exp. Bot. 56,417–423.

Magbanua, Z.V., de Moraes, C.M., Brooks, T.D., Williams, W.P., Luthe, D.S., 2007. Is catalaseactivity one of the factors associated with maize resistance to Aspergillus flavus? Mol.Plant Microbe Interact. 20, 697–706.

Masoumeh, S., Faezeh, G., Mehrdad, B., Abazar, H., Bahareh, N., Ghahremani, M., 2013. En-hancement of antioxidant enzymes activity and expression of CAT and PAL genes inhazel (Corylus avellana L.) cells in response to low-intensity ultrasound. Acta Physiol.Plant. 35, 2847–2855.

Matsumura, T., Tabayashi, N., Kamagata, Y., Souma, C., Saruyama, H., 2002.Wheat catalaseexpressed in transgenic rice can improve tolerance against low temperature stress.Plant Physiol. 116, 1317–1327.

Mhamdi, A., Queval, G., Chaouch, S., Vanderauwera, S., Van Breusegem, F., Noctor, G.,2010. Catalase function in plants: a focus on Arabidopsis mutants as stress-mimicmodels. J. Exp. Bot. 61, 4197–4220.

Mittler, R., 2002. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 7,405–410.

Miyagawa, Y., Tamoi, M., Shigeoka, S., 2000. Evaluation of the defense system in chloro-plasts to photooxidative stress caused by paraquat using transgenic tobacco plantsexpressing catalase from Escherichia coli. Plant Cell Physiol. 41, 311–320.

Moriwaki, T., Yamamoto, Y., Aida, T., Funashi, T., Shishido, T., Asada, M., Prodhan, S.H.,Komanine, A., Motohashi, T., 2008. Overexpression of the Escherichia coli catalase

71Q. Nie et al. / Gene 563 (2015) 63–71

katE, enhances tolerance to salinity stress in the transgenic indica rice cultivar, BR5.Plant Biotechnol. Rep. 2, 41–46.

Muneharu, E., NaokoY, Masao K., Yuji, S., Ryuji, T., Maki, K., Mikio, N., 1997. cDNA cloningand differential gene expression of three catalases in pumpkin. Plant Mol. Biol. 33,141–155.

Niu, Y., Wang, Y.P., Li, P., Zhang, F., Liu, H., Zheng, G.C., 2013. Drought stress induces oxi-dative stress and the antioxidant defense system in ascorbate-deficient vtc1 mutantsof Arabidopsis thaliana. Acta Physiol. Plant. 35, 1189–1200.

Noctor, G., Veljovic-Jovanovic, S., Foyer, C.H., 2000. Peroxide processing in photosynthe-sis: antioxidant coupling and redox signalling. Philos. Trans. R. Soc. Lond. B Biol. Sci.55, 1465–1475.

Reddy, A.R., Chaitanya, K.V., Vivekanandan, M., 2004. Drought-induced responses of pho-tosynthesis and antioxidant metabolism in higher plants. J. Plant Physiol. 161,1189–1202.

Redinbaugh, M.G., Sabre, M., Scandalios, J.G., 1990. Expression of the maize Cat3 catalasegene is under the influence of a circadian rhythm. Proc. Natl. Acad. Sci. U. S. A. 87,6853–6857.

Safari, M., Ghanati, F., Behmanesh, M., Hajnorouzi, A., Nahidian, B., Mina, G., 2013a. En-hancement of antioxidant enzymes activity and expression of CAT and PAL genes inhazel (Corylus avellana L.) cells in response to low-intensity ultrasound. Acta Physiol.Plant. 35, 2847–2855.

Safari, M., Ghanati, F., Hajnoruzi, A., Rezaei, A., Abdolmaleki, P., Mokhtari-Dizaji, M.,2013b. Maintenance of membrane integrity and increase of taxanes production inhazel (Corylus avellana L.) cells induced by low intensity ultrasound. Biotechnol.Lett. 34, 1137–1141.

Sairam, R.K., Srivastava, G.C., Agarwal, S., Meena, R.C., 2005. Differences in antioxidant ac-tivity in response to salinity stress in tolerant and susceptible wheat genotypes. BiolPlantarum 49, 85–91.

Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructingphylogenetic trees. Mol. Biol. Evol. 4, 406–425.

Sedmak, J., Grossberg, S., 1977. A rapid, sensitive, and versatile assay for protein usingCoomassie brilliant blue G250. Anal. Biochem. 79, 544–552.

Shi, J., Liu, M.Q., Shi, J.N., Zheng, G.S., Wang, Y.P., Wang, J.Y., Chen, Y.Z., Lu, C.F., Yin, W.L.,2012. Reference gene selection for qPCR in Ammopiptanthus mongolicus under abioticstresses and expression analysis of seven ROS-scavenging enzyme genes. Plant CellRep. 31, 1245–1254.

Song, Y.P., Ci, D., Tian, M., Zhang, D.Q., 2014. Comparison of the physiological effects andtranscriptome responses of Populus simonii under different abiotic stresses. Plant Mol.Biol. 86, 139–156.

Svetlana, V., Osipova, A.V., Permyakov, M.D., Permyakova, T.A., Pshenichnikova, A.B., 2011.Leaf dehydroascorbate reductase and catalase activity is associated with soil droughttolerance in bread wheat. Acta Physiol. Plant. 33, 2169–2177.

Vaillant, F., Perez, A., Davila, I., Dornier, M., Reynes, M., 2005. Colorant and antioxidantproperties of red-purple pitahaya (Hylocereus sp.). Fruits 60, 1–7.

Vandenabeele, S., Vandeauwera, S., Vuylsteke, M., Rombauts, S., Langebartels, C., Seiditz,H.K., 2004. Catalase deficiency drastically affects gene expression induced by highlight in Arabidopsis thaliana. Plant J. 39, 45–58.

Willekens, H., Langebartels, C., Tiré, C., VanMontagu,M., Inzé, D., Van Camp,W., 1994. Dif-ferential expression of catalase genes in Nicotiana plumbaginifolia. Proc. Natl. Acad.Sci. U. S. A. 91, 10450–10454.

Willekens, H., Inzé, D., Van Montagu, M., Van Camp, W., 1995. Catalases in plants. Mol.Breed. 1, 207–228.

Wu, X.W., Tan, J., Cai, M.Y., Liu, X.D., 2014. Molecular cloning, characterization, and ex-pression analysis of a heat shock protein (HSP) 70 gene from Paphia undulata. Gene543, 275–285.

Xing, Y., Jia, W., Zhang, J., 2008. AtMKK1 mediates ABA-induced CAT1 expression andH2O2 production via AtMPK6-coupled signaling in Arabidopsis. Plant J. 54, 440–451.

Yang, W.L., Liu, J.M., Chen, F., Liu, Q., Gong, Y.D., Zhao, N.Y., 2006. Identification of Festucaarundinacea Schreb. Catl catalase gene and analysis of its expression under abioticstresses. J. Integr. Plant Biol. 03, 334–340.

Zhang, F., Huang, L.Y., Wang, W.S., Zhao, X.Q., Zhu, L.H., Fu, B.Y., Li, Z.K., 2012. Genome-wide gene expression profiling of introgressed indica rice alleles associated withseedling cold tolerance improvement in a japonica rice background. BMC Genomics13, 461 (http://www.biomedcentral.com/1471-2164/13/461).

Zhong, H.H., Young, J.C., Pease, E.A., Hangarter, R.P., McClung, C.R., 1994. Interactions be-tween light and the circadian clock in the regulation of CAT2 expression inArabidopsis. Plant Physiol. 104, 889–898.

Zhuang, Y., Zhang, Y., Sun, L., 2012. Characteristics of fibre-rich powder and antioxidantactivity of pitaya (Hylocereus undatus) peels. Int. J. Food Sci. Technol. 47, 1279–1285.

Zimmermann, P., Heinlein, C., Orendi, G., Zentgraf, U., 2006. Senescence-specific regula-tion of catalase in Arabidopsis thaliana (L.) Heynh. Plant Cell Environ. 29, 1049–1056.