Research Article Sequence and Apoptotic Activity of...

Research ArticleSequence and Apoptotic Activity of VacA Cytotoxin Cloned froma Helicobacter pylori Thai Clinical Isolate

Muhammad Junaid12 Sarbast Al-Gubare2 Muhammad Yousef3

Mathukorn Na Ubol4 Somphob Leetachewa2 Chatchai Muanprasat3

Chanan Angsuthanasombat2 Wanpen Chaicumpa4 Niaz Ali5 and Gerd Katzenmeier2

1 Department of Pharmacy Division of Pharmacology University of Malakand Khyber Pakhtunkhwa 18550 Pakistan2 Bacterial Protein Toxin Research Cluster Institute of Molecular Biosciences Mahidol University SalayaNakornpathom 73170 Thailand

3Department of Physiology Faculty of Science Mahidol University Bangkok 10400 Thailand4Department of Parasitology Faculty of Medicine Siriraj Hospital Mahidol University Bangkok 10700 Thailand5Department of Pharmacology Institute of Basic Medical Sciences Khyber Medical University Peshawar 25000 Pakistan

Correspondence should be addressed to Gerd Katzenmeier katzenmeiergermahidolacth

Received 17 August 2013 Revised 6 March 2014 Accepted 8 March 2014 Published 2 April 2014

Academic Editor Emanuele Marzetti

Copyright copy 2014 Muhammad Junaid et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

The vacuolating cytotoxin VacA produced byHelicobacter pylori induces the formation of large cytoplasmic vacuoles in host gastricepithelial cells as well as a release of cytochrome C from mitochondria resulting in cell apoptosis Considerable sequence diversityin VacA relating to different degrees of disease severity is observed with clinical samples from a multitude of geographic placesIn this study we describe expression in Escherichia coli purification to homogeneity and in vitro assay of its apoptotic activity of aVacA toxin from aH pylori isolate of aThai patient with gastrointestinal lymphoma Sequencing revealed that the deduced aminoacid sequence of the cloned Thai isolate VacA is similar to H pylori s1m2 type strains The percent sequence similarity to themodel strain 60190 was lower due to the presence of extra amino acids in the mid (m) region The purified VacA toxin exhibitedsignificant apoptotic activity on both T84 and MDCK epithelial cell lines as revealed by DAPI staining whereby the observedactivity was significantly higher on MDCK cells These findings could relate to a modulation of VacA activity on host cells in theThai isolate-VacA toxin that may differ from those of the model strain

1 Introduction

Helicobacter pylori is a Gram-negative spiral-shaped bac-terium which causes serious chronic infectious diseases thatdamage gastric structure and function and lead to gastricatrophy peptic ulcer disease gastric adenocarcinoma andprimary gastric cell lymphoma [1 2] About half of the worldrsquospopulation is infected with H pylori making this organismthemost prevalent bacterial pathogen which is known to date[3 4]

The vacuolating cytotoxin A (VacA) is one of the majorvirulence factors released by H pylori VacA targets not onlyepithelial cells but also cells of the immune system where it

induces immunosuppression [5] The vacA gene is presentin all strains and encodes a sim140-kDa protoxin [6] whichupon proteolytic processing produces the mature sim90 kDa(sim821 amino acids) toxin [7] The mature toxin can undergoproteolytic cleavage into fragments of 33 and 55 kDa whichrepresent 2 domains of VacA [8ndash10] The p33 domain isinvolved in membrane insertion and ion-channel formationwhereas the p55 domain has a role in receptor bindingand toxin oligomerization [11 12] Two receptor-like proteintyrosine phosphatases RPTP120572 and RPTP120573 were identified ascellular receptors involved in VacA uptake [13 14]

The production of cytotoxin activity can vary consid-erably among H pylori strains due to extensive sequence

Hindawi Publishing CorporationBioMed Research InternationalVolume 2014 Article ID 398350 8 pageshttpdxdoiorg1011552014398350

2 BioMed Research International

polymorphisms in the vacA gene [15] The most variableregion corresponds to a sim800-bp sequence located in themiddle of the p55 domain (ldquomidrdquo or ldquomrdquo region) Variousm sequences have been grouped into two families of allelesm1 and m2 whereby strains carrying the m2 phenotypeappear to have limited vacuolating activity [16] Additionalsequence variations are located in the ldquosrdquo region whichincludes the N-terminal signal sequence of the mature VacAtoxin [17] Two main allelic families are recognized desig-nated s1 and s2 All possible combinations of these poly-morphic regions (s1m1 s1m2 s2m1 and s2m2) have beendetected in clinical isolates ofH pylori although s2m1 formsoccur rarely Strains containing a type s2 allele reportedlyare unable to induce vacuolation with specific cell types[17]

A third polymorphic site within the vacA sequence wasrecently identified and designated ldquoirdquo (intermediate) region[18] The ldquoirdquo region is located within the p33 domain and 2types i1 and i2 were commonly found in clinical isolates ofH pylori Vacuolation assays demonstrated that vacuolatingactivity of s1m2 VacA was dependent on the presence of theldquoirdquo region thereby suggesting a pivotal role for VacA activity

Vacuolating cytotoxin purified from H pylori causesmitochondrial damage leading to apoptotic cell death andit was speculated that differences in gastric mucosal cellapoptosis amongH pylori-infected personsmay be caused bydifferences in the structure and activity of VacA allelic forms[19]

In the present study we constructed an expression systemto obtain sequence information and to analyze the apoptoticactivity of a H pylori VacA toxin isolated from a Thaipatient with gastric lymphoma (ldquoThai isolaterdquo) We wereseeking to understand how genetic differences and sequencepolymorphisms between m1 andm2 types of vacA alleles arerelated to theThai isolate VacA and how these could possiblyinfluence the apoptotic activity of this protein

2 Materials and Methods

21 Cloning and Sequence Analysis of vacA Gene from a ThaiPatient Isolate H pylori was cultured from a gastric biopsysample from a Thai patient with diagnosed gastric lym-phoma (62-year-old male) obtained at Vichaiyut HospitalBangkokThailand on the surfaces of horse blood agar plates(10 horse blood in Casman agar base (BBL MicrobiologySystems Cockeysville MD)) which were incubated in anatmosphere of 5 oxygen and 10 carbon dioxide for 72 hat 37∘C for up to 5 days [20ndash22] Chromosomal DNA wasextracted as described previously [23] and used as templatefor PCR amplification of vacA The following pair of primersderived from the sequence of H pylori model strain 60190was used

SJ vacA1F 51015840-CATGCCATGGCCTTTTTTACAACC-GTGATCA-31015840 (underlined sequence represents the NcoIrestriction site) and SJ vacA821R 51015840-TGCACTGCAGAG-CGTAGCTAGCGAAACGC-31015840 (underlined sequence rep-resents the PstI restriction site) Oligonucleotides werepurchased from Sigma-Aldrich Singapore

PCRwas performed with PfuDNA polymerase (Fermen-tas Life Sciences USA) using a thermal cycler GeneAmpPCR system Model 2400 (Perkin Elmer Cetus USA) withpredenaturing (98∘C 2min) 25 cycles of denaturing (98∘C01min) annealing (65∘C 03min) extension (72∘C 13min)and final extension (72∘C 7min)The resulting PCRproductswere subjected to agarose gel electrophoresis and the 25-kbfragment representing themature full-length vacA toxin gene(p88) was excised and purified by QIAquick gel extraction kit(QIAGEN Germany)

The purified vacA PCR product and pTrcHisA (44 kb)vector (Invitrogen USA) were digested with restrictionenzymesNcoI and PstI and purified by QIAquick purificationkit Insert DNA and pTrcHisA vector were combined ata 10 1 molar ratio in a ligation reaction containing 1timesligation buffer (50mMTris-HCl pH 76 10mMMgCl

2 1 mM

ATP 1mM DTT 25 (wv) polyethylene glycol 8000) andfive units of T4 DNA ligase (Gibco BRL USA) in a finalvolume of 20 120583L and incubated overnight at 14∘C resultingin pTrcHisAVacA carrying a C-terminal (His)

6tag and a

translation initiation methionine residue at the N-terminusThe correct sequence of the recombinant pTrcHisAVacAconstruct was verified by restriction digestion and DNAsequencing analysis (Macrogen Inc South Korea)

22 Expression and Purification of the Recombinant VacAProtein Recombinant plasmid containing the vacA insert(pTrcHis2AVacA) was transformed into Escherichia coliTOP10 (GIBCO BRL USA) To determine optimum con-ditions for the expression of the VacA protein the E colicells were incubated at 37∘C in one liter LB medium con-taining 100 120583gmLminus1 ampicillin At OD

600= 05 expression

was induced by isopropyl-120573-D-thiogalactopyranoside (IPTG01mMfinal concentration) Protein biosynthesiswas assayedat different incubation times (0 h 1 h 4 h and 6 h andovernight) and temperatures (18 25 30 and 37∘C) Cellswere harvested by centrifugation (6000timesg 4∘C 10min) andthe pellet was resuspended in 30mL lysis buffer (01M Tris-HCl pH 75 03MNaCl 025mgmLminus1 lysozyme 10mgmLminus1DNase and 5mMMgCl

2) Cells were lysed on ice by sonica-

tion using an Ultrasonic Processor XL (Misonix Inc USA)The cell lysate was subjected to centrifugation (15000timesg 4∘C30min) insoluble material was pelleted by centrifugation(15000timesg 4∘C 20min) and the soluble fraction was filteredthrough a 022 micron pore-size filter (Pall CorporationUSA)

Histidine-tagged VacA protein was purified by immo-bilized metal ion affinity chromatography (IMAC) usingnickel-sepharoseHisTrapHP 5-mL columns (GEHealthcareSweden) The columns were preequilibrated with 5ndash10 col-umn volumes of sample buffer containing 100mM Tris-HClpH 75 300mMNaCl and the sample was loaded at a flowrate of 1mLminminus1 using a FPLC pump (AKTA FPLC systemGE Healthcare) The column was washed with 10 columnvolumes of degased washing buffer (100mM Tris-HCl pH75 300mM NaCl 10mM imidazole) and the protein waseluted with elution buffer (100mMTris-HCl pH 75 300mMNaCl 100mM imidazole) at flow rate of 1mLminminus1 Elution

BioMed Research International 3

was monitored by absorbance at 280 nm using a UV detector(AKTA FPLC system GE Healthcare) and fractions of 2mLwere collected From each fraction 20120583L were analysed onSDS-PAGE (10 gel) Western blotting was performed usinganti-VacA rabbit antiserum (Invitrogen USA) at 1 2000dilution with alkaline phosphatase color detection

Fractions containing VacA were desalted by stepwisedialysis at 4∘C by using SPECTRAPOR dialysis membranes(6ndash8 kDa MWCO) (Spectrum Medical Industries Inc MAUSA) against three batches of a 100-fold sample volumebuffer A (100mMTris-HCl pH 75 200mMNaCl) one batchof a 100-fold volume buffer B (100mM Tris-HCl pH 75100MNaCl) and one batch of a 100-fold volume of bufferC (50mM Tris-HCl pH 75) Purified VacA was furtherconcentrated to 10mgmLminus1 by centrifugal filter devices(Centricon 15mL 30-kDa MWCO Millipore USA) at 4∘CProtein concentrations were determined with a Bradfordprotein microassay (Bio-Rad USA) using bovine serumalbumin (Sigma USA) as calibration standard Samples wereused immediately or stored in 50mM Tris-HCl pH 75 50(vv) glycerol at minus20∘C

23 Assay of VacA Apoptotic Activity Human colonic adeno-carcinoma (T84) and Madin-Darby canine kidney (MDCK)epithelial cells originally purchased from the AmericanType Culture Collection (Manassas USA) were grown asmonolayers in a 1 1 mixture of Dulbeccorsquos modified EaglersquosMediumNutrientMixture F-12Ham (DMEM-Ham) (SigmaUSA) supplemented with 50UmLminus1 penicillin 50120583gmLminus1streptomycin and 5 foetal bovine serum The culturemedium was replaced every other day Monolayers weresubcultured by trypsinization with 025 (wv) trypsinand 53mM EDTA in Ca2+- and Mg2+-free phosphate-buffered saline (PBS) and plated on coverslips at a densityof 105 cellsmLminus1 to study apoptosis caused by VacA T84and MDCK cells were seeded in 75mL flasks at 37∘C in ahumidified atmosphere of 5 CO

2

Apoptosis of the colonic epithelium was assessed usinga nuclear stain 410158406-diamidino-2-phenylindole dihydrochlo-ride (DAPI) (Sigma USA) Cells were placed on coverslips ata density of 5times105 cells per well in DMEMmedium and keptat the incubator At the time of experiment old medium wasremoved and cells were incubated with either 150120583gmLminus1VacA-containing medium or serum-free medium (as a con-trol) for 24 h Cells were washed in PBS and fixed with 60 120583Lof 4 paraformaldehyde for 8min at 4∘C followed by three-time washing with 60120583L of 1times PBS Cells were incubatedwith 60120583L of 01 Triton X-100 for 10min and nonspecificbinding sites were blocked by adding 2 skimmed milkpowder for 1 h Cells were washed in PBS three times 10mineach Finally cells were stained with 50120583L of DAPI (1 1000dilution in blocking buffer) for 15min and mounted using50 glycerol The signals were visualized at wavelength350460 nm (excitationemission) by using a fluorescencemicroscope (model IX71 Olympus Japan) Binding of DAPIto dsDNA produced a sim20-fold fluorescence enhancementand a minimum of 200 cells was counted for each sampleand the control by visual inspection of microscopic images

Results are the mean of three independent experiments anddata are represented as mean plusmn standard error of the mean

3 Results and Discussion

31 Sequence and Allele Type of VacA Toxin Gene from ThaiPatient Isolate The 25-kb vacA gene sequence encoding themature VacA toxin was obtained by PCR amplification usingH pylori genomic DNA extracted from a patient isolate astemplate VacA is the product of a single gene that encodes a140-kDa precursor protein which upon proteolytic removalof the N-terminal signal sequence yields the mature 88-kDa toxin containing alanine as N-terminal amino acidresidue [7] An N-terminal methionine residue was includedto ensure proper initiation of translation in the recombinantE coli host and a C-terminal (His)

6sequence was added for

purification purposesThe construct was analyzed by nucleotide sequencing and

alignment with sequences of H pylori strain 60190 (s1m1allelic type) vacA sequence (GenBank accession numberU05676) and strain 95-54 (s1m2 allelic type) (GenBankaccession number U95971) (Figure 1) The sequence of theThai isolate was deposited in GenBank at accession numberKC529337 Sequence analysis revealed that the sequence ofthe cloned Thai vacA gene encompasses 2577 bp encoding amature VacA toxin of 859 amino acid residues The sequenceof the Thai isolate vacA gene is identical to a recentlydescribed strain isolated in China (CHN1811a GenBankaccession number AF050326) It shows sim82 identity to thetoxigenicH pylori s1m2 strain 95-54 and identity to the s1m1model strain 60190 is only sim53 (Figure 1(a))H pylori strain95-54 encodes an unusually large VacA toxin of 1323 aminoacid residues and has been shown to possess an s1m2 allelicphenotype [17]

Comparison of deduced amino acid sequences showeda well conserved p33 domain among the surveyed strainscontaining m1 and m2 alleles and a diversification regionwhich differentiatesm1 andm2 allelic types Residue D455 islocated at the beginning of the mid region in H pylori strain60190 and it was proposed that this area represents a receptorbinding site common to allm1 andm2 strains [24]

The most notable difference between H pylori strain60190 and the Thai strain is the sizable insertion of 21 aminoacid residues in the middle region making the Thai isolatean m2 type strain (Figure 1(b)) The structural consequencesof this insertion are not well understood at present Inparticular it is unclear whether the inserted sequence directlyparticipates in receptor binding as both RPTP120572 and RPTP120573are recognized by them2 type of vacA alleles [25]

Numerous studies have demonstrated a correlationbetween the allelic types of ldquomrdquo and ldquosrdquoregions and theoccurrence of gastroduodenal diseases in humans howeverthe pathophysiological mechanisms involved in these asso-ciations are characterized only to a limited extent [17 26ndash35] A study on the clinical relevance of VacA genotypescorroborated that VacA type s2 strains are rarely associatedwith peptic ulceration [17] As regions of diversity in vacAalleles comprise an ample portion of the gene structural


TTTGTGAATT TAAAGGTGGA TGCTCATACA GCGGTGAATT TAAGAGTGGA TGCTCATAC A GCTT ATTTTA ATGGCAATAT TTATCTGGGA AAATCCACGAGCGGTAAATT TAAAAGTGGA TGCCCATAC G ATCA ATTTTA ATGGCAATAT GTATTTGGGA AGATTTACGC

GCTAATT TTAAA GGTAT TGAT ACGGGTAAT G GTGGTTTCAAATTTAAA AGT GAATGGCCAT AGCGCTCATT TTAAA AATAT TGAT GCCACA AAGAGCGATA ACGGGCTAAAATTTAAA AGT GAATGGTCAT ACAGCCAATT TTAAA GATAT TGAT GCCAGC AAGGGTAGAA ATGGTATCGA

CACC TTAGATTTTA GTGGTGTTAC AAACAA GGTC AATATCAACA AGCTCA TTAC GGCTTCCACTCACTAGCGCT TTGGATTTTA GCGGCGTTAC AGACAA AGTC AATATCAACA AGCTCA CTAC ATCTGCCACTCACCACCATT TTGGATTTTA GCGGCGTTAC AAACAA GGTC AATATCAACA AGCTCA CCAC AGCTGCCACT

U05676 | 60190 (2276)U95971 | 95-54 (1732)KC529337 | Thai (1289)

U05676 | 60190 (2276)U95971 | 95-54 (1732)KC529337 | Thai (1289)

U05676 | 60190 (2276)U95971 | 95-54 (1732)KC529337 | Thai (1289)

(a)

FVNLKVDAHT ANFKGID TGNGGFNT LDFSGVT NKV NINKL ITASTAVNLRVDAHT AYFNGN IYLG KSTNLKVNGH SAHFKNIDAT KSDNGLNTSA LDFSGVT DKV NINKL TTSATAVNLKVDAHT INFNGN MYLG RFTHLKVNGH TANFKDIDAS KGRNGIDTTI LDFSGVT NKV NINKL TTAAT

U05676 | 60190 (494)U95971 | 95-54 (497)KC529337 | Thai (464)

(b)

Figure 1 Partial nucleotide sequence and deduced amino acid sequence in the m region of recombinant vacA toxin gene from Thai isolate(rVacA) aligned with sequences of H pylorimodel strain 60190 (s1m1) and strain 95-54 (s1m2) (a) Nucleotide sequences identical in the 3strains are in blue and nucleotide sequences identical between 2 strains are shown in yellowThe black box shows the insertion in the middleregion of the Thai isolate vacA gene (b) Amino acid sequences identical in the 3 strains are in blue and amino acid sequences identicalbetween 2 strains are shown in yellow The black box shows the insertion in the middle region of the Thai isolate vacA gene

differences between typem1 and typem2 gene products couldgive rise to differences in cytotoxin phenotypes affectingreceptor recognition internalization and vacuolation Cell-specific binding has been attributed to differences in the m1and m2 alleles Strains encoding s1m1 vacA genes typicallyproduce VacA with cytotoxic activity on human cervicalcarcinoma HeLa cells whereas m2-type VacA could inducevacuoles in primary cultured human gastric cell lines as wellas nongastric epithelial RK13 cells but not in HeLa cells [36]

It is interesting to note that the third polymorphicdeterminant within the Thai isolate vacA sequence theldquoirdquo region showsmarked differences to strain 95-54 whereasit shares greater homology to the other model strainsHow the ldquoirdquo region functions in the context of VacA allelicpolymorphisms needs to be elucidated in future studies

Currently most in vitro studies utilize the s1m1 type ofVacATherefore analysis of the biological effects of the s1m2type VacA as described herein could contribute to a betterunderstanding of the relation between toxin activity and theirallelic variations We are currently working on a comparativeanalysis of toxin activity and structural differences from thes1m1 model strain 60190 and the s1m2Thai isolate

32 Expression and Purification of the Recombinant VacAProtein Therecombinant plasmid pTrcHis2AVacAdirectedexpression of the VacA toxin in E coli TOP10 upon induc-tion with IPTG Optimization of expression conditions wasattempted to achieve increased levels of expression Time-dependent expression of VacA was analyzed by SDS-PAGEof crude lysate and subsequent Western blotting with com-mercially available anti-VacA antiserum It is interestingto note that growth of the recombinant stain carryingpTrHis2AVacA ceased after addition of IPTG and over aperiod of 14 h no further increase in bacterial growth ratewas observed thereby suggesting cytotoxic effects of therecombinant VacA toxin on E coli cell growth (data not

shown) At lower temperatures (18minus25∘C) reduced amountsof recombinant VacA were detected after incubation for 14 hand consequently expression was performed at 37∘C

The recombinant VacA protein was purified to near-homogeneity in a single step procedure bymetal chelate affin-ity chromatography (IMAC) At a concentration of 10mMimidazole most host proteins were eluted from the affinitymatrix and recombinant VacA protein was eluted from thecolumnwith 100mM imidazole as a single peak (Figure 2(a))Elution fractions analyzed on SDS-PAGE revealed a majorprotein band at 90 kDa and another minor protein band atsim88 kDa (Figure 2(b)) Subsequent Western blotting withanti-VacA rabbit polyclonal antiserum produced a singleprotein band at sim90 kDa (Figure 2(c)) The purity of VacAin the elution fraction was estimated to be gt95 howeverthe yield of the recombinant VacA protein was relatively low(lt1mg Lminus1 of bacterial culture)

33 VacA Apoptotic Activity Apoptosis plays a major role inthe pathogenic action ofH pylori [37] Previous studies haveestablished that a correlation exists between the developmentof duodenal ulcer inH pylori infection and the level of apop-tosis in antral mucosal epithelium [38] Literature reportshave also shown that the vacuolating toxin from H pylorican increase the epithelial permeability of T84 and MDCKmonolayers independent of its vacuolating activity and that invitro infection of T84 intestinal epithelial cells with H pylorican result in apoptosis [39ndash41] Moreover earlier studies haveshown that exposure to VacA induces the degradation oftight junctions in MDCK cells [39] The T84 and MDCK celllines thus appear to represent interesting models to study theinteraction of H pylori with epithelial monolayers leading toapoptotic cell death

Herein apoptotic activity of the purified recombinantVacA toxin was detected by incubation of T84 and MDCKcells for 24 h in the presence of 150120583g mLminus1 VacA protein


Imidazole Imidazole

A28

0 (m

AU)

1400

200

0

400

600

800

1000

1200

10 20 40 60 80 10030 50 70 90

A

B

M 1 2 3

900

M 1 2 3

662

2000

1162974

45

31

10mM 100mM

(kDa)

(a)

(b) (c)

Figure 2 Purification and Western blot analysis of VacA(a) Purification of H pylori VacA toxin by Ni2+affinity chromatog-raphy The column was washed with 01M Tris-HCl pH 8003 M NaCl 10mM imidazole (peak a) VacA toxin was elutedwith elution buffer (01M Tris-HCl pH 80 03M NaCl 100mMimidazole) (peak b) (b) SDS-PAGE (10 gel) analysis of H pyloriVacA toxin after IMAC purification Lane M broad range proteinmarker lane 1 flow-through lane 2 10mM imidazole wash lane 3100mM imidazole elution fraction of the protein (c) CorrespondingWestern blot of H pylori VacA toxin after IMAC purificationWestern blot profile of the gel as seen in (a) using anti-VacA antibodyon 10 SDS-PAGE Lane M broad range protein marker lane1 flow-through lane 2 10mM imidazole wash lane 3 100mMimidazole elution fraction of the protein

and subsequent nuclear staining with DAPI analyzed by fluo-rescence microscopy The DAPI-nuclear staining revealed anincrease in the number of nuclei which showed cytopathicsymptoms typical of apoptosis such as chromatin condensa-tion as well as DNA fragmentation (Figure 3)

Incubation of T84 cells with VacA resulted in an increasein apoptosis of T84 cells with 82 plusmn 16 in VacA treatedcells (mean plusmn SEM) compared with 42 plusmn 14 in thecontrol cells with a significance 119875 lt 005 (Figure 4) VacAinduced a marked apoptosis in MDCK cells with an increaseof 254 plusmn 31 when compared to 36 plusmn 11 in controlcells with 119875 lt 0001 significance Similar to T84 cellspresence of VacA induced apoptotic symptoms in treatedMDCK cells even at a higher degree Thus MDCK cells

appear to be significantly more sensitive to VacA than T84cells

An earlier study using HeLa cells suggested the existenceof a nonapoptoticmechanism forVac-induced cell death [42]It is important to note that the experimental approach usedherein does not allow conclusive differentiating between theinduction of apoptosis or a programmed necrosismechanismcaused by VacA as proposed in a study using the gastric cellline AZ-521 [43] While numerous reports have accumulatedevidence that VacA-induced cell death involves the activationof caspases and the proapoptotic proteins Bax and Bak as wellas the release of cytochrome C [44] Radin et al suggestedthe existence of a necrotic pathway based on an observedrelease of LDH and the proinflammatory protein HMGB1in VacA-treated AGS cells It is noteworthy however thatwe have not observed an apparent rupture of the plasmamembrane as typically seen with necrotic cells It remainsto be investigated in detail whether the cell-type specificrelease of proinflammatory proteins by gastric epithelial cellsis caused by pyronecrosis or an apoptotic mechanism of celldeath

Differentiated T84 monolayers display high transepithe-lial resistance (TER) [45] a well-organized brush borderand the capacity to release IL-8 at the basal cell surfaceunder adhesion withH pylori [46] Previous studies demon-strated that stimulation of T84 monolayers with H pylorisoluble extracts has dramatic effects on epithelial physiolog-ical balance and integrity [47] Apical but not basolateralexposure of confluent monolayers of T84 cells to H pyloriextracts induces a rapid decrease in TER as well as theformation of domes Domes are fluid-filled blister-like areaswhich form due to separation of the monolayer from thesubstrate while the cells remain attached to each otherIt was previously proposed that during an infection withH pylori physiological gastric secretion in the antrum isimpaired eventually leading to the subsequent developmentof duodenal ulcer [47] Although these findings suggesta correlation between the development of duodenal ulcerand the level of apoptosis in the antral mucosal epithe-lium the precise molecular mechanism of the events lead-ing to an accelerated disease development remains to beinvestigated

4 Conclusion

We have successfully established the construction of aprokaryotic expression system for vacA gene from a clini-cal isolate and purification of the biologically active toxinThis is the first reported analysis of a VacA toxin from apatient sample obtained in Thailand The isolate representsan s1m2 allelic type and purified VacA toxin was able toinduce apoptosis in two types of epithelial cell lines Thisstudy could serve as an entry point to future investiga-tions on genetic diversity within the vacA gene and theirrole for the differential pathogenicity of different strains ofH pylori


(a) (c)

(d)(b)

Figure 3 DAPI staining of intestinal epithelial cells (T84) and Madin-Darby Canine Kidney (MDCK) cells (a) Control of untreated T84cells showing normal nuclei (b) T84 cells treated with VacA (150 120583gmLminus1) cells showing chromatin condensation and DNA fragmentation(c) Control of untreated MDCK cells (d) MDCK cells treated with VacA (150120583gmLminus1) showing chromatin condensation and DNAfragmentation DAPI was used at 1000-fold dilution in buffer and the magnification of images is 1000times

Apop

tosis

()

UntreatedT84 cells

UntreatedMDCK cells

VacA-treatedMDCK cells

VacA-treatedT84 cells

5

0

10

15

20

25

30

Figure 4 Percentage of apoptotic cells as observed after DAPIstaining in T84 and MDCK cells A mean of six pictures from eachsamplewith at least 200 cells was counted for apoptosis-positive cellsand the mean percentage of apoptotic cells was compared with theuntreated control Error bars represent SEM

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors would like to thank Somsri Sakdee for excel-lent technical work and Anchalee Nirachanon for excellent

secretarial assistance This work was supported by GrantRSA5580047 from the Thailand Research Fund (to GerdKatzenmeier)

References

[1] J R Warren and B J Marshall ldquoUnidentified curved bacilli ongastric epithelium in active chronic gastritisrdquo The Lancet vol321 no 8336 pp 1273ndash1275 1983

[2] S Suerbaum and PMichetti ldquoHelicobacter pylori infectionrdquoTheNew England Journal of Medicine vol 347 no 15 pp 1175ndash11862002

[3] J G Kusters AHM vanVliet and E J Kuipers ldquoPathogenesisof Helicobacter pylori infectionrdquo Clinical Microbiology Reviewsvol 19 no 3 pp 449ndash490 2006

[4] J C Atherton ldquoThepathogenesis ofHelicobacter pylori-inducedgastro-duodenal diseasesrdquo Annual Review of Pathology vol 1pp 63ndash96 2006

[5] G Rieder W Fischer and R Haas ldquoInteraction of Helicobacterpylori with host cells function of secreted and translocatedmoleculesrdquo Current Opinion in Microbiology vol 8 no 1 pp67ndash73 2005

[6] E Papini M Zoratti and T L Cover ldquoIn search of theHelicobacter pyloriVacAmechanism of actionrdquo Toxicon vol 39no 11 pp 1757ndash1767 2001

[7] T L Cover M K R Tummuru P Cao S AThompson andMJ Blaser ldquoDivergence of genetic sequences for the vacuolatingcytotoxin amongHelicobacter pylori strainsrdquo Journal of Biologi-cal Chemistry vol 269 no 14 pp 10566ndash10573 1994


[8] V Q Nguyen R M Caprioli and T L Cover ldquoCarboxy-terminal proteolytic processing of Helicobacter pylori vacuolat-ing toxinrdquo Infection and Immunity vol 69 no 1 pp 543ndash5462001

[9] J A Garner and T L Cover ldquoBinding and internalization oftheHelicobacter pylori vacuolating cytotoxin by epithelial cellsrdquoInfection and Immunity vol 64 no 10 pp 4197ndash4203 1996

[10] T L Cover P I Hanson and J E Heuser ldquoAcid-induced disso-ciation of VacA the Helicobacter pylori vacuolating cytotoxinreveals its pattern of assemblyrdquoThe Journal of Cell Biology vol138 no 4 pp 759ndash769 1997

[11] M S McClain H Iwamoto P Cao et al ldquoEssential role of aGXXXG motif for membrane channel formation by Helicobac-ter pylori vacuolating toxinrdquoThe Journal of Biological Chemistryvol 278 no 14 pp 12101ndash12108 2003

[12] H Isomoto J Moss and T Hirayama ldquoPleiotropic actions ofHelicobacter pylori vacuolating cytotoxin VacArdquo The TohokuJournal of Experimental Medicine vol 220 no 1 pp 3ndash14 2010

[13] K Yahiro A Wada M Nakayama et al ldquoProtein-tyrosinephosphatase 120572 RPTP120572 is a Helicobacter pylori VacA receptorrdquoThe Journal of Biological Chemistry vol 278 no 21 pp 19183ndash19189 2003

[14] P I Padilla AWada K Yahiro et al ldquoMorphologic differentia-tion of HL-60 cells is associated with appearance of RPTP120573 andinduction ofHelicobacter pyloriVacA sensitivityrdquoThe Journal ofBiological Chemistry vol 275 no 20 pp 15200ndash15206 2000

[15] Y Ito T Azuma S Ito et al ldquoFull-length sequence analysisof the vacA gene from cytotoxic and noncytotoxic HelicobacterpylorirdquoThe Journal of InfectiousDiseases vol 178 no 5 pp 1391ndash1398 1998

[16] F Tombola C Pagliaccia S Campello et al ldquoHow the loop andmiddle regions influence the properties of Helicobacter pyloriVacA channelsrdquoTheBiophysical Journal vol 81 no 6 pp 3204ndash3215 2001

[17] J C Atherton P Cao R M Peek Jr M K R Tummuru MJ Blaser and T L Cover ldquoMosaicism in vacuolating cytotoxinalleles of Helicobacter pylori Association of specific vacA typeswith cytotoxin production and peptic ulcerationrdquo The Journalof Biological Chemistry vol 270 no 30 pp 17771ndash17777 1995

[18] J L Rhead D P Letley M Mohammadi et al ldquoA New Heli-cobacter pylori vacuolating cytotoxin determinant the interme-diate region is associated with gastric cancerrdquoGastroenterologyvol 133 no 3 pp 926ndash936 2007

[19] T L Cover U S Krishna D A Israel and R M Peek JrldquoInduction of gastric epithelial cell apoptosis by Helicobacterpylori vacuolating cytotoxinrdquoCancer Research vol 63 no 5 pp951ndash957 2003

[20] C S Goodwin J A Armstrong and M Peters ldquoMicrobiologyof Campylobacter pylorirdquo in Campylobacter Pylori in Gastritisand Peptic Ulcer Disease M J Blaser Ed pp 25ndash49 IgakuShoin Medical Publishers New York NY USA 1989

[21] A B Price J Levi and J M Dolby ldquoCampylobacter pyloridisin peptic ulcer disease microbiology pathology and scanningelectron microscopyrdquo Gut vol 26 no 11 pp 1183ndash1188 1985

[22] F Antonio-Rincon Y Lopez-Vidal G Castillo-Rojas et alldquoPathogenicity island cag vacA and IS605 genotypes inMexicanstrains of Helicobacter pylori associated with peptic ulcersrdquoAnnals of Clinical Microbiology and Antimicrobials vol 10article 18 2011

[23] J C Atherton ldquoMolecular techniques to detect pathogenicstrains of H pylorirdquo in Methods in Molecular Medicine Heli-cobacter Pylori Protocols C L Clayton andH L TMobley Edspp 133ndash143 Humana Press Totowa NJ USA 1996

[24] K A Gangwer D J Mushrush D L Stauff et al ldquoCrystal struc-ture of the Helicobacter pylori vacuolating toxin p55 domainrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 104 no 41 pp 16293ndash16298 2007

[25] B B De Guzman J Hisatsune M Nakayama et al ldquoCyto-toxicity and recognition of receptor-like protein tyrosine phos-phatases RPTP120572 and RPTP120573 by Helicobacter pylori m2VacArdquoCellular Microbiology vol 7 no 9 pp 1285ndash1293 2005

[26] J Rudi C Kolb M Maiwald et al ldquoDiversiyt of HelicobacterpylorivacA and cagA genes and relationship to VacA andCagA protein expression cytotoxin production and associateddiseaserdquo Journal of Clinical Microbiology vol 36 no 4 pp 944ndash948 1998

[27] S Strobel S Bereswill P Balig P Allgaier H-G Sonntag andM Kist ldquoIdentification and analysis of a new vacA genotypevariant of Helicobacter pylori in different patient groups inGermanyrdquo Journal of Clinical Microbiology vol 36 no 5 pp1285ndash1289 1998

[28] M Kidd A J Lastovica J C Atherton and J A LouwldquoHeterogeneity in the Helicobacter pylorivacA and cagA genesassociation with gastroduodenal disease in South Africardquo Gutvol 45 no 4 pp 499ndash502 1999

[29] S Miehlke C Kirsch K Agha-Amiri et al ldquoThe Helicobacterpylori vacA s1 m1 genotype and cagA is associated with gastriccarcinoma in Germanyrdquo International Journal of Cancer vol 87no 3 pp 322ndash327 2000

[30] X Ji T Fernandez D Burroni et al ldquoCell specificity ofHelicobacter pylori cytotoxin is determined by a short region inthe polymorphic midregionrdquo Infection and Immunity vol 68no 6 pp 3754ndash3757 2000

[31] A A R Ashour P P Magalhaes E N Mendes et alldquoDistribution of vacA genotypes in Helicobacter pylori strainsisolated from Brazilian adult patients with gastritis duodenalulcer or gastric carcinomardquo FEMS Immunology and MedicalMicrobiology vol 33 no 3 pp 173ndash178 2002

[32] C Figueiredo J C Machado P Pharoah et al ldquoHelicobacterpylori and interleukin 1 genotyping an opportunity to identifyhigh-risk individuals for gastric carcinomardquo Journal of theNational Cancer Institute vol 94 no 22 pp 1680ndash1687 2002

[33] V J Hofman C Moreilhon P D Brest et al ldquoGene expressionprofiling in human gastric mucosa infected with HelicobacterpylorirdquoModern Pathology vol 20 no 9 pp 974ndash989 2007


[35] I J Kim and S R Blanke ldquoRemodeling the host environmentmodulation of the gastric epithelium by the Helicobacter pylorivacuolating toxin (VacA)rdquo Frontiers in Cellular and InfectionMicrobiology vol 2 article 37 2012

[36] C Pagliaccia M de Bernard P Lupetti et al ldquoThe m2form of the Helicobacter pylori cytotoxin has cell type-specificvacuolating activityrdquo Proceedings of the National Academy ofSciences of the United States of America vol 95 no 17 pp 10212ndash10217 1998

[37] J F Kerr A H Wyllie and A R Currie ldquoApoptosis abasic biological phenomenon with wide-ranging implications


in tissue kineticsrdquo British Journal of Cancer vol 26 no 4 pp239ndash257 1972

[38] L A Noach T M Rolf and G N J Tytgat ldquoElectronmicroscopic study of association between Helicobacter pyloriand gastric and duodenalmucosardquo Journal of Clinical Pathologyvol 47 no 8 pp 699ndash704 1994

[39] E Papini B Satin N Norais et al ldquoSelective increase ofthe permeability of polarized epithelial cell monolayers byHelicobacter pylori vacuolating toxinrdquo The Journal of ClinicalInvestigation vol 102 no 4 pp 813ndash820 1998

[40] V Pelicic J-M Reyrat L Sartori et al ldquoHelicobacter pyloriVacA cytotoxin associated with the bacteria increases epithelialpermeability independently of its vacuolating activityrdquoMicrobi-ology vol 145 no 8 pp 2043ndash2050 1999

[41] T L Cover P Cao C D Lind K T Tham and M JBlaser ldquoCorrelation between vacuolating cytotoxin productionbyHelicobacter pylori isolates in vitro and in vivordquo Infection andImmunity vol 61 no 12 pp 5008ndash5012 1993

[42] D C Willhite and S R Blanke ldquoHelicobacter pylori vacuo-lating cytotoxin enters cells localizes to the mitochondriaand induces mitochondrial membrane permeability changescorrelated to toxin channel activityrdquo Cellular Microbiology vol6 no 2 pp 143ndash154 2004

[43] J N Radin C Gonzalez-Rivera S E Ivie M S McClain andT L Cover ldquoHelicobacter pylori VacA induces programmednecrosis in gastric epithelial cellsrdquo Infection and Immunity vol79 no 7 pp 2535ndash2543 2011

[44] E Yamasaki A Wada A Kumatori et al ldquoHelicobacter pylorivacuolating cytotoxin induces activation of the proapoptoticproteins Bax and Bak leading to cytochrome c release and celldeath independent of vacuolationrdquo The Journal of BiologicalChemistry vol 281 no 16 pp 11250ndash11259 2006

[45] V Hofman V Ricci A Galmiche et al ldquoEffect of Helicobacterpylori on polymorphonuclear leukocytemigration across polar-ized T84 epithelial cell monolayers role of vacuolating toxinVacA and cag pathogenicity islandrdquo Infection and Immunity vol68 no 9 pp 5225ndash5233 2000

[46] A M Terres H J Windle E Ardini and D P KelleherldquoSoluble extracts from Helicobacter pylori induce dome forma-tion in polarized intestinal epithelial monolayers in a laminin-dependent mannerrdquo Infection and Immunity vol 71 no 7 pp4067ndash4078 2003

[47] K Kohda K Tanaka Y Aiba M Yasuda T Miwa and Y KogaldquoRole of apoptosis induced by Helicobacter pylori infection inthe development of duodenal ulcerrdquoGut vol 44 no 4 pp 456ndash462 1999

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


polymorphisms in the vacA gene [15] The most variableregion corresponds to a sim800-bp sequence located in themiddle of the p55 domain (ldquomidrdquo or ldquomrdquo region) Variousm sequences have been grouped into two families of allelesm1 and m2 whereby strains carrying the m2 phenotypeappear to have limited vacuolating activity [16] Additionalsequence variations are located in the ldquosrdquo region whichincludes the N-terminal signal sequence of the mature VacAtoxin [17] Two main allelic families are recognized desig-nated s1 and s2 All possible combinations of these poly-morphic regions (s1m1 s1m2 s2m1 and s2m2) have beendetected in clinical isolates ofH pylori although s2m1 formsoccur rarely Strains containing a type s2 allele reportedlyare unable to induce vacuolation with specific cell types[17]

A third polymorphic site within the vacA sequence wasrecently identified and designated ldquoirdquo (intermediate) region[18] The ldquoirdquo region is located within the p33 domain and 2types i1 and i2 were commonly found in clinical isolates ofH pylori Vacuolation assays demonstrated that vacuolatingactivity of s1m2 VacA was dependent on the presence of theldquoirdquo region thereby suggesting a pivotal role for VacA activity

Vacuolating cytotoxin purified from H pylori causesmitochondrial damage leading to apoptotic cell death andit was speculated that differences in gastric mucosal cellapoptosis amongH pylori-infected personsmay be caused bydifferences in the structure and activity of VacA allelic forms[19]

In the present study we constructed an expression systemto obtain sequence information and to analyze the apoptoticactivity of a H pylori VacA toxin isolated from a Thaipatient with gastric lymphoma (ldquoThai isolaterdquo) We wereseeking to understand how genetic differences and sequencepolymorphisms between m1 andm2 types of vacA alleles arerelated to theThai isolate VacA and how these could possiblyinfluence the apoptotic activity of this protein

2 Materials and Methods

21 Cloning and Sequence Analysis of vacA Gene from a ThaiPatient Isolate H pylori was cultured from a gastric biopsysample from a Thai patient with diagnosed gastric lym-phoma (62-year-old male) obtained at Vichaiyut HospitalBangkokThailand on the surfaces of horse blood agar plates(10 horse blood in Casman agar base (BBL MicrobiologySystems Cockeysville MD)) which were incubated in anatmosphere of 5 oxygen and 10 carbon dioxide for 72 hat 37∘C for up to 5 days [20ndash22] Chromosomal DNA wasextracted as described previously [23] and used as templatefor PCR amplification of vacA The following pair of primersderived from the sequence of H pylori model strain 60190was used

SJ vacA1F 51015840-CATGCCATGGCCTTTTTTACAACC-GTGATCA-31015840 (underlined sequence represents the NcoIrestriction site) and SJ vacA821R 51015840-TGCACTGCAGAG-CGTAGCTAGCGAAACGC-31015840 (underlined sequence rep-resents the PstI restriction site) Oligonucleotides werepurchased from Sigma-Aldrich Singapore

PCRwas performed with PfuDNA polymerase (Fermen-tas Life Sciences USA) using a thermal cycler GeneAmpPCR system Model 2400 (Perkin Elmer Cetus USA) withpredenaturing (98∘C 2min) 25 cycles of denaturing (98∘C01min) annealing (65∘C 03min) extension (72∘C 13min)and final extension (72∘C 7min)The resulting PCRproductswere subjected to agarose gel electrophoresis and the 25-kbfragment representing themature full-length vacA toxin gene(p88) was excised and purified by QIAquick gel extraction kit(QIAGEN Germany)

The purified vacA PCR product and pTrcHisA (44 kb)vector (Invitrogen USA) were digested with restrictionenzymesNcoI and PstI and purified by QIAquick purificationkit Insert DNA and pTrcHisA vector were combined ata 10 1 molar ratio in a ligation reaction containing 1timesligation buffer (50mMTris-HCl pH 76 10mMMgCl

2 1 mM

ATP 1mM DTT 25 (wv) polyethylene glycol 8000) andfive units of T4 DNA ligase (Gibco BRL USA) in a finalvolume of 20 120583L and incubated overnight at 14∘C resultingin pTrcHisAVacA carrying a C-terminal (His)

6tag and a

translation initiation methionine residue at the N-terminusThe correct sequence of the recombinant pTrcHisAVacAconstruct was verified by restriction digestion and DNAsequencing analysis (Macrogen Inc South Korea)

22 Expression and Purification of the Recombinant VacAProtein Recombinant plasmid containing the vacA insert(pTrcHis2AVacA) was transformed into Escherichia coliTOP10 (GIBCO BRL USA) To determine optimum con-ditions for the expression of the VacA protein the E colicells were incubated at 37∘C in one liter LB medium con-taining 100 120583gmLminus1 ampicillin At OD

600= 05 expression

was induced by isopropyl-120573-D-thiogalactopyranoside (IPTG01mMfinal concentration) Protein biosynthesiswas assayedat different incubation times (0 h 1 h 4 h and 6 h andovernight) and temperatures (18 25 30 and 37∘C) Cellswere harvested by centrifugation (6000timesg 4∘C 10min) andthe pellet was resuspended in 30mL lysis buffer (01M Tris-HCl pH 75 03MNaCl 025mgmLminus1 lysozyme 10mgmLminus1DNase and 5mMMgCl

2) Cells were lysed on ice by sonica-

tion using an Ultrasonic Processor XL (Misonix Inc USA)The cell lysate was subjected to centrifugation (15000timesg 4∘C30min) insoluble material was pelleted by centrifugation(15000timesg 4∘C 20min) and the soluble fraction was filteredthrough a 022 micron pore-size filter (Pall CorporationUSA)

Histidine-tagged VacA protein was purified by immo-bilized metal ion affinity chromatography (IMAC) usingnickel-sepharoseHisTrapHP 5-mL columns (GEHealthcareSweden) The columns were preequilibrated with 5ndash10 col-umn volumes of sample buffer containing 100mM Tris-HClpH 75 300mMNaCl and the sample was loaded at a flowrate of 1mLminminus1 using a FPLC pump (AKTA FPLC systemGE Healthcare) The column was washed with 10 columnvolumes of degased washing buffer (100mM Tris-HCl pH75 300mM NaCl 10mM imidazole) and the protein waseluted with elution buffer (100mMTris-HCl pH 75 300mMNaCl 100mM imidazole) at flow rate of 1mLminminus1 Elution





2















U05676 | 60190 (2276)U95971 | 95-54 (1732)KC529337 | Thai (1289)

U05676 | 60190 (2276)U95971 | 95-54 (1732)KC529337 | Thai (1289)

U05676 | 60190 (2276)U95971 | 95-54 (1732)KC529337 | Thai (1289)

(a)


U05676 | 60190 (494)U95971 | 95-54 (497)KC529337 | Thai (464)

(b)











Imidazole Imidazole

A28

0 (m

AU)

1400

200

0

400

600

800

1000

1200

10 20 40 60 80 10030 50 70 90

A

B

M 1 2 3

900

M 1 2 3

662

2000

1162974

45

31

10mM 100mM

(kDa)

(a)

(b) (c)







4 Conclusion



(a) (c)

(d)(b)


Apop

tosis

()

UntreatedT84 cells

UntreatedMDCK cells



5

0

10

15

20

25

30




Acknowledgments



References


























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology





2















U05676 | 60190 (2276)U95971 | 95-54 (1732)KC529337 | Thai (1289)

U05676 | 60190 (2276)U95971 | 95-54 (1732)KC529337 | Thai (1289)

U05676 | 60190 (2276)U95971 | 95-54 (1732)KC529337 | Thai (1289)

(a)


U05676 | 60190 (494)U95971 | 95-54 (497)KC529337 | Thai (464)

(b)











Imidazole Imidazole

A28

0 (m

AU)

1400

200

0

400

600

800

1000

1200

10 20 40 60 80 10030 50 70 90

A

B

M 1 2 3

900

M 1 2 3

662

2000

1162974

45

31

10mM 100mM

(kDa)

(a)

(b) (c)







4 Conclusion



(a) (c)

(d)(b)


Apop

tosis

()

UntreatedT84 cells

UntreatedMDCK cells



5

0

10

15

20

25

30




Acknowledgments



References


























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology





U05676 | 60190 (2276)U95971 | 95-54 (1732)KC529337 | Thai (1289)

U05676 | 60190 (2276)U95971 | 95-54 (1732)KC529337 | Thai (1289)

U05676 | 60190 (2276)U95971 | 95-54 (1732)KC529337 | Thai (1289)

(a)


U05676 | 60190 (494)U95971 | 95-54 (497)KC529337 | Thai (464)

(b)











Imidazole Imidazole

A28

0 (m

AU)

1400

200

0

400

600

800

1000

1200

10 20 40 60 80 10030 50 70 90

A

B

M 1 2 3

900

M 1 2 3

662

2000

1162974

45

31

10mM 100mM

(kDa)

(a)

(b) (c)







4 Conclusion



(a) (c)

(d)(b)


Apop

tosis

()

UntreatedT84 cells

UntreatedMDCK cells



5

0

10

15

20

25

30




Acknowledgments



References


























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


Imidazole Imidazole

A28

0 (m

AU)

1400

200

0

400

600

800

1000

1200

10 20 40 60 80 10030 50 70 90

A

B

M 1 2 3

900

M 1 2 3

662

2000

1162974

45

31

10mM 100mM

(kDa)

(a)

(b) (c)







4 Conclusion



(a) (c)

(d)(b)


Apop

tosis

()

UntreatedT84 cells

UntreatedMDCK cells



5

0

10

15

20

25

30




Acknowledgments



References


























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


(a) (c)

(d)(b)


Apop

tosis

()

UntreatedT84 cells

UntreatedMDCK cells



5

0

10

15

20

25

30




Acknowledgments



References


























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology



















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

Research Article Sequence and Apoptotic Activity of...

Documents

Transcript of Research Article Sequence and Apoptotic Activity of...