Research Article Escherichia coli -Derived Thymosin 4 ...

Hindawi Publishing CorporationBioMed Research InternationalVolume 2013 Article ID 241721 7 pageshttpdxdoiorg1011552013241721

Research ArticleThe Escherichia coli-Derived Thymosin 1205734 ConcatemerPromotes Cell Proliferation and Healing Wound in Mice

Xiaolei Wang Guihua Yang Shanshuang Li Meifeng GaoPangfeng Zhao and Lingxia Zhao

Plant Biotechnology Research Center School of Agriculture and Biology Fudan-SJTU-NottinghamPlant Biotechnology R and D Center Shanghai Jiao Tong University Shanghai 200240 China

Correspondence should be addressed to Lingxia Zhao lz258cornelledu

Received 21 January 2013 Revised 5 April 2013 Accepted 17 April 2013

Academic Editor Youngjun Choi

Copyright copy 2013 Xiaolei Wang et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Thymosin 1205734 (T1205734) is one of the most promising thymosins for future clinical applications and it is anticipated that commercialdemand for T1205734 will increase In order to develop a new approach to produce recombinant T1205734 a 168 bp DNA (termed T1205734) wasdesigned based on the T1205734 protein sequence and used to express a 4 times T1205734 concatemer (four tandem copies of T1205734 termed 4 timesT1205734) together with a histidine tag (6 timesHis) in E coli (strain BL21) SDS-PAGE and western blot analysis were used to confirm thata recombinant 4 times T1205734 protein of the expected size (3087 kDa) was produced following the induction of the bacterial cultures withisopropyl 120573-D-thiogalactoside (IPTG) The E coli-derived 4 times T1205734 was purified by Ni-NTA resin and its activities were examinedwith regard to both stimulating proliferation of themice spleen cells in vitro and in vivowound healingThe results demonstrate thatthese activities of the E coli-derived recombinant 4 times T1205734 were similar or even better than existing commercially obtained T1205734This production strategy therefore represents a potentially valuable approach for future commercial production of recombinantT1205734

1 Introduction

Thymosin 1205734 (T1205734) a small acidic polypeptide (43-aminoacid residues) was first discovered and isolated firstly fromcalf thymus [1] and encoding gene was mapped to the Xchromosome [2] T1205734 which has a molecular weight of4982Da and an isoelectric point of 51 is one of the mostimportant thymosin in fraction 5 which participates in theregulation of thymus-dependent immune response [1]

T1205734 is localized in the cytoplasm shows a high affinityfor G-actin and serves as an G-actin-sequestering proteinthat regulates actin polymerization It forms a 1 1 complexwith monomeric G actin to maintain a dynamic equilibriumbetween G actin and F actin preventing polymerizationinto actin filaments supplies a pool of actin monomerswhen the cell needs filaments and is thus critical for rapidreorganization of the cytoskeleton [2ndash6] The amino acidresidues of the T1205734 protein that are critical for action bindingwere confirmed by chemical cross-linking and shown tocorrespond to a hydrophobic cluster consisting of residues

(M6-I9-F12) in N-terminal 120572-helix as well as K14 and K18[7]

Several studies have suggested that T1205734 contributes tovarious biological functions in different pathological stagesand physiological processes including the migration of epi-dermal cell and collagen as well as formation of blood-vessel in the both wound healing [8 9] and the induction ofangiogenesis [3 10 11] In particular T1205734 has been associatedwith healing of diabetic ulcers bedsores damaged corneasand heart muscle injured during heart attacks [12 13] T1205734also plays important roles in the inhibition of inflammation[14 15] as well as T-cell maturation proliferation of cell anddifferentiation [13 16]

T1205734 is also present in tumor cells [2] and severalresearch groups have found that aberrant expression of T1205734is associated with metastasis [10] and invasion of tumor cells[3] as seen in colorectal carcinoma [17 18] gastrointestinalstromal tumors [2] breast cancer cells [19] melanoma andlung tumors in mouse [10] It has also been shown thatT1205734 promotes the growth of cancerous tumors by enhancing

2 BioMed Research International

new blood-vessel formation [12] However other studies haveresulted in contrary conclusions For instance the expressionlevel of T1205734 is significantly lower in multiple myeloma andit has been suggested that T1205734 can function to suppress theproliferation of tumor cells in myeloma development [3]Moreover another analysis concluded that overexpression ofT1205734 does not cause an increase in cell number in tumors in atransgenic strain of mice [12]

Although there is still considerable debate about theactions of T1205734 in the context of tumor biology it wasconcluded that ldquothe clinical prospects for at least two thy-mosin proteins are finally looking brighter since first medicalexperiment at UCSF (University of California San Francisco)more then [sic] a quarter-centuryrdquo [12] among which T1205734 isone of the most promising prospects for clinical applicationthe other is thymosin 1205721

In addition T1205734 is a promising molecular marker ortherapeutic agent to serve the diagnosis and prognosis ofcertain diseases [2 20] or to treat some common andfrequently occurring conditions and has been proposed tohave value in the wound healing of diabetic ulcers bedsoresand damaged corneas [9 15]

In order to meet a potential increase in the clinicaldemand for T1205734 the goal of this study was to develop aproduction pipeline for recombinant T1205734 A DNA sequencebased on the T1205734 coding sequences was designed to generatea 4 times T1205734 concatemer (four copies of the T1205734 gene arrangedend to end in tandem thereafter 4 times T1205734) and two differentbioactivities of resulting recombinant 4 times T1205734 expressed inEscherichia coli were evaluated

2 Materials and Methods

21 Synthesis of T1205734 and Construction of the pET28a-6 times his-4times T1205734 Vector Based on the T1205734 amino acid sequence a T1205734gene was designed and synthesized [1] and DNA fragment oftheT1205734 gene was subcloned into the pUC57 plasmid (termedpUC57-T1205734)The pUC57-T1205734 plasmid was digested with twocombinations of restriction enzymes of Spe ISac I and XbaISac I and the resulting DNAwas ligated into SpeISacI sitesof pUC57-T1205734 to create pUC57-2timesT1205734 The pUC57-4 times T1205734containing four repeats of the T1205734 gene was also generatedbased on the isocaudamer property of Spe I and Xba I

To facilitate the purification of the recombinant 4times T1205734 protein a DNA sequence which is encoding sixhistidines was added at 51015840 end of the 4 times T1205734 concatemerby PCR technique using the primers of T1205734F1 (51015840-ggggatccatgcaccaccaccaccaccacggtaccatgtctagaatgtctga-31015840)and T1205734R1 (51015840-ccgagctcttaactagtcataga-31015840)The PCR productwas gel purified and ligated into the plasmid pMD18 (TakaraBiotechnology Dalian China) and termed pMD18-6 timeshis-4timesT1205734 Subsequently the plasmids pMD18-6 times his-4 timesT1205734 and pET28a (Merck Millipore Germany) were digestedwith Bam H ISac I and the vector pET28a-6 times his-4 times T1205734was constructed following incubation with T

4DNA ligase

(Takara Biotechnology Dalian China) The recombinantpET28a-6 times his-4 times T1205734 was transformed into E coli strainBL21 by a thermal impulse at 42∘C for 90 seconds

22 Confirmation of the E coli-Derived 4 times T1205734 ProductionThe BL21 cell strain harboring pET28a-6 times his-4 times T1205734 wascultured in a 15mL flask with 3mL LB broth liquid medium(pH = 75) containing kanamycin (100120583gmL) in a shaker(220 rpm) at 37∘C for overnight A similar culture of the BL21cell strain transformedwith pET28a was also grown and usedas a negative control Both cultures (200120583L) were added to50mL fresh LB medium with kanamycin (100 120583gmL) andcultured to the OD

600= 05 in a 37∘C shaker (220 rpm)Then

IPTGwas added to a 1mMfinal concentration and incubatedas above for 0 h to 8 h

The BL21 cells from a 1mL aliquot culture were collectedby centrifugation at 8000 g for 10min then resuspended in10 120583L of the 1 times PBS buffer (140mM NaCl 27mM KCl10mM Na

2HPO4 18mM KH

2PO4 PH 74) The cells were

then mixed with 10 120583L of 2 times SDSPAGE sample buffer(120mM Tris-HCl pH68 20 glycerol 4 SDS 3 120573-mercaptoethanol 002 bromophenol blue) and boiled ina water bath (100∘C) for 5min The boiled samples werecentrifuged at 8000 g for 5min at 4∘C and 7 120583L supernatantfrom each sample was loaded a SDS-12 polyacrylamidegels and then subjected to electrophoresis in 1timesTris-GlycineBuffer (0025M Tris 025M glycine 01 (wv) SDS) at100 volt at 4∘C for 2 h Duplicate gels were stained with 1Coomassie Brilliant Blue (R250) another one or electro-transferred to 022120583m PVDF (Polyvinylidene Fluoride Bio-Rad USA) membrane using a Bio-Rad transfer equipment(35 volt at 4∘C) for overnight for Western blotting anal-ysis A mouse anti-His-tag monoclonal antibody (Shang-hai ImmunoGen Biological Technology Shanghai China)and an AP-conjugated goat anti-mouse antibody (ShanghaiImmunoGen Biological Technology Shanghai China) wererespectively used as primary and second antibodies respec-tively to detect the expression of the recombinant 4 times T1205734protein

23 In Vitro 4 times T1205734 Stimulates Cell Proliferation Thecells harboring pET28a-6 times his-4 times T1205734 were collected bycentrifugation after IPTG (1mM) induction at 37∘C for 6 hand the cells pellet was resuspended in PBS buffer (v v =1 5) and then sonicated at 200ndash300W in an ice bath 6 times(pausesonication = 10 s10 s per time) The sonicated crudelysate was centrifuged under 4∘C at 10 000 g for 30min andthe supernatant was discarded The precipitated cells pellet(per gramme) was resuspended in 5mL buffer B (8M urea01M sodium phosphate buffer 001M Tris-Cl pH 80) andshaken gently at room temperature for approximately 30minuntil the solution became translucent The mixture was thenmixed with Ni-NTA resin (Qiagen Gmbh Germany) andloaded into a column The flow-through from the columnwas collected Nonbound proteins were collected by passing20mL buffer C (8M urea 01M sodium phosphate buffer001M Tris-Cl pH 63) and the proteins adsorbed with Ni-NTA resin were eluted with 5mL buffer E (8M urea 01Msodium phosphate buffer 001M Tris-Cl pH 45)

The bioactivity of the E coli-derived-4timesT1205734 protein instimulating mice splenic lymphocyte proliferation was testedby a MTT-(3-(45-dimethylthiazol-2-yl)-25-diphenyl-2H-tetrazolium bromide) based method in vitro [21] Spleen

BioMed Research International 3

cells were isolated from 6-to 8-week-old Balbc mice Thecells were collected by centrifugation at 1000 g at roomtemperature for 10min and the cells pellet was resuspendedand diluted to 1 times 105cells per mL in RPMI 1640 culturemedium (Sigma-Aldrich Shanghai China)

A 100120583L aliquot of the diluted spleen cells was added toeach well of a 96-well plate Samples of the E coli-derived 4 timesT1205734 and commercially obtained T1205734 protein (GL BiochemShanghai China) were diluted to 250 ng120583L in 1 times PBS bufferand a 100 120583L of the diluted 4 times T1205734 was added to eachwell (six replications per treatment) Aliquots (100 120583L) of thediluted commercial T1205734 protein and 1 times PBS buffer were usedas positive and negative controls respectively The 96-wellplate was incubated in a cell culture incubator at 5 CO

2at

37∘C for 24 h After incubation 10 120583L of MTT reagents wasadded into each well Then the plate was then returned tothe cell culture incubator for an additional 4 h The cells inthe 96-well plate were periodically examined with a CKX31inverted microscope (Olympus Watford Herts UK) Whena purple precipitate was clearly visible 100120583L of dimethylsulfoxide (DMSO) was added and the plate was then gentlyswirled and placed in the dark at room temperature for15minThe absorbance was read at 570 nmwith aMicroplateReader (Bio-Tek Power Wave XS USA) The mouse spleniclymphocyte proliferation rate was calculated according toformula proliferation rate = (ODtest minusODcontrol)ODtest

24 In Vivo 4 times T1205734 Promotes Wound Healing Three full-thickness punch wounds (5mm diameter) were made ondorsal surfaces of eachBalbcmouse (6- to 8-week-old 119899 = 6)(Shanghai SALES Laboratory Animal Shanghai China) aspreviously described [22 23] Both the E coli-derived 4 timesT1205734 and commercial T1205734 protein were diluted to 01120583g120583Lusing 09 (wv) physiological saline Three punch woundsper mouse were topically treated with the 4 times T1205734 thecommercial T1205734 protein and 09 (wv) physiological salinerespectively 24 h and 48 h after wounding

In the first experimental group of threemice keratinocytemigration was determined by measuring the lengths of theepidermal tongues from wound edges with a vernier caliper(Endura-Greenlee Tools E0531 Shanghai China) from 2 to10 days after application treatment and the percentagewoundof closure was calculated by formula percentage woundclosure = distance of migrated keratinocytes from the woundedgetotal wound width times 100 [23]

A second experiment group of three mice was used toexamine reepithelialization and vessel counts (angiogenesis)in the wound bed The mice were euthanized on day 8 afterwounding and the skin tissues were taken from woundsfixed in 4 (vv) formalin buffer and then embedded inparaffin after dehydration in series of increasing ethanolconcentrations (75 85 95 and 100) The embeddedskin tissue samples were sliced into 5120583m thick sectionsusing a microtome (Leica RM2200) and the sections frommiddle of the wounds were mounted on glass slides and thenwere stained with hematoxylin and eosin (Shanghai DingjieBiotechnology Company Shanghai China) after paraffin

removal and the samples were evaluated using a microscope(Olympus BX51 Japan)

Histological sections were used to measure the vesselcounts as previously described by Malinda et al [22] Vesselcounts were determined by first identifying vascular spacesby their endothelial lining All such vessels in the wound bedwere counted including those at the junction of the dermisand the subcutis since angiogenesis in the wounds occursto a great extent from these vessels The vessel counts weretaken from mean value of 10 view fields (40times) per treatmentStatistical analysis pf the data was performed using StatisticalProduct and Service Solutions (SPSS) with a 119875 value lt005[24] All the above analyses were performed using doubleblind trials

3 Results

31 Synthesis of T1205734Gene andConstruction of pET28a-6times his-4 times T1205734 According to amino acid sequence of T1205734 proteina 168 bp of T1205734 gene was designed and synthesized whichincludes restriction enzyme sites (underlined) protectionbases and initiation codon (ATG) and the termination codon(TAA) (bold) as shown below

Kpn I Xba I

GGTACCATGTCTAGAATGTCTGATAAGCCAGATATGGCTGAAATTGAAA

AGTTTGATAAGTCTAAGCTTAAGAAGACTGAAACTCAAGAAAAGAATCCA

CTTCCATCTAAGGAAACTATTGAACAAGAAAAGCAAGCTGGAGAATCTATG

ACTAGTTAAGAGCTCGSpe I Sac I

GG

The 4 times T1205734 was created using isocaudamer property ofXba I and Spe I and a short DNA sequence (18 base pair)encoding six histidines was introduced at 51015840-end of the 4 timesT1205734 sequence by PCR yielding a DNA sequence of the 6 timeshis-4 times T1205734 (619 bp) The DNA fragment was subsequentlyinserted into the Bam H I and Sac I sites in the pET28aplasmid to generate pET28a-6 times his-4 times T1205734 (Figure 1)

32 Induced Expression of 4 times T1205734 Protein To confirm theinduced expression of 4 times T1205734 protein in E coli rudeproteins extracted from BL 21 cell pellets were separated bySDSPAGE gels and the expected 3087 kDa recombinant 4times T1205734 protein was monitored following IPTG induction for0 h to 8 h in BL 21 harboring pET28a-6 times his-4 times T1205734 theexpected band was detected at all time increments other than0 h (Figure 2(a)) In order to further confirm the presenceof 4 times T1205734 protein the mouse anti-His-tag was used as aprimary antibody in a Western blot analysis of the proteinextracts The expected hybridization signal at 3087 kDa wasdetected at different induction times from 0 h to 8 h in BL 21harboring pET28a-6 times his-4 times T1205734 however the signal wasmuch weaker in 0 h sample As expected no immunoreactiveband corresponding 4 times T1205734 was detected in the negativecontrol BL21 samples form cultures transformedwith pET28a(Figure 2(b))

33 In Vitro 4 times T1205734 Stimulates Cell Proliferation In orderto confirm the bioactivity of the recombinant 4 times T1205734


pET28a-6 times His-4 times T12057345966 bp

ApaLI (3636)

ori (3287)

ApaLI (4136)

ClaI (4715)

XmaI (4896)AvaI (4896)SmaI (4898)

Kan (3996ndash4808)

f1 origin (4904ndash5359) AvaI (159)

6 times His-4 times T1205734

NcoI (894)

ApaLI (1701)Iacl (774ndash1853)

Bam H I (796)

Figure 1 Diagramme of pET28a-6 times his-4 times T1205734 lac I lac repressor coding gene Kan kanamycin coding gene 6 times his a DNA sequenceencoding six histidines 4 times T1205734 four copies of a DNA sequence which encode T1205734 arranged in tandem origin DNA sequence of pBR322origin of replication f1 origin DNA sequence of phage f1 origin of replication

55

(kD

a)

13070

35

25

15

10

M 1 2 3 4 5 6

(a)

M 1 2 3 4 5 6

15

25

5570

130

(kD

a) 35

(b)

Figure 2 (a) Expression of recombinant 4 times T1205734 in BL21 cells at different induction times LaneM middle-molecular mass protein markerslanes from 1 to 5 induced expression of the recombinant 4 times T1205734 by IPTG (1mM) at 0 2 4 6 and 8 hs respectively lane 6 induced BL21containing pET28a by IPTG (1mM) for 6 hs Red arrows indicate specific band of E coli-derived 6 times his-timesT1205734 (b) Western blot analysis ofthe E coli-derived 6 times his-4 times T1205734 Lane M middle-molecular-mass protein markers lanes from 1 to 5 BL21 harboring pET28a-6 times his-4 timesT1205734 after IPTG (1mM) induction at 37∘C for 0 2 4 6 and 8 h respectively lane 6 induction of expression of the BL21 containing pET28aby IPTG (1mM) at 37∘C for 6 h Red arrows indicate the specific hybridization signal for the E coli-derived 6 times his-timesT1205734

the E coli-derived 4 times T1205734 protein was purified by theNi-NTA resin and examined by SDS-PAGE gel The resultsshowed that both unbound and nonspecific bound proteinswere eluted from the columnusing 1timesNi-NTAbuffer B andCrespectively however the 4 times T1205734 protein with 6 times his fusionwas successfully obtained by elution of bound proteins fromthe Ni-NTA resin (Figure 3(a))

Both E coli-derived 4 times T1205734 proteins and commercialT1205734 were subsequently diluted to 250 ng120583L in 1timesPBS bufferand then used to in a MTT assay The MTT results showedthat the E coli-derived 4 times T1205734 promotes mice lympho-cyte proliferation (1813 plusmn 365) to a significantly higherdegree than the commercial T1205734 (849 plusmn 332) (Figure 3(b)119875 lt 001)

34 In Vivo 4 times T1205734 Promotes Wound Healing The fullthickness cutaneous mouse wound model was employed toexamine the efficiency of theE coli-derived 4timesT1205734 inwoundhealing Keratinocyte migration was determined by measur-ing the lengths of the epidermal tongues from the woundedgesThe results showed that reepithelialization is increasedin all treatments and that rate was higher following treatmentwith E coli-derived-4timesT1205734 than that with both positive con-trol (commercial T1205734) and negative control (09 physiolog-ical saline) However the difference is insignificant betweentreatments from 2 days to 6 days after application treatmentKeratinocyte migration was significantly higher followingtreatment with the E coli-derived 4 times T1205734 than the negativecontrol from day 8 and the percentage of wound closure


10

15

25 35 55

130 70

(kD

a)

M 1 2 3 54 76 98

(a)

0

5

10

15

20

25

Cell

pro

lifer

atio

n (

)

4 times T1205734 T1205734

lowastlowast

(b)

Figure 3 (a) Purification of the E coli-derived 4 times T1205734 Lane M middle molecular mass protein markers lane 1 unbound proteins wereeluted using 1timesNi-NTA buffer B lane 2 nonspecific proteins were eluted using 1 times Ni-NTA buffer C lanes from 3 to 9 4 times T1205734 was elutedusing 1 times Ni-NTA buffer E Red arrows indicate the specific band of E coli-derived 4 times T1205734 on SDSPAGE gel (b) Assay of mice spleniclymphocyte proliferation using MTT method 4 times T1205734 purified 4 times T1205734 protein extracted from BL21 (E coli) stimulate mice spleniclymphocyte proliferation T1205734 commercial T1205734 protein (GL Biochem) stimulates mice splenic lymphocyte proliferation

020406080

100

Days after applied proteins

Kera

tinoc

yte

mig

ratio

n

2d 4d 6d 8d 10d

T12057344 times T120573409 NaCI

Figure 4 Change of keratinocyte migration in wound bed atdifferent times after application treatment T1205734 wounds of theapplied standard T1205734 purchased fromGL Biochem 4 times T1205734 (BL21)wounds of the applied E coli-derived 4 times T1205734 NaCl wounds of theapplied 09 physiological saline 2 d to 10 d days after application

reached 7672plusmn554Onday 10 the closurewas significantlyhigher (119875 lt 001) than the negative control (5405 plusmn 455)(Figure 4 see Supplementary Figure 1 available online athttpdxdoiorg1011552013241721) however there was nosignificant difference between treatments with the E coli-derived 4 times T1205734 and commercial T1205734

The E coli-derived 4 times T1205734 also promoted an increase inthe number of blood vessels in wound bed as determinedby observing tissue sections on day 8 after wounding Theblood vessel number (1033plusmn058 vessel number9times 104 120583m2119875 lt 001) was significantly greater than that of the negativecontrol (500 plusmn 100 vessel number9 times 104 120583m2) howeverthere was no significant difference between theE coli-derived4 times T1205734 and the commercial T1205734 (1000 plusmn 100 vesselnumber9 times 104 120583m2) samples (Figure 5)

4 Discussion

The T1205734 protein has been proposed as one of the two mostpromising thymosins (the another being thymosin 1205721) forfuture clinical applications [12] Several research groups have

suggested that T1205734 protein has the potential to cure orprevent many diseases associated with the immune systemand can be used to treat inflammation [14 15] and tumors[2 3] and promote wound healing [8] The number ofpatients with diseases such as diabetes is gradually risingin conjunction with an aging population and suboptimallife style often resulted in diabetic ulcers and bedsores T1205734protein is therefore likely to have increasing importance asa therapeutic agent which in turn suggests that there willbe an increasing demand for T1205734 production Currently theT1205734 is produced commercially by two approaches extractionfromanimal thymus [1] and chemical synthesis [25] but thereare challenges with meeting clinic demand due to risks ofzoonosis and higher production costs [25 26]

We therefore sought to produce T1205734 protein via agenetic engineering approach and a gene encoding T1205734was designed and synthesized To enhance expression andfacilitate purification a recombinantT1205734 concatemer proteinfused to a histidine tag was expressed in and purified from Ecoli cultures

Several studies have revealed that T1205734 functions bybinding to G-actin [3ndash6] and the bioactivity of T1205734 proteinwas related to its structure and amino acid components [727] As of yet we have no evidence that the E coli-derived4 times T1205734 has similar binding characteristics equal to thecommercial T1205734 which is generated by chemosynthesis orextraction of animal thymuses However the results showedthat the E coli-4 times T1205734 protein promotes cell proliferationin vitro (Figure 3(b)) as well as wound healing and vesselincrease in vivo (Figures 4 and 5) and its capabilities in theseregards are at least similar or even better than commercialT1205734 Further research focuses on producing T1205734 using otherexpression systems including yeast and plant [28ndash32]

Conflict of Interests

The authors declare that there is no any conflict of interestsassociated with this publication and there has been nosignificant financial support for this work that could haveinfluenced its outcome


(a) (b)

(c) (d)

Figure 5 Histological sections of reepithelialization and angiogenesis at day 8 after wounding Arrows indicate the formation of blood vesselin the wound bed (a)The newly formed blood vessels and reepithelialization of the wound epidermis in wound location by topical treatmentwith 5 120583g 4timesT1205734 (dissolved in 50120583Lof the 09physiological saline) (b)Thenewly formed blood vessels and reepithelialization of thewoundepidermis in the wound location by topical treatment with 5120583g T1205734 (dissolved in 50120583L of the 09 physiological saline) (c) Treatment with09 physiological saline (d) Normal mouse skin tissues (bar = 100 120583m)

Acknowledgments

The authors thank Professor Zhong-Dong Qiao (School ofLife Sciences and Biotechnology Shanghai Jiao Tong Univer-sity Shanghai China) and Professor Yan Yu (School of Agri-culture and Biology Shanghai Jiao TongUniversity ShanghaiChina) for providing assistance with assaying protein activityand wound healing respectively They also thank ProfessorRose (Department of Plant Biology Cornell University NYUSA) and Dr Ming Xia (Division of Infectious DiseasesCincinnati Childrenrsquos Hospital Medical Center OH USA)for taking a lot of time to revise the paper This work wassupported by funding from the China National ldquo863rdquo High-Tech Program (no 2011AA100607 and no 2007AA100503)and National Natural Science Foundation of China (no31071810)

References

[1] T L K Low S K Hu and A L Goldstein ldquoComplete aminoacid sequence of bovine thymosin 1205734 a thymic hormonethat induces terminal deoxynucleotidyl transferase activity inthymocyte populationsrdquo Proceedings of the National Academy ofSciences of the United States of America vol 78 no 2 pp 1162ndash1166 1981

[2] B Can F Karagoz L Yildiz M Kefeli G Gonullu andB Kandemir ldquoThymosin 1205734 is a novel potential prognosticmarker in gastrointestinal stromal tumorsrdquo Acta PathologicaMicrobiologica et Immunologica Scandinavica vol 120 no 9 pp689ndash698 2012

[3] J Caers E Otjacques D Hose B Klein and K VanderkerkenldquoThymosin1205734 inmultiplemyeloma friend or foerdquoAnnals of theNew York Academy of Sciences vol 1194 pp 125ndash129 2010

[4] C Chen M Li H Yang H Chai W Fisher and Q Yao ldquoRolesof thymosins in cancers and other organ systemsrdquoWorld Journalof Surgery vol 29 no 3 pp 264ndash270 2005

[5] T Huff C S G Muller A M Otto R Netzker and EHannappel ldquo120573-thymosins small acidic peptides with multiplefunctionsrdquo International Journal of Biochemistry and Cell Biol-ogy vol 33 no 3 pp 205ndash220 2001

[6] D Safer M Elzinga and V T Nachmias ldquoThymosin 1205734 and Fxan actin-sequestering peptide are indistinguishablerdquo Journal ofBiological Chemistry vol 266 no 7 pp 4029ndash4032 1991

[7] M Van Troys D Dewitte M Goethals M F Carlier JVandekerckhove and C Ampe ldquoThe actin binding site ofthymosin 1205734 mapped by mutational analysisrdquo EMBO Journalvol 15 no 2 pp 201ndash210 1996

[8] K Matsuo Y Akasaki K Adachi et al ldquoPromoting effects ofthymosin 1205734 on granulation tissue and new bone formationafter tooth extraction in ratsrdquoOral Surgery Oral Medicine OralPathology Oral Radiology vol 114 no 1 pp 17ndash26 2012


[9] G Sosne P Qiu M Kurpakus-Wheater and H MatthewldquoThymosin 1205734 and corneal wound healing visions of thefuturerdquo Annals of the New York Academy of Sciences vol 1194pp 190ndash198 2010

[10] H J ChaM J Jeong andHKKleinman ldquoRole of thymosin1205734in tumor metastasis and angiogenesisrdquo Journal of the NationalCancer Institute vol 95 no 22 pp 1674ndash1680 2003

[11] N Smart A Rossdeutsch and P R Riley ldquoThymosin 1205734and angiogenesis modes of action and therapeutic potentialrdquoAngiogenesis vol 10 no 4 pp 229ndash241 2007

[12] J Marx ldquoThymosins clinical promise after a decades-longsearchrdquo Science vol 316 no 5825 pp 682ndash683 2007

[13] C Wei S Kumar I K Kim and S Gupta ldquoThymosin Beta 4protects cardiomyocytes from oxidative stress by targeting anti-oxidative enzymes and anti-apoptotic genesrdquo Public Library ofScience One vol 7 no 8 Article ID e42586 2012

[14] G Sosne C C Chan KThai et al ldquoThymosin beta 4 promotescorneal wound healing andmodulates inflammatory mediatorsin vivordquo Experimental Eye Research vol 72 no 5 pp 605ndash6082001

[15] G Sosne E A Szliter R Barrett K A Kernacki H Kleinmanand L D Hazlett ldquoThymosin beta 4 promotes corneal woundhealing and decreases inflammation in vivo following alkaliinjuryrdquo Experimental Eye Research vol 74 no 2 pp 293ndash2992002

[16] T L K Low C Y Lin T L Pan A J Chiou and A TsugitaldquoStructure and immunological properties of thymosin 1205739Meta new analog of thymosin 1205734 isolated from porcine thymusrdquoInternational Journal of Peptide and Protein Research vol 36no 6 pp 481ndash488 1990

[17] C S Cierniewski I Papiewska-Pajak M Malinowski et alldquoThymosin 1205734 regulates migration of colon cancer cells by apathway involving interaction with Ku80rdquo Annals of the NewYork Academy of Sciences vol 1194 pp 60ndash71 2010

[18] W S Wang P M Chen H L Hsiao H S Wang W YLiang and Y Su ldquoOverexpression of the thymosin 120573-4 gene isassociated with increased invasion of SW480 colon carcinomacells and the distant metastasis of human colorectal carcinomardquoOncogene vol 23 no 39 pp 6666ndash6671 2004

[19] S Y Yoon H R Lee Y Park et al ldquoThymosin 1205734 expres-sion correlates with lymph node metastasis through hypoxiainducible factor-120572 induction in breast cancerrdquo OncologyReports vol 25 no 1 pp 23ndash31 2011

[20] A L Goldstein ldquoThymosin 1205734 a new molecular target forantitumor strategiesrdquo Journal of the National Cancer Institutevol 95 no 22 pp 1646ndash1647 2003

[21] T Mosmann ldquoRapid colorimetric assay for cellular growth andsurvival application to proliferation and cytotoxicity assaysrdquoJournal of Immunological Methods vol 65 no 1-2 pp 55ndash631983

[22] K M Malinda G S Sidhu H Mani et al ldquoThymosin 1205734 accel-erates wound healingrdquo Journal of Investigative Dermatology vol113 no 3 pp 364ndash368 1999

[23] X Li L Zheng F Peng et al ldquoRecombinant thymosin beta 4can promote full-thickness cutaneous wound healingrdquo ProteinExpression and Purification vol 56 no 2 pp 229ndash236 2007

[24] S Wallenstein C L Zucker and J L Fleiss ldquoSome statisticalmethods useful in circulation researchrdquo Circulation Researchvol 47 no 1 pp 1ndash9 1980

[25] S S Wang B S Wang J K Chang T K Low and A LGoldstein ldquoSynthesis of thymosin 1205734rdquo International Journal ofPeptide and Protein Research vol 18 no 4 pp 413ndash415 1981

[26] K E Jones N G Patel M A Levy et al ldquoGlobal trends inemerging infectious diseasesrdquoNature vol 451 no 7181 pp 990ndash993 2008

[27] T Low and A Goldstein ldquoThymosins structure function andtherapeutic applicationsrdquo Thymus vol 6 no 1-2 pp 27ndash421984

[28] L Avesani L Bortesi L Santi A Falorni and M PezzottildquoPlant-made pharmaceuticals for the prevention and treatmentof autoimmune diseases where are werdquo Expert Review ofVaccines vol 9 no 8 pp 957ndash969 2010

[29] J K C Ma P M W Drake and P Christou ldquoThe productionof recombinant pharmaceutical proteins in plantsrdquo NatureReviews Genetics vol 4 no 10 pp 794ndash805 2003

[30] C L Nykiforuk Y Shen E W Murray et al ldquoExpressionand recovery of biologically active recombinant ApolipoproteinAIMilano from transgenic safflower (Carthamus tinctorius)seedsrdquo Plant Biotechnology Journal vol 9 no 2 pp 250ndash2632011

[31] T U Gerngross ldquoAdvances in the production of humantherapeutic proteins in yeasts and filamentous fungirdquo NatureBiotechnology vol 22 no 11 pp 1409ndash1414 2004

[32] T N Athmaram S Saraswat S R Santhosh et al ldquoYeastexpressed recombinant Hemagglutinin protein of novel H1N1elicits neutralising antibodies in rabbits and micerdquo VirologyJournal vol 8 p 524 2011

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


new blood-vessel formation [12] However other studies haveresulted in contrary conclusions For instance the expressionlevel of T1205734 is significantly lower in multiple myeloma andit has been suggested that T1205734 can function to suppress theproliferation of tumor cells in myeloma development [3]Moreover another analysis concluded that overexpression ofT1205734 does not cause an increase in cell number in tumors in atransgenic strain of mice [12]

Although there is still considerable debate about theactions of T1205734 in the context of tumor biology it wasconcluded that ldquothe clinical prospects for at least two thy-mosin proteins are finally looking brighter since first medicalexperiment at UCSF (University of California San Francisco)more then [sic] a quarter-centuryrdquo [12] among which T1205734 isone of the most promising prospects for clinical applicationthe other is thymosin 1205721

In addition T1205734 is a promising molecular marker ortherapeutic agent to serve the diagnosis and prognosis ofcertain diseases [2 20] or to treat some common andfrequently occurring conditions and has been proposed tohave value in the wound healing of diabetic ulcers bedsoresand damaged corneas [9 15]

In order to meet a potential increase in the clinicaldemand for T1205734 the goal of this study was to develop aproduction pipeline for recombinant T1205734 A DNA sequencebased on the T1205734 coding sequences was designed to generatea 4 times T1205734 concatemer (four copies of the T1205734 gene arrangedend to end in tandem thereafter 4 times T1205734) and two differentbioactivities of resulting recombinant 4 times T1205734 expressed inEscherichia coli were evaluated

2 Materials and Methods

21 Synthesis of T1205734 and Construction of the pET28a-6 times his-4times T1205734 Vector Based on the T1205734 amino acid sequence a T1205734gene was designed and synthesized [1] and DNA fragment oftheT1205734 gene was subcloned into the pUC57 plasmid (termedpUC57-T1205734)The pUC57-T1205734 plasmid was digested with twocombinations of restriction enzymes of Spe ISac I and XbaISac I and the resulting DNAwas ligated into SpeISacI sitesof pUC57-T1205734 to create pUC57-2timesT1205734 The pUC57-4 times T1205734containing four repeats of the T1205734 gene was also generatedbased on the isocaudamer property of Spe I and Xba I

To facilitate the purification of the recombinant 4times T1205734 protein a DNA sequence which is encoding sixhistidines was added at 51015840 end of the 4 times T1205734 concatemerby PCR technique using the primers of T1205734F1 (51015840-ggggatccatgcaccaccaccaccaccacggtaccatgtctagaatgtctga-31015840)and T1205734R1 (51015840-ccgagctcttaactagtcataga-31015840)The PCR productwas gel purified and ligated into the plasmid pMD18 (TakaraBiotechnology Dalian China) and termed pMD18-6 timeshis-4timesT1205734 Subsequently the plasmids pMD18-6 times his-4 timesT1205734 and pET28a (Merck Millipore Germany) were digestedwith Bam H ISac I and the vector pET28a-6 times his-4 times T1205734was constructed following incubation with T

4DNA ligase

(Takara Biotechnology Dalian China) The recombinantpET28a-6 times his-4 times T1205734 was transformed into E coli strainBL21 by a thermal impulse at 42∘C for 90 seconds

22 Confirmation of the E coli-Derived 4 times T1205734 ProductionThe BL21 cell strain harboring pET28a-6 times his-4 times T1205734 wascultured in a 15mL flask with 3mL LB broth liquid medium(pH = 75) containing kanamycin (100120583gmL) in a shaker(220 rpm) at 37∘C for overnight A similar culture of the BL21cell strain transformedwith pET28a was also grown and usedas a negative control Both cultures (200120583L) were added to50mL fresh LB medium with kanamycin (100 120583gmL) andcultured to the OD

600= 05 in a 37∘C shaker (220 rpm)Then

IPTGwas added to a 1mMfinal concentration and incubatedas above for 0 h to 8 h

The BL21 cells from a 1mL aliquot culture were collectedby centrifugation at 8000 g for 10min then resuspended in10 120583L of the 1 times PBS buffer (140mM NaCl 27mM KCl10mM Na

2HPO4 18mM KH

2PO4 PH 74) The cells were

then mixed with 10 120583L of 2 times SDSPAGE sample buffer(120mM Tris-HCl pH68 20 glycerol 4 SDS 3 120573-mercaptoethanol 002 bromophenol blue) and boiled ina water bath (100∘C) for 5min The boiled samples werecentrifuged at 8000 g for 5min at 4∘C and 7 120583L supernatantfrom each sample was loaded a SDS-12 polyacrylamidegels and then subjected to electrophoresis in 1timesTris-GlycineBuffer (0025M Tris 025M glycine 01 (wv) SDS) at100 volt at 4∘C for 2 h Duplicate gels were stained with 1Coomassie Brilliant Blue (R250) another one or electro-transferred to 022120583m PVDF (Polyvinylidene Fluoride Bio-Rad USA) membrane using a Bio-Rad transfer equipment(35 volt at 4∘C) for overnight for Western blotting anal-ysis A mouse anti-His-tag monoclonal antibody (Shang-hai ImmunoGen Biological Technology Shanghai China)and an AP-conjugated goat anti-mouse antibody (ShanghaiImmunoGen Biological Technology Shanghai China) wererespectively used as primary and second antibodies respec-tively to detect the expression of the recombinant 4 times T1205734protein

23 In Vitro 4 times T1205734 Stimulates Cell Proliferation Thecells harboring pET28a-6 times his-4 times T1205734 were collected bycentrifugation after IPTG (1mM) induction at 37∘C for 6 hand the cells pellet was resuspended in PBS buffer (v v =1 5) and then sonicated at 200ndash300W in an ice bath 6 times(pausesonication = 10 s10 s per time) The sonicated crudelysate was centrifuged under 4∘C at 10 000 g for 30min andthe supernatant was discarded The precipitated cells pellet(per gramme) was resuspended in 5mL buffer B (8M urea01M sodium phosphate buffer 001M Tris-Cl pH 80) andshaken gently at room temperature for approximately 30minuntil the solution became translucent The mixture was thenmixed with Ni-NTA resin (Qiagen Gmbh Germany) andloaded into a column The flow-through from the columnwas collected Nonbound proteins were collected by passing20mL buffer C (8M urea 01M sodium phosphate buffer001M Tris-Cl pH 63) and the proteins adsorbed with Ni-NTA resin were eluted with 5mL buffer E (8M urea 01Msodium phosphate buffer 001M Tris-Cl pH 45)

The bioactivity of the E coli-derived-4timesT1205734 protein instimulating mice splenic lymphocyte proliferation was testedby a MTT-(3-(45-dimethylthiazol-2-yl)-25-diphenyl-2H-tetrazolium bromide) based method in vitro [21] Spleen




2at







3 Results


Kpn I Xba I





GG






ApaLI (3636)

ori (3287)

ApaLI (4136)

ClaI (4715)

XmaI (4896)AvaI (4896)SmaI (4898)

Kan (3996ndash4808)



NcoI (894)


Bam H I (796)


55

(kD

a)

13070

35

25

15

10

M 1 2 3 4 5 6

(a)

M 1 2 3 4 5 6

15

25

5570

130

(kD

a) 35

(b)






10

15

25 35 55

130 70

(kD

a)

M 1 2 3 54 76 98

(a)

0

5

10

15

20

25

Cell

pro

lifer

atio

n (

)

4 times T1205734 T1205734

lowastlowast

(b)


020406080

100


Kera

tinoc

yte

mig

ratio

n

2d 4d 6d 8d 10d

T12057344 times T120573409 NaCI




4 Discussion








(a) (b)

(c) (d)


Acknowledgments


References









































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology




2at







3 Results


Kpn I Xba I





GG






ApaLI (3636)

ori (3287)

ApaLI (4136)

ClaI (4715)

XmaI (4896)AvaI (4896)SmaI (4898)

Kan (3996ndash4808)



NcoI (894)


Bam H I (796)


55

(kD

a)

13070

35

25

15

10

M 1 2 3 4 5 6

(a)

M 1 2 3 4 5 6

15

25

5570

130

(kD

a) 35

(b)






10

15

25 35 55

130 70

(kD

a)

M 1 2 3 54 76 98

(a)

0

5

10

15

20

25

Cell

pro

lifer

atio

n (

)

4 times T1205734 T1205734

lowastlowast

(b)


020406080

100


Kera

tinoc

yte

mig

ratio

n

2d 4d 6d 8d 10d

T12057344 times T120573409 NaCI




4 Discussion








(a) (b)

(c) (d)


Acknowledgments


References









































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology



ApaLI (3636)

ori (3287)

ApaLI (4136)

ClaI (4715)

XmaI (4896)AvaI (4896)SmaI (4898)

Kan (3996ndash4808)



NcoI (894)


Bam H I (796)


55

(kD

a)

13070

35

25

15

10

M 1 2 3 4 5 6

(a)

M 1 2 3 4 5 6

15

25

5570

130

(kD

a) 35

(b)






10

15

25 35 55

130 70

(kD

a)

M 1 2 3 54 76 98

(a)

0

5

10

15

20

25

Cell

pro

lifer

atio

n (

)

4 times T1205734 T1205734

lowastlowast

(b)


020406080

100


Kera

tinoc

yte

mig

ratio

n

2d 4d 6d 8d 10d

T12057344 times T120573409 NaCI




4 Discussion








(a) (b)

(c) (d)


Acknowledgments


References









































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


10

15

25 35 55

130 70

(kD

a)

M 1 2 3 54 76 98

(a)

0

5

10

15

20

25

Cell

pro

lifer

atio

n (

)

4 times T1205734 T1205734

lowastlowast

(b)


020406080

100


Kera

tinoc

yte

mig

ratio

n

2d 4d 6d 8d 10d

T12057344 times T120573409 NaCI




4 Discussion








(a) (b)

(c) (d)


Acknowledgments


References









































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


(a) (b)

(c) (d)


Acknowledgments


References









































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

Research Article Escherichia coli -Derived Thymosin 4 ...

Documents

Transcript of Research Article Escherichia coli -Derived Thymosin 4 ...