Journ

alof

Cell

Scie

nce

Genetic interaction between pku300 and fbn2bcontrols endocardial cell proliferation and valvedevelopment in zebrafish

Xu Wang1,*, Qingming Yu2,*, Qing Wu1, Ye Bu1, Nan-Nan Chang1, Shouyu Yan1, Xiao-Hai Zhou1, Xiaojun Zhu1

and Jing-Wei Xiong1,`

1Institute of Molecular Medicine, Peking University, Yi He Yuan Lu 5, Hai Dian Qu, Beijing 100871, China2Department of Medicine/Nephrology, Massachusetts General Hospital and Harvard Medical School, 149 13th Street, Boston, MA 02129, USA

*These authors contributed equally to this work`Author for correspondence (jingwei_xiong@pku.edu.cn)

Accepted 20 December 2012Journal of Cell Science 126, 1381–1391� 2013. Published by The Company of Biologists Ltddoi: 10.1242/jcs.116996

SummaryAbnormal cardiac valve morphogenesis is a common cause of human congenital heart disease. The molecular mechanisms regulatingendocardial cell proliferation and differentiation into cardiac valves remain largely unknown, although great progress has been made on

the endocardial contribution to the atrioventricular cushion and valve formation. We found that scotch tapete382 (scote382) encodes anovel transmembrane protein that is crucial for endocardial cell proliferation and heart valve development. The zebrafish scote382 mutantshowed diminished endocardial cell proliferation, lack of heart valve leaflets and abnormal common cardinal and caudal veins.

Positional cloning revealed a C946T nonsense mutation of a novel gene pku300 in the scote382 locus, which encoded a 540-amino-acidprotein on cell membranes with one putative transmembrane domain and three IgG domains. A known G3935T missense mutation offbn2b was also found ,570 kb away from pku300 in scote382 mutants. The genetic mutant scopku300, derived from scote382, only had the

C946T mutation of pku300 and showed reduced numbers of atrial endocardial cells and an abnormal common cardinal vein. Morpholinoknockdown of fbn2b led to fewer atrial endocardial cells and an abnormal caudal vein. Knockdown of both pku300 and fbn2b

phenocopied these phenotypes in scote382 genetic mutants. pku300 transgenic expression in endocardial and endothelial cells, but not

myocardial cells, partially rescued the atrial endocardial defects in scote382 mutants. Mechanistically, pku300 and fbn2b were requiredfor endocardial cell proliferation, endocardial Notch signaling and the proper formation of endocardial cell adhesion and tight junctions,all of which are crucial for cardiac valve development. We conclude that pku300 and fbn2b represent the few genes capable of regulatingendocardial cell proliferation and signaling in zebrafish cardiac valve development.

Key words: Scotch tape, Cardiac valve development, Endocardial cell proliferation, Zebrafish

IntroductionThe heart tube, at the time of its formation, has a two-layer

structure consisting of an inner endothelium and an outer

myocardium, connected by the extracellular matrix (Fishman

and Chien, 1997). While the myocardium has been the focus of

heart development during the past decades, the origin,

proliferation and differentiation of the endocardium has gained

less attention and so remains largely unknown. Lineage tracing

studies support the suggestion that endocardial and myocardial

progenitors are located near each other ventro-laterally in the

zebrafish blastula (Keegan et al., 2004; Lee et al., 1994; Stainier

et al., 1993). These progenitors migrate to form the cardiac field

(or anterior lateral plate mesoderm) in the early somite zebrafish

embryos, where the anterior Scl+ and Etsrp+ progenitors give rise

to endocardial/endothelial cells and the posterior Nkx2.5+

mesodermal cells to myocardial progenitors (Palencia-Desai

et al., 2011; Schoenebeck et al., 2007). In zebrafish, etsrp,

cloche and lycat are critical for the generation of endocardial and

endothelial progenitors (Palencia-Desai et al., 2011; Stainier

et al., 1995; Xiong et al., 2008). Tie2 (Tek) is required for the

formation of the endocardium, but dispensable for the formation

of vessels in mice (Puri et al., 1999). Hedgehog signaling is

required for the specification and differentiation of endocardial

progenitors in zebrafish (Wong et al., 2012). Scl/tal1 is not

needed for the formation of endocardial progenitors but is

essential for endocardial cell migration (Bussmann et al., 2007).

While VEGF-induced NFATc1 activation promotes endocardial

cell proliferation for sustaining endocardial cell numbers in heart

valve development (Combs and Yutzey, 2009b; Graef et al.,

2001; Johnson et al., 2003; Lee et al., 2006), we have limited

knowledge on how endocardial cell proliferation is regulated

before and during the formation of the atrio-ventricular canal

(AVC) and cardiac valves. The common cardinal vein (CCV) is

on the yolk syncytial layer connecting the posterior cardinal vein

(PCV) and the sinus venosus of the heart. The CCV appears

,24 hours post-fertilization (hpf) and finishes remodeling

,72 hpf (Isogai et al., 2001).

Endocardial differentiation is associated with remarkable

morphological and molecular changes during cardiac valve

development in the zebrafish, chicken, and mouse (Beis et al.,

2005; Gitler et al., 2003; Hu et al., 2000; Markwald et al., 1975;

Mjaatvedt et al., 1998; Person et al., 2005; Timmerman et al.,

Research Article 1381

Journ

alof

Cell

Scie

nce

2004). In zebrafish, AVC valve development progresses through

three major and continuous stages: first, AV endocardial cells

extend processes and invaginate into the space between the

endocardium and myocardium around three days post-

fertilization (dpf) (Rutenberg et al., 2006; Scherz et al., 2008);

second, a subset of AVC endocardial cells form endocardial

cushions through the epithelial–mesenchymal transition (EMT)

,6 dpf (Beis et al., 2005; Martin and Bartman, 2009); and third,

endocardial cushions are subsequently remodeled into mature

valve leaflets between 16 and 28 dpf (Martin and Bartman,

2009). RNA in situ analysis in mouse and zebrafish embryonic

hearts reveals that several genes are preferentially expressed in

the endocardial cushions/valves, including vegf, neuregulin,

erbB3, NFATc1, notch1, versican, bmp2/4, tbx2b, foxn4 and

pkd2 (Chi et al., 2008; de la Pompa et al., 1998; Del Monte et al.,

2007; Gitler et al., 2003; Just et al., 2011; Ranger et al., 1998;

Rivera-Feliciano and Tabin, 2006; Walsh and Stainier, 2001).

Analyzing these signaling pathways in mouse and zebrafish

mutants further supports their roles in endocardial cushion and

valve formation (Armstrong and Bischoff, 2004; Chi et al., 2008;

Combs and Yutzey, 2009a; Hinton and Yutzey, 2011;

MacGrogan et al., 2010; Scherz et al., 2008; Smith et al., 2011;

Totong et al., 2011). In the AVC of mouse embryos, myocardial

Bmp2/Tgfb2 and endocardial Notch1 activate Snail1, then

suppress VE-cadherin to promote the EMT and endocardial

cushion formation (for reviews. see Armstrong and Bischoff,

2004; Hinton and Yutzey, 2011; MacGrogan et al., 2010).

However, the cellular and molecular events underlying this

important process remain largely unknown, particularly how

notch signaling is regulated in the endocardium. In this work, we

investigated this important process by positional cloning of an

ethylnitrosourea (ENU)-induced genetic mutant, scotch tapete382

(scote382), and revealed simultaneous mutations of pku300 and

fbn2b in scote382, and their genetic interactions when endocardial

cells proliferate and differentiate into cardiac valves.

ResultsEndocardial and valve morphogenesis are abnormal in the

scote382 mutant heart

To gain insights into the molecular basis of cardiac valve

development, we analyzed the zebrafish genetic mutant scote382,

which was isolated from a large-scale ENU-induced mutagenesis

of the zebrafish genome for cardiovascular mutants (Chen et al.,

1996). Homozygous scote382 mutants were indistinguishable from

their siblings before 24 hpf, but had pericardial edema (Fig. 1B),

dilated heart chambers (Fig. 1D), and abnormal caudal veins in the

trunk (supplementary material Fig. S3B) at 48 hpf. Histological

sections revealed that scote382 mutants had abnormal AVC at

48 hpf (Fig. 1F), and failed to form cardiac valve leaflets at 6 dpf

(Fig. 1H), compared with wild-type siblings (Fig. 1E,G). By

taking high-speed movies of scote382 mutant hearts, we found that

major blood stream followed the direction from the inflow tract to

atrium, ventricle and outflow tract, but a fraction of blood cells

were pushed back from ventricle to atrium, suggesting the

presence of valve defects in the AVC (supplementary material

Movie 1). A systematic examination revealed that ,3%

homozygous mutant embryos with milder pericardial edema and

some circulation at 48 hpf survived to adulthood. Therefore, we

maintained both heterozygous and homozygous adult scote382

mutant zebrafish for subsequent experiments.

Fig. 1. Endocardial and cardiac valve defects

were found in scote382 mutant embryos.

(A,B) Brightfield views of live wild-type (A) and

scote382 mutant (B) embryos at 48 hpf. Note

pericardial edema and heart abnormality (black

arrowhead), as well as abnormal vessels in the

caudal trunk (red arrowhead). (C,D) Confocal

images of Tg(myl7:eGFP) transgenic wild-type

(C) and scote382 mutant (D) hearts at 48 hpf. Note

lack of constricted AVC and dilated heart in scote382

mutant (arrowhead). (E,F) Hematoxylin-eosin

staining of wild-type (E) and scote382 mutant

(F) hearts at 48 hpf on transverse JB4 sections.

Note lack of AVC constriction (arrowhead) in

scote382 mutant heart. (G,H) Valve leaflets

(arrowhead) were labeled and detected by the

Tg(kdrl:eGFP) transgene in wild-type (G), but not

in scote382 mutant (H) embryos at 6 dpf on

vibrotome sections across the heart.

(I–N) Endocardial markers fli1 (I,J) and tie1

(K,L) were expressed in wild-type (I,K) and scote382

mutant (J,L) embryos; and Tg(kdrl:eGFP) labeled

the endocardium in wild type (M) and scote382

mutant (N) embryos at 48 hpf. Note that

endocardial genes (fli1, tie1 and flk1) were reduced

in the atrium of scote382 mutants (J,L,N). Arrows

point to the AVC. a, atrium; v, ventricle.

Journal of Cell Science 126 (6)1382

Journ

alof

Cell

Scie

nce

To identify cellular and molecular defects in scote382 mutants,we analyzed and compared the expression patterns of endocardial

and myocardial genes between scote382 mutants and controlsiblings. We found that endocardial fli1, tie1 and kdrl werealmost undetectable in the atria of scote382 mutants (Fig. 1J,L,N)while they were normally expressed in both the atria and ventricle

of control siblings at 48 hpf (Fig. 1I,K,M). The myocardial genesmyl7, nkx2.5 and tbx5 were normally expressed in scote382 mutants(supplementary material Fig. S1). To evaluate vascular

development in scote382 mutants, we crossed the Tg(kdrl:EGFP)transgene into wild-type and scote382 mutant zebrafish, and foundthat the overall vasculature formed in both the scote382 mutants and

the Tg(kdrl:eGFP) siblings (supplementary material Movies 6, 7).However, the organization of endothelial cells in the caudal veinwas disrupted in the scote382 mutants at 48 hpf (supplementarymaterial Fig. S3B). Together, our data suggested that primary

endocardial and endothelial cell defects led to abnormal cardiacvalve and caudal vein development in scote382 mutants.

A novel gene pku300 is responsible for the scote382

mutant locus

For genetic analysis, we collected ,25% homozygous mutants

with both abnormal heart and caudal vein from heterozygousscote382 mutant zebrafish crosses. We mapped the scote382 locuson linkage group 22 by bulk segregation analysis withmicrosatellite markers. Fine mapping determined the genetic

interval between Z10673 and Z33723 by genotyping 1632informative meioses. Further genetic and physical walkingidentified closer flanking genetic markers 9 (1/1632) and 6 (2/

1632), as well as marker 7 (0/1632) (Fig. 2A). Therefore, thescote382 locus was defined between markers 9 and 6, whichare covered by the contigs CR751224.20, CR394531.15,

CU570881.11, CU582903.5, CU207311.10, CU929300.5 andCU076074.3 in Zv9 on the Zebrafish Genome Browser Gateway.We identified the four genes calreticulin (calr), LAG1 longevity

assurance homolog 4 (trh1), 182 (ZDB-GENE-070705-222 orENSDART00000147116) and calcium homeostasis endoplasmic

reticulum protein (cherp) from this genetic interval. A recentreport showed that fbn2b is mutated in the scote382 locus

(Mellman et al., 2012), however fbn2b was located outside ofthis genetic interval on our genetic mapping panel (Fig. 2A).

To search for mutations in scote382 mutant embryos, we

isolated full-length coding regions of the four genes by RT-PCR.The 182 gene is predicted as ENSDART00000147116 in theEnsembl. Isolating 182 cDNA from zebrafish embryos at 24 hpf

revealed that the correct 182 mRNA transcript contained 1976nucleotides encoding a peptide with 540 amino acids(supplementary material Fig. S7). A C946T mutation in exon 3led to a premature stop code (TAG), generating a truncated

protein with only 121 amino acids (Fig. 2B). This nonsensemutation was also confirmed by sequencing genomic DNA ofscote382 mutants (Fig. 2C). These findings suggested that the 182

gene was responsible for the scote382 mutant locus. We namedthis 182 cDNA pku300. pku300 is located within CU570881.11(contig 3) and fbn2b is within FP360035.6 (contig 15), where the

two genes are ,570 kb apart in Zv9 (Fig. 2A). UsingInterProScan, we found that the Pku300 protein had onetransmembrane domain, three extracellular immunoglobulin

(IgG) domains, and a short 19-amino-acid cytoplasmic tail(Fig. 2D), suggesting that Pku300 may be a receptor or co-receptor on the cell surface. By blast searching in the human

genome with the zebrafish Pku300 protein as a query, we

identified several homologs of IgG-containing proteins such as

CD44, the hyaluronic acid receptor. However, the sequence

Fig. 2. Positional cloning of pku300 from the scote382 locus in zebrafish.

(A) The scote382 locus was mapped on linkage group 22 by bulk segregation

analysis with microsatellite markers. Note that the scote382 locus, which

contains calr, trh1, pku300 and cherp genes, was determined between markers

6 and 9 by genotyping 1632 informative meiosis using SLP and SNP methods.

A G3935T missense mutation of fbn2b is reported to be responsible for the

scote382 locus (Mellman et al., 2012), but fbn2b is located outside of the

genetic interval in our mapping cross DNA panels. fbn2b is about 570 kb

away from pku300. (B) pku300 consists of 6 exons and encodes a 540-amino-

acid protein. Note that a C946T mutation in exon 3 of pku300 led to a

premature stop code (TAG) in the scote382 allele (arrowhead). (C) Sequencing

traces of wild-type and homozygous scote382 mutant embryos. Note a single

base pair change from C to T in the scote382 allele (arrowhead). (D) Pku300

protein was predicted to contain three extracellular IgG domains, a

transmembrane domain and a short intracellular tail. (E–G) pku300 was

broadly expressed, including in the heart (arrowhead) during early

embryogenesis. Staged wild-type 24 (E), 48 (F) and 48 hpf (G) hearts were

subjected to in situ hybridization with anti-sense pku300 riboprobe.

(H) pku300 was expressed in day-2 Tg(myl7:eGFP) embryonic hearts by RT-

PCR. (I) pku300 was reduced in cloche (clo) mutant embryos that have no

endocardial cells. RNA was prepared from siblings (sib) and clo mutant

embryos (clo) from heterozygous clochem39 crosses. (J) Pku300-mCherry

fusion proteins were transiently expressed in the heart of a Tg(kdrl:EGFP)

transgenic embryo. Note the red Pku300-mCherry fusion protein localization

on cell membranes (arrowhead), which was not overlapped with cytoplasmic

localization of EGFP. Pku300-mCherry was driven by the zebrafish kdrl

promoter. a, atrium; v, ventricle. Scale bar: 30 mm.

pku300 and fbn2b in heart development 1383

Journ

alof

Cell

Scie

nce

homology is very low between zebrafish Pku300 and human

CD44, reflecting the sequence diversity in this family of IgG-

domain-containing proteins across species. We found that pku300

mRNA was widely expressed, including in the heart, during

zebrafish embryogenesis by in situ hybridization (Fig. 2E–G).

Also, RT-PCR showed that pku300 was expressed in the heart

(Fig. 2H), and was reduced in clochem39 mutant embryos that

lack endothelial/endocardial lineages (Fig. 2I), showing that

pku300 is expressed in the endocardial and endothelial cells.

Endocardial expression of the fusion gene pku300-mCherry

revealed a cell membrane localization (Fig. 2J), suggesting that

Pku300 is a cell membrane protein.

To investigate whether both pku300 and fbn2b are responsible

for the phenotypes of scote382 mutants, we carefully evaluated

and classified the mutants into two groups by analyzing 2341

offspring from heterozygous scote382 mutant crosses (Fig. 3;

supplementary material Table S2). Group I mutants represented

6.7% of the total offspring and had defects only in the heart,

lacking most of the Tg(kdrl:EGFP) atrial endocardium (Fig. 3C;

supplementary material Fig. S4C). Group II mutants represented

25.5% of the total offspring and had defects in the heart, lacking

most of the Tg(kdrl:EGFP) atrial endocardium, and abnormalities

in the CCV (Fig. 3B; supplementary material Fig. S4B) and the

caudal vein (supplementary material Fig. S3B; supplementary

material Fig. S5B). Wild-type siblings represented 67.8% of the

total offspring (Fig. 3A; supplementary material Fig. S3A;

supplementary material Fig. S4A; supplementary material Fig.

S5A). These data suggested that more than one gene contribute to

the phenotypes of scote382 mutants. Indeed, sequencing analyses

revealed that group I mutants were all heterozygous for both

genes; group II mutants were all homozygous for both genes; and

wild-type siblings were 1) heterozygous for both genes, 2)

heterozygous for pku300, 3) heterozygous for fbn2b, or 4) wild-

type (supplementary material Table S2). Furthermore,

simultaneous knockdown of fbn2b and pku300 with low-dose

morpholinos led to higher percentages of morphants resembling

group II mutants (supplementary material Fig. S2D), while each

applied separately was less potent (supplementary material Fig.

S2B,C). These data strongly suggest a genetic interaction

between pku300 and fbn2b in regulating the development of

the atrial endocardium.

To further investigate the roles of pku300 and fbn2b in scote382

mutants, we applied loss-of-function and gain-of-function

analyses of the two genes in zebrafish embryos. First, we

attempted to isolate pku300+/2 and fbn2b+/2 zebrafish lines from

the scote382 mutant line by segregating the pku300 and fbn2b

mutant loci. We detected either pku300+/2 or fbn2b+/2 mutant

embryos from wild-type offspring of heterozygous scote382

crosses, suggesting that the two loci can be segregated

(supplementary material Table S2). By sequencing 64 adult

offspring of heterozygous scote382 mutant crosses, we only

isolated a pair of pku300+/2 adult zebrafish, named scopku300.

The pku300+/2 mutants lost most of the Tg(kdrl:EGFP) atrial

endocardium and common cardinal vein (Fig. 3E) but had mild

defects in the caudal vein (supplementary material Fig. S3E),

compared with their controls (Fig. 3D; supplementary material

Fig. S3D). We designed a morpholino targeting the ATG of

pku300 (MO1), and a morpholino targeting the first exon splicing

donor site of pku300 (MO2). Microinjections of either MO1 or

MO2 into embryos phenocopied the scote382 mutant phenotypes

in the heart (Fig. 3G). MO1 appeared to be more potent in

knocking down pku300 function. Therefore we used MO1 to

carry out the rest of the experiments, unless otherwise specified.

pku300MO knockdown led to very few Tg(kdrl:EGFP)

endocardial cells (Fig. 3G), little tie1 or fli1 expression (data

not shown) in the atrial endocardium, an abnormal CCV

(Fig. 3G), and mild defects in the caudal vein (supplementary

material Fig. S3G). Consistent with the previous report (Mellman

et al., 2012), we found that fbn2bMO morphants lost most of the

Tg(kdrl:EGFP) atrial endocardium but had no defect in the

Fig. 3. Mutations of both pku300 and fbn2b contributed to

scote382 mutant phenotypes. The endocardium in the atrium,

ventricle and CCV were labeled by the Tg(kdrl:EGFP) transgene.

The endocardium was projected by red pseudocolor with Imaris

software. (A–C) 2341 offspring from heterozygous scote382

mutant crosses produced 25.5% mutants that had defects in the

atrial endocardium and CCV (B), 6.7% mutants that had only

reduced atrial endocardium (C), and 67.8% siblings that were

phenotypically normal (A), suggesting more than one gene

mutated in the scote382 locus. Sequencing confirmed that the

mutants (group II) with defects in the heart (endocardium and

CCV) and tail (caudal vein) (supplementary material Fig. S3)

were fbn2b2/2 and pku3002/2 (B), and the mutants (group I)

with defects only in the heart (endocardium) were fbn2b+/2 and

pku300+/2 (C). (D–F) 297 offspring from heterozygous scopku300

mutant crosses produced 25.5% mutants with defects in the atrial

endocardium and CCV (E) and 74.6% normal siblings (D), which

was supported by morpholino knockdown of pku300 with 9.6 ng

pku300MO (F). (G–I) A fbn2bMO (1.6 ng) morphant showed

reduced atrial endocardium but had normal CCV (I), compared

with the control (H) and a pku300 morphant (G). a, atrium; v,

ventricle. Scale bars: 50 mm.

Journal of Cell Science 126 (6)1384

Journ

alof

Cell

Scie

nce

common cardinal vein (Fig. 3I) and defect in the caudal vein

(supplementary material Fig. S3I), compared with their controls

(Fig. 3H; supplementary material Fig. S3H). These data suggest

critical roles of pku300 in the development of the atrial

endocardium, the CCV, and the caudal vein, as well as fbn2b

in the development of the atrial endocardium and caudal vein.

We then asked whether overexpression of pku300 can rescue the

mutant phenotypes of scopku300 or scote382. Microinjection of pku300

mRNA rescued the Tg(kdrl:EGFP) atrial endocardium and common

cardinal vein of a pku3002/2 mutant (Fig. 4C), compared with an

uninjected mutant (Fig. 3E). Nine pku3002/2 mutants out of 182

offspring from heterozygous scopku300 crosses had little or no rescue

(Fig. 4B), showing that overexpression of pku300 mRNA had

rescued most of the pku3002/2 mutants. The genotypes of pku300

mutants and siblings were confirmed (data not shown). On the other

hand, we failed to rescue mutant phenotypes of scote382 byoverexpression of pku300 mRNA (data not shown). To explore

pku300 transgenic rescue, we generated Tg(kdrl:pku300) transgeniczebrafish where pku300 was overexpressed in the endocardium andendothelial cells. We found that the Tg(kdrl:pku300) transgenerescued endocardial Tg(kdrl:EGFP) expression in the atrium of 24

out of 89 (27%) Tg(kdrl:pku300);scote382/te382 mutant embryos(Fig. 4F,G), while there was no rescue in the scote382/te382 mutant(Fig. 4E). We also generated Tg(myl7:pku300) transgenic zebrafish

that overexpressed pku300 in the myocardium, but none of33 Tg(myl7:pku300);scote382/te382 mutant embryos showedTg(kdrl:EGFP) expression in the atrium. They did not show

additional defects (data not shown). The genotypes of scote382/te382

mutants and siblings as well as transgenic Tg(kdrl:pku300) andTg(myl7:pku300) were confirmed (data not shown). These resultsdemonstrate that pku300 is responsible for scote382 and plays a role in

the development of the endocardium, common cardinal vein andcaudal vein.

Proliferation of endocardial cells gradually declines duringheart looping and chamber formation in scote382 mutants

Previous studies reported that endocardial cells are specified in the

anterior lateral plate mesoderm in early somite embryos, thenmigrate and fuse in the midline ,18 hpf, and turn leftward at,20 hpf (Schoenebeck et al., 2007; Bussmann et al., 2007; Wonget al., 2012). We did not see any abnormality, including formation

and patterning of the endocardium within the heart tube in scote382

mutants at 24 hpf. Consistently, Tg (kdrl: EGFP) endocardial cellsmigrated properly to the heart tube in the midline and then turned

toward the left side in scote382 mutants (supplementary materialMovie 3), as in wild-type embryos (supplementary material Movie2). Live imaging suggested that increased Tg(kdrl:EGFP)

endocardial cells came from cell proliferation and migration alongthe looped heart tube. Those Tg(kdrl:EGFP) endocardial cellscoming from outside the heart tube mostly contributed to the sinus

venosus (supplementary material Movies 2, 4). We did not detectendocardial cell apoptosis in scote382 mutant and wild-type embryosby TUNEL assays (data not shown). These findings suggest that thereduced numbers of atrial endocardial cells were not due to defects in

endocardial cell migration or apoptosis in scote382 mutants. Thereforewe hypothesized that the reduced numbers of atrial endocardium of48 hpf mutant embryos result from defects of endocardial cell

proliferation. By using Tg(fli1a:nuEGFP)y7 transgenic labeling(Roman et al., 2002), we revealed that endocardial cells failed todivide in scote382 mutants from 29 to 36 hpf (supplementary material

Movie 5), compared with an average of 12 dividing endocardial cells(13.3% proliferation rate) in the heart tube of wild-type embryos(supplementary material Movie 4). A set of representative images,from one of the three experiments, showed that there was one

dividing cell between 29 hours 30 minutes (Fig. 5A) and 29 hours40 minutes (Fig. 5B), and three dividing cells between 29 hours40 minutes and 29 hours 50 minutes (Fig. 5C) in wild-type

embryos. In contrast, we did not see any dividing cells in scote382

mutants at the same time points (Fig. 5D–F). The ratio ofproliferating to total endocardial cells was much smaller in scote382

mutants than in wild-type siblings (Fig. 5G). Importantly, we foundthat the numbers of endocardial cells in the atrium and the wholeheart were reduced, while they were slightly increased in the

ventricle, in scote382 mutants compared with wild-type siblings at48 hpf (Fig. 5H–J). In contrast, the numbers of myocardial cells inthe ventricle and atrium were slightly increased in scote382 mutants

Fig. 4. Both pku300 mRNA and transgenic expression of pku300 in the

endocardium rescued the respective mutant phenotypes of scopku300 or

scote382. (A–C) The endocardium in the atrium, ventricle and CCV were labeled

by Tg(kdrl:eGFP). The endocardium was projected as red pseudocolor with

Imaris software. Compared with a wild-type sibling (A), pku300 mRNA rescued

the atrial endocardium and CCV of a scopku300 mutant embryo (C). Nine

homozygous scopku300 mutants out of 182 offspring from heterozygous scopku300

crosses showed little or no rescue in the atrial endocardium and CCV (B). Wild-

type sibling (A) and homozygous scopku300 mutants (B,C) were confirmed by

sequencing. Red arrowheads point to the endocardium. (D–G) The endocardium

was labeled by Tg(kdrl:eGFP) in the atrium and ventricle of wild-type embryos

(D). Note little endocardium in the atrium of scote382 mutant Tg(kdrl:eGFP)

embryos (E), which were partially rescued by overexpressing pku300 using

Tg(kdrl:pku300) transgene (F). (G) Higher magnification of the atrium of panel F

shows the rescued atrial endocardial cells (red arrowheads). The atrium and

ventricle are demarcated with white arrowheads (D–F). a, atrium; v, ventricle;

WT, wild type. Scale bars: 50 mm.

pku300 and fbn2b in heart development 1385

Journ

alof

Cell

Scie

nce

compared with wild-type siblings at 48 hpf (Fig. 5K–M). By using

BrdU labeling or immunostaining with anti-pH3 we also found that

endocardial cells gradually failed to enter mitotic phases in scote382

mutant hearts from 23 to 33 hpf (supplementary material Fig.

S6E,F). Representative images showed that there were more dividing

endocardial cells in wild-type (supplementary material Fig. S6A,C)

than in scote382 mutant (supplementary material Fig. S6B,D)

embryos at 25 hpf and 30 hpf. Interestingly, we did not find

defects in vascular endothelial cell proliferation in the trunk of

scote382 mutants (supplementary material Movie 7), compared with

wild-type embryos (supplementary material Movie 6) from 23 to

33 hpf. Together, these results suggest that pku300 and fbn2b are

required for endocardial cell proliferation during heart looping and

chamber formation.

Endocardial Notch signaling is defective in the AVC of

scote382 mutant

The presence of cardiac valve defects in scote382 mutants urged us

to address the underlying molecular mechanisms. A previous

report showed that Notch1b and bmp4 are restricted in the

respective endocardium or myocardium of the AVC during heart

valve development in zebrafish (Walsh and Stainier, 2001).

Endocardial notch 1b and its ligand dll4 were weakly expressed

in the ventricle at 48 hpf and gradually restricted within the AVC

from 48 to 72 hpf (Fig. 6A–C,M,N; data not shown), however

they were ectopically expressed in the ventricle of scote382 mutant

hearts (Fig. 6D–F,O,P). In contrast, myocardial bmp4 were

normally expressed in the inflow tract, AVC and outflow tract

in both wild-type (Fig. 6G–I) and scote382 (Fig. 6J–L) embryos

from 48 to 72 hpf. To assess whether the endocardial–

mesenchymal transition (EMT) is affected in scote382 mutants,

we examined the expression of secreted phosphoprotein 1 (spp1),

a previously known factor that is upregulated in the AVC

endocardial cushion in zebrafish (Just et al., 2011; Peal et al.,

2009). We found that spp1 was not expressed in the AVC (red

arrowhead) while was reduced in the outflow tract (black

arrowhead) of a scote382 mutant (Fig. 6R), compared with those

in a wild-type embryo (Fig. 6Q), suggesting that EMT was also

Fig. 5. Atrial Tg(fli1:nuEGFP) endocardial numbers were reduced while ventricular cardiomyocyte numbers were increased in scote382 mutant embryos.

(A–F) Endocardial nuclei were labeled by Tg(fli1:nuEGFP) in wild-type (wt) (A–C) and scote382 mutant (D–F) embryos at 29 hours 30 minutes, 29 hours

40 minutes and 29 hours 50 minutes post fertilization. A representative set of time-lapse images showed one divided cell from 29 hours 30 minutes to 29 hours

40 minutes (1 in B), and three divided cells from 29 hours 40 minutes to 29 hours 50 minutes (2, 3 and 4 in C) in wild-type Tg(fli1:nuEGFP) embryos. Note that

there were no divided cells from 29 hours 30 minutes to 29 hours 50 minutes in scote382 mutant embryos (D–F). (G) The endocardial proliferation rate

(proliferating endocardium from 29 to 36 hpf to the total endocardium at 29 hpf) in scote382 was very low, compared with their siblings. n53; mean 6 s.e.m.;

Student’s t-test. (H–J) The endocardium, labeled by Tg(fli1:nuEGFP), was divided into ventricular, AVC and atrial parts. Note fewer endocardial cells in the

mutant AVC and atrium (I–J). (K–M) Myocardial nuclei were labeled by Tg(myl7:nuDsRed). Note more cardiomyocytes in the mutant ventricle (L–M). (J,M)

n58–12; mean 6 s.e.m.; Student’s t-test. Scale bars: 30 mm (A–F); 50 mm (H–L).

Journal of Cell Science 126 (6)1386

Journ

alof

Cell

Scie

nce

affected in scote382 mutants. Together, these data support a notion

that the compromised expression of AVC endocardial and valve

genes led to abnormal development of the endocardial cushion

and cardiac valve in scote382 mutants.

We then asked whether endocardial notch signaling was

accordingly changed in the AVC of scote382 mutants. The Notch

reporter zebrafish line Tg(Tp1:mCherry) is generated in which

mCherry is placed downstream to 12 repeated RBP-Jk sites

(Parsons et al., 2009). To determine Notch signaling in scote382

mutant hearts, we crossed the Notch reporter transgene into

scote382 mutant zebrafish to make scote382/te382; Tg (kdrl:eGFP);

Tg (Tp1:mCherry) double transgenic mutant zebrafish. In wild

type Tg (kdrl: eGFP) transgenic embryos, we found endocardial

Notch signaling was initially activated in the endocardium of the

AVC and ventricle at 48 hpf (Fig. 7A), and gradually

concentrated in the AVC at 60 hpf and 72 hpf (Fig. 7C,E).

However, Notch signaling was not activated in the endocardium

of the AVC of scote382 mutant hearts (Fig. 7B,D,F) while was

ectopically activated in the ventricles of scote382 mutant hearts at

60 and 72 hpf (Fig. 7D,F), which is consistent with dll4 and

notch1b ectopic expression in mutant ventricles (Fig. 6D–F,O,P).

In particular, Tg(Tp1:mCherry) positive cells did not overlap

with the endocardial cells (Fig. 7D,F), suggesting that the Notch

signaling might be ectopically activated in the myocardium in

scote382 mutants. These data support the idea that pku300 and

fbn2b are required for the endocardial Notch signaling during

cardiac cushion and valve development in zebrafish.

Endocardial cell adhesion and tight junctions areectopically expressed during endocardial cushion

development in scote382 mutants

During the first three days of development, endocardial

invagination is formed as a temporary structure in the AVC to

secure directional blood flow in the heart, and EMT might take

place at larval stages after 6 dpf (Martin and Bartman, 2009;

Fig. 6. Cardiac valve genes were abnormally expressed in the AVC of scote382 mutant hearts. (A–R) Wild-type (A–C,G–I, M–N,Q) and scote382

(D–F,J–L,O–P,R) embryos were analyzed by in situ hybridization with cardiac valve markers notch1b (A–F), bmp4 (G–L), dll4 (M–P) and spp1 (Q–R) at 48 hpf

(A,D,G,J), 60 hpf (B,E,H,K,M,O), and 72 hpf (C,F,I,L,N,P–R). Note that endocardial notch1b and dll4 were ectopically expressed in the ventricle of scote382

mutants but myocardial bmp4 was not affected in scote382 mutants from 48 to 72 hpf. spp1, an endocardial–mesenchymal transition marker gene, was not

expressed in the AVC of scote382 mutants (red arrowhead in R). The atrium and ventricle are demarcated with red arrowheads. Black arrowheads (Q,R) point to the

outflow tract. a, atrium; v, ventricle; wt, wild type. Dotted lines outline the heart.

Fig. 7. Notch signaling was not activated in the AVC of scote382 mutant

hearts. (A–F) Tg(Tp1bglob:hmgb1-mCherry)jh11, called Tg(Tp1:mCherry),

transgenic zebrafish (Parsons et al., 2009) were bred with scote382/te382;

Tg(kdrl:eGFP) transgenic zebrafish to generate scote382/+; Tg(Tp1:mCherry)/+;

Tg(kdrl:eGFP)/+ zebrafish. Images were taken with agarose-embedded

embryos using Zeiss 700 upright confocal microscope. Endocardial cells

labeled by Tg(kdrl:eGFP) were used to project the heart shapes. Note that

Tg(Tp1:mCherry) were gradually restricted in the AVC of wild-type hearts at

48 hpf (A), 60 hpf (C) to 72 hpf (E), but were ectopically expressed in the

ventricle of scote382 mutant hearts at 48 hpf (B), 60 hpf (D) and 72 hpf (F). a,

atrium; v, ventricle. Red arrowheads point to the AVC.

pku300 and fbn2b in heart development 1387

Journ

alof

Cell

Scie

nce

Scherz et al., 2008). However, it is unclear how the endocardial

invagination is related to the cardiac valve during heart

development, and what are the underlying cellular and molecular

mechanisms engaging in cardiac valve development during the

first three days. EMT is normally involved in cell adhesion, cell

junctions and cell polarity (Combs and Yutzey, 2009a). From the

previous studies (Beis et al., 2005; Just et al., 2011; Peal et al.,

2009) and our data (Fig. 6Q), endocardial cushion and the EMT

might take place during the first three days of development

in zebrafish. We found endocardial cell adhesion gene cdh5

(VE-cadherin) was expressed in the whole heart at 48 hpf,

downregulated and restricted in the AVC of wild type hearts

from 60 to 72 hpf (Fig. 8A,C,E), while it remained ectopically

expressed in the endocardium of scote382 mutant ventricles from 48

to 72 hpf (Fig. 8B,D,F). To address morphological changes of cell

junctions, we assessed ZO1 expression during the first three days

of development by immunostaining. We found that ZO1 was

normally expressed around the AV endocardial cells at 48 hpf

(n513) and was gradually reduced at 60 hpf (n512) and 72 hpf

(n515); ZO1 was not expressed in the basal part of the

endocardium of wild type embryos at 60 hpf and was not

expressed in both basal and epical parts of the endocardium of

wild type embryos at 72 hpf (Fig. 8G,I,K). However, in scote382

mutant embryos at 48 hpf (n518), ZO1 was slightly upregulated;

at 60 hpf (n57) and 72 hpf (n511), ZO1 was abnormally

expressed around endocardial cells in the AV canal, and was

particularly upregulated in the basal side of endocardial cells in the

AVC (Fig. 8J,L). These data suggest that abnormal endocardial

cell adhesion and tight junction likely interfered endocardial EMT

or morphological changes that are required for heart valve

formation in scote382 mutant hearts.

DiscussionOur major findings in this work were (1) positional cloning of

scote382 as a novel gene, pku300, that encodes a putative

transmembrane protein, and mutations of both pku300 and

fbn2b contribute to the defects in the atrial endocardium and

caudal vein in scote382 mutants; (2) deciphering pku300 as a novel

player in endocardial cell proliferation; and 3) demonstrating the

critical roles of pku300 and fbn2b in regulating endocardial

Notch signaling, endocardial cell adhesion and tight junctions

during valve morphogenesis. Our data support the hypothesis that

endocardial cell proliferation is critical for correct lining of the

endocardium during heart tube expansion and chamber

formation. Also we demonstrated that dramatic morphological

changes and possible endocardial EMT in the AVC take place in

the first three days of heart development in zebrafish. Both

pku300 and fbn2b play essential roles in this important process in

the AV endocardial cells, partly by regulating the temporo-spatial

patterning of endocardial Notch signaling.

By positional cloning, we clearly demonstrated that scote382

encoded a novel putative transmembrane protein by revealing a

Fig. 8. Endocardial cell adhesion and tight junctions were ectopically expressed in the AVC of scote382 mutant hearts. (A–F) Endocardial cell adhesion gene cdh5/

ve-cadherin was analyzed by in situ hybridization in wild-type embryos at 48 hpf (A), 60 hpf (B) and 72 hpf (C); and scote382 mutant embryos at 48 hpf

(D), 60 hpf (E) and 72 hpf (F). Note gradual restriction of cdh5 in the AVC in wild-type embryos and ectopic expression of cdh5 in the ventricle of scote382 mutant

embryos. Red arrowheads point to the AVC. (G–L) Wild-type and scote382 mutant Tg(kdrl:EGFP) transgenic embryos on vibratome sections were subjected to

immunostaining with anti-ZO1 antibody. Note that ZO1 was expressed in the AVC of wild-type hearts at 48 hpf (G) and downregulated at 60 (I) and 72 hpf

(K), but remained in the AVC of scote382 mutant hearts at 48 (H), 60 (J) and 72 hpf (L). a, atrium; v, ventricle; arrowhead points to the AVC. Dotted lines outline the heart.

Journal of Cell Science 126 (6)1388

Journ

alof

Cell

Scie

nce

nonsense mutation in scote382 mutants, phenocopying scote382

mutant phenotypes by antisense pku300 morpholino knockdown,

rescuing scote382 mutant phenotypes by overexpressing the wild-type pku300 gene in the endothelium and endocardium, anddetermining pku300 mRNA expression in the endocardium. Asreported recently (Mellman et al., 2012), we also found the

G3935T missense mutation of fbn2b in our scote382 mutant.Mutational analyses of fbn2b and pku300 allowed us to furtherclassify two groups of mutants in scote382, where group I mutants

were heterozygous for both genes and group II mutants werehomozygous for both genes (supplementary material Table S2;Fig. 3A–C). But only ,13% of embryos that were heterozygous

for both genes showed group I mutant phenotypes. Together withthe work by Mellman et al., our data support the conclusion thatsimultaneous mutations of both fbn2b and pku300, which were,570 kb apart in Chromosome 22, contributed to the defects in

scote382 mutants. This very rare event, presumably induced byENU, provides an important lesson that the possibility of morethan one causative gene mutation should be explored if the

mutant phenotypes from a particular locus are not identical.Furthermore, the genetic interaction between fbn2b and pku300

will guide future studies on how the two proteins interact in

regulating endocardial cell proliferation.

The Pku300 protein was predicted to contain threeextracellular IgG domains, a single transmembrane domain, anda short intracellular tail without any conserved kinase motifs

according to InterProScan (http://www.ebi.ac.uk/interpro/scan.html), which is similar to a large class of cell adhesion moleculesand receptors, including CD44, one of the hyaluronan receptors

(Bechara et al., 2007). Blast searching with human CD44 proteinas bait did not identify any potential homologs in the zebrafishgenome. IgG-domain-containing proteins are generally sequence

diversified. Our current hypothesis is that Pku300 functions as ahyaluronic acid (HA) receptor that participates in cardiac jellyformation and then modulates Notch, Fbn2b and other signaling

pathways during heart valve development. However, true Pku300protein homologs in other vertebrates remain to be identified.

Cardiac jelly is the extracellular matrix between endocardiumand myocardium, and its major components are

glycosaminoglycans (GAGs) and proteoglycans. GAGs arelong-chain sulfated sugar polymers of three subtypes:chondroitin sulfate (CS), heparan sulfate (HS) and HA. The

generation and breakdown of cardiac jelly are preciselycontrolled, as they are essential for proper heart development.Mice lacking hyaluronan synthase-2, the enzyme required for the

production of mucopolysaccharide hyaluronan, do not developtrabeculae and have significantly reduced cardiac jelly(Camenisch et al., 2000; Mjaatvedt et al., 1998). This is mainlydue to the failure of the cardiac endothelium to undergo EMT

with inactivation of ERBB2/ERBB3 and RAS signaling(Camenisch et al., 2002). Hyaluronan binds to either two majorreceptors (CD44 and RHAMM) or other receptors at the cell

surface (Toole, 2004). In zebrafish, ENU-induced mutagenesisscreens have led to the identification of many valve mutants, ofwhich two are known to have cardiac jelly defects: scotch tape

and jekyll (Chen et al., 1996; Walsh and Stainier, 2001). Jekyll isa null mutation of UDP-glucose dehydrogenase, which isrequired for the synthesis of HS, CS, and HA (Walsh and

Stainier, 2001). Jekyll mutants indeed show abnormal expressionof several valve markers at 48 hpf, suggesting that cardiac jelly isinvolved in heart valve development at very early embryonic

stages. As reported previously (Chen et al., 1996), we foundcardiac jelly was reduced in scote382 mutant hearts, however, CS,

a component of cardiac jelly, was normally expressed in thesemutants (data not shown). The other two components, HS andHA, need to be examined in scote382 mutant hearts when the

required assay reagents become available. Identifying the roles ofthe pku300 and fbn2b genes here will allow further study of themolecular basis of cardiac jelly defects and their relationship toheart valve development.

Our data suggest that both pku300 and fbn2b are required forendocardial cell proliferation but are dispensable for vascular

endothelial cell proliferation in the trunk. To our knowledge, thisis one of the very few reports on identifying regulators inendocardial cell proliferation. Previous studies have shown thatmyocardial Nfat2/3/4 represses Vegf expression in the AVC that

allows local EMT, and that later endocardial Calcineurin-Nfatc1promotes valve elongation and remodeling in mice (Chang et al.,2004). Early studies suggested that VEGF-Nfatc1 is essential for

endocardial cell proliferation (Lee et al., 2006; Combs andYutzey, 2009b). On the other hand, others reported that VEGF isdispensable for endocardial cell proliferation, cell death and

Nfatc1 nuclear localization in the endocardial cells of elongatingmitral valves (Stankunas et al., 2010). Therefore, the underlyingsignaling pathways that regulate endocardial cell proliferationremain largely unknown. Identifying pku300 and fbn2b as

essential genes for endocardial cell proliferation will likely helpto further delineate related molecular mechanisms in the future.

As in jekyll mutants, cardiac valve genes were abnormallyexpressed in the AVC of scote382 mutants. Previously, Hey1 andHey2 were shown to suppress Bmp2/4 and then Tbx2 expressionin the heart chambers, so Bmp2/4 and Tbx2 are restricted to the

myocardium of the AVC where Hey1 and Hey2 are not expressed(Fischer et al., 2007; Kokubo et al., 2007; Rutenberg et al., 2006).On the other hand, it remains unknown how endocardial notch1 is

regulated in the AVC. Here, we found that endocardial Notchsignaling was not activated and dll4/notch1b were not properlyexpressed in the AVC of scote382 mutant hearts, suggesting that

pku300 and fbn2b modulate Notch signaling during endocardialcell proliferation and valve development. Ectopic Notch activity,particularly in the ventricle of scote382, might promote ventricular

myocyte proliferation, which is consistent with the finding ofmore myocytes in the mutant ventricle (Fig. 5K–M) and Notchactivation of cell cycle entry and proliferation in mammaliancardiac myocytes (Campa et al., 2008). Previous studies suggest

that the TGFb/BMP and Notch signaling pathways are essentialfor endocardial EMT and valve development (Combs andYutzey, 2009a; MacGrogan et al., 2010; Rivera-Feliciano and

Tabin, 2006; Timmerman et al., 2004). In addition,overexpression of a constitutively active Notch intracellulardomain in zebrafish embryos increases endocardial cell

proliferation (Timmerman et al., 2004). The lack of endocardialNotch signaling and the endocardial EMT marker spp1 in theAVC substantiates the roles of fbn2b and pku300 function in

valve development. Therefore, our work provides anotherimportant entry point to determine endocardial signaling incardiac valve morphogenesis.

Materials and MethodsZebrafish strains

scote382 is a cardiac valve mutant isolated from an ENU-induced mutagenesisscreen in Tubingen (Chen et al., 1996). We acquired this mutant fish from MarkFishman’s laboratory at Massachusetts General Hospital, Boston. Both

pku300 and fbn2b in heart development 1389

Journ

alof

Cell

Scie

nce

heterozygous and homozygous scote382 fish were maintained. Transgenic lineTg(kdrl:EGFP) that EGFP was driven by the zebrafish kdrl promoter (Choi et al.,2007; Cross et al., 2003) was crossed with heterozygous scote382/+ fish. Individualfish of Tg(kdrl:EGFP)/+, scote382/+ and Tg(kdrl:EGFP);scote382/+ were identified.Heterozygous scopku300/+ was derived from offspring of heterozygous scote382/+

crosses. Tg(myl7:EGFP) and Tg(myl7:nuDsRed) lines were from Geoffrey Burnsat Massachusetts General Hospital (Burns et al., 2005). Tg(fli1:nuEGFP) wasprovided by Feng Liu at Institute of Zoology, Chinese Academy of Sciences(Roman et al., 2002). The Notch reporter transgenic line Tg(Tp1:mCherry) wasobtained from Dr Michael Parsons, Johns Hopkins University (Parsons et al.,2009). Tg(kdrl:pku300-mCherry), Tg(kdrl:pku300) and Tg(myl7:pku300)transgenic zebrafish lines were generated by using Tol2-based transgenesis asdescribed (Kawakami et al., 2004). Individual fish of Tg(kdrl:pku300)/+;scote382/te382

and Tg(myl7:pku300);scote382/+ were isolated from crosses between scote382/te382 andtransgenic zebrafish. Zebrafish were raised and handled in accordance with the PekingUniversity and Massachusetts General Hospital institutional guidelines.

Positional cloning of pku300 gene

About 25% siblings from heterozygous scote382 mapping zebrafish were mutantswith defects in both the heart and caudal vein, which were sorted for generatingour mapping DNA panels. The scote382 locus was mapped between themicrosatellite markers Z10673 and Z33723 on chromosome 22 using bulksegregation analysis. Using sequence length polymorphism (SLP) and singlenucleotide polymorphism (SNP) markers (supplementary material Table S1), wenarrowed down the scotch tape genetic interval into about 0.18 cM betweenmarkers 6 and 9. SLP markers were assayed by agarose gel electrophoresis of PCRproducts. SNP markers were analyzed by sequencing PCR products. Marker 6 wasin the 4th intron of pku300. The scote382 genetic interval was covered andsequenced in the assembled zebrafish genome sequence by the Sanger Institute,UK, where four genes were determined, including calr, trh1, pku300 and cherpgenes. fbn2b was ,570 kb away from pku300.

Morpholinos and capped mRNA Injections

Two antisense morpholinos were synthesized to target the zebrafish pku300 ATGsite (pku300MO1): AAATCATACCTCAGCGAAGCTCACA; the first splicingdonor site (pku300MO2): GTGTTGTAGCACCTGTAATTTTCA; fbn2b start sitetargeted morpholino (fbn2bMO): GCGACTCCTGAAGCGCCGGTAAATG(Mellman et al., 2012); and a control morpholino (CtrMO): GCAGC-GGGCACTGCTGGTGGAAGT (Gene Tools, LLC). The full length of wild typeand mutant pku300 cDNAs were cloned into T7TS vector and linearized, and cappedmRNA was synthesized using Ambion mMESSAGE mMACHINE mRNAtranscription synthesis kits. Morpholinos or mRNA were injected into 1- or 2-cell-stage wild-type or scote382 or scopku300 mutant embryos. Injected embryos wereincubated at 28.5 C for examination of phenotypes or were fixed for in situhybridization and immunostaining as described (Xiong et al., 2008). Photographswere taken using a Leica MZ16 fluorescence microscope.

RNA in situ hybridization and histology

In situ hybridization was done using antisense myl7, tbx5, nkx2.5, ve-cadherin, fli1,tie1, notch 1b, dll4, versican, bmp4, spp1, pku300 and tbx2b RNA probes.Histology was done by JB4 section according to a protocol by the manufacturer(Polysciences, Inc., Warrington, PA, USA).

Reverse transcription PCR

Wild type TL, scote382 and clochem39 mutant embryos were collected. Hearts fromTg(myl7:eGFP) embryos at 48 hpf were isolated under the florescencemicroscope. Total RNA was isolated from embryos and hearts using Trizolreagents (Invitrogen). First-strand cDNA was synthesized using the Superscript IIRT system (Invitrogen), followed by a standard PCR.

Endocardial cell labeling using Tg(fli1:nuEGFP) transgenic embryos

For endocardial cell labeling, one-cell Tg(fli1:nuEGFP) or Tg(kdrl:EGFP)transgenic embryos were microinjected with 0.96 ng of tnnt2aMO to stop heartbeating. For live imaging, embryos were embedded in 1.5% low-melting-temperature agarose with 0.16 mg/ml tricaine (Sigma) in E3 water. When theagarose cooled completely, extra agarose were removed leaving the embryo headfacing E3 water with tricaine. The embryos were imaged with Zeiss 700 confocalmicroscope, following up to 10 hours at 5–6 minutes time intervals using a 206water immersion objective. Z-stack movies were assembled in 3D time lapse usingImaris7.0 (Bitplane).

Cell proliferation assay

BrdU labeling for DNA synthesis and phosphorylation of histone 3 for cell cycleswere carried out to determine endocardial cell proliferation. For BrdU pulsechasing, scote382 mutants and siblings were incubated with 10 mM BrdU for10 hours, and then subjected to immunostaining with anti-BrdU (1:500, Sigma) asdescribed (Laguerre et al., 2005). For detecting phosphorylation of histone 3,

staged scote382 mutants and siblings were fixed and subjected to immunostainingwith anti-pH3 (1:500, Millipore).

Immunostaining of zebrafish heart

For anti-ZO1 antibody staining, all embryos were put into 0.12% tricaine (Sigma,St. Louis, USA) to stop and relax the heart before fixation. Embryos were fixed in4% paraformaldehyde (PFA) at room temperature for 2 hours, embedded in 3%low melting agarose gel and sectioned into 100 mm slices with a vibratome (LeicaVT 1,000s, Bannockburn, USA). Embryos were blocked with a blocking solution[10% normal goat serum (NGS) plus 2% blocking reagent (BR) (RocheDiagnostics, Indianapolis, USA) in maleic acid buffer (MAB) (150 mM maleicacid, 100 mM NaCl, pH 7.5)]. Immunostaining with anti-ZO1 (Invitrogen,Eugene, USA) (1:100) antibody was performed in an incubation solution (2%NGS plus 2% BR in MAB) at 4 C overnight. Goat anti-rabbit IgG(H+L) (VectorLaboratories, Burlingame, USA) (1:2000) was used as secondary antibody. Imageswere taken under the confocal microscope (Zeiss LSM 5 Pascal or Zeiss LSM510).

AcknowledgementsWe acknowledge Dr Jinrong Peng and members of Dr Xiong’slaboratory for comments on this manuscript and Dr Iain Bruce for theEnglish editing.

Author contributionsX.W. and Q.Y. equally designed and carried out the experiments anddata interpretation and manuscript writing; Q.W., Y.B., N.-N.C.,S.Y., X.-H.Z. and X.Z. designed and carried out some experiments;J.-W.X. conceived, designed and wrote up this work.

FundingThis research was funded by the National Key Basic ResearchProgram of China [grant numbers 2010CB529503 and2012CB944501]; the National Natural Science Foundation ofChina [grant numbers 30971662 and 31271549]; a NationalInstitutes of Health (NIH) training grant [grant number T32-DK07540-22]; the March of Dimes Birth Defects Foundation[grant number 1-FY2007-471]; and the Milton Fund from HarvardUniversity. Deposited in PMC for release after 12 months.

Supplementary material available online at

http://jcs.biologists.org/lookup/suppl/doi:10.1242/jcs.116996/-/DC1

ReferencesArmstrong, E. J. and Bischoff, J. (2004). Heart valve development: endothelial cell

signaling and differentiation. Circ. Res. 95, 459-470.

Bechara, A., Falk, J., Moret, F. and Castellani, V. (2007). Modulation of semaphorin

signaling by Ig superfamily cell adhesion molecules. Adv. Exp. Med. Biol. 600, 61-72.

Beis, D., Bartman, T., Jin, S.-W., Scott, I. C., D’Amico, L. A., Ober, E. A., Verkade,

H., Frantsve, J., Field, H. A., Wehman, A. et al. (2005). Genetic and cellular

analyses of zebrafish atrioventricular cushion and valve development. Development

132, 4193-4204.

Burns, C. G., Milan, D. J., Grande, E. J., Rottbauer, W., MacRae, C. A. and

Fishman, M. C. (2005). High-throughput assay for small molecules that modulate

zebrafish embryonic heart rate. Nat. Chem. Biol. 1, 263-264.

Bussmann, J., Bakkers, J. and Schulte-Merker, S. (2007). Early endocardial

morphogenesis requires Scl/Tal1. PLoS Genet. 3, e140.

Camenisch, T. D., Spicer, A. P., Brehm-Gibson, T., Biesterfeldt, J., Augustine,

M. L., Calabro, A. J., Jr, Kubalak, S., Klewer, S. E. and McDonald, J. A. (2000).

Disruption of hyaluronan synthase-2 abrogates normal cardiac morphogenesis and

hyaluronan-mediated transformation of epithelium to mesenchyme. J. Clin. Invest.

106, 349-360.

Camenisch, T. D., Schroeder, J. A., Bradley, J., Klewer, S. E. and McDonald, J. A.

(2002). Heart-valve mesenchyme formation is dependent on hyaluronan-augmented

activation of ErbB2-ErbB3 receptors. Nat. Med. 8, 850-855.

Campa, V. M., Gutierrez-Lanza, R., Cerignoli, F., Dıaz-Trelles, R., Nelson, B.,

Tsuji, T., Barcova, M., Jiang, W. and Mercola, M. (2008). Notch activates cell

cycle reentry and progression in quiescent cardiomyocytes. J. Cell Biol. 183, 129-141.

Chang, C. P., Neilson, J. R., Bayle, J. H., Gestwicki, J. E., Kuo, A., Stankunas, K.,

Graef, I. A. and Crabtree, G. R. (2004). A field of myocardial-endocardial NFAT

signaling underlies heart valve morphogenesis. Cell 118, 649-663.

Chen, J.-N., Haffter, P., Odenthal, J., Vogelsang, E., Brand, M., van Eeden, F. J. M.,

Furutani-Seiki, M., Granato, M., Hammerschmidt, M., Heisenberg, C.-P. et al.

(1996). Mutations affecting the cardiovascular system and other internal organs in

zebrafish. Development 123, 293-302.

Journal of Cell Science 126 (6)1390

Journ

alof

Cell

Scie

nce

Chi, N. C., Shaw, R. M., De Val, S., Kang, G., Jan, L. Y., Black, B. L. and Stainier,D. Y. (2008). Foxn4 directly regulates tbx2b expression and atrioventricular canalformation. Genes Dev. 22, 734-739.

Choi, J., Dong, L., Ahn, J., Dao, D., Hammerschmidt, M. and Chen, J. N. (2007).FoxH1 negatively modulates flk1 gene expression and vascular formation inzebrafish. Dev. Biol. 304, 735-744.

Combs, M. D. and Yutzey, K. E. (2009a). Heart valve development: regulatorynetworks in development and disease. Circ. Res. 105, 408-421.

Combs, M. D. and Yutzey, K. E. (2009b). VEGF and RANKL regulation of NFATc1 inheart valve development. Circ. Res. 105, 565-574.

Cross, L. M., Cook, M. A., Lin, S., Chen, J. N. and Rubinstein, A. L. (2003). Rapidanalysis of angiogenesis drugs in a live fluorescent zebrafish assay. Arterioscler.

Thromb. Vasc. Biol. 23, 911-912.de la Pompa, J. L., Timmerman, L. A., Takimoto, H., Yoshida, H., Elia, A. J.,

Samper, E., Potter, J., Wakeham, A., Marengere, L., Langille, B. L. et al. (1998).Role of the NF-ATc transcription factor in morphogenesis of cardiac valves andseptum. Nature 392, 182-186.

Del Monte, G., Grego-Bessa, J., Gonzalez-Rajal, A., Bolos, V. and De La Pompa,J. L. (2007). Monitoring Notch1 activity in development: evidence for a feedbackregulatory loop. Dev. Dyn. 236, 2594-2614.

Fischer, A., Steidl, C., Wagner, T. U., Lang, E., Jakob, P. M., Friedl, P., Knobeloch,

K. P. and Gessler, M. (2007). Combined loss of Hey1 and HeyL causes congenitalheart defects because of impaired epithelial to mesenchymal transition. Circ. Res.

100, 856-863.Fishman, M. C. and Chien, K. R. (1997). Fashioning the vertebrate heart: earliest

embryonic decisions. Development 124, 2099-2117.Gitler, A. D., Lu, M. M., Jiang, Y. Q., Epstein, J. A. and Gruber, P. J. (2003).

Molecular markers of cardiac endocardial cushion development. Dev. Dyn. 228, 643-650.

Graef, I. A., Chen, F., Chen, L., Kuo, A. and Crabtree, G. R. (2001). Signalstransduced by Ca(2+)/calcineurin and NFATc3/c4 pattern the developing vasculature.Cell 105, 863-875.

Hinton, R. B. and Yutzey, K. E. (2011). Heart valve structure and function indevelopment and disease. Annu. Rev. Physiol. 73, 29-46.

Hu, N., Sedmera, D., Yost, H. J. and Clark, E. B. (2000). Structure and function of thedeveloping zebrafish heart. Anat. Rec. 260, 148-157.

Isogai, S., Horiguchi, M. and Weinstein, B. M. (2001). The vascular anatomy of thedeveloping zebrafish: an atlas of embryonic and early larval development. Dev. Biol.

230, 278-301.Johnson, E. N., Lee, Y. M., Sander, T. L., Rabkin, E., Schoen, F. J., Kaushal, S. and

Bischoff, J. (2003). NFATc1 mediates vascular endothelial growth factor-inducedproliferation of human pulmonary valve endothelial cells. J. Biol. Chem. 278, 1686-1692.

Just, S., Berger, I. M., Meder, B., Backs, J., Keller, A., Marquart, S., Frese, K.,Patzel, E., Rauch, G. J., Katus, H. A. et al.; Tubingen 2000 Screen Consortium(2011). Protein kinase D2 controls cardiac valve formation in zebrafish by regulatinghistone deacetylase 5 activity. Circulation 124, 324-334.

Kawakami, K., Takeda, H., Kawakami, N., Kobayashi, M., Matsuda, N. and

Mishina, M. (2004). A transposon-mediated gene trap approach identifiesdevelopmentally regulated genes in zebrafish. Dev. Cell 7, 133-144.

Keegan, B. R., Meyer, D. and Yelon, D. (2004). Organization of cardiac chamberprogenitors in the zebrafish blastula. Development 131, 3081-3091.

Kokubo, H., Tomita-Miyagawa, S., Hamada, Y. and Saga, Y. (2007). Hesr1 andHesr2 regulate atrioventricular boundary formation in the developing heart throughthe repression of Tbx2. Development 134, 747-755.

Laguerre, L., Soubiran, F., Ghysen, A., Konig, N. and Dambly-Chaudiere,C. (2005). Cell proliferation in the developing lateral line system of zebrafishembryos. Dev. Dyn. 233, 466-472.

Lee, R. K., Stainier, D. Y. R., Weinstein, B. M. and Fishman, M. C. (1994).Cardiovascular development in the zebrafish. II. Endocardial progenitors aresequestered within the heart field. Development 120, 3361-3366.

Lee, Y. M., Cope, J. J., Ackermann, G. E., Goishi, K., Armstrong, E. J., Paw, B. H.

and Bischoff, J. (2006). Vascular endothelial growth factor receptor signaling isrequired for cardiac valve formation in zebrafish. Dev. Dyn. 235, 29-37.

MacGrogan, D., Nus, M. and de la Pompa, J. L. (2010). Notch signaling in cardiacdevelopment and disease. Curr. Top. Dev. Biol. 92, 333-365.

Markwald, R. R., Fitzharris, T. P. and Smith, W. N. (1975). Sturctural analysis ofendocardial cytodifferentiation. Dev. Biol. 42, 160-180.

Martin, R. T. and Bartman, T. (2009). Analysis of heart valve development in larvalzebrafish. Dev. Dyn. 238, 1796-1802.

Mellman, K., Huisken, J., Dinsmore, C., Hoppe, C. and Stainier, D. Y. (2012).Fibrillin-2b regulates endocardial morphogenesis in zebrafish. Dev. Biol. 372, 111-119.

Mjaatvedt, C. H., Yamamura, H., Capehart, A. A., Turner, D. and Markwald, R. R.(1998). The Cspg2 gene, disrupted in the hdf mutant, is required for right cardiacchamber and endocardial cushion formation. Dev. Biol. 202, 56-66.

Palencia-Desai, S., Kohli, V., Kang, J., Chi, N. C., Black, B. L. and Sumanas,S. (2011). Vascular endothelial and endocardial progenitors differentiate ascardiomyocytes in the absence of Etsrp/Etv2 function. Development 138, 4721-4732.

Parsons, M. J., Pisharath, H., Yusuff, S., Moore, J. C., Siekmann, A. F., Lawson,N. and Leach, S. D. (2009). Notch-responsive cells initiate the secondary transition inlarval zebrafish pancreas. Mech. Dev. 126, 898-912.

Peal, D. S., Burns, C. G., Macrae, C. A. and Milan, D. J. (2009). Chondroitin sulfateexpression is required for cardiac atrioventricular canal formation. Dev. Dyn. 238,3103-3110.

Person, A. D., Klewer, S. E. and Runyan, R. B. (2005). Cell biology of cardiac cushiondevelopment. Int. Rev. Cytol. 243, 287-335.

Puri, M. C., Partanen, J., Rossant, J. and Bernstein, A. (1999). Interaction of the TEKand TIE receptor tyrosine kinases during cardiovascular development. Development

126, 4569-4580.

Ranger, A. M., Grusby, M. J., Hodge, M. R., Gravallese, E. M., de la Brousse, F. C.,

Hoey, T., Mickanin, C., Baldwin, H. S. and Glimcher, L. H. (1998). Thetranscription factor NF-ATc is essential for cardiac valve formation. Nature 392, 186-190.

Rivera-Feliciano, J. and Tabin, C. J. (2006). Bmp2 instructs cardiac progenitors toform the heart-valve-inducing field. Dev. Biol. 295, 580-588.

Roman, B. L., Pham, V. N., Lawson, N. D., Kulik, M., Childs, S., Lekven, A. C.,

Garrity, D. M., Moon, R. T., Fishman, M. C., Lechleider, R. J. et al. (2002).Disruption of acvrl1 increases endothelial cell number in zebrafish cranial vessels.Development 129, 3009-3019.

Rutenberg, J. B., Fischer, A., Jia, H., Gessler, M., Zhong, T. P. and Mercola,M. (2006). Developmental patterning of the cardiac atrioventricular canal by Notchand Hairy-related transcription factors. Development 133, 4381-4390.

Scherz, P. J., Huisken, J., Sahai-Hernandez, P. and Stainier, D. Y. (2008). High-speed imaging of developing heart valves reveals interplay of morphogenesis andfunction. Development 135, 1179-1187.

Schoenebeck, J. J., Keegan, B. R. and Yelon, D. (2007). Vessel and bloodspecification override cardiac potential in anterior mesoderm. Dev. Cell 13, 254-267.

Smith, K. A., Lagendijk, A. K., Courtney, A. D., Chen, H., Paterson, S., Hogan,

B. M., Wicking, C. and Bakkers, J. (2011). Transmembrane protein 2 (Tmem2) isrequired to regionally restrict atrioventricular canal boundary and endocardial cushiondevelopment. Development 138, 4193-4198.

Stainier, D. Y. R., Lee, R. K. and Fishman, M. C. (1993). Cardiovascular developmentin the zebrafish. I. Myocardial fate map and heart tube formation. Development 119,31-40.

Stainier, D. Y. R., Weinstein, B. M., Detrich, H. W. I., 3rd, Zon, L. I. and Fishman,M. C. (1995). Cloche, an early acting zebrafish gene, is required by both theendothelial and hematopoietic lineages. Development 121, 3141-3150.

Stankunas, K., Ma, G. K., Kuhnert, F. J., Kuo, C. J. and Chang, C. P. (2010). VEGFsignaling has distinct spatiotemporal roles during heart valve development. Dev. Biol.

347, 325-336.

Timmerman, L. A., Grego-Bessa, J., Raya, A., Bertran, E., Perez-Pomares, J. M.,Dıez, J., Aranda, S., Palomo, S., McCormick, F., Izpisua-Belmonte, J. C. et al.

(2004). Notch promotes epithelial-mesenchymal transition during cardiac develop-ment and oncogenic transformation. Genes Dev. 18, 99-115.

Toole, B. P. (2004). Hyaluronan: from extracellular glue to pericellular cue. Nat. Rev.

Cancer 4, 528-539.

Totong, R., Schell, T., Lescroart, F., Ryckebusch, L., Lin, Y. F., Zygmunt, T.,Herwig, L., Krudewig, A., Gershoony, D., Belting, H. G. et al. (2011). The noveltransmembrane protein Tmem2 is essential for coordination of myocardial andendocardial morphogenesis. Development 138, 4199-4205.

Walsh, E. C. and Stainier, D. Y. (2001). UDP-glucose dehydrogenase required forcardiac valve formation in zebrafish. Science 293, 1670-1673.

Wong, K. S., Rehn, K., Palencia-Desai, S., Kohli, V., Hunter, W., Uhl, J. D., Rost,M. S. and Sumanas, S. (2012). Hedgehog signaling is required for differentiation ofendocardial progenitors in zebrafish. Dev. Biol. 361, 377-391.

Xiong, J.-W., Yu, Q., Zhang, J. and Mably, J. D. (2008). An acyltransferase controlsthe generation of hematopoietic and endothelial lineages in zebrafish. Circ. Res. 102,1057-1064.

pku300 and fbn2b in heart development 1391