REQUIREMENT(S) FOR THE REPLICATION OF LUCERNE …...Requirement(s) for the Replication of Lucerne...
130
REQUIREMENT(S) FOR THE REPLICATION OF LUCERNE TRANSIENT STREAK VIRUS SATELLITE RNA By Tetyana Rogalska A thesis submitted in conformity with the requirements for the Degree of Master of Science Graduate Department of Cell and Systems Biology University of Toronto © Copyright by Tetyana Rogalska 2012
Transcript of REQUIREMENT(S) FOR THE REPLICATION OF LUCERNE …...Requirement(s) for the Replication of Lucerne...
REQUIREMENT(S) FOR THE REPLICATION OF LUCERNE TRANSIENT STREAK VIRUS
SATELLITE RNA
By
Tetyana Rogalska
A thesis submitted in conformity with the requirements for the Degree of Master of Science
Graduate Department of Cell and Systems Biology University of Toronto
© Copyright by Tetyana Rogalska 2012
ii
Requirement(s) for the Replication of Lucerne Transient Streak Virus Satellite
RNA
Tetyana Rogalska
Degree of Master of Science
Department of Cell and Systems Biology
University of Toronto
2012
The satellite RNA of Lucerne Transient Streak Virus (LTSV) is a 322-nucleotide,
single-stranded circular RNA that has a rod-like structure very similar to that of viroids.
As it does not encode any translation products and cannot replicate independently of a
helper virus, the satellite RNA is proposed to rely on viral-encoded proteins for the
replication and/or cell-to-cell movement that facilitate its systemic infection in a host. To
investigate the requirements for replication of the LTSV satellite RNA, transgenic plant
systems were generated to express the viral RNA-dependent RNA polymerase and
predicted viral transport protein independently as well as in combination. Results of
infectivity assays of these transgenic lines demonstrated for the first time that the viral-
encoded RNA-dependent RNA polymerase is necessary and sufficient for the replication
of LTSV satellite RNA, and that no additional viral proteins are required for its cell-to-
cell or systemic transport.
iii
Acknowledgements
I would like to sincerely thank Dr. Mounir AbouHaidar for all of his expertise,
guidance, and support throughout this project. Thank you for the valuable opportunity to
conduct research in your laboratory and learn from the best.
Many thanks go to Dr. Peter McCourt and Dr. Eiji Nambara who have supported
me as members of my supervisory committee. Thank you also to Dr. Kathleen Hefferon
for the opportunity to collaborate in publication.
I am very grateful to Tauqeer Ahmad, a wonderful colleague, for all of his helpful
advice and unreserved assistance. I have learned a great deal from you and I wish you the
very best of luck in all of your current and future endeavors.
Finally, I am especially thankful to my family, for all of their love, support, and
confidence. To them, I owe all of my accomplishments.
iv
Table of Contents
ABSTRACT………………………………………………………………………………ii
ACKNOWLEDGEMENTS……………………………………………………………....iv
TABLE OF CONTENTS……………………………………………………………….....v
LIST OF FIGURES……………………………………………………………………….x
LIST OF TABLES.............................................................................................................xii
LIST OF ABBREVIATIONS..........................................................................................xiii
1 LITERATURE REVIEW................................................................................................1
1. 1 Overview..........................................................................................................1
1. 2 Sobemoviruses.................................................................................................2
1. 2. 1 General Features...............................................................................2
1. 2. 2 Genome Organization and Translation of Gene Products...............4
1. 2. 3 Properties of Virus Coat Protein and Assembly of
Viral Particles..................................................................................8
1. 2. 4 Cell-to-Cell Movement..................................................................11
1. 3 Lucerne Transient Streak Virus..................................................................12
1. 3. 1 Biological and Pathological Properties..........................................12
1. 4 Satellite RNA of Lucerne Transient Streak Virus.....................................15
1. 4. 1 Biological and Physiological Properties........................................15
1. 4. 2 Host and Helper Specificity...........................................................15
1. 4. 3 Mechanisms of Replication...........................................................16
v
1. 4. 4 Sequence and Structure..................................................................18
1. 5 Viroids............................................................................................................21
1. 5. 1 Genomic Organization...................................................................21
1. 5. 2 Ribozyme Activity.........................................................................24
1. 5. 3 Cell-to-Cell and Long Distance Movement...................................27
2 INTRODUCTION.........................................................................................................28
2. 1 Requirement(s) for Replication of Lucerne Transient Streak
Virus Satellite RNA..................................................................................28
2. 1. 1 Research Question.........................................................................28
2. 2 Independent Packaging Ability of LTSV satRNA and Importance
of Sense Directionality.............................................................................30
2. 2. 1 Research Question.........................................................................30
3 MATERIALS AND METHODS...................................................................................32
3. 1 Molecular Techniques..................................................................................32
3. 1. 1 Plasmid DNA Isolation from E. coli..............................................32
3. 1. 2 Gel Electrophoresis........................................................................33
3. 1. 3 Heat Shock Transformation of E. coli...........................................34
3. 1. 4 Preparation of Competent Cells and Transformation of
A. tumefaciens................................................................................35
3. 1. 5 Glycerol Stocks..............................................................................36
3. 1. 6 Phenol-Chloroform DNA/RNA Extraction...................................37
3. 1. 7 Polymerase Chain Reaction............................................................38
3. 1. 8 Reverse Transcription (RT) – Polymerase Chain Reaction...........38
vi
3. 2 Gene Cloning and Screening.......................................................................39
3. 2. 1 Fragment Amplification and Purification......................................39
3. 2. 2 Digestion of PCR Products and Plasmids for pCambia
Cloning...........................................................................................40
3. 2. 3 Digestion of PCR Products and Plasmids for pBI121
Cloning...........................................................................................40
3. 2. 4 Plasmid-Insert Ligation..................................................................41
3. 2. 5 Screening of Colonies....................................................................41
3. 3 Construction of Turnip Rosette Virus (TRoV) and Lucerne
Transient Streak Virus (LTSV) Clones.....................................42
3. 3. 1 pCambia 1300 Clones....................................................................42
I TROVPOL......................................................................42
II TROVT..........................................................................44
III TROVCP_LTSVsat......................................................46
3. 3. 2 pBI121 Clone.................................................................................49
I TROVTP.........................................................................49
3. 4 Tissue Culture and Transformation...........................................................52
3. 4. 1 Agrobacterium-mediated transformation of Nicotiana
tabacum cv Xanthi and Nicotiana benthamiana...........................52
3. 4. 2 Agrobacterium-mediated transformation of Arabidposis
thaliana (Floral Dip)......................................................................53
3. 4. 3 Chromosomal DNA Extraction from Plant Tissue........................55
3. 4. 4 Total RNA Extraction from Plant Tissue......................................57
vii
3. 4. 5 Infectivity Assays of A. thaliana with TRoV and
LTSV satRNA................................................................................58
3. 4. 6 Purification of TRoV from B. rapa N. tabacum
cv Xanthi, and N. benthamiana.....................................................59
3. 5 Generation of Antibodies and Immunoblotting.........................................60
3. 5. 1 Polyclonal Antibody Production....................................................60
3. 5. 2 Total Protein Extraction.................................................................61
3. 5. 3 Dot-Blot Immunoassays.................................................................61
3. 5. 4 Western Blot..................................................................................62
4 RESULTS......................................................................................................................64
4. 1 Construction and Confirmation of pCambia 1300 Clones........................64
4. 1. 1 Analysis of TROVPOL (Turnip Rosette Virus Polymerase
Gene) Clone...................................................................................64
4. 1. 2 Analysis of TROVT (Turnip Rosette Virus Transport
Protein) Clone................................................................................65
4. 1. 3 Analysis of TROVCO_LTSVsat (Turnip Rosette Virus
Capsid Protein and LTSV Satellite) Clone....................................71
4. 2 Construction and Confirmation of Binary pBI121 Clone........................76
4. 2. 1 Analysis of TROVTP (Turnip Rosette Virus Transport
Protein) Clone................................................................................76
4. 3 Tests of Susceptibility to Turnip Rosette Virus and LTSV
Satellite RNA in Various Plant Species......................................78
4. 4 Production and Analysis of Transgenic Plants..........................................82
viii
4. 4. 1 Analysis of Transgenic Arabidopsis thaliana Plants
Produced Using the Floral Dip Technique.....................................82
4. 4. 2 Analysis of Transgenic N. benthamiana and N. tabacum cv
Xanthi Plants..................................................................................85
4. 5 Determination of Requirement(s) of Replication of LTSV
Satellite RNA................................................................................87
4. 6 Expression of TRoV Capsid Protein in Transgenic Plants.......................91
5 DISCUSSION................................................................................................................93
5. 1 Requirement(s) for LTSV Satellite Replication.........................................93
5. 2 Role(s) of the Proposed TRoV Transport Protein Gene
in Replication and Movement of LTSV Satellite RNA.............97
5. 3 Similarity of Virusoids (Circular Satellite RNAs) to Viroids...................98
5. 4 Packaging of LTSV Satellite RNA............................................................100
6 FUTURE DIRECTIONS.............................................................................................102
6. 1 Function of Host Factors in Virus-Encoded RNA Polymerase
Activity........................................................................................102
6. 2 Template Recognition by TRoV RNA-Dependent RNA Polymerase....104
6. 3 Cell-to-Cell and Vascular Movement........................................................105
6. 4 LTSV Satellite RNA Packaging.................................................................105
7 REFERENCES............................................................................................................107
ix
List of Figures
Figure 1: Genomic organization of various sobemoviruses………………………………5
Figure 2: Structural representation of the Southern Bean Mosaic Virus Subunit and the
arrangement of subunits in the viral particle………………………………………9
Figure 3: Representation of LTSV and TRoV genome organization………………........14
Figure 4: Rolling circle mechanisms proposed for viroid replication……………..…….17
Figure 5: The predicted secondary structure of various viroids and satRNAs…………..20
Figure 6: Structural features of viroids…………………………………………………..23
Figure 7: Rolling circle model for the replication of circular RNAs…………………….25
Figure 8: Reversible self-cleavage underlying hammerhead ribozyme activity…………26
Figure 9: Proposed secondary structure of the positive (plus) and negative (minus) sense
hammerhead domains for LTSV satRNA…………………………………..……26
Figure 10: Organization of the modified pCambia 1300 binary vector………………….43
Figure 11: Schematic representation of TROVPOL and TROVT constructs……………45
Figure 12: Organization of pBS plasmid containing LTSV satellite dimer insert…….....47
Figure 13: Schematic representation of TROVCP_LTSVsat constructs……...…………48
Figure 14: Organization of pBI121 binary vector………………………………………..50
Figure 15: Design of TROVPOL fragment destined for cloning into pCambia 1300…...66
Figure 16: Verification of the DNA fragments destined for pCambia 1300 and pBI121
cloning…………………………………………………………………….….…..67
Figure 17: Confirmation of TROVPOL pCambia 1300 clones digested with
NcoI………………………………………………………………………………68
x
Figure 18: Design of TROVT fragment destined for cloning into pCambia 1300………69
Figure 19: Confirmation of TROVT pCambia 1300 clones digested with NcoI………...70
Figure 20: Design of TROVCP DNA fragment destined for cloning into pCambia
1300…………………………………………………………………………...….73
Figure 21: Confirmation of TROVCP pCambia 1300 clones digested with NcoI………74
Figure 22: Confirmation of TROVCP_LTSVsat pCambia 1300 clones digested with
SmaI………………………………………………………………………..…….75
Figure 23: Confirmation of TROVTP clones digested with XbaI and SacI……………..77
Figure 24: Verification of the susceptibility of N. benthamiana for infection by TRoV
and LTSV………………………………………………………………………...80
Figure 25: Verification of the susceptibility of A. thaliana for the replication of TRoV
alone and TRoV together with LTSV satellite RNA.............................................81
Figure 26: Confirmation of the integrity of total RNA extracted from A. thaliana...........83
Figure 27: PCR confirmation of TROVPOL and TROVT transgenes in A. thaliana.......84
Figure 28: PCR confirmation of TROVCP_LTSVsat transgenes in N. benthamiana......86
Figure 29: Run-off RNA transcripts of LTSV satellite dimer...........................................89
Figure 30: Verification of replication of LTSV satellite RNA in transgenic
A. thaliana………………………………………………………………………..90
Figure 31: Confirmation of TRoV in samples used for antibody production....................92
Figure 32: Analysis of TRoV capsid protein expression in transgenic plants (dot-blot)...94
xi
List of Tables
Table 1: Viruses of the genus Sobemovirus and their biological properties........................3
Table 2: The in vitro translation products of various sobemoviruses..................................7
Table 3: Nucleotide sequences of forward and reverse primers used for construct
synthesis.................................................................................................................51
Table 4: Nucleotide sequences of forward (F) and reverse (R) primers used for
confirmation of gene or LTSV satellite presence..................................................56
xii
List of Abbreviations
A. tumefaciens Agrobacterium tumefaciens
ASBVd avocado sunblotch viroid
ATP adenosine triphosphate
BAP 6-benzyl-aminopurine
BSA bovine serum albumin
BSSV blueberry shoestring virus
bp base pair
cDNA complementary DNA
CfMV cocksfoot mottle virus
CP capsid protein
dNTP 2’-deoxyribonucleotide triphosphate
DEPC diethylpyrocarbonate
ddH2O double distilled water
DNase deoxyribonuclease
E. coli Escherichia coli
EDTA ethylenediaminetetra-acetate
g gram
g gravitational constant (9.8m/s2)
HCl hydrochloric acid
hr hour
kDA kilodalton
xiii
LB Luria-Bertani (media)
LBA LB media with 15 g/L agar
LTSV lucerne transient streak virus
mA milliampere
min minute
mg milligram
MgCl2 magnesium chloride
mM millimolar
mRNA messenger ribonucleic acid
MS Murashige and Skoog (media)
N. benthamiana Nicotiana benthamiana
N. tabacum cv Xanthi Nicotiana tabacum cv Xanthi
NAA naphthalene acetic acid
NaCl sodium chloride
ng nanogram
nm nanometer
nt nucleotide
OD optical density
ORF open reading frame
PAGE polyacrylamide gel electrophoresis
pBS Blue-script plasmid
pCambia Cambia plasmid strain 1300
PCR polymerase chain reaction
xiv
PSTVd potato spindle tuber viroid
RdRp RNA-dependet RNA polymerase
RNA ribonucleic acid
RNase ribonuclease
rRNA ribosomal ribonucleic acid
RT-PCR reverse transcription – polymerase chain reaction
RYMV rice yellow mottle virus
satRNA satellite ribonucleic acid
SBMV southern bean mosaic virus
SCMoV subterranean clover mottle virus
SCPMV southern cowpea mosaic virus
SDS sodium dodecyl sulfate
sgRNA subgenomic RNA
SNMoV solanum nodiflorum mottle virus
SoMV sowbane mosaic virus
ssRNA single-stranded RNA
TE-1 1: 10 dilution of 10mM Tris-HCl (pH 8), and 1mM EDTA
TMV tobacco mosaic virus
Tris tris(hydroxymethyl)aminomethane
TRoV turnip rosette virus
µg microgram
µL microliter
VPg viral protein genome-linked
xv
VTMoV Velvet tobacco mottle virus
1
1 Literature Review
1. 1 OVERVIEW
Viruses are small biological agents that can replicate only inside the living cells of
organisms. As they do not have the molecular machinery to replicate independently, they are
considered intracellular parasites of their hosts. Viruses infect all types of organisms, from
animals and plants to bacteria and archaea (Koonin et al., 2006). Their immense host and
ecological range make viruses the most abundant biological entities on the planet (Edwards &
Rohwer, 2005).
Plant viral pathogens cause an estimated $60 billion (US) loss in crop yields worldwide each
year (Wei et al., 2010), making the study of their replication processes and cell-to-cell movement
mechanisms of great importance. The genome of the majority of plant viruses is positive-sense
single-stranded RNA, which is encapsidated in a protein coat that may be either rod-like or
icosahedral in shape. Plant-to-plant transmission usually involves vectors such as insects, and the
presence of a plant cell wall necessitates viral cell-to-cell movement to occur through
plasmodesmata.
2
1. 2 SOBEMOVIRUSES
1. 2. 1 GENERAL FEATURES
Plant RNA viruses of the genus Sobemovirus are icosahedral particles which contain a
single protein coat (approximately 30 kDA in size), a genomic RNA molecule, and one
subgenomic RNA molecule (Hull, 1995). The capsid is constructed of 180 protein subunits (T=3
symmetry), and the genomic RNA is a single-stranded messenger-sense (+) molecule
approximately 4 kb in size with a genome-liked protein (VPg) at the 5’ terminus and the absence
of a poly-A tail at the 3’ end (Hull, 1995). The genus currently contains 11 species (Table 1)
whose natural host range is quite narrow but includes both monocotyledonous and
dicotyledonous species (Zaumeyer & Hareter, 1943).
In addition to their genomic RNA, some sobemoviruses encapsidate a circular viroid-like
satellite RNA (satRNA) that is dependent on the helper virus for replication. The presence of
viroid-like satellite RNAs has been reported for Lucerne transient streak virus (LTSV), Rice
yellow mottle virus (RYMV), Subterranean clover mottle virus (SCMoV), Solanum nodiflorum
mottle virus (SNMoV), and Velvet tobacco mottle virus (VTMoV) (Seghal et al., 1993; Collins
et al., 1998; Francki et al., 1983; Gould & Hatta, 1981). These satRNAs range from 220 to 390
nucleotides (nt) in length, with the RYMV satRNA (220nt) being the smallest naturally
3
Virus Natural Host Vector Seed Transmission
Reference(s)
BSSV Vaccinium corymbosum,
Vaccinium angustifolium
Aphids No Ramsdell, 1979
CfMV Dactylis glomerata, Triticum aestivum
Beetles No Mohammed & Mossop, 1981
LTSV Medicago sativa Not Determined No Blackstock, 1978
RYMV Oryza sativa, Oryza longistaminata
Beetles No Bakker, 1974
SNMoV Solanum nodiflorum, Solanum
nitidibaccatum, Solanum nigrum
Beetles No Greber, 1981
SBMV Phaseolus vulgaris Beetles Yes Tremaine & Hamilton, 1983
SCPMV Vigna unguiculata Beetles Yes Tremaine & Hamilton, 1983
SoMV Chenopodium spp., Chenopodium murale,
Vitis sp., Prunus domestica, Atriplex
suberecta
Leafminers, Leafhoppers
Yes Kado, 1967
SCMoV Trifolium subterraneu Not Determined Yes Francki et al., 1983
TRoV Brassica campestris subsp. napus, Brassica campestris subsp.rapa
Beetles Not Determined Hollings & Stone, 1973
VTMoV Nicotiana velutina Mirid No Randles et al., 1981
Table 1. Viruses of the genus Sobemovirus and their biological properties. Adapted from
Tamm & Truve, 2000a.
4
occurring viroid-like RNA known to date (Collins et al., 1998). Interactions between the
satRNA, helper virus, and host plant have all been determined to be important factors influencing
the infectivity of the satellite.
1. 2. 2 GENOME ORGANIZATION AND TRANSLATION OF GENE
PRODUCTS
The sequencing of various sobemoviruses has revealed genomic similarities amongst
members of the genus (Fig. 1); all sequenced sobemoviruses contain a small ORF1 at the 5’ end
(labeled P1, Fig. 1), a 3’-proximal ORF which encodes the viral capsid protein (CP), and a large
polyprotein (ORF2) consisting of a serine protease, RNA-dependent-RNA-polymerase (RdRp),
and a Vpg protein. Translation of sobemoviruses in cell-free systems has consistently produced
four polypeptides of relatively similar size amongst the different members of the group (Table
2). Studies of Southern cowpea mosaic virus (SCPMV) have shown that the 100-kDa protein is
translated directly from the full-length RNA, despite being encoded by ORF2 (Ghosh et al.,
1981; Mang et al., 1982). No subgenomic (sgRNA) corresponding to the polyprotein has been
found, and experimental evidence supports the function of sobemovirus genomic RNA as
5
Figure 1. Genomic organization of various sobemoviruses. Boxes denote open reading
frames (ORFs) while vertical chains mark the sites of -1 ribosomal frameshift consensus
signals. The covalently-attached VPg is illustrated by a small circle at the 5’ end, and the
approximate locations of protease (Pro) and RNA-dependent RNA polymerase (RdRp) are
indicated. The positions of the first AUG in ORF3 (and ORF2b of CfMV) are indicated by
short vertical lines. P1, ORF1-encoded protein; CP, coat protein (Tamm and Truve, 2000a).
6
bicistronic mRNA that allows the translation of ORF1 and ORF2 at their respective AUG
codons. A comparison of the sequences surrounding the ORF1 and ORF2 initiation codons of
sobemoviruses with the consensus sequences of plant mRNAs indicate that the AUG of ORF2 is
in a more favourable context for translation by plant ribosomes (Tamm & Truve, 2000a).
Moreover, the placement of the ORF1 initiation codon in a sequence context optimal for
translation initiation reduced ORF2 expression (Sivakumaran & Hacker, 1998), indicating that
the ORF2 polyprotein is most likely translated by leaky scanning rather than internal ribosome
binding or coupled termination-reinitiation.
Previous research indicates that the polyprotein encoded by ORF2 undergoes proteolytic
cleavage by the virus-encoded serine protease to produce three separate protein products: the
protease (which cleaves itself first), VPg, and RdRp (Wu et al., 1987). Furthermore, analyses of
the 5’ end sequences of genomic and subgenomic RNAs of various sobemoviruses have been
performed, and results reveal identical primary sequences (ACAAAA) that suggest such a
conserved sequence may be important for viral replication by the RdRp (Tamm & Truve, 2000a).
The ACAAA sequence has also been identified at the 5’ termini of genomic RNAs and sgRNAs
of peleroviruses (Miller et al., 1995), Red clover necrotic mosaic virus (Zavriev et al., 1996), and
Mushroom bacilliform virus (Revill et al., 1999); its conservation in genomic and subgenomic
RNAs of viruses belonging to different groups implies a potential role directing RdRp activity.
7
Virus Molecular mass (kDA) of in vitro translation product
Polyprotein Unknown Unknown Coat Protein
Unknown References
CfMV 100 71 34 12 Mäkinen et al., 1995
LTSV 105 78 33 18 Morris-Krsinich & Forster, 1983
SBMV 105 75 29 14 Mang et al., 1982
SCPMV 100 70 30 20 Mang et al., 1982
SNMoV 100 67 38 28 Kiberstis & Zimmern, 1984
TRoV 105 67 35 30 Morris-Krsinich & Hull, 1981
Table 2. The in vitro translation products of various sobemoviruses. Adapted from Tamm
& Truve, 2000a.
8
In addition to the genomic RNA, sgRNA molecules derived from the 3’ proximal coat
protein gene have been detected in sobemovirus-infected tissues as well as within virus particles
themselves. These smaller RNAs serve as the template for the translation of the viral coat protein
(the 30-kDa protein in the case of SCPMV) (Rutgers et al., 1980), and have a VPg linked to the
5’ end as in the genomic RNA (Ghosh et al., 1981).
1. 2. 3 PROPERTIES OF VIRAL COAT PROTEIN AND ASSEMBLY OF
VIRAL PARTICLES
The capsid, or coat, of all sobemoviruses is comprised of 180 subunits which form an
icosahedral particle with a triangulation number of T=3. The subunits of the icosahedral particle
are quasiequivalent; subunit types A, B, and C display slightly different conformations and are
assembled in quasiequivalent positions to each other (Fig. 2) (Abad-Zapatero et al., 1980). Two
functional domains of the subunit have been revealed by X-ray crystallography, the R (random)
domain and the S (surface) domain (Abad-Zapatero et al., 1980). While the S domain is
responsible for subunit-subunit interactions in the virus particle, the basic residues of the R
domain are responsible for coat protein contacts with the RNA (Hermodson et al., 1982;
Rossman et al., 1983). The specific pattern of basic residues on the coat protein surface facing
the RNA is able to bind and partially neutralize the negative charge of ssRNA in a
9
Figure 2. Structural representation of the Southern Bean Mosaic Virus subunit and the
arrangement of subunits in the viral particle. I) Tertiary structure of the Southern Bean
Mosaic Virus subunit is ramped in colour from blue at the N-terminus to red at the C-terminus
(left panel), with 180 subunits assembled into a T=3 quaternary structure (Johnson, 2008). II)
(a) The surface lattice displaying the relationship between the three groups of 60 identical
subunits (A, B, C). (b) The arrangement of protein subunits on the surface of the virus. (c) A
ribbon representation of viral coat protein for position A (Abad-Zapatero et al., 1980).
I II
10
non-sequence-specific manner in vitro, and binding has been shown to be selective for ssRNA
over double-stranded DNA (Tamm & Truve, 2000b).
Despite evidence of coat protein-RNA binding, it remains unclear whether interactions
between the capsid coat and genomic RNA are important for the assembly of the viral particle. In
general, formation of T=3 SCPMV particles requires Ca2+ and Mg2+ at a neutral or alkaline pH
(Savithri & Erickson, 1983). Studies of SBMV dissociation in high-salt solution have revealed
that viral RNA is associated with six coat protein subunits in a ribonucleoprotein complex
(RNPC) (Hsu et al., 1977); the coat protein subunits have been proposed to bind to a specific site
in the protease-coding region of genomic SCPMV RNA, and there is evidence to suggest that the
RNA itself folds into a hairpin secondary structure (Hacker, 1995). However, these reports do
not directly demonstrate the necessity of coat protein-RNA interactions for virus particle
assembly, and the existence of variable amounts of empty capsids in extracts of infected tissues
puts such a mechanism into question (Verhoeven et al., 2003).
While its requirements for particle assembly remains unclear, the function of the coat
protein in cell-to-cell and systemic movement of RYMV and SCPMV has been demonstrated.
No virus accumulation was detected in studies of inoculated or systemic leaves of plants tested
with C-terminal-deleted RYMV mutants, whereas the coat protein was not required for RYMV
or SCPMV RNA synthesis in protoplast systems (Brugidou 1995, Sivakumaran 1998).
11
1. 2. 4 CELL-TO-CELL MOVEMENT
While a small P1 protein (11.7 to 24.3 k-Da) encoded by the 5’ ORF1 is common to all
characterized sobemoviruses, these proteins have little sequence homology (Tamm & Truve,
2000a). Studies of RYMV and SCPMV mutants incapable of producing P1 (due to a truncated or
missing gene) demonstrated that the respective viruses were still able to replicate successfully
and indicate that P1 is not necessary for viral replication (Bonneau et al., 1998; Sivakumaran et
al., 1998). However, while mutants replicated efficiently in protoplasts, the absence of full-
length P1 abolished cell-to cell and systemic movement in full plants. Systemic infection was
recovered in transgenic rice plants expressing wild-type P1 and infected with RYMV mutants
harbouring a mutation at the P1 initiation codon (Bonneau et al., 1998). These data demonstrate
the essential role of the P1 protein in plant infection.
While the functions of P1 remain largely unknown, recent studies point to its potential
role in cell-to-cell transport. Most plant viruses produce movement proteins which facilitate viral
movement through plasmodesmata, however no sobemovirus gene products have yet been
assigned this function. These movement proteins are nucleic acid-binding proteins, therefore
reports of the ability of P1 to interact with (bind) single-stranded RNA (ssRNA) in a non-
sequence-specific manner (Tamm & Truve, 2000b), combined with the requirement of the
protein for systemic infection described above, make its role in cell-to-cell transport very
12
convincing. Interestingly, it has been reported that P1 of RYMV also functions as a suppressor of
posttranscriptional gene silencing (PTGS) (Voinnet et al., 1999). P1 has also been implicated in
enhancing genome amplification, with RYMV symptoms appearing more rapidly in P1-
overexpressing plants inoculated with full-length RYMV transcripts than in non-transformed
plants (Bonneau et al., 1998).
1. 3 LUCERNE TRANSIENT STREAK VIRUS
1. 3. 1 BIOLOGICAL AND PATHOLOGICAL PROPERTIES
Lucerne Transient Streak Virus (LTSV) belongs to the sobemo group of plant viruses and
is a 4.5 kilobase, single-stranded messenger-sense (+) RNA with a 5’-bound VPg (Hull, 1988).
As with other sobemoviruses, LTSV virions are icosahedral particles with T=3 symmetry and are
thus assembled from 180 subunits of a single 32 kDa coat protein (Forster & Jones, 1979). Three
isolates of LTSV with distinct host ranges and symptomologies have been identified: New
Zealand (Blackstock, 1978), Australian (Forster & Jones, 1979), and Canadian (Paliwal, 1983).
While the New Zealand isolate induces large chlorotic local lesions in Nicotiana clevelandii, for
example, the plant is not infected by Australian or Canadian isolates (Paliwal, 1983). The virus
13
occurs naturally in clover (Medicago sativa) and can be propagated in Trigonella foenum-
graecum, one of 29 experimentally-determined hosts of LTSV (Forster & Jones, 1980; Paliwal,
1984a).
Translation experiments in vitro have shown LTSV genomic RNA encodes three major
polypeptides (Fig 3a) (Morris-Krsinich & Forster, 1983). The virus particle also encapsidates a
small, 322-nt satRNA which is present in both circular and linear forms (Tien-Po et al., 1981).
14
Figure 3. Representation of LTSV and TRoV genome organization. A) Lucerne Transient
Streak Virus (LTSV) genome (NCBI Reference: NC_001696). The genomic segment between 716
– 3472 nt encodes a polyprotein which constitutes a serine protease, VPg, and RNA-dependent
RNA polymerase. The polyprotein undergoes self-cleavage through protease activity. P1, P2, and
P4 encode LTSV hypothetical genomic proteins. B) Turnip Rosette Virus (TRoV) genome (NCBI
Reference: NC_004553). The segment between 750 – 3349 nt encodes a polyprotein which
undergoes self-cleavage by the activity of TRoV-encoded serine protease to produce three protein
products, including an RNA-dependent RNA polymerase. P1 and P2 encode TRoV hypothetical
genomic proteins, of which P1 has predicted roles in viral movement.
78 440 534 725
716 1495 1825
1951 2457
3312 3472 4148
4275
5’ 3’
P2
Serine Protease VPg RNA-dependent RNA Polymerase
Capsid Protein
P4 P1
AUG
UGA
AUG AUG
AUG
UAA UAA
UGA
AUG
UGA
UAA
AUG
Polyprotein
P1 P2
Serine Protease VPg RNA-dependent RNA Polymerase
Capsid Protein
AUG AUG
AUG
AUG
UAA UAG
UAG
UAG
UAG
5’ 3’
AUG
68 505 560 793
750 1505 1733
3198 3349 3965
4037
Polyprotein
A
B
15
1. 4 SATELLITE RNA OF LUCERNE TRANSIENT STREAK
VIRUS
1. 4. 1 BIOLOGICAL AND PHYSIOLOGICAL PROPERTIES
The 322-nt RNA moiety packaged together with genomic LTSV has been characterized
as a satellite RNA (satRNA) due to its inability to replicate independently of this helper virus.
Studies performed by Jones et al. (1983) demonstrate that while genomic LTSV was able to
infect Chenopodium amaranticolor and C. quinoa, inoculation with purified satRNA produced
no symptoms and the satellite was not detected in nucleic acid extracts from inoculated leaves.
On the other hand, genomic LTSV did not require the satellite to produce a viral infection.
Further studies on Trigonella foenum-graecum and Trifolium incarnatum confirmed that LTSV
satRNA was unable to replicate in the absence of a suitable helper virus (Paliwal, 1984b).
1. 4. 2 HOST AND HELPER VIRUS SPECIFICITY
Several interesting interactions between LTSV satRNA, helper virus, and host plant have
been described. While LTSV satRNA is not infectious alone, it lacks helper specificity. The
replication of LTSV satRNA is also supported by sobemoviruses that are naturally devoid of
satRNAs, including Cocksfoot mottle virus (CfMV), SBMV, Sowbane mosaic virus (SoMV),
16
and Turnip rosette virus (TRoV) (AbouHaidar & Paliwal, 1988; Paliwal, 1984b; Sehgal et al.,
1993). Furthermore, while LTSV genomic RNA has been shown to support the replication of
SNMoV satRNA, the converse is not the case; SNMoV fails to replicate LTSV satRNA (Jones &
Mayo, 1984).
In addition to being specific to the helper virus, LTSV satRNA replication is also host-
dependent. TRoV has been reported to support LTSV satRNA replication in Brassica rapa,
Raphanus raphanistrum, and Sinapsis arvensis, but not in Thlaspi arvense or Nicotiana bigelovii
(Sehgal et al., 1993a). Furthermore, satRNA of LTSV replicates effectively and is encapsidated
in the presence of CfMV in two monocotyledonous species, Triticum aestivum and Dactylis
glomerata (Sehgal et al., 1993a).
1. 4. 3 MECHANISMS OF REPLICATION
The LTSV satellite RNA is replicated through a symmetrical rolling circle mechanism
common to viroids of the family Avsunviroidae (Fig. 4). Nucleic acid extracts of LTSV-infected
tissue performed by Hutchins et al. (1985) revealed monomeric and multimeric RNAs of both
polarities (both the encapsidated positive (+) and complementary negative (-) sense RNAs).
17
Figure 4. Rolling-circle mechanisms proposed for viroid replication. The asymmetric
pathway, with one rolling circle, is observed in members of the family Pospiviroidae and
takes place in the nucleus. The symmetric pathway, with two rolling circles, is observed in
members of the family Avsunviroidae and takes place in the chloroplast for these viroids.
White lines indicate (+) strands, yellow lines indicate (-) strands; cleavage sites are marked by
arrowheads. Self-cleavage mediated by hammerhead ribozymes (Rz) or host proteins (HP)
leads to linear monomeric RNAs. Pol II refers to RNA polymerase II and NEP refers to
nuclear-encoded RNA polymerase (Flores et al., 2005).
18
Observations of in vitro self-cleavage of (+) and (-) sense LTSV satRNA transcripts further
support this model (Forster & Symons, 1987a; 1987b; Sheldon & Symons, 1993).
In the symmetrical model, original (+) sense circular monomeric RNAs are initially
copied by an RNA polymerase to produce multimeric (-) sense strands. These (-) sense
concatamers are cleaved into monomers through their own ribozyme activity, and then
circularize to serve as templates for the synthesis of multimeric (+) sense RNAs. Positive sense
RNA concatamers undergo ribozymal self-cleavage again to generate circular (+) sense
monomers (Forster & Symons, 1987a). On the contrary, multimeric (-) sense RNAs are copied
directly to produce (+) sense concatamers in the asymmetric model. These (+) sense concatamers
undergo ribozymal self-cleavage to generate monomers that subsequently circularize (Forster &
Symons, 1987a).
1. 4. 4 SEQUENCE AND STRUCTURE
Sequence analyses have revealed a high degree of similarity amongst the three known
isolates of LTSV satRNA. Both the New Zealand and Australian isolates are 324-nt in length and
share 98% sequence similarity (Keese et al., 1983), while the Canadian isolate is a 322-nt RNA
with only 80% sequence homology with the others (AbouHaidar & Paliwal, 1988). While the
19
primary sequences of the three satRNA isolates predict up to seven ORFs, there is little amino
acid conservation within the ORFs and no in vitro translation products have been identified
(Morris-Krsinich & Forster, 1983). Consequently, LTSV satRNAs are considered to lack
functional mRNA activity in vivo (AbouHaidar & Paliwal, 1988).
Secondary structure models based on thermodynamic stability of the three LTSV satRNA
isolates predict extensive internal base-pairing of the circular RNAs (up to 70%) and suggest a
rod-like native structure very similar to that of viroids (Fig. 5). In both the positive- and
negative-sense strands of LTSV, the right one-third of the molecule can fold into an alternative
hammerhead structure involved in self-splicing (Forster &Symons, 1987a; Sheldon & Symons,
1989).
20
Figure 5. The predicted secondary structures of various viroids (A) and satRNAs (B).
Predicted structures of Avocado sunblotch viroid (ASBV), Potato spindle tuber viroid
(PSTV), and five satellite RNAs: Velvet tobacco mottle virus (VTMoV), Solanum nodiflorum
mottle virus (SNMV), Lucerne transient streak virus (LTSV), and two isolates of
Subterranean clover mottle virus (SCMoV). Splice sites are indicated by arrows. Adapted
from Francki, 1987.
B
A
21
1. 5 VIROIDS
1. 5. 1 GENOMIC ORGANIZATION
Viroids differ radically from viruses in structure, function, and evolutionary origin. These
circular ssRNAs are approximately tenfold smaller than the smallest RNA viruses; their genomic
sizes range from 246-401 nt and result in a rod-like structure due to a high degree of self-
complementarity (Sanger et al., 1976). As they do not code for any protein products, viroids rely
exclusively on host factors for infection (Diener, 2001). Some viroids are also catalytic RNAs
with self-encoded hammerhead ribozymes; the hammerheads mediate self-cleavage of
multimeric RNAs that are generated during rolling circle replication (Flores et al., 2005). Other
than select plant satellite RNAs, such as LTSV satRNA, and the RNA of human hepitits delta
virus (Flores et al., 2001; Taylor, 2003), catalytic ribozyme activity has not been observed in any
other virus-related RNAs.
Of the 29 known viroid species, all but four belong to the family Pospiviroidae and thus
share the characteristics of Potato spindle tuber viroid (PSTVd). They adopt a rod-like structure
and follow the symmetric rolling-circle mechanism previously described (Branch & Robertson,
1984). The remaining four viroids are members of the Avsunviroidae family, characteristic of the
Avocado sunblotch viroid (ASBVd). Unlike Pospiviroidae viroids, those in the Avsunviroidae
22
group do not have a conserved central region, terminal conserved region, or terminal conserved
hairpin motifs (Fig. 6). Nevertheless, ASBVd strands of both polarities are able to self-cleave
through hammerhead ribozymes, while cleavage in PSTVd is performed by host enzymes whose
site-specificity is determined by a particular RNA folding (Flores et al., 2005). Members of
Avsunviroidae undergo asymmetric rolling circle replication, where the multimeric (-) sense
RNAs are directly copied to produce (+) sense concatemers (Fig. 4).
The accumulation of PSTVd and its complementary strands in the nucleus of infected
plants strongly suggests the involvement of nuclear RNA polymerase in the replication of
Pospiviroidae (Diener, 1971). In contrast, the (+) and (-) strands of ASBVd have been shown to
preferentially accumulate in the chloroplast, indicating the involvement of enzymatic machinery
of the chloroplast in the replication of members of the family Avsunviroidae (Bonfiglioli et al.,
1994; Lima et al., 1994). The mechanism by which viroids redirect the template specificity of
certain host DNA-dependent RNA polymerases to transcribe RNA remains unknown.
23
Figure 6. Structural features of viroids. (a) Rod-like secondary structure of members of the
family Pospiviroidae. Domains C (central), P (pathogenic), V (variable), and TL and TR
(terminal left and right, respectively) are indicated, as well as the CCR (central conserved
region), TCR (terminal conserved region) and TCH (terminal conserved hairpin). Arrows
indicate flanking sequences that together with the upper CCR strand form a hairpin, and the S-
shaped line connects the residues linked after UV irradiation as a consequence of forming part
of the loop E. (b) Quasi-rod-like and branched secondary structures of ASBVd and PLMVd,
respectively (family Avsunviroidae). Sequences conserved in most natural hammerhead
structures are shown within boxes with blue and white backgrounds for (+) and (−) polarities,
respectively. (Inset) PLMVd (+) hammerhead structure represented according to the original
scheme (left) and to X-ray crystallography data obtained with artificial hammerhead structures
(right), in which a proposed tertiary interaction between loops 1 and 2 enhancing the catalytic
activity is indicated. Nucleotides conserved in most natural hammerhead structures are depicted
as above. Arrows mark the self-cleavage site (Flores et al., 2005).
24
1. 5. 2 RIBOZYME ACTIVITY
Rolling circle replication (Fig. 7) requires a precise mechanism by which viroid
monomers are excised from multimeric replication intermediates and ligated to form circular,
monomeric progeny RNAs. While members of the Pospiviroidae use host enzymes for this
purpose, Avsunviroidae are self-cleaving pathogenic RNAs that contain a highly conserved series
of short nucleotide sequences that form a hammerhead secondary structure upon base pairing
(Fig. 6b). This hammerhead ribozyme is embedded in both polarity strands and self-cleaves at a
specific phosphodiester bond through a transesterification reaction in the presence of divalent
cations such as Mg2+ or Mn2+ (Fig. 8) (Hutchins et al., 1986). The active ribozyme is transiently
formed during replication to promote monomeric cleavage, while a later alternate folding
promotes ligation during monomer circularization (Flores et al., 2004).
Similar to viroids, the satellite RNA of LTSV also contains hammerhead motifs (Fig. 9).
The sequences adjacent to the cleavage sites of (+) and (-) sat RNA can be folded into a
hammerhead secondary structure, which occupies the right one third of the LTSV satRNA
molecule (~ 58 nt). The splice sites of both sense strands are separated by only 6 nucleotides
(Forster & Symons, 1987a).
25
Figure 7. Rolling circle model for the replication of circular RNAs. A) In symmetrical
rolling circle replication, both the (+) and (-) multimeric RNAs are processed to
monomers before re-circularizing. B) Asymmentrical rolling circle replication involves
the processing of only the (+) sense strand into monomers. The (-) sense concatamer is
copied directly into a (+) sense strand. (+) sense RNAs are represented as black rods while
complementary (-) sense RNAs are white. Adapted from Forster & Symons, 1987a.
26
Figure 8. Reversible self-cleavage underlying hammerhead ribozyme activity. The
cleavage reaction proceeds through a nucleophilic attack by the 2’ OH on the phosphate to
generate a 2’,3’-cyclic phosphate and 5’ hydroxyl cleavage product. Mg2+ is essential for
the stabilization of the transition state of the splicing reaction through interaction with the
non-bridging oxygen in the phosphate. Adapted from Sheldon & Symons, 1989.
Figure 9. Proposed secondary structure of the positive (plus) and negative (minus)
sense hammerhead domains for LTSV satRNA. Stems are numbered I to III, the arrow
indicates site of cleavage, and conserved bases between various LTSV satRNA isolates are
boxed. Adapted from Sheldon & Symons, 1989.
27
1. 5. 3 CELL-TO-CELL AND LONG DISTANCE MOVEMENT
In contrast to viruses, viroids do not encode their own movement proteins (or other
translation products), and therefore must interact directly with host factors for mobility within
the host. Previous reports describe cell-to-cell movement of endogenous or viral proteins and
nucleic acids occurs via the plasmodesmata of the plant. Studies of PSTVd indicate viroids
follow the same pathway for intercellular movement (Ding et al., 1997). Interestingly, fusion of
an otherwise nonmotile RNA to PSTVd resulted in its transport into adjacent cells, suggesting
that the viroid encodes a motif necessary for plasmodesmata transport (Ding et al., 1997).
Systemic spread of viroids in plant tissues occurs through the vasculature and has been
found to be mediated by chaperone proteins which bind viroid RNA in the phloem to form a
ribonucleoprotein complex (Gomez & Pallas, 2001). In addition, there is evidence that
plasmodesmata at some cellular boundaries restricts PSTVd trafficking (Zhu et al., 2002). While
present in vascular tissues of infected N. benthamiana and tomato plants, the PSTVd was not
detected in shoot apical meristems or developing flowers, whereas mature flowers contained the
viroid only in the parenchyma cells of sepals. Thus viroid transport through plasmodesmata is
not universal and systemic trafficking may be dependent on interactions with host proteins that
mediate RNA traffic in plants.
28
2 Introduction
2. 1 REQUIREMENT(S) FOR REPLICATION OF LUCERNE
TRANSIENT STREAK VIRUS SATELLITE RNA
2. 1. 1 RESEARCH QUESTION
Many plant viruses have been found to be associated with satellite RNAs that are
dependent on their helper virus for both replication and encapsidation; they act, in a sense, as
parasites of the virus itself. They range in size from just under 200 nucleotides to over 1500
nucleotides, and may either ameliorate or exacerbate the symptoms of their helper virus. The
larger satellites of nepoviruses contain open reading frames (ORFs) which have been shown to
be functional in vitro and, in some cases, in vivo. Meanwhile, smaller satellites do not encode
any functional ORFs but are highly structured, and may be either linear or circular (Roossinck et
al., 1992).
Virusoids, a subclass of viral satellites that exist as small, circular, viroid-like RNAs, are
single-stranded, highly self-complementary entities that are unable to replicate autonomously
and are dependent upon a larger helper virus for infection (with which they share no sequence
29
homology) (Francki, 1985). Their mechanisms and requirements for replication, however, remain
undefined. As they do not code for the molecular machinery required to replicate, it is possible
that satellites which do not encode any translation products rely on the activity of the helper
virus-encoded polymerase for replication. Interestingly, the secondary structure of LTSV
satRNA, as well as that of other virusoids (Fig. 5), is very similar to the rod-like structure of
viroids, which are also small circular RNAs that do not associate with any virus but replicate
autonomously using cellular DNA-dependent RNA polymerases (Flores et al., 2005). Due to its
structural similarity to viroids, it is possible that the LTSV satellite is capable of self-replication
through the activity of some functional secondary-structural motif, yet it is not infectious alone
because it lacks an accompanying transport protein, such as that encoded by the helper virus, that
would facilitate cell-to-cell movement in a plant host. The elucidation of the replication
mechanism used by viral satellites would be important in contributing to the fundamental
understanding of the biological activity of these small plant pathogens.
30
2. 2 INDEPENDENT PACKAGING ABILITY OF LTSV satRNA
AND IMPORTANCE OF SENSE DIRECTIONALITY
2. 2. 1 RESEARCH QUESTION
The satellite RNA of LTSV relies on the helper virus not only for replication, but for
encapsidation (packaging) as well, and no translation products have been reported for LTSV
satellite RNA. The small circular LTSV satRNA is found packaged along with the viral genomic
RNA into the icosahedral viral capsid, which is assembled from 180 identical subunits (Forster
& Jones, 1979). Interestingly, viral packaging is exclusive for these RNA molecules; no cellular
RNAs (mRNA, tRNA, etc) have been found in nucleic acid extracts of virions. In addition,
conflicting mechanisms for viral particle assembly have been proposed (see 1.2.3). The
suggestion that packaging is initiated via sequence-specific binding of viral coat proteins to
genomic RNA raises the question of the mechanism by which LTSV satRNA is packaged, as it
shares no sequence homology with LTSV genomic RNA.
The second aim of this thesis is to better understand whether the interactions (if any)
between genomic and satellite RNA are important for satellite packaging and assembly, and
31
whether the characteristics of LTSV satRNA influence the packaging ability of the satellite. To
further this goal, the following research questions will be explored:
(1) Is LTSV satRNA able to be packaged independently (without the helper virus) in TRoV
capsid particles?
(2) Is sense-directionality important in LTSV satRNA packaging? Do both positive- and
negative- sense LTSV satRNAs share the ability to be packaged in TRoV capsid
particles?
32
3 Materials and Methods
3. 1 MOLECULAR TECHNIQUES
3. 1. 1 PLASMID DNA ISOLATION FROM E. COLI (MINI-PREP)
A 50% glycerol stock of Escherichia coli (strain DH5∝) was used to inoculate 4
mL of LB media (1% tryptone, 0.5% bacto yeast extract and 1% sodium chloride [pH
7.5]) supplemented with the appropriate selection antibiotic (eg. 60 µg/mL Ampicillin for
pBS plasmids and 50 µg/mL Kanamycin for pCambia plasmids) and the cells were
cultured overnight in a 37°C orbital shaker. The culture was then divided into 1.5 mL
aliquots and plasmid DNA was extracted using a modified version of the alkaline lysis
method described in Maniatis et al. (1982).
E. coli cells were sedimented by centrifugation at 12 000 g for five minutes. The
supernatant was decanted and pellets were resuspended in 100 µL of Solution I, stored at
4°C (50 mM glucose, 10 mM EDTA [pH 8.0], 25 mM Tris-HCl [pH 8.0], and 5 mg/mL
lysozyme). After a 10-minute incubation period at room temperature, 200 µL of freshly
prepared Solution II (0.2N sodium hydroxide and 1% sodium dodecyl sulphate) was
added to each sample to promote lysis of bacterial cells, denaturation of cellular proteins,
denaturation of chromosomal DNA and degradation of cellular RNA. The solution was
thoroughly mixed by gently inverting the tubes, which were then chilled on ice for 20
minutes. 150 µL of ice-cold neutralizing Solution III (3M sodium acetate [pH 4.8]) was
33
then added to each tube and the suspension was thoroughly mixed before incubating for
45 minutes on ice. Samples were then centrifuged at 12 000 g for 10 minutes at 4°C to
separate precipitated proteins, lipids, and chromosomal DNA from plasmid DNA
suspended in the supernatant, which was transferred to a new tube.
To precipitate plasmid DNA, 0.6 volumes of isopropanol was added to each
sample, mixed by vortex, and incubated at room temperature for 1 hour. Plasmid DNA
was pelleted by centrifugation at 12 000 g for 5 minutes, and the pellets were then
washed with 70% ethanol followed by 95% ethanol, and air-dried to allow for the
evaporation of remaining ethanol. Finally, the pellets were resuspended in 30 µL of TE-1
buffer (1 mM Tris-HCl [pH 8.0] and 0.1 mM EDTA [pH 8.0]) and stored at -20°C.
3. 1. 2. GEL ELECTROPHORESIS
DNA and RNA samples were analyzed using gel electrophoresis. TBE buffer (0.1
M Tris base, 0.5 M Boric acid, and 2 mM EDTA [pH 8.0]) was used for both the
preparation of the agarose gel (1-2%) as well as the running buffer. The DNA or RNA
was diluted with 3-5 µL TE-1 and 3 µL loading dye (0.25% xylene cyanol, 0.25%
bromophenol blue, 20% glycerol). After loading the sample, the gel was subjected to
electrophoresis at a constant current of 50 mA and voltage of 120 V. Once the
bromophenol dye had migrated half-way down the gel, the gel was stained with 1%
ethidium bromide and photographed under ultraviolet light (300 nm) with a
transilluminator.
34
3. 1. 3 HEAT SHOCK TRANSFORMATION OF E. COLI
Bacterial strains were made competent and transformed using the calcium
chloride heat shock protocol outlined by Maniatis et al. (1982). A glycerol stock of E.
coli, strain DH5α, was used to inoculate 4 mL of LB media, and the culture was grown
overnight in a 37°C shaker. The next day, 250 µL of this culture was added to 25 mL
fresh LB media and was set on a 37°C shaker for an addition 2.5 hours, until the optical
density at 595 nm (OD595) was 0.4 – 0.6. The culture was incubated on ice for 20 minutes
and then divided into two tubes (10 mL), which were centrifuged at 3 000 g and 4°C for 5
minutes. The supernatant was decanted in the fume hood and the pellet was resuspended
in 5 mL of ice-cold 50 mM calcium chloride. After 20 minutes on ice, the cells were
centrifuged under the same conditions for 10 minutes. The supernatant was discarded in
the fume hood and the pellet was resuspended in 670 µL of ice-cold 100 mM calcium
chloride. The tubes were chilled on ice for 25 minutes. Aliquots of 200 µL competent
DH5α cells were distributed to separate tubes, and 5 µL ligated plasmid preparation (1
µL undigested plasmid from mini-prep as control) was added to respective tubes. The
samples were incubated on ice for 30 minutes.
Heat-shock was performed on all samples at 42°C for 90 seconds, after which
tubes were immediately transferred to ice for 2-10 minutes. Following the incubation
period, 800 µL of fresh LB media was added to each sample, tubes were vortexed to mix,
and then transferred to a 37°C shaker for 45 minutes. The cells were pelleted by
centrifugation at 12 000 g for 1 minute at room temperate and 700 µL of the supernatant
was discarded. The pellet was resuspended in the remaining supernatant and the mixture
35
was evenly plated on LBA plates (LB media, 15 g/L agar) with 50 µL/mL Kanamycin.
The agar plates were inverted and incubated at 37°C overnight to allow colony growth.
Plates were transferred to 4°C the next morning. Single colonies were selected
and grown in 4 mL LB media supplemented with 50 µL/mL Kanamycin in a 37°C
shaker. Plasmid DNA was extracted from these cultures (see 3.1.1) and restriction digests
were performed to verify successful transformation (see 3.2.5). Cloning was then
confirmed by sequencing the plasmid insert using a GFP reverse primer (sGFP_R, Table
3)
3. 1. 4 PREPARATION OF COMPETENT CELLS AND
TRANSFORMATION OF A. TUMEFACIENS
A glycerol stock of Agrobacteria tumefaciens, strain GV3101, was used to
inoculate 4 mL of LB media, supplemented with 30 µg/mL Gentamycin. The culture was
allowed to grow overnight on a 28°C shaker. The following day, 1 mL of this culture was
added to 25 mL fresh LB media supplemented with Gentamycin (30 µg/mL). The cells
were set on a 28°C shaker for an additional 4 hours, until OD595 reached 0.4-0.6. The
culture was chilled on ice for 20 minutes and then split into two tubes of 10 mL before
centrifuging at 3 000 g for 15 minutes at 4°C. All supernatant was then discarded and the
pellet was resuspended in 1 mL of ice-cold 20 mM calcium chloride solution. One
hundred-µL aliquots of this suspension were distributed into pre-chilled tubes and left on
ice for a further 10-15 minutes. At least 50 ng of plasmid DNA was then added to cells;
36
1-3 µL of phenol-chloroform extracted plasmid DNA from E. coli mini-prep of
confirmed clones, dissolved in 10 µL TE-1.
Next, cells were frozen by immersing tubes containing competent A. tumefaciens
and desired plasmid into liquid nitrogen for 5 minutes, followed by a thawing period of 5
minutes at 37°C. After the addition of 1 mL LB media to each sample, tubes were
incubated for 3 hours at 28°C with gentle shaking. Cells were then pelleted by
centrifugation at 12 000 g for 1 minute at room temperature, and 1 mL of supernatant was
discarded. Cells were resuspended in the remaining 100 µL supernatant and evenly plated
on LBA plates prepared with 50 µL/mL Kanamycin and 30 µg/mL Gentamycin for
selection. Plates were inverted and incubated at 28°C for 2-3 days (until appearance of
colonies), then stored at 4°C. Single colonies were selected and grown in 4 mL LB media
supplemented with 50 µL/mL Kanamycin and 30 µg/mL Gentamycin in a 28°C shaker.
Plasmid DNA was extracted from these cultures (see 3.1.1) and restriction digests were
performed to verify successful transformation.
3. 1. 5 GLYCEROL STOCKS
Once confirmed, 10 µL of transformed bacterial culture was used to sub-culture 4
mL of fresh LB media with appropriate antibiotic, and samples were grown overnight in
a 37°C (E. coli) or 28°C (A. tumefaciens) shaker. The next day, 500 µL of this culture
was added to 500 µL autoclaved glycerol in a sterile tube, and the mixture was
thoroughly vortexed. Samples were stored at -80°C.
37
3. 1. 6 PHENOL-CHOLORFORM DNA/RNA EXTRACTION
To purify nucleic acids, phenol-chloroform extraction was performed. Depending
on the volume of TE-1 used to dissolve the DNA/RNA, an equal volume of saturated
phenol was added to the sample. The tubes were vortexed to mix and centrifuged at 12
000 g for 2 minutes. The top phase from each sample was transferred to a new tube while
a volume of TE-1 equal to the volume of the original DNA/RNA sample was added to the
original tubes containing remaining phenol (back extraction). The mixture was
thoroughly mixed by vortex and centrifuged again for 2 minutes. The top phase was once
again carefully removed and transferred to the new tubes. The original tubes were
discarded.
To remove traces of phenol, two volumes of saturated chloroform (stored at 4°C)
were added to each tube. The samples were thoroughly vortexed and centrifuged for 2
minutes. The chloroform (bottom phase) was removed and this step was repeated. After
the second centrifugation, the DNA/RNA in the top aqueous phase was transferred to a
new tube and potassium acetate was added to a 0.1 M final concentration. Two and a half
volumes of cold 95% ethanol were also added to promote nucleic acid precipitation. The
samples were thoroughly mixed and stored overnight at -20°C or for 3 hours at -80°C.
The DNA/RNA was then pelleted by centrifugation at 12 000 g for 10 minutes at 4°C.
The supernatant was discarded and the pellet was washed with 70% ethanol followed by
95% ethanol. The samples were allowed to air-dry until all ethanol had evaporated, and
pellets were dissolved in 30 µL TE-1.
38
3. 1. 7 POLYMERASE CHAIN REACTION
Polymerase Chain Reaction (PCR) was used for the synthesis and amplification of
double stranded DNA inserts for clone production and the confirmation of gene presence
in the chromosomal DNA of transgenic plants. A 25 µL reaction was prepared using 15
µL double-distilled water (ddH2O), 5 µL of 5X PCR buffer, 1 µL of 10 mM dNTPs, 1 µL
each of 10 µM forward and reverse primers, 1 µL of LongAmp Taq DNA Polymerase
(NEB), and 1 µL template DNA (plasmid, chromosomal, or cDNA). The mixture was
vortexed and 20 µL of mineral oil was added to the surface of the reaction to prevent
evaporation. Samples were placed in a thermal cycler for 30 cycles of amplification at a
primer-specific annealing temperature.
3. 1. 8 REVERSE TRANSCRIPTION (RT) – POLYMERASE CHAIN
REACTION
The confirmation of viral presence in plant issues, total virus preparations, and
transgene expression in transformed plants was achieved by RT-PCR following RNA
extraction. Isolated RNA was first reverse-transcribed into cDNA: 5 µL of total RNA or
3 µL pure viral RNA was mixed with 1 µL of 10 µM reverse primer and 13 – 15 µL TE-1
(DEPC-treated). The samples were boiled for 5 minutes and then chilled on ice for 10
minutes. The following reagents were then added to each sample: 2.5 µL of 10X M-
MulV Reverse Transcriptase (RT) buffer (NEB), 2 µL of 10 mM dNTPs, 0.5 µL of
39
RNase inhibitor, and 1 µL of M-MulV RT. The samples were incubated at 37°C for 1
hour.
Once first-strand synthesis was complete, 2 µL of prepared cDNA was used as a
template for PCR amplification (see 3.1.7).
3. 2 GENE CLONING AND SCREENING
3. 2. 1 FRAGMENT AMPLIFICATION AND PURIFICATION
Two hundred fifty µL (10 standard PCR reactions) of the desired PCR product
were amplified and then purified using either the GeneJet PCR Purification Kit
(Fermentas) or, in the case of multiple bands, run on a 1.5% agar gel without loading dye.
The gel was briefly stained with ethidium bromide and fragments of appropriate size
were excised from the gel under ultraviolet irradiation (less than 1 minute exposure to
avoid DNA damage). Excised DNA fragments were then purified using the PureLink
Quick Gel Extraction Kit (Invitrogen) and eluted with 50 µL TE-1.
40
3. 2. 2 DIGESTION OF PCR PRODUCTS AND PLASMIDS FOR pCAMBIA
CLONING
In separate 50 µL reactions, empty pCambia 1300 plasmids (from E. coli mini-
prep) and the appropriate PCR products were digested simultaneously with KpnI and
XbaI (5 µL of 10X KpnI buffer, 4 µL XbaI, 1.5 µL KpnI, ddH2O to volume). Samples
were incubated at 37°C overnight and an additional 4 µL XbaI and 1.5 µL KpnI were
added the following day for a further 4-hour digestion. The DNA was then deproteinated
by phenol-chloroform extraction (see 3.1.6) and precipitated overnight at -20°C. After
centrifugation and washing with ethanol, air-dried pCambia 1300 pellets were dissolved
in 15 µL sterile ddH2O while the tubes containing fragment DNA were used for ligation
reactions (see 3.2.4).
3. 2. 3 DIGESTION OF PCR PRODUCTS AND PLASMIDS FOR pBI121
CLONING
In separate 50 µL reactions, empty pBI121 plasmids (from E.coli mini-prep) and
the appropriate PCR product (TROVTP insert) were digested simultaneously with XbaI
and SacI (5 µL of 10X NEB Buffer 4, 0.5 µL of 100X purified BSA (NEB), 1.5 µL XbaI
(NEB), 1.5 µL SacI-HF (NEB), ddH2O to volume). Samples were incubated at 37°C
overnight and an additional 1.5 µL XbaI and SacI-HF were added the following day for a
further 4-hour digestion. The DNA was then phenol-chloroform extracted (see 3.1.6) and
41
precipitated overnight at 20°C. Digested plasmids were re-dissolved in 15 µL sterile
ddH2O while the tubes containing fragment DNA were used for ligation (see 3.2.4).
3. 2. 4 PLASMID-INSERT LIGATION
To tubes containing purified PCR fragments, the following reagents were added:
2.5 µL of 10X T4 DNA Ligase buffer, 5 µL linearized, purified plasmid, 1 µL T4 DNA
Ligase (400 units), and 16.5 µL ddH2O (25 µL reaction). Inserts were ligated to
linearized plasmids overnight at 16°C, and were incubated at room temperature for a
further 4 hours the following day after the addition of 21.5 µL ddH2O, 2.5 µL 10X T4
DNA Ligase buffer, and 1 µL T4 DNA Ligase (400 units). Ligated samples were then
used to transform DH5α (see 3.1.3).
3. 2. 5 SCREENING OF COLONIES
Up to 20 colonies of transformed DH5α were selected and cultured overnight in 4
mL LB supplemented with the appropriate antibiotic(s) in a 37°C shaker. Plasmid DNA
was extracted from these cultures (see 3.1.1) and screened with restriction enzymes. As
two NcoI sites flank the cloning site in pCambia, these plasmids were digested with NcoI
for 2 hours at 37°C in a 50 µL reaction (12 µL plasmid DNA, 5 µL 10X NEB Buffer 4, 2
µL NcoI, 31 µL ddH2O). On the other hand, pBI121 plasmid DNA was double-digested
with XbaI and SacI overnight at 37°C (10 µL plasmid DNA, 5 µL 10X NEB Buffer 4, 0.5
42
µL 100X purified BSA, 1.5 µL XbaI (NEB), 1.5 µL SacI-HF (NEB), 31.5 µL ddH2O).
Digested samples were then subjected to gel electrophoresis and the nucleotide sequences
of confirmed clones were verified. Selected plasmids were then used to transform A.
tumefaciens cells (strain GV3101) (see 3.1.4).
3. 3 CONSTRUCTION OF TURNIP ROSETTE VIRUS
(TROV) AND LUCERNE TRANSIENT STREAK
VIRUS (LTSV) CLONES
3. 3. 1 pCAMBIA 1300 CLONES
I TROVPOL
The TRoV RNA-dependent RNA polymerase gene was synthesized and amplified
using RT-PCR of the pure virus. A KpnI site was incorporated into the forward primer
(TROVP_F, Table 3) and an XbaI site was incorporated into the reverse primer
(TROVP_R, Table 3), so as to produce sticky ends following digestion of the PCR
product. A 6-nt overhang was added to the 5’ end of all primers to promote enzyme
cleavage activity. Additionally, the ATG start codon was added to the TROVP forward
primer in between the restriction site and the beginning of the RdRp gene sequence; the
TROV RdRp gene exists as part of a polyprotein and does not possess an independent
43
start codon (Fig. 3b). The inclusion of the start codon in the clone sequence is important
for the facilitation of RdRp protein translation in transgenic plants.
Empty pCambia 1300 plasmids and amplified TROVPOL PCR fragments were
digested concurrently with KpnI and XbaI (see 3.2.2), unique restriction sites on the
pCambia 1300 binary vector (Fig. 10). After purification from enzymes, the linearized
plasmids were ligated with digested amplicons at 16°C with T4 DNA Ligase (see 3.2.4).
Competent DH5α were transformed with this preparation (see 3.1.3); the cells were
plated on 50 µg/mL Kanamycin LBA plates and colonies were picked the next day.
Plasmid DNA isolated from cultures was digested with NcoI and the resulting fragments
were analyzed on a 1.5% agarose gel. Clones with incorporated TROVPOL (Fig. 11a)
released two fragments summing 2350 bp (due to an internal NcoI cleavage site), while
empty pCambia released a 557 bp fragment.
CaMV 35S sGFP Tnos
KpnI XbaI BamHI NcoI
NotI PstI
HindIII SpnI
NcoI
PstI
Figure 10. Organization of the modified pCambia 1300 binary vector. The original
promoter was previously removed and replaced with the cauliflower mosaic virus (CaMV)
35S promoter with unique KpnI and XbaI sites downstream. These sites were used for all
cloning in pCambia 1300 constructs. Two NcoI sites surround the location of cloning
(557bp apart) and therefore were used to screen colonies for presence of insert. sGFP
denotes synthetic green fluorescent protein (previously added to pCambia 1300 to create a
modified plasmid, and not used for the purposes of this thesis). Tnos denotes nopaline
synthase terminator.
pCambia 1300
44
II TROVT
As with the TROVPOL clone, the TRoV transport protein insert was produced
using RT-PCR of purified TRoV. Similarly, a KpnI site was incorporated into the
forward primer (TROVT_F, Table 3) and an XbaI site was incorporated into the reverse
primer (TROVT_R, Table 3), which flank the proposed transport protein sequence on
genomic RNA. The TRoV transport protein gene possesses both a natural start (AUG)
and stop (UAA) codon, which are included in the cloned fragment (Fig. 11b).
Additionally, a 6-nt overhang was added to the 5’ end of both primer oligonucleotides to
promote efficient restriction enzyme cleavage. Cloning was performed as in 3.4.1 (I).
Potential clones were treated with NcoI and the digestion products were analyzed on a
1.5% agarose gel. Clones harbouring the TROVT insert produced a 1027 bp fragment,
whereas empty pCambia released a 557 bp fragment.
45
Figure 11. Schematic representation of TROVPOL and TROVT constructs. A)
TROVPOL: An ATG start codon was added to the TRoV RNA-dependent RNA
polymerase gene (1616 nt in length) prior to cloning between the KpnI and XbaI sites in
the modified pCambia 1300 plasmid. The gene possesses a natural stop codon (TAG,
indicated). B) TROVT: The predicted TRoV transport protein gene (438 nt in length)
possesses natural start and stop (ATG, TAA, indicated) codons and is cloned between
the KpnI and XbaI sties in the modified pCambia 1300 plasmid. Transcription is driven
by the cauliflower mosaic virus (CaMV) 35S promoter. sGFP denotes synthetic green
fluorescent protein; Tnos denotes nopaline synthase terminator.
CaMV 35S TROVPOL TAG
KpnI XbaI
sGFP Tnos
pCambia 1300
ATG
1651 bp
A
CaMV 35S ATG TROVT TAA
KpnI XbaI
sGFP Tnos
pCambia 1300
470 bp
B
46
III TROVCP_LTSVsat
To examine the independent packaging ability of LTSV satRNA, a construct was
developed with the TRoV capsid protein gene and LTSV satellite dimer sequence in
tandem. The TRoV capsid gene was cloned using a forward primer with an incorporated
KpnI sequence (TROVCP_F, Table 3) and a reverse primer containing an XbaI restriction
site (TROVCP_R, Table 3); the insert incorporated the natural start and stop codons of
the capsid protein gene. Cloning and screening was performed as in 3.4.1 (I); NcoI-
treated plasmids containing the desired insert (TROVCP) released two fragments
summing 1325 bp, while empty pCambia released one 557 bp fragment.
The fidelity of TROVCP sequences was verified, and confirmed constructs were
subsequently used for sub-cloning with the LTSV satellite dimer insert. pBS plasmids
containing the 322-nt LTSV satellite sequence in a dimer arrangement (Fig. 12) had been
previously constructed in the lab; these clones were confirmed by sequencing. Forward
and reverse primers were designed to include the full dimer sequence; the forward primer
and reverse primers both contained an XbaI restriction site (LTSVdimer_F and
LTSVdimer_R, Table 3). Amplified inserts and TROVCP plasmids were digested with
XbaI prior to ligation with T4 DNA Ligase at 16°C overnight (see 3.2.4). Competent
DH5α were transformed with this preparation (see 3.1.3); the cells were plated on LBA
plates with 50 µg/mL Kanamycin and colonies were picked the next day. Overnight
digestion with XbaI was performed to identify transformed clones; a 655 bp fragment
was released from successfully transformed clones while empty pCambia was linearized
without a released fragment. As both ends of the insert possessed an XbaI restriction site,
47
transformation produced clones of both positive and negative directionalities (Fig. 13); to
determine the orientation of the insert, clones selected by XbaI digestion were further
cultured overnight in 4 mL LB with 50 µg/mL Kanamycin at 37°C, plasmid DNA was
isolated (see 3.1.1) and then digested with SmaI overnight. TROVCP plasmids with
forward-sense insertions released a 482 bp fragment whereas LTSV satellite dimers
inserted in a negative orientation released a 620 bp fragment. Prospective forward- and
negative- sense clones were confirmed by sequencing.
122 322 1 322 1 127
BglI HindIII XbaI BamHI
EcoRI
Figure 12. Organization of pBS plasmid containing LTSV satellite dimer insert. Arrows
indicate the direction of the + strand within the vector, with nucleotide positions shown, and
restriction cleavage sites are marked.
pBS
48
Figure 13. Schematic representation of TROVCP_LTSVsat constructs. The TROV capsid
protein gene (TROVCP) is cloned between the KpnI and XbaI restriction sites of modified pCambia
1300, and the LTSV satellite dimer insert is cloned at the XbaI site; both forward (F) and reverse (R)
orientations are produced. SmaI restriction sites were used to determine orientation of LTSV satellite
dimer insert. All elements downstream of the cauliflower mosaic virus (CaMV) 35S promoter are
destined for transcription, ending at the nopaline synthase terminator (Tnos). TROVCP possesses
independent translational start and stop (TAG, indicated) codons. sGFP denotes synthetic green
fluorescent protein.
CaMV 35S TROVCP TAG
KpnI XbaI XbaI
sGFP Tnos
pCambia 1300
LTSVsat dimer (R)
SmaI SmaI SmaI
LTSVsat dimer (F) CaMV 35S TROVCP UAG
KpnI XbaI XbaI
sGFP Tnos
pCambia 1300
SmaI SmaI SmaI
49
3. 3. 2 pBI121 CLONE
I TROVTP
To analyze whether the combined activity of the TRoV transport protein and
TRoV RdRp were necessary for systemic infectivity of LTSV satRNA, a transgenic plant
system expressing both genes was developed. In order to select for double-transformed
seeds, and considering the Hygromycin resistance of TROVPOL pCambia clones in plant
tissue, the Kanamycin-resistant pBI121 binary vector (Fig. 14) was used for the
construction of a second TRoV transport protein clone (TROVTP) destined for double
transformation with TROVPOL-expressing plants. An XbaI restriction site was
incorporated into the TROVTP forward primer (TROVTP_F, Table 3), while a SacI site
was incorporated into the reverse primer (TROVTP_R, Table 3). Consequently, the
TROVTP insert replaced the β-glucuronidase (GUS) reporter gene in the original pBI121
vector and was positioned under the control of the CaMV 35S constitutive promoter (Fig.
14). Amplified TROVTP fragments and empty pBI121 plasmids were digested with XbaI
and SacI overnight at 37°C (see 3.2.3), ligated overnight at 16°C (see 3.2.4), and
transformed into competent DH5α the following day (see 3.1.3). Selected colonies were
digested with XbaI and SacI; clones possessing the TROVTP insert released a 530 bp
fragment.
50
Figure 14. Organization of pBI121 binary vector. The neomycin phosphotransferase II
gene (NPT II) is under the control of the native nopaline synthase promoter (NOS-pro) and
provides Kanamycin resistance in bacterial and plant cells. The Cauliflower mosaic virus 35S
promoter (CaMV 35S) controls transcription of the β-glucuronidase reporter gene. The
nopaline synthase terminator (Tnos) ends transcription of both genes. Restriction cleavage
sites are shown, of which HindIII, XbaI, BamHI, SmaI, and SacI are unique. RB denotes right
border, LB denotes left border.
NOS-pro NPT II Tnos Tnos CaMV 35S β-GLUCURONIDASE LB RB
HindIII SphI PstI XbaI BamHI SmaI
SacI
SmaI . TCT AGA GGA TCC CCG GGT GGT CAG TCC CTT ATG
XbaI BamHI
pBI121
51
PRIMER NAME
SEQUENCE (5’ – 3’) Tm (°C)
TROVP_F GACGGAGGTACCATGACTCTACCAGTGAGCTCTTT 71.1 TROVP_R GGGCGGTCTAGATATTCAGCGAACTAATTGACAGT 69.4 TROVT_F AATTTAGGTACCATGAGTAGAGTTGCCACAATCG 67.1 TROVT_R GCGTGGTCTAGATGTGGATTTTAGTCAGAAAAGA 67.1 TROVTP_F GACTACTCTAGAATGAGTAGAGTTGCCACAATCGA 68.2 TROVTP_R GCAGTCGAGCTCGTAAATGTCTTGTGGATTTTAGT 68.2 TROVCP_F ATAGTCGGTACCATGGAGAAAGGAAACAAGAAGCT 68.2 TROVCP_R GGGAACTCTAGACCATTCTATACGTTTAAGGACGA 68.2 LTSVdimer_F GGTCGACTCTAGAGGATCCCCCCCATGGCCTCATCAGT 76.6 LTSVdimer_R GGCGCGGTCTAGATACGACTCACTATAGGGCGAATTCG 74.4 sGFP_R GAACTTCAGGGTCAGCTTGC
Table 3. Nucleotide sequences of forward and reverse primers used for construct
synthesis. The TROVP primers flank the TRoV polymerase gene and were used to create
the insert for the production of the TROVPOL clone. The ATG start codon is added to the
TROVP forward primer. The TROVT primers were used to amplify the predicted TRoV
transport protein gene and were used in the synthesis of the TROVT clone. The TROVTP
primers were used to amplify the predicted TRoV transport protein gene for cloning into
pBI121. The TROVCP primers were used to produce the TROV capsid protein insert and
the LTSVdimer primers were used to amplify the LTSV satellite dimer in a previously-
constructed pBS clone. With the exception of TROVTP, all fragments were destined for
pCambia 1300 cloning. The sGFP reverse primer was used in the sequencing of all
pCambia clones to confirm fidelity. F indicates forward primer; R indicates reverse
primer.
52
3. 4 TISSUE CULTURE AND TRANSFORMATION
3. 4. 1 AGROBACTERIUM-MEDIATED TRANSFORMATION OF
NICOTIANA TABACUM CV XANTHI AND NICOTIANA
BENTHAMIANA
A glycerol stock of A. tumefaciens strain GV3103 harbouring the desired
pCambia 1300 construct was used to inoculate 4 mL of LB media supplemented with 50
µg/mL Kanamycin and 30 µg/mL Gentamycin. The culture was incubated overnight in a
28°C shaker. The following day, 150 µL of this culture was used to subculture 30 mL of
LB media with 50 µg/mL Kanamycin and 30 µg/mL Gentamycin, and the preparation
was again incubated overnight on a 28°C shaker.
On the day of transformation, one month-old N. tabacum cv Xanthi or N.
benthamiana plants growing in sterile ½ MS media (2.2 g/L MS salts, 1.5% sucrose, 8
g/L agar, pH 5.8) were used for agrobacterial infiltration. Bacterial entry sites were
created by carefully cutting around the edges of leaves in a sterile fumehood
environment. Approximately 15 leaf discs were then incubated in 30 mL of each
agrobacterial culture for 8-10 minutes and then blotted dry on sterile filter paper for 2
minutes. Infected leaf discs were then transferred to plates of MSIa media (4.4 g/L MS
salts, 3% sucrose, 2 g/L MES, 1 mg/L 6-benzyl-aminopurine (BAP), 0.4 mg/L
naphthalene acetic acid (NAA), and 8 g/L agar, pH 5.8) and incubated for 2 days at 24°C
53
to promote transformation with agrobacteria. Leaf discs were then transferred to plates of
MSIb selection media (4.4 g/L MS salts, 3% sucrose, 2 g/L MES, 1 mg/L BAP, 0.4 mg/L
NAA, 8 g/L agar, 400 µg/mL Carbenicillin and 20 µg/mL Hygromycin, pH 5.8) in a
sterile fumehood. After approximately 6 weeks of callus formation on MSIb, primary
shoots were transferred to sterile Magenta boxes containing MSII rooting media (2.2 g/L
MS salts, 1.5% sucrose, 2 g/L MES, 8 g/L agar, 400 µg/mL Carbenicillin and 20 µg/mL
Hygromycin, pH 5.8).
Plants were grown in MSII and propagated by cutting shoots at the plant stem and
transferring to MSII for root development. Once roots could be observed, successful
transformation was confirmed by PCR of plant chromosomal DNA and transgene
expression was verified by RT-PCR of total plant RNA. Plants were then transferred to
soil and pots were covered with plastic for the first two weeks to preserve humidity.
Plants were grown in the greenhouse.
3. 4. 2 AGROBACTERIUM-MEDIATED TRANSFORMATION OF
ARABIDOPSIS THALIANA (FLORAL DIP)
In preparation for agrobacterial transformation, seeds from A. thaliana ecotype
Columbia (Col-0) were first sterilized by vortexing for 3-5 minutes in a solution of 700
µL 70% ethanol and 300 µL 20% bleach. Seeds were then washed twice with 95%
ethanol and completely air-dried before transferring to ½ MS plates for germination.
Plants were grown according to a 16-hour light, 22°C growth chamber program. Two-
54
week old plants were then transferred to soil and tray covers were used for the first 3 days
to preserve humidity. Once stems had developed, apical buds were removed to reduce
apical dominance and promote multi-stem growth. Flowering development was observed
in 4 to 5 week-old plants; these plants were used for agrobacterial transformation.
Agrobacterial cultures were prepared by using a glycerol stock of A. tumefaciens
strain GV3103 harbouring the desired pCambia 1300 or pBI121 construct to inoculate 4
mL of LB supplemented with 50 µg/mL Kanamycin. The culture was incubated overnight
in a 28°C shaker, and 150 µL of this culture was added the following day to 50 mL new
LB supplemented with 50 µg/mL Kanamycin, which was then incubated in a 28°C shaker
overnight. The culture was divided the following morning into two tubes of 25 mL,
which were centrifuged at 5 000 g for 15 minutes to pellet bacterial cells. Agrobacteria
was then resuspended in 50 mL of Solution A (5% sucrose, 0.05% Tween-20) and the
mixture was transferred into a small beaker.
Stalks of flowering plants were dipped into the appropriate agrobacterial solution
for 10 seconds and were immediately covered with a plastic bag to preserve humidity and
promote agrobacterial transformation. Plants were maintained in the growth chamber
under the same conditions as before transformation; bags were opened on the second day
and removed on the third. Transformation was repeated on the same plants two weeks
later.
Once seeds had matured, they were harvested and screened on plates containing
selection media (2.2 g/L MS salts, 1.5% sucrose, 8 g/L agar, 400 µg/mL Carbenicillin, 20
µg/mL Hygromycin, pH 5.8). Plants which developed roots were transferred to soil; once
55
transgene presence was confirmed by PCR of plant chromosomal DNA, they were grown
to maturity and seeds of multiple lines were collected.
3. 4. 3 CHROMOSOMAL DNA EXTRACTION FROM PLANT TISSUE
A 0.5 cm2 leaf sample was added to 50 µL of DNA extraction buffer (500 mM
NaCl, 100 mM Tris-HCl pH 7.5, 50 mM EDTA pH 7.5) in a sterile 1.5 mL tube. The leaf
tissue was homogenized in the tube by grinding with a sterile pestle for 20 seconds. An
additional 150 µL of DNA extraction buffer was added to the tube and the mixture was
ground again. Once fully homogenized, 20 µL of 20% SDS was added to the tube and the
mixture was vortexed for 30 seconds to mix. The sample was then incubated at 65°C for
10 minutes to allow for cell lysis. An equal volume (200 µL) of 25:24:1
phenol:chloroform:isoamyl alcohol solution was then added to the sample and thoroughly
vortexed for 30 seconds. The mixture was then subjected to centrifugation at 10 000 g for
3 minutes at 4°C. The supernatant was transferred to a new tube and mixed with an equal
volume of chloroform, thoroughly mixed by vortexing, and then centrifuged for 1 minute
at 10 000 g. The supernatant was once again transferred to a new tube and a double-
volume of 95% ethanol was added. The sample was vortexed and incubated at -20°C for
30 minutes to allow precipitation of DNA. Following the incubation period, the DNA
was pelleted by centrifugation at 10 000 g for 10 minutes at 4°C. The supernatant was
discarded and the pellet was washed with 70% ethanol prior to air-drying in the fume
hood. The pellet was then dissolved in 10 µl of TE-1 buffer (1 mM Tris-HCl pH 8, 0.1
mM EDTA) and stored at -20°C. One µl of the extracted chromosomal DNA was used as
56
a template for amplification by PCR using internal primers for the respective inserts
(Table 4), in order to confirm transgene presence in transformed tobacco and Arabidopsis
plants.
PRIMER NAME
SEQUENCE (5’ – 3’)
Tm (°C) PCR Product Size (bp)
TROVP_iF AGAGTGGTTGGTGTCCCAAG 62.4 230 TROVP_iR TTTGTTCAGTCAGCGACAGG 60.4 TROVT_iF CACGCGCTCCTAGAACTCTT 62.4 244 TROVT_iR AAAGGCAAGCTTCACTCTCG 60.4 TROVCP_iF ACGAGTGTGTGGAAGGGAAG 62.4 250 TROVCP_iR GTGGATATCTCGCCGACAGT 62.4 TROV_F ACGAGTGTGTGGAAGGGAAG 62.4 255 TROV_R GTGGATATCTCGCCGACAGT 62.4 LTSV_F GAACAACAACGCACAGAGGA 62.4 150 LTSV_R TCAGTGTTGCACACCTGGAT 60.4 LTSVsat_F CCTACCATGGCCTCATCAGT 62.4 200 LTSVsat_R GCCGGTAGGATGATGGATTA 60.4
Table 4. Nucleotide sequences of forward (F) and reverse (R) primers used for
confirmation of gene or LTSV satellite presence. TROVP_i primers produce a 230-bp
PCR product and are internal to the TROV RNA-dependent RNA polymerase gene.
TROVT_i primers produce a 244-bp PCR product and are internal to the TROV
transport protein gene. TROVCP_i primers correspond to a 250-bp internal TROV
capsid protein gene sequence. TROV primers are used for the detection of TROV RNA
and produce a 255-bp product following RT-PCR. LTSV primers are used for the
detection of LTSV RNA and produce a 150-bp product following RT-PCR LTSVsat
primers are used for the detection of LTSV satellite RNA and produce a 200-bp product
following RT-PCR.
57
3. 4. 4 TOTAL RNA EXTRACTION FROM PLANT TISSUE
To confirm transgene expression in transformed plants as well as viral presence in
infected plant tissues, total RNA was extracted. Sterile bleach-treated mortar and pestle
were cooled with liquid nitrogen, then 0.5 mL of 0.1 M Tris-HCl and 0.5 mL of 25:24:1
phenol:chloroform:isoamyl alcohol solution were added (all solutions were treated with
DEPC). The mixture was frozen by adding liquid nitrogen and then ground to a fine
powder. Leaves were subsequently added to the mortar and frozen with liquid nitrogen
before being homogenized as a fine powder. The powder mixture was immediately
distributed to sterile, DEPC-treated 1.5 mL tubes and centrifuged for 3 minutes at 10 000
g. The supernatant was transferred to new tubes and washed twice with 2 volumes of
chloroform. After the second removal of chloroform, the tubes containing only the top
layer were centrifuged at 10 000 g for 2 minutes to separate any residual chloroform. The
supernatant was then transferred to new 1.5 mL tubes, to which sodium acetate was
added to a 0.1 M final concentration along with 2.5 volumes of ice-cold 95% ethanol.
Samples were incubated at -20°C overnight or at -80°C for 3 hours. RNA was then
pelleted by centrifugation at 4 °C for 20 minutes. The resulting pellet was washed with
70% ethanol followed by 95% ethanol and left to air dry in the fume hood. The dried
pellet was then dissolved in 30 µL of TE-1 buffer and stored at -20°C.
To ensure RT-PCR analysis would provide accurate information on transcription,
all RNA samples were treated with DNaseI prior to cDNA synthesis. To the tube
containing pelleted RNA, the following reagents were added: 2.5 µL 10X reaction buffer,
1 µL DNase I, 1 µL RNase Inhibitor, and DEPC-treated ddH2O to a final volume of 25
58
µL. Samples were incubated at 37°C for 1 hour and all protein was then removed by
phenol-chloroform extraction (see 3.1.6) prior to RT-PCR.
3. 4. 5 INFECTIVITY ASSAYS OF A. THALIANA WITH TROV AND LTSV
satRNA
Transgenic and wild-type Arabidopsis were treated with TRoV and transcribed
LTSV satRNA in infectivity assays. LTSV satRNA was prepared by in vitro runoff
transcription of pBS DNA clones containing the LTSV satellite dimer insert. The clones
were first linearized by restriction digest with HindIII by combining 10 µL plasmid DNA
(from mini-prep) with 10 µL 10X HindIII buffer, 2.5 µL HindIII and 77.5 µL TE-1
buffer. Samples were mixed by vortex and incubated at 37°C overnight. Following
digestion, the reaction mixtures were phenol-chloroform extracted and precipitated
overnight at -20°C. Linearized DNA was then pelleted by centrifugation at 10 000 g and
pellets were washed with 70% ethanol before air-drying to allow all ethanol to evaporate.
Runoff transcription reactions were performed by adding the following reagents to each
tube: 10 µL 5X transcription buffer, 10 µL 10 mM rNTPs, 2 µL RNase Inhibitor, 2 µL T7
RNA Polymerase, and 24 µL DEPC-treated ddH2O. Samples were incubated at 37°C for
2 hours.
Bottom leaves of 4 to 5 week-old Arabidopsis plants were lightly brushed with
cotton before 50 µg/leaf of TRoV, LTSV satRNA, or both were applied. Inoculated
59
plants were then returned to the growth chamber and maintained for 2 weeks when
newly-grown, uninoculated leaves were collected to determine systemic presence of
LTSV satRNA.
3. 4. 6 PURIFICATION OF TROV FROM B. RAPA, N. TABACUM
CV XANTHI, AND N. BENTHAMIANA
TRoV was propagated in greenhouse-grown Brassica rapa, while transgenic N.
tabacum cv Xanthi and N. benthamiana expressing the TRoV capsid protein gene were
expected to produce TRoV virions. To isolate viral particles from these plant tissues, 15 -
20 g of leaves were harvested; in the case of inoculated B. rapa plants, uninoculated
systemically-infected leaves were collected 12-20 days post-inoculation (dpi). Leaves
were homogenized in 70 mL of 50 mM sodium acetate buffer, pH 5.0, and 0.1% 2-
mercaptoethanol (v/v) using a blender, and the homogenate was then twice expressed
through 4 layers of cheesecloth. The extract was centrifuged at 10 000 g for 20 minutes,
and the aqueous phase was transferred into ultracentrifuge tubes. Samples then underwent
sedimentation at 90 000 g (36 000 rpm) for 3.5 hours. The aqueous phase was removed
and viral pellets were dissolved in 50 mM sodium acetate buffer, pH 5.0 overnight at
4°C. The viral solution was collected the following day in a sterile 1.5 mL tube, and
optical density was measured at 260 nm and 280 nm to determine virus purity and
concentration. To prevent bacterial degradation, 0.04% sodium azide (w/v) was added to
the viral solution and stored at 4°C.
60
To verify the presence of viral particles, 100 µL of collected viral solution was
phenol-chloroform extracted and analyzed by RT-PCR.
3. 5 GENERATION OF ANTIBODIES AND
IMMUNOBLOTTING
3. 5. 1 POLYCLONAL ANTIBODY PRODUCTION
Four-month old male rabbits were used for the production of polyclonal
antibodies. After a two-week habituation period following transfer, 0.5 mL of TRoV (3.2
mg/mL) purified from turnip leaves was combined with 0.5 mL Freund’s Incomplete
Adjuvant (FIA) and mixed thoroughly by pipetting. The sample was then administered by
subcutaneous injection at two to three sites. Two booster injections were given at two-
week intervals following the same protocol. Exsanguination was performed two weeks
following the second booster injection, with 100 mL of blood collected per animal by
cardiac puncture. Blood was divided into two 50 mL tubes and left undisturbed overnight
at 4°C to allow clotting. Tube were centrifuged at 10,000 g for 10 minutes the next
morning, serum was transferred to new tubes, and samples were stored at -80°C.
61
3. 5. 2 TOTAL PROTEIN EXTRACTION
To autoclaved mortars, leaf samples were added together with liquid nitrogen and
ground to a fine powder. Using a flame-sterilized scapula, the powder was transferred to
1.5 mL tubes containing 50 µL Protein Extraction Buffer (50 mM Tris-HCl [pH 7.5], 15
mM MgCl2, 0.1 mM PMSF, 18% glycerol, 2% Triton X-100, 0.5% NP40, 0.7% β-
mercaptoethanol). Samples were thoroughly mixed by vortex, and then centrifuged for 5
min at 10, 000 g. The supernatant was transferred to new tubes, and samples were stored
at -80°C.
3. 5. 3 DOT-BLOT IMMUNOASSAYS
To detect the presence of TRoV capsid proteins in transgenic tissue, dot blots
were performed. A 6 cm x 7 cm section of nitrocellulose membrane was divided into a 1-
cm grid, and samples were spotted in 0.5 µL volumes to a total of 2 µL/square. Samples
were spotted in columns at two-fold dilutions. Once all samples had dried, the
nitrocellulose membrane was immersed in 35 mL of Blocking Solution (TBS [25 mM
Tris-HCl, pH 7.5; 150 mM NaCl], 5% dried skimmed milk) in an autoclaved petri dish
and left for 4 hours at room temperature with gentle shaking. A 50 mL solution of TBS,
0.5% dried skimmed milk, and 50 µL primary antibody serum was prepared, to which the
nitrocellulose membrane was transferred following the previous incubation. The
preparation was left at 4°C overnight with gentle shaking.
62
The next morning, the membrane was transferred to 25 mL of TBS-T (TBS,
0.05% Tween-20) and incubated with shaking at room temperature for 10 minutes. The
solution was discarded, and this washing step was repeated three additional times. The
membrane was then washed with TBS for 10 minutes with shaking, after which the
membrane was immersed in 25 mL of TBS solution with secondary antibody (TBS, 0.5%
dried skimmed milk, 0.066% anti-rabbit goat antibody). The preparation was incubated
for one hour at room temperature with gentle shaking.
To remove excess antibodies, the nitrocellulose membrane was again washed four
times with TBS-T at 10 minute periods. After a final 10-minute washing with TBS
alone, the membrane was covered with alkaline phosphatase substrate solution and left in
the dark with gentle shaking for 5 minutes. The solution was discarded and the membrane
was washed with distilled water prior to analysis.
3. 5. 4 WESTERN BLOT
Following total protein extraction (see 3.5.2), 1X SDS gel-loading buffer (50 mM
Tris-HCl [pH 6.8], 100 mM dithiothreitol, 2% electrophoresis grade SDS, 0.1%
bromophenol blue, 10% glycerol) was added to 25 µL of each sample, and tubes were
vortexed to mix. To denature proteins and promote SDS coating of polypeptides, samples
were heated to 100°C for 5 minutes, together with a sample containing marker proteins of
known molecular weights. SDS-Polyacrylamide Gel Electrophoresis (PAGE) was
performed using a 4-20% glycine precast gel (BioRad), which was rinsed with distilled
water and placed into the appropriate clamping frame. The assembly was filled with 1X
63
SDS Electrophoresis buffer (5 mM Tris-HCl [pH 8.3], 50 mM glycine, 0.5%
electrophoresis-grade SDS) and 25 µL of prepared sample was added to each well. The
gel was then subjected to electrophoresis at a constant voltage of 200V for 40 minutes. In
preparation for sample transfer, nitrocellulose membrane (cut to dimensions of gel), filter
paper, and fiber pads were soaked in Transfer Buffer (7.7 mM glycine, 9.6 mM Tris,
0.037% electrophoresis grade SDS, 20% methanol) for 5-10 minutes. Once
electrophoresis was complete, the gel, nitrocellulose membrane, filter paper, and fiber
pads were assembled in the cassette according to manufacturer instructions and immersed
in Transfer Buffer. Transfer was conducted overnight at 25V and 60mA at 4°C, with the
voltage being increased the following morning to 75V for an additional 2 hours. The
nitrocellulose membrane was removed from the assembly and subjected to
immunoblotting according to the dot blot protocol outlined in 3.5.3.
64
4 Results
4. 1 CONSTRUCTION AND CONFIRMATION OF
PCAMBIA 1300 CLONES
4. 1. 1 ANALYSIS OF TROVPOL (TURNIP ROSETTE VIRUS
POLYMERASE GENE) CLONE
For the study of the role of the Turnip Rosette Virus RNA-dependent RNA
Polymerase (RdRp) in the replication of LTSV satellite RNA, a transgenic plant system
was designed to express the TRoV RdRp in vivo. The polymerase gene is naturally
situated as part of a polyprotein in the genomic RNA of TRoV, and due to its position as
part of this polyprotein complex, it lacks a natural start codon (Fig. 3b). To allow for
translation following transformation, the ATG start codon was included as part of the
forward primer sequence (TROVP_F, Table 3), directly adjacent to and in frame with the
beginning of the TRoV RdRp gene (nucleotides 1734-3346 of TRoV genomic RNA,
NCBI Reference Sequence NC_004553.1). The amplified fragment (1651 nt, Fig. 16)
was used for cloning into the pCambia 1300 binary vector (Fig. 11a).
Following transformation, single colonies were selected, cultured, and screened
for TROVPOL by NcoI digestion. Clones harbouring the TROVPOL insert released two
fragments summing 2350 bp as a result of an internal NcoI cleavage site, while cultures
65
transformed with empty pCambia released a 557 bp fragment (Fig. 17). Successfully
transformed clones were sequenced to verify sequence integrity and then used for
transformation into A. tumefaciens.
4. 1. 2 ANALYSIS OF TROVT (TURNIP ROSETTE VIRUS TRANSPORT
PROTEIN) CLONE
Similar to pCambia constructs containing the TRoV RdRp gene, additional
pCambia constructs were designed to include the TRoV transport (or movement) protein
gene (Fig. 11b) in order to investigate whether it was a requirement for the replication
and/or systemic infection (cell-to-cell movement) of LTSV satellite RNA. Both a start
codon and stop codon are present in the genomic sequence of the gene, therefore forward
and reverse primers were designed to flank and include these sequences (Fig. 18); the
predicted TRoV transport protein gene sequence comprises nucleotides 68 to 505 on
genomic TRoV RNA (NCBI Reference Sequence NC_004553.1). Amplification by RT-
PCR generated the expected 470 bp fragment (Fig. 16).
As a consequence of NcoI restriction digest, clones containing the TROVT insert
produced the expected 1027 bp fragment, whereas empty pCambia released a 557 bp
fragment (Fig. 19). Further verification of the identity of the clones was carried out by
nucleotide sequencing.
66
Figure 15. Design of TROVPOL fragment destined for cloning into pCambia 1300. Grey-
blocked sequences indicate forward (TROVP_F) and reverse (TROVP_R) primers used for the
amplification of the TRoV RdRp gene (reverse primer sequence is complimentary to indicated
sequence). A KpnI restriction site and ATG start codon are integrated into the forward primer,
while the reverse primer contains an XbaI restriction site. Both primers include a 6-nucleotide
overhang to facilitate restriction enzyme endonuclease activity. The fragment includes the start of
the polymerase gene sequence, at 1734 nucleotides on the genomic TRoV RNA, and extends past
the natural stop codon to 3366 nucleotides on the genomic TRoV RNA (NCBI Reference Sequence
NC_004553.1).
67
Figure 16. Verification of the DNA fragments destined for pCambia 1300 and pBI
121 cloning. All TRoV gene fragments were obtained by RT-PCR from purified viral
RNA, while the LTSV satellite dimer fragment was amplified from previously constructed
pBS clones containing an LTSV satellite dimer insert. Lane A: 100 bp DNA ladder. Lane
B: 1651 bp TROVPOL fragment. Lane C: 100 bp DNA ladder. Lane D: 470 bp
TROVT fragment. Lane E: TROVTP fragment. Lane F: 797 bp TROVCP fragment.
Lane G: 742 bp LTSV satellite dimer sequence.
A B C D E F G
1651 bp
470 bp
797 bp 742 bp
480 bp
68
Figure 17. Confirmation of TROVPOL pCambia 1300 clones digested with NcoI.
Lane A: 100 bp DNA ladder. Lanes B – E: Empty pCambia, with released 557 bp
fragment. Lanes F – G: pCambia construct possessing TROVPOL insert. Two fragments
are released following NcoI digestion totaling 2350 bp.
A B C D E F G
69
Figure 18. Design of TROVT fragment destined for cloning into pCambia 1300.
Grey-blocked sequences indicate forward (TROVT_F) and reverse (TROVT_R) primers
used for the amplification of the TRoV transport protein gene (reverse primer sequence is
complimentary to indicated sequence). A KpnI restriction site is integrated into the
forward primer, while the reverse primer contains an XbaI restriction site. The transport
protein gene sequence (68-505 nt on genomic TRoV RNA, NCBI Reference Sequence
NC_004553.1) contains both a natural start (ATG) and stop (TAA) codon, which are
included in the amplified fragment. Both primers include a 6-nucleotide overhang to
facilitate restriction enzyme endonuclease activity. The fragment begins at the start codon
and extends past the natural stop codon to 513 nucleotides on the genomic TRoV RNA.
70
Figure 19. Confirmation of TROVT pCambia 1300 clones digested with NcoI.
Lane A: 1 kb DNA ladder. Lanes B – E:. pCambia constructs with TROVT insert. A
1027 bp fragment is released following NcoI digestion. Lane F: Empty pCambia, with
release of the expected 557 bp fragment.
A B C D E F
1027 bp
557 bp
71
4. 1. 3 ANALYSIS OF TROVCP_LTSVsat (TURNIP ROSETTE VIRUS
CAPSID PROTEIN AND LTSV SATELLITE) CLONE
The pCambia 1300 clone harbouring the TRoV capsid protein gene in tandem
with a head-to-tail dimer construct of the LTSV satellite sequence was generated. The
TRoV capsid protein gene fragment was first amplified, ligated into empty pCambia
plasmids, and screened. The forward primer corresponded to the first 23 nucleotides of
the gene, while the reverse primer extended 5 nucleotides past the stop codon of the gene
(Fig. 20), which spans nucleotides 3198-3965 on genomic TRoV RNA. RT-PCR using
TROVCP_F and TROVCP_R yielded a 797–nt fragment (Fig. 16). Following
transformation, colonies with resistance to Kanamycin were cultured and digested with
NcoI to distinguish empty plasmids from TROVCP constructs. Results obtained indicated
that pCambia vectors that had incorporated the TRoV capsid gene released two fragments
summing 1325 bp (Fig. 21). Nucleotide sequencing confirmed the fidelity and the size of
the incorporated gene.
A head-to-tail dimer sequence of the 322-nt LTSV satellite had been previously
constructed in pBS plasmid in the laboratory and its identity was confirmed by
sequencing. Forward and reverse primers corresponded to pBS sequences surrounding
the dimer sequence, such that the complete dimer was included in the amplified fragment
(742 nucleotides, Fig. 16). The fragment was amplified by PCR and treated with XbaI
restriction digest, along with TROVCP plasmids confirmed above. As only one
restriction digest site was used for ligation, the cloning process produced constructs with
dimer sequences oriented in both forward and backward polarities (Fig. 13). After
72
digestion with NcoI to identify clones containing both TRoV capsid gene and LTSV
satellite dimer inserts, a SmaI restriction digest was used to distinguish between forward-
sense (TROVCP_LTSVsatF) and reverse-sense (TROVCP_LTSVsatR) clones (Fig. 22).
Sequencing analysis was then used to further confirm orientation and sequence of
potential clones prior to A. tumefaciens transformation.
73
Figure 20. Design of TROVCP DNA fragment destined for cloning into pCambia
1300. Grey-blocked sequences indicate forward (TROVCP_F) and reverse (TROVCP_R)
primers used for the amplification of the TRoV capsid protein gene (reverse primer
sequence is complementary to indicated sequence). A KpnI restriction site is integrated
into the forward primer, while the reverse primer contains an XbaI restriction site. The
capsid protein gene sequence (3198-3965 nt on genomic TRoV RNA, NCBI Reference
Sequence NC_004553.1) contains both a natural start (ATG) and stop (TAG) codon,
which are included in the amplified fragment. Both primers include a 6-nucleotide
overhang to facilitate restriction enzyme endonuclease activity. The fragment begins at the
start codon and extends past the natural stop codon to 3970 nucleotides on the genomic
TRoV RNA.
74
B A C D E F
Figure 21. Confirmation of TROVCP pCambia 1300 clones digested with NcoI.
Lane A: 1 kb DNA ladder. Lane C: Empty pCambia, with release of the expexted 557
bp fragment. Lanes B, D, E, F: pCambia construct with incorporated TROVCP insert.
Two fragments are released following NcoI digestion summing 1325 bp.
557 bp
75
B A C D
Figure 22. Confirmation of TROVCP_LTSVsat pCambia 1300 clones digested with
SmaI. A SmaI digest was used to determine the orientation of the LTSV satellite insert of
TROVCP_LTSVsat constructs. Due to the location of the SmaI site in the LTSV satellite
sequence in relation to the SmaI site within the pCambia plasmid, the reverse sense dimer
produces a band approximately 100 bp longer than the forward sense insert. As it is a dimer,
a 322-bp fragment is also released. Lane A: 100 bp DNA ladder. Lane B:
TROVCP_LTSVsatF (forward sense). Lane C: TROVCP_LTSVsatR (reverse sense). D: 1
kb DNA ladder.
322 bp
100 bp
76
4. 2 CONSTRUCTION AND CONFIRMATION OF
BINARY PBI121 CLONE
4. 2. 1 ANALYSIS OF TROVTP (TURNIP ROSETTE VIRUS TRANSPORT
PROTEIN) CLONE
Agrobacterial transformation was used to introduce the TRoV RNA-dependent
RNA polymerase gene or, separately, the TRoV transport protein gene from pCambia
1300 into the chromosomal DNA of plant cells, in order to investigate whether either
protein was sufficient alone for LTSV satellite replication and/or systemic infection.
However, the possibility remained that the TRoV RdRp may be sufficient for LTSV
satellite replication, but satellite RNA may not be detected in uninfected tissue due to the
satellite’s potential dependence on the TRoV transport protein for cell-to-cell and
systemic movement. Thus, a double-transgenic plant system was established which
expressed both genes. Plants transformed with TROVPOL and confirmed to be
expressing the gene were transformed by Agrobacterial-mediated transformation with
pBI121 constructs harbouring the TRoV transport protein gene (TROVTP) (Fig. 23). It
was necessary to use a binary vector with antibiotic resistance other than Hygromycin in
order to be able to screen plantlets derived from calli transformed with both genes;
pBI121 (Fig. 14) provides Kanamycin resistance in both bacterial and plant cultures.
77
Figure 23. Confirmation of TROVTP clones digested with XbaI and SacI.
Lane A: 100 bp DNA ladder. Lanes B, C, E: pBI121 with successfully incorporated
TROVTP gene insert, releasing the expected 480 bp fragment following double digestion
with XbaI and SacI. Lane D: Empty pBI121.
D E C B A
480 bp
78
4. 3 TESTS OF SUSCEPTIBILITY TO TURNIP ROSETTE
VIRUS AND LTSV SATELLITE RNA IN VARIOUS
PLANT SPECIES
Infectivity assays were performed on several plant species to determine their
capacity to support the replication of TRoV and LTSV. Due to the reliance of plant
viruses on various host factors that interact with viral RdRP for polymerase activity, it
was important to develop the transgenic system in plants that naturally support TRoV
viral replication. The agrobacterial transformation protocol for N. benthamiana has been
well established with relatively high efficiency, and the species is a host to a wide array
of plant viruses. N. bethamiana was therefore chosen as a good candidate for TRoV and
LTSV infectivity tests. Two sets of five plants (1 month old) were treated: one group of
plants was inoculated with TRoV alone and the other set with LTSV alone. Healthy
turnip was also inoculated with TRoV, while healthy T. foenum-graecum plants were
treated with LTSV, as a positive control for the quality of inoculum; these plants serve as
natural hosts for the respective viruses. Plants were maintained in the greenhouse for two
to three weeks; uninoculated, newly grown leaves were collected 14 to 21 days post
inoculation. Total RNA was extracted from these uninoculated leaves and RT-PCR was
performed to determine the presence of TRoV or LTSV RNA (TROV and LTSV primers
as in Table 4). While TRoV and LTSV were well replicated in turnip and T. foenum-
graecum plants respectively, there was no viral RNA in the uninfected tissue of N.
79
benthamiana that had been treated with the same inocula (Fig. 24). This clearly indicated
that N. benthamiana does not support the replication of either virus and was thus not a
suitable plant species for transgenic development.
An identical infectivity assay was performed on N. clevelandii, another tobacco
variety, however it was similarly found not to be a host for either TRoV or LTSV.
Callaway et al. (2004) had previously reported that multiple ecotypes of
Arabidopsis thaliana, including Columbia, were found to be susceptible to TRoV. To
confirm this, and to check whether TRoV would be able to support the replication of
LTSV satellite RNA in this plant species, the bottom leaves of two sets of A. thaliana
plants (5 plants per set) were inoculated with either TRoV alone or TRoV together with
LTSV satellite RNA. The same treatment was replicated in healthy turnip plants (positive
control), whereas uninfected wild-type Arabidopsis plants were used as a negative
control. New uninoculated leaves were collected two weeks post inoculation and RT-
PCR for both TRoV and LTSV satellite RNA was performed on extracted RNA. RNA of
both the helper virus and the LTSV satellite were detected in uninoculated tissue of
treated A. thaliana (Fig. 25), indicating that A. thaliana is a not only a host for the
replication of genomic TRoV RNA but also capable of supporting LTSV satellite
replication.
80
Figure 24. Verification of the susceptibility of N. benthamiana for infection by TRoV and
LTSV. Lane A: 100 bp DNA ladder. Lane B: Expected 255 bp TROV PCR product from
TRoV-infected turnip (as positive control). Lane C: Expected 150 bp LTSV PCR product
from LTSV-infected T. foenum-graecum (as positive control). Lane D: TROV PCR product
of TRoV-infected N. benthamiana. Lane E: LTSV PCR product of LTSV-infected N.
benthamiana. Lane F: TROV PCR product of uninfected wild-type N. benthamiana. Lane
G: LTSV PCR product of uninfected wild-type N. benthamiana.
A B C D E F G
255 bp
150 bp
81
Figure 25. Verification of the susceptibility of A. thaliana for the replication of TRoV alone
and TRoV together with LTSV satellite RNA. RT-PCR products were analyzed on a 1.5%
agarose gel to determine the capacity for replication and systemic infection in the host. Lane A:
100 bp DNA ladder. Lane B: Expected 255 bp TROV PCR product from TRoV-infected turnip
(positive control). Lane C: Expected 200 bp LTSV satellite PCR product from turnip infected
with TRoV and LTSV satellite RNA (positive control). A 522 bp band is also visible due to the
presence of concatamers (200 + 322 bp on dimer transcript). Lane D: 255 bp TROV PCR
product of TRoV-infected A. thaliana. Lane E: 200 bp LTSV satellite PCR product of A.
thaliana inoculated with TRoV and LTSV satellite RNA. Lane F: TROV PCR product of
uninfected wild-type A. thaliana. Lane G: LTSV satellite PCR product of uninfected wild-type
A. thaliana.
A B C D E F G
255 bp 200 bp
522 bp
82
4. 4 PRODUCTION AND ANALYSIS OF TRANSGENIC
PLANTS
4. 4. 1 ANALYSIS OF TRANSGENIC ARABIDOPSIS THALIANA PLANTS
PRODUCED USING THE FLORAL DIP TECHNIQUE
Four to five-week old Arabidopsis thaliana (ecotype Columbia) plants were used
for agrobacterial infiltration. Once mature, seeds of treated plants were harvested and
screened on Hygromycin selection media. From the growth of seeds on Hygromycin, the
transformation efficiency was determined to be approximately 1%. Plants that developed
roots were presumed to be potential transgenics and were transferred to soil, while leaf
samples were collected for total DNA and total RNA extraction (Fig. 26). PCR and RT-
PCR, respectively, were used to confirm gene presence and gene expression in selected
plants (Fig. 27) using internal gene primers (Table 4). TROVP_iF and TROVP_iR were
used as internal primers for the TROVPOL insert while TROVT_iF and TROVT_iR
were used as forward and reverse (respectively for both genes) internal primers for the
TROVT insert (Table 4).
Seeds from confirmed transgenic F1 plants were sterilized and allowed to
germinate on MS media with 20 µg/mL Hygromycin; Hygromycin resistance was
observed in 75% of seeds, corresponding to classical Mendelian genetics. Two-week old
83
plants were transferred to soil and grown for three weeks prior to inoculation with TRoV
and LTSV satellite RNA.
Figure 26. Confirmation of the integrity of total RNA extracted from A. thaliana.
RNA was extracted from TROVPOL and TROVT lines and, due to high susceptibility to
degradation, was viewed on a 1.5% agarose gel to verify RNA quality prior to RT-PCR.
Distinct rRNA bands can be seen and tRNAs are indicated. Lanes A – C: total RNA from
various A. thaliana TROVPOL lines. Lanes D – F: total RNA from various A. thaliana
TROVT lines.
E F D C B A
tRNAs
84
Figure 27. PCR confirmation of TROVPOL and TROVT transgenes in A. thaliana.
Total DNA was extracted from TROVPOL and TROVT Arabidopsis lines, and PCR
products using internal primers for both genes were analyzed on a 1.5% agarose gel. Lane
A: 100 bp DNA ladder. Lane B: Internal TROVPOL PCR product from RT_PCR on
TRoV RNA (positive control for primers) Lane C: Internal TROVT PCR product from RT-
PCR on TRoV RNA (positive control for primers) Lane D: Internal TROVPOL PCR
product from TROVPOL Arabidopsis total DNA Lane E: Internal TROVT PCR product
from TROVT Arabidopsis total DNA. Lane F: Internal TROVT PCR on wild-type
Arabidopsis Lane G: Internal TROVPOL PCR on wild-type Arabidopsis.
F G E D C B A
244 bp 230 bp
85
4. 4. 2 CONFIRMATION OF TRANSGENIC N. BENTHAMIANA AND
N. TABACUM CV XANTHI PLANTS
Leaf discs from one-month old N. benthamiana and N. tabacum cv Xanthi plants
were used for infiltration with TROVCP_LTSVsatF and TROVCP_LTSVsatR
agrobacteria, in separate preparations. Consequently, TROVCP_LTSVsatF and
TROVCP_LTSVsatR transgenic plants of both tobacco species were generated.
Chromosomal DNA was isolated from leaf samples of potential transgenic plants, and
PCR was performed to confirm transgene presence; TROVCP_iF was used as the
forward primer and TROVCP_iR was used as the reverse primer (Table 4). A 250-bp
PCR product was produced from the chromosomal DNA of successfully transformed
plants (Fig. 28).
86
Figure 28. PCR confirmation of TROVCP_LTSVsat transgenes in N. benthamiana. Total DNA
was extracted from TROVCP_LTSVsatF and TROVCP_LTSVsatR N. benthamiana lines. PCR was
performed using internal primers for the insert (TROVCP_iF, TROVCP_iR) and PCR products were
analyzed on a 1.5% agarose gel. Lane A: 100 bp DNA ladder. Lane B: Internal TROVCP PCR
product from RT-PCR on TRoV RNA (positive control for primers) Lane C: Internal TROVCP PCR
product from wild-type N. benthamiana total DNA Lane D: Internal TROVCP PCR product from
TROVCP_LTSVsat F N. benthamiana total DNA. Lane E: Internal TROVCP PCR product from
TROVCP_LTSVsatR N. benthamiana total DNA.
A B C D E
250 bp
87
4. 5 DETERMINATION OF REQUIREMENT(S) FOR
REPLICATION OF LTSV SATELLITE RNA
Transgenic TROVPOL and TROVT A. thaliana plants were generated through
floral-dip agrobacterial infiltration and F1 seeds were screened on MS media with
Hygromycin. Plants with Hygromycin resistance were maintained in growth chambers
and were verified for gene presence and gene expression by PCR (total chromosomal
DNA) and RT-PCR (total extracted RNA, DNase treated). F2 seeds were collected from
confirmed lines of plants expressing the TROV RNA-dependent RNA polymerase gene
(TROVPOL) and TROV transport protein gene (TROVT).
Once the base leaves of transgenic plants were broad enough for infection, LTSV
satellite RNA was prepared by in vitro run-off transcription. pBS clones of the LTSV
satellite dimer were linearized with HindIII and the T7 RNA polymerase was used to
produce LTSV satellite dimer RNA transcripts. Samples from all reactions were viewed
on a 1.5% agarose gel to confirm successful transcription (Fig. 29).
Mechanical inoculation was used to infect TROVPOL, TROVT, and wild-type A.
thaliana with transcripts of LTSV satellite RNA. The leaves were first gently brushed
with cotton to break fine leaf hairs and allow sites for RNA entry. Six wild-type plants
were then treated with TRoV (helper virus) together with LTSV satellite RNA transcripts
(as a positive control); 0.01 mg of purified TRoV was administered to three leaves on
each plant, and 10 µL of a 50-µL transcription reaction was added to each of the same
leaves. Six further plants of transgenic TROVPOL and TROVT A. thaliana were used to
88
test whether LTSV satellite RNA would be able to replicate without a helper virus and in
the presence of only the TRoV RdRp or TRoV transport protein, expressed in the
respective transgenic lines. Three leaves of each of these plants were similarly inoculated
with LTSV satellite RNA transcripts.
Inoculated plants were maintained in growth chambers for two to three weeks
before uninoculated leaves were collected. Total RNA extraction was performed on each
of the three treatments: 1) wild-type A. thaliana infected with TRoV + LTSV satellite
RNA; 2) TROVPOL A. thaliana infected with LTSV satellite RNA alone; 3) TROVT A.
thaliana infected with LTSV satellite RNA alone. RT-PCR was performed with primers
for the detection of TRoV and/or LTSV satellite (Table 4). Results show that both TRoV
and LTSV satellite RNA were detected in the uninoculated tissue of wild-type A. thaliana
in treatment 1), and LTSV satellite RNA was present in the uninoculated tissue of A.
thaliana expressing the TRoV RNA-dependent RNA polymerase gene (TROVPOL). No
band for the LTSV satellite was observed in A. thaliana expressing the TRoV transport
protein gene (TROVT), or in wild-type, uninoculated A. thaliana (Fig. 30).
89
A B C D E F G
Figure 29. Run-off RNA transcripts of LTSV satellite dimer. pBS clones
containing the LTSV satellite dimer insert were linearized with HindIII prior to run-
off transcription with T7 RNA polymerase. 2.5 µL of each 50-µL transcription
reaction were loaded. Lane A: 100 bp DNA ladder. Lanes D, F, G: Bands of LTSV
satellite dimer RNA (approximately 600 nt) and self-spliced monomer (322 nt) as a
result of internal ribozyme activity. Lanes B, C, E: Empty lanes.
322 nt
600 nt
90
Figure 30. Verification of replication of LTSV satellite RNA in transgenic A. thaliana.
Total RNA was extracted from new uninoculated upper leaves of TROVPOL, TROVT, and
wild-type A. thaliana collected two to three weeks post inoculation. RT-PCR was performed
and PCR products were analyzed on a 1.5% agarose gel. Lane A: 100 bp DNA ladder. Lane
B: Expected 200 bp LTSVsat PCR product from A. thaliana inoculated with TRoV and
LTSV satellite RNA. Bands also appear at 522 bp and 844 bp (dimer and trimer forms at 322-
bp intervals) due to the production of concatamers in the rolling circle replication process.
Lane C: 200 bp LTSVsat PCR product from TROVPOL A. thaliana inoculated with LTSV
satellite RNA. A 522 bp band is also visible. Lane D: LTSVsat PCR product (no band) from
TROVT A. thaliana inoculated with LTSV satellite RNA. Lane E: LTSVsat PCR product (no
band) from uninoculated wild-type A. thaliana.
A B C D E
200 bp
522 bp
844 bp
91
4. 6 EXPRESSION OF TROV CAPSID PROTEIN IN
TRANSGENIC PLANTS
In order to determine whether the TRoV capsid protein was being translated in
TROVCP_LTSVsat transgenic plants, polyclonal antibodies to be used in
immunoblotting were raised against the TRoV capsid protein. TRoV was first propagated
in turnip plants and total virus was isolated by ultracentrifugation at concentrations of 2
to 3 mg/mL. To confirm TRoV presence, samples from each preparation were phenol-
chloroform extracted and RT-PCR was performed with primers for TROV (Table 4).
Confirmed TRoV samples (Fig. 31) were then combined with an equal volume of
Freund’s Incomplete Adjuvant and 1 mL of the mixture was subcutaneously injected into
four month-old male rabbits three times at two-week intervals. Blood was collected from
injected rabbits by cardiac puncture, and antibody serum was separated and used for
subsequent immunoblotting.
Total protein was extracted from TROVCP_LTSVsatF N. benthamiana
(previously confirmed as transgenic by PCR [using total chromosomal DNA] and RT-
PCR [using total RNA]) as well as wild-type N. benthamiana. A dot-blot was then
performed to test anti-serum reactivity with purified TRoV, purified PVX (negative
control), total protein from TROVCP_LTSVsatF N. benthamiana, and total protein from
wild-type N. benthamiana. While a strong antiserum response was detected to purified
TRoV, no difference in immune-reactivity was observed between transgenic and wild-
type N. benthamiana (Fig. 32).
92
A B C D E F G Figure 31. Confirmation of TRoV in
samples used for antibody production.
RT-PCR was used to confirm viral
presence in viral preparations isolated from
B. rapa. Lane A: 100 bp DNA ladder.
Lanes C, E – G: Expected 255 bp TROV
PCR product from purified TRoV. Lanes
B, D: Unloaded. 255 bp
A
A B C D
I
II
III
IV
V
VI
VII
Figure 32. Analysis of TRoV capsid
protein expression in transgenic plants
(dot-blot). Lane A: Purified TRoV Lane
B: Purified PVX Lane C: Total protein
extracted from TROVCP_LTSVsatF N.
benthamiana Lane D: Total protein
extracted from wild-type N. benthamiana.
Row I represents the starting dilution of
each sample, with two-fold dilutions
continuing to Row VII. Row IA: 1/500
Row IB: 1/10 Row IC: ½ Row ID: 1/2
93
5 Discussion
5. 1 REQUIREMENT(S) FOR LTSV SATELLITE RNA
REPLICATION
Infectivity assays of TROVPOL and TROVT transgenic A. thaliana demonstrated
that the TROV RNA-dependent RNA polymerase was necessary and sufficient for the
replication of LTSV satellite RNA. LTSV satellite RNA was detected by RT-PCR in the
uninoculated leaves of TROVPOL transgenic plants whose base leaves had been
inoculated with LTSV satellite RNA. Care was made to apply the viral satellite only to
the marked, treated leaves, and to collect plant tissue that was unlikely to have been in
contact with those leaves. Thus, the likelihood of contamination associated with the
experimental method is low, particularly as identical assays performed on TROVT and
wild-type A. thaliana produced no band following RT-PCR (Fig. 28). In addition to the
200 bp band expected from the PCR primers used to detect LTSV satellite RNA, a 522
bp band was also present following RT-PCR of infected TROVPOL A. thaliana. This
band size is exactly 322 bp greater than the 200 bp band expected from monomer satellite
RNA and is not present in TROVT or wild-type A. thaliana, but is also observed in RT-
PCR results of wild-type A. thaliana inoculated with LTSV satellite RNA together with
the TRoV helper virus. It is therefore a likely consequence of concatamer templates being
94
detected during cDNA synthesis – products of the satellite’s rolling circle replication
mechanism.
This is the first report providing direct evidence that attributes LTSV satellite
replication to the function of the helper virus’s RNA-dependent RNA polymerase.
However, by definition, the LTSV satellite shares no sequence homology with its helper
virus. A BLAST analysis comparing TRoV and LTSV satellite sequences revealed
identity at only two short sequences, 12 and 19 nucleotides in length, while there was no
homology between the sequences of the LTSV satellite and its natural helper virus,
LTSV. The recognition of satellite RNA by the RNA-dependent RNA polymerase of its
helper virus is therefore unlikely to be exclusive for specific sequences. It has been
demonstrated that the RdRp acts together with various host factors to recognize its
cognate RNA through interaction with specific cis-acting elements in the RNA template
(Buck, 1996). The polymerase can also accurately recognize the start site for transcription
of the genomic RNA even when its location on the template is artificially modified
(Miller et al., 1986). However, the viral RdRp is also able to synthesize 3’-coterminal
subgenomic RNAs using promoters located on minus-strand replication intermediates
that do not necessarily share sequence or structural homology to promoters that mediate
full-length complementary-strand synthesis (Levis et al., 1990). The ability of the same
replication machinery to drive satellite RNA replication further exemplifies the viral
polymerase’s capacity to recognize a variety of different promoter elements, of which the
features have yet to be studied.
The host-specificity of TRoV’s ability to support LTSV satellite replication has
been well established – the LTSV satellite is able to replicate in the presence of TRoV in
95
B. rapa, R. raphanistrum and S. arvensis, but not T. arvense or N. bigelovii (Sehgal et al.,
1993a). This suggests that satellite replication does not depend solely on the properties of
the helper virus; host factors must play a role as well. Accordingly, the results of
infectivity assays of wild-type and transgenic A. thaliana suggest that this plant species
produces host factors appropriate for the function of the RNA-dependent RNA
polymerase in replicating not only TRoV, but LTSV satellite RNA as well. While the
susceptibility of A. thaliana to TRoV had been previously reported by Callaway et al.
(2004), this study provides the first evidence of A. thaliana being a successful host for the
LTSV satellite when paired with TRoV as a helper virus.
Due to its dependence on a helper virus for replication, LTSV satellite RNA is
always found packaged within the viral particle of its helper. While this is an effective
mechanism for the perpetuation of its infection and an advantageous barrier from RNAse
degradation, the results of this study indicate that capsid packaging is not critical for
LTSVsat’s replication, internal transport, or protection from degradation. This is not the
case for all viruses; the capsid protein of RYMV has been demonstrated to be necessary
for cell-to-cell and systemic movement of this virus (Sivakumaran, 1998).
The satellite was unable to systemically infect the plant with only the added
presence of the predicted TROV transport protein, as no LTSV satellite RNA was found
in the total RNA of uninoculated tissue in treated transgenic TROVT A. thaliana.
Therefore, the protein encoded by ORF1 of TRoV is neither sufficient nor necessary (as
indicated by the TROVPOL results above) to support the replication of LTSV satellite
RNA. Moreover, the LTSV satellite does not rely on this protein for cell-to-cell
96
movement; LTSV satellite RNA was able to spread not only locally but also systemically
in TROVPOL plants.
Studies of cell-to-cell movement in plants indicate that plasmodesmata, the
narrow channels that link adjoining plant cell walls, have a molecular size exclusion limit
between 700 and 800 daltons – enough to allow for the transfer of carbohydrates, amino
acids, and inorganic ions throughout plant tissue (Tucker and Spunswick, 1985). The
transport protein has been implicated in facilitating the transport of viruses through
plasmodesmata by altering their function – the TMV transport protein has been reported
to increase the size exclusion limit of plasmodesmata to 9400 daltons (Wolf et al., 1989).
Molecular weight, however, does not correspond well to viral mobility as movement
depends greatly on the orientation and configuration of the viral RNA; with a 6395-
nucleotide RNA genome, TMV has a molecular weight of approximately 2, 174 kDa
(340 daltons/RNA nucleotide) yet is able to move through plasmodesmata. Wolf et al.
(1989) suggest instead an empirically-derived equivalency of 10,000 daltons
corresponding to 2.4 nm radius. Plasmodesmata would thus have a natural exclusion limit
of approximately 0.73 nm, with the TMV transport protein functionally increasing this
limit to approximately 2.4 nm. While there is currently no information on the size of
LTSV satellite RNA, it is likely that the radius of its rod-like secondary structure is less
than 0.73 nm, or the satellite is able to interact with plasmodesmata in such a way as to
allow for its movement without the assistance of other viral-encoded proteins.
Due to the locations of ribozyme cleavage sites on the LTSV satellite, dimer RNA
transcripts were used for plant inoculation (self-cleavage of full-length monomer
transcripts would have produced truncated, functionally deficient satellite sequences).
97
The successful replication of the LTSV satellite in TROVPOL A. thaliana suggests that
in vivo ribozyme activity of the lone LTSV satellite is efficient; dimer LTSVsat RNA is
able to self-cleave and circularize efficiently in vivo to subsequently undergo rolling
circle replication.
5. 2 ROLE(S) OF THE PROPOSED TROV TRANSPORT
PROTEIN GENE IN REPLICATION AND
MOVEMENT OF LTSV SATELLITE RNA
To allow for cell-to-cell movement and systemic infection, most plant viruses
encode their own movement proteins that allow for their passage through plasmodesmata.
While this function has not yet been assigned to any viral-encoded protein of the
sobemovirus family, the small P1 protein is a likely candidate. It is common to all viruses
in the family and is encoded by ORF1 at the 5’ end of the viral genome. It has been most
extensively studied in RYMV, and has been found to both bind ssRNA and serve as a
requirement for cell-to-cell movement of the virus without influencing the replication of
the genome (Bonneau et al., 1998). Consequently, the P1 gene of TRoV was predicted to
encode the viral transport protein. Like those of all other sobemoviruses, it is encoded at
the 5’ end of the RNA genome under ORF1 (68-505 nucleotides) and possesses its own
start and stop codon. The entire gene was amplified and cloned into pCambia 1300.
98
In this study, transgenic plants were produced that expressed the predicted P1
transport protein alone or in combination with the polymerase gene. Transgenic A.
thaliana (TROVT) was used to determine whether the TRoV transport protein was
sufficient to move the LTSV satellite RNA from cell-to-cell and address the hypothesis
that LTSV satellite RNA is capable of replication but requires the transport protein for
cell-to-cell and generalized movement. This hypothesis was proven incorrect (see above).
Transgenic plants expressing both the transport protein and the polymerase genes
were produced to investigate the replication and cell-to-cell movement requirements of
LTSV satellite RNA. Results obtained in this study revealed that LTSV satellite RNA
does not require the transport protein (see above). Consequently, no further studies
relating to the functionality and/ or roles(s) of the TRoV P1 transport protein were
conducted.
5. 3 SIMILARITY OF VIRUSOIDS (CIRCULAR
SATELLITE RNAS) TO VIROIDS
The LTSV satellite shares many common features with viroids. Both are small
(<400 nucleotides) single-stranded RNAs with high self-complementarity and very
similar rod-like secondary structures (Fig. 5). Viroids belonging to the Avsunviridae
family are able to self-cleave through hammerhead ribozymes and all viroids undergo
rolling circle replication, properties shared with LTSV satellite RNA (Flores et al., 2005).
99
Studies of viroid cell-to-cell movement have provided evidence to suggest that they
encode a motif that enables their transport through plasmodesmata (Ding et al., 1997). It
is likely that this characteristic is also a feature of the LTSV satellite, due to its ability to
move throughout the host without the aid of any helper virus-encoded proteins.
Moreover, viroids exist as naked RNAs, and the successful infection of the LTSV
satellite in transgenic TROVPOL plants in the absence of any capsid protein
demonstrates that packaging is not critical for the infection of LTSV satellite RNA.
The most distinguishing feature between the two classes of viral RNAs stems
from their requirements for replication. Unlike the dependence of LTSVsat on a helper
virus, viroids are able to replicate independently. While they similarly do not encode any
protein products, viroids exploit host factors in the nucleus (Pospiviroidae) or chloroplast
(Avsunviridae) of plant cells for their replication. Due to their multiple shared structural
and functional features, it is likely that the LTSV satellite shares an evolutionary
relationship with viroids. As demonstrated in this study, the satellite requires only the
polymerase of its helper virus for infection, and no additional viral-encoded protein
products for movement. Consequently, it is a possibility that viroids at one time also
shared this property with satellite RNAs, but lost their dependence on the viral
polymerase by exploiting the activity of the nuclear/chloroplastic polymerases of the
plant cell. It remains unclear how the DNA-dependent RNA polymerase is able to
transcribe the RNA genome of viroids, however this mechanism would have removed the
inherent limit of the presence of a helper virus and allowed viroids to infect much more
broadly.
100
5. 4 PACKAGING OF LTSV SATELLITE RNA
One of the goals of this study was to investigate whether LTSV satellite RNA is
able to be packaged independently – without the presence of a helper virus – in TRoV
capsid particles. The particles of LTSV, the natural helper virus of the LTSV satellite, are
always found to contain satRNA together with LTSV genomic RNA. Moreover,
packaging is selective for these RNA molecules (Forster & Jones, 1979). The
TROVCP_LTSVsat transgenic lines were developed to test whether TRoV particles can
assemble and encapsidate the LTSV satellite in the absence of TRoV. Transgene
presence was confirmed in TROV_LTSVsat plants by PCR, however immunoblots
performed to verify translation point to unsuccessful TRoV capsid protein production in
these transgenic plants. While antibodies raised against TRoV reacted with purified
TRoV and not an unrelated virus on dot-blots, no difference in reactivity was observed
between transgenic and wild-type plants. Furthermore, the results of a Western blot on
wild-type and transgenic lines (using antiserum to TRoV) revealed multiple bands and it
was not possible to ascertain the presence or absence of the capsid protein in transgenics.
The virus injected into rabbits during the production of polyclonal antibodies had been
propagated and extracted from turnip plants, and as isolation of the virus is not high in
purity, many plant proteins were present in the viral preparation. The observation of
multiple bands in the Western blot may be a consequence of the reactivity of antibodies
produced against plant proteins in addition to the viral proteins injected. Accordingly, the
antiserum was treated with total protein from N. benthamiana to allow any antibodies that
had been formed against plant proteins to react and precipitate, thus purifying the
101
antiserum for TRoV antibodies. A dot blot was performed again on total protein extracts,
however no difference in reactivity was observed for transgenic and wild-type plants.
These results suggest that translation of the TRoV capsid protein is unsuccessful
in TROVCP_LTSVsat transgenic plants. This may be related to the instability of the
transgene mRNA; given that the capsid protein gene is positioned in tandem with the
LTSV satellite dimer, self-cleavage of the satellite following transcription would leave
the TRoV capsid protein without a poly-A tail and therefore prone to degradation. This is
despite the additional 168 nucleotides that would remain following satellite self-cleavage.
In contrast, the lack of signal observed in dot blots using total protein extracts of
transgenic plants may be the result of low protein expression levels. While the 35S
promoter is expected to drive constitutive expression in transgenic tissue, further
investigation is necessary to confirm whether TRoV capsid proteins are being transcribed
and translated in transgenic lines before the assembly and packaging of viral packaging
can be examined.
102
6 Future Directions
6. 1 FUNCTION OF HOST FACTORS IN VIRUS-
ENCODED RNA POLYMERASE ACTIVITY
Previous studies have demonstrated the LTSV satellite replication is both host-
and helper virus – specific. With regards to the latter, the present study has confirmed
that the RNA-dependent RNA polymerase of TRoV is necessary and sufficient for the
replication of the LTSV satRNA. However, it is known that TRoV supports LTSV
satRNA in a host-specific manner, and the success of this study demonstrates that A.
thaliana provides the appropriate host factors to complement the virus-encoded RdRp in
replicating both satellite and helper RNA. It would be interesting to identify and
characterize the host factors involved in TRoV RdRp activity in A. thaliana and compare
them to host factors in plants which support only TRoV and purportedly lack the host
factors necessary for LTSV satRNA replication. This would contribute to our
understanding of the factors influencing host specificity in supporting LTSV satRNA.
A. thaliana is a well-characterized model plant with a fully described genome and
would therefore be useful for the study of proteins that act in concert with the viral-
encoded RNA polymerase. Additionally, the availability of Arabidopsis lines with
specific recessive mutations provides an elegant tool in identifying the wild-type gene
products involved in viral replication. In fact, several recessive host mutations affecting
103
the replication of other viruses have already been identified. The tom1 mutation in A.
thaliana has been found to suppress the multiplication of TMV-Cg and TMV-L
tobamoviruses, which also have single-stranded positive-sense RNA genomes. Moreover,
Yamanaka et al., (2000) have suggested that TOM1 participates in the formation of the
viral replication complex by anchoring it to membranes (it is known that tobamoviruses
replicate in a membrane-bound replication complex). Since this finding, TOM3 has been
added as host factor likely to be associated with the viral replication complex, with tom1
and tom3 double mutants fully eliminating the replicative ability of tobamoviruses
(Yamanaka et al., 2003). In studies of Cucumber mosaic virus (CMV), cum1 and cum2
recessive mutation of A. thaliana have been found to reduce the accumulation of CMV in
plants but not protoplasts. This has been linked to the inefficient expression of protein
products from CMV RNA3 that are involved in viral cell-to-cell movement. The fact that
these mutations affect protein but not RNA accumulation suggest that the mutations
inhibit the translation of CMV RNA3 (Yoshii et al., 2004). Together, these findings offer
insight into the role of the host in the replication and translation of other viruses and the
identified host factors may be targeted in the study of the replicative host requirements of
the LTSV satellite RNA.
In addition to host factor characterization, it would also be useful to examine
whether the polymerase alone would be capable of LTSV satellite replication in a non-
host. Subsequent to the suggestion that the host factors required for helper and satellite
replication are different, it is possible that plants lacking the appropriate proteins for the
replication of the genomic RNA nevertheless produce the factors required by the RdRp to
successfully replicate satellite RNA. This can be achieved through the development of
104
transgenic plants expressing the TROV RNA-dependent RNA polymerase gene in
species which are not susceptible to TRoV.
6. 2 TEMPLATE RECOGNITION BY TROV RNA-
DEPENDENT RNA POLYMERASE
While the role of the TRoV RdRp in replicating LTSV satRNA has been defined
in this study, the mechanism by which it does so remains unclear. Due to the lack of
sequence homology between the helper virus and satellite RNA, the identification of
sequences/structural domains of LTSV satRNA required for its detection and replication
by the viral RdRp would be important in furthering our understanding of its interaction
with the viral polymerase.
A series of mutations in the LTSV satellite sequence had been previously
generated in this laboratory (Gellatly et al., 2011). The replicative behaviour of these
mutants in transgenic TROVPOL plants would be interesting to study so as to determine
whether these select regions are important in satellite replication.
105
6. 3 CELL-TO-CELL AND VASCULAR MOVEMENT
The results of the current research have demonstrated that the LTSV satellite does
not require any viral-encoded proteins to facilitate its transport throughout plant tissue.
Nevertheless, the activity of plant factors may be involved in its transfer through
plasmodesmata, and it would therefore be informative to study whether LTSV satRNA
moves passively through plasmodesmata, relies on the activity of host proteins, or
encodes a motif that facilitates its transport through these size-selective channels.
Furthermore, the discovery that viroid RNAs interact with host chaperone proteins that
mediate their movement in plant vasculature (Gomez & Pallas, 2008) suggests a similar
relationship may exist in the case of LTSV satellite RNA.
6. 4 LTSV SATELLITE RNA PACKAGING
At this time, it is necessary to confirm the translation and assembly of TRoV
capsid proteins in TROVCP_LTSVsat transgenic plants before analyses of LTSV satellite
packaging ability can be performed. Once verified, examination of whether LTSV
satRNA can be packaged in viral particles without the presence of a helper virus would
provide important insight into both the mechanism of satellite packaging and the
assembly requirements of the capsid coat itself. Furthermore, the present development of
transgenic lines expressing the LTSV satellite in both forward- and reverse- sense
orientations (together with the TRoV capsid protein in TROVCP_LTSVsat tobacco)
106
would allow for the determination of whether directionality is important in the packaging
of LTSV satellite RNA.
An additional point of study is the determination of whether the sequence and/or
structure of LTSV satellite RNA is implicated in its interaction with the TRoV capsid
protein. The aforementioned LTSV satellite mutants could be tested for their capacity to
be packaged by the capsid proteins. Such experiments would provide insight into the
complexity of the satellite’s signaling and protein interactions involved in encapsidation.
107
7 References
Abad-Zapatero C., Abdel-Meguid S.S., Johnson J.E., Leslie A.G.W., et al. (1980)
Structure of southern bean mosaic virus at 2.8 Å resolution. Nature, 286: 33–9.
AbouHaidar M.G., and Y.C. Paliwal. (1988) Comparison of the nucleotide sequences of
the viroid-like satellite RNA of the Canadian and Australasian strains of lucerne
transient streak virus. Journal of General Virology, 69: 2369–73.
Bakker W. (1974) Characterization and ecological aspects of rice yellow mottle virus in
Kenya. Agricultural Research Report, Wageningen: Agricultural University
Publishing.
Blackstock J.M. (1978) Lucerne transient streak and lucerne latent, two new viruses of
lucerne. Australian Journal of Agricultural Research, 29: 291-304.
Bonfiglioli R.G., McFadden G.I., and R.H. Symons. (1994) In situ hybridization localizes
avocado sunblotch viroid on chloroplast thylakoid membranes and coconut c
adang-cadang viroid in the nucleus. The Plant Journal, 6: 99–103.
Bonneau C., Brugidou C., Chen L., Beachy R. N., and C. Fauquet. (1998) Expression of
the rice yellow mottle virus P1 protein in vitro and in vivo and its involvement in
virus spread. Virology, 244: 79–86.
Branch A.D., and H.D. Robertson. (1984) A replication cycle for viroids and other small
infectious RNAs. Science, 223: 450–4.
Brugidou C., Holt C., Yassi M.N., Zhang S., Beachy R., Fauquet C. (1995) Synthesis of
an infectious full-length cDNA clone of rice yellow mottle virus and mutagenesis
108
of the coat protein. Virology, 206: 108–115.
Buck, K.W. (1996) Comparison of the replication of positive-stranded RNA viruses of
plants and animals. Advances in Virus Research, 47: 159-251.
Collins R.F., Gellatly D.L., Sehgal O.P., and M.G. AbouHaidar. (1998) Self-cleaving
circular RNA associated with rice yellow mottle virus is the smallest viroid-like
RNA. Virology, 241: 269-75.
Diener T.O. (1971) Potato spindle tuber “virus”: a plant virus with properties of a free
nucleic acid. III. Subcellular location of PSTV-RNA and the question of whether
virions exist in extracts or in situ. Virology, 43: 75–89.
Diener T.O. (2001) The viroid: biological oddity or evolutionary fossil? Advances in
Virus Research, 57: 137–84.
Ding B., Kwon M.O., Hammond R., and R.A. Owens. (1997) Cell-to-cell movement of
potato spindle tuber viroid. The Plant Journal, 12: 931–6.
Edwards R.A. and F. Rohwer. (2005) Viral metagenomics. Nature Reviews
Microbiology. 3 (6): 504-10.
Flores R., Hernández C., De la Peña M., Vera A., and J.A. Daròs. (2001) Hammerhead
ribozyme structure and function in plant RNA replication. Methods in
Enzymology. 341: 540–52.
Flores R., Delgado S., Gas M.E., Carbonell A., et al. (2004) Viroids: the minimal non-
coding RNAs with autonomous replication. FEBS Letters, 567: 42–8.
Flores, R., Hernández C., Martinez de Alba A.E., Daròs J.A., and F. Di Serio. (2005)
Viroids and viroid-host interactions. Annual Review of Phyopathology, 43: 117-
39.
109
Forster A.C. and R.H. Symons. (1987a) Self-cleavage of a virusoid RNA is performed
by the proposed 55-nucleotide active site. Cell, 50: 9-16.
Forster A.C. and R.H. Symons. (1987b) Self-cleavage of plus and minus RNAs of a
virusoid and a structural model for the active sites. Cell, 49: 211-220.
Francki R.B., Randles J.W., Hatta T., Davies C., et al. (1983) Subterranean clover
mottle virus: another virus from Australia with encapsidated viroid-like RNA.
Plant Pathogens, 32: 47-59.
Francki, R.B. (1985). Plant virus satellites. Annual Review of Microbiology, 39: 151-74.
Ghosh A., Rutgers T., Ke-Qiang M., and P. Kaesberg. (1981) Characterization of the coat
protein mRNA of southern bean mosaic virus and its relationship to the genomic
RNA. Journal of Virology, 39: 87–92.
Gómez G, and V. Pallás. (2001) Identification of an in vitro ribonucleoprotein complex
between a viroid RNA and a phloem protein from cucumber plants. Molecular
Plant–Microbe Interactions, 14: 910–13.
Gould A.R. and T. Hatta. (1981) Studies on encapsidated viroid-like RNA. III.
Comparative studies on RNAs isolated from velvet tobacco mottle virus and
solanum nodiflorum mottle virus. Virology, 109: 137-47.
Greber R.S. (1981) Some characteristics of solanum nodiflorum virus – a beetle-
transmitted isomeric virus from Australia. Australian Journal of Biological
Science, 34: 369-78.
Hacker D. L. (1995) Identification of a coat protein binding site on southern bean mosaic
virus RNA. Virology, 207:562–5.
Hermodson M. A., Abad-Zapatero C., Abdel-Meguid S. S., Pundak S., Rossmann M. G.,
110
and J.H. Tremaine. (1982) Amino acid sequence of southern bean mosaic virus
coat protein and its relation to the three-dimensional structure of the virus.
Virology, 119: 133–49.
Hollings M., and O.M. Stone. (1973) Turnip rosette virus. CMI/AAB Description of Plant
Viruses. Commonwealth Mycological Institute and Association of Applied
Biologists. Warwick, England.
Hsu C.H., White J.A., and O.P. Sehgal. (1977) Assembly of southern bean mosaic virus
from its two subviral intermediates. Virology, 81: 471–5.
Hutchins C,. Rathjen P.D., Forster A.C., and R.H. Symons. (1986) Self-cleavage of plus
and minus RNA transcripts of avocado sunblotch viroid. Nucleic Acids Research,
14: 3627–40.
Hull R. (1995) Sobemovirus. Classification and Nomenclature of Viruses. Sixth Report
of the International Committee on Taxonomy of Viruses. Eds. Murphy F.A.,
Fauquet C.M., Bishop D.H.L., Ghabrial S.A., Jarvis A.W., Martelli G.P., Mayo
M.A., and M.D. Summers. Vienna: Springer Publishing, pp. 376-78.
Johnson, J.E. (2008) Multi-disciplinary studies of viruses: The role of structure in
shaping the questions and answers. Journal of Structural Biology, 163 (3): 246-
53.
Jones A.T. and M.A. Mayo. (1984) Satellite nature of the viroid-like RNA-2 of solanum
nodiflorum mottle virus and the ability of other plant viruses to support the
replication of viroid-like RNA molecules. Journal of General Virology, 65: 1713-
21.
Kado, C.I. (1967) Biological and biochemical characterization of sowbane mosaic virus.
111
Virology, 31: 217-29.
Kiberstis P. A., and D. Zimmern. (1984) Translational strategy of solanum nodiflorum
mottle virus RNA: synthesis of a coat protein precursor in vitro and in vivo.
Nucleic Acids Research, 12: 933–43.
Koonin E.V., Senkevich T.G., and V.V. Dolja. (2006) The ancient Virus World and
evolution of cells. Biology Direct, 1: 29.
Levis, R., Schlesinger S., and H. V. Huang. (1990) Promoter for sindbis virus RNA-
dependent subgenomic RNA transcription. Journal of Virology, 64: 1726-33.
Lima M.I., Fonseca M.E.N., Flores R., and E.W. Kitajima. (1994) Detection of avocado
sunblotch viroid in chloroplasts of avocado leaves by in situ hybridization.
Archives of Virology, 138: 385–90.
Mäkinen K., Næss V., Tamm T., Truve E., Aaspõllu A., and M. Saarma. (1995) The
putative replicase of the cocksfootle mottle sobemovirus is translated as part of
the polyprotein by -1 ribosomal frameshift. Virology, 207: 566-71.
Mang K.Q., Gosh A., and P. Kaesberg. (1982) A comparative study of the cowpea and
bean strains of southern bean mosaic virus. Virology, 116: 264-74.
Maniatis, T., Fritsch, E. F. and J. Sambrook. (1982) Molecular Cloning, A Laboratory
Manual. Cold Spring Harbor, N.Y.: Cold Spring Harbour Laboratory Press.
Miller, W.A., Bujarski J.J., Dreher T.W., and T. C. Hall. (1986) Minus-strand initiation
by brome mosaic virus replicase within the 3′ tRNA-like structure of native and
modified RNA templates. Journal of Molecular Biology, 187: 537-46.
Miller W. A., Dinesh-Kumar S. P., and C.P. Paul. (1995) Luteovirus gene expression.
Critical Reviews in Plant Sciences, 14: 179–211.
112
Mohamed N.A. and D.W. Mossop. (1981) Cynosurus and cocksfoot mottle viruses: a
comparison. Journal of General Virology, 55: 63-74.
Morris-Krsinich B. A. M., and R. Hull. (1981) Translation of turnip rosette virus RNA in
rabbit reticulocyte lysates. Virology, 114: 98–112.
Morris-Krsinich B.A.M. and R.L.S. Forster. (1983) Lucerne transient streak virus RNA
and its translation in rabbit reticulocyte lysate and wheat germ extract. Virology,
128: 176-85.
Paliwal, Y.C. (1983) Identification and distribution in eastern Canada of Lucerne
transient streak, a virus newly discovered in North America. Canadian Journal of
Plant Pathology, 5: 75-80.
Paliwal, Y.C. (1984a) Properties of a Canadian isolate of lucerne transient streak virus
and further evidence of similarity of the virus to sobemoviruses. Canadian
Journal of Plant Pathology, 6: 1-92.
Paliawal, Y.C. (1984b) Interction of the viroid-like RNA-2 of lucerne transient streak
virus with southern bean mosaic virus. Canadian Journal of Plant Pathology, 6:
93-184.
Ramsdell D.C. (1979) Blueberry shoestring virus. CMI/AAB Description of Plant
Viruses. Commonwealth Mycological Institute and Association of Applied
Biologists. Warwick, England.
Randles J.W., Davies C., Hatta T., Gould A.R., and R.I.B. Francki. (1981) Studies on
encapsidated viroid-like RNA. I. Characterization of velvet tobacco mottle virus.
Virology, 108: 111-122.
Revill P.A., Davidson A.D., and P.J. Wright. (1999) Identification of a subgenomic
113
mRNA encoding the capsid protein of mushroom bacilliform virus, a single-
stranded RNA mycovirus. Virology, 260: 273-76.
Roossinck, M.J., Sleat D., and P. Palukaitis. (1992) Satellite RNAs of plant viruses:
structures and biological effects. Microbiology Reviews, 56: 265-279.
Rossmann M.G., Abad-Zapatero C., Hermodson M.A., and J.W. Erickson. (1983)
Subunit interactions in southern bean mosaic virus. Journal of Molecular Biology,
166: 37–73.
Rutgers T., Salerno-Rife T., and P. Kaesberg. (1980) Messenger RNA for the coat protein
of southern bean mosaic virus. Virology, 104: 506-09.
Sänger H.L., Klotz G., Riesner D., Gross H.J., and A. Kleinschmidt. (1976) Viroids are
single-stranded covalently closed circular RNA molecules existing as highly base-
paired rod-like structures. Proceedings of the National Academy of Sciences
United States of America, 73: 3852–6.
Savithri H.S., and J.W. Erickson. (1983) The self-assembly of the cowpea strain of
southern bean mosaic virus: formation of T = 1 and T = 3 nucleoprotein particles.
Virology, 126: 328–35.
Sehgal O.P., Sinha R.C., Gellatly D.L., Ivanov I., and M.G. AbouHaidar. (1993)
Replication and encapsidation of the viroid-like satellite RNA of lucerne transient
streak virus are supported in divergent hosts by cocksfoot mottle virus and turnip
rosette virus. Journal of General Virology, 74: 785-8.
Sheldon C.C. and R.H. Symons. (1989) Mutagenesis analysis of a self-cleaving RNA.
Nucleic Acids Research, 17: 5679-85.
Sivakumaran K., Fowler B. C., and D.L. Hacker. (1998a) Identification of viral genes
114
required for cell-to-cell movement of southern bean mosaic virus. Virology, 252:
376–386.
Sivakumaran K., and D.L. Hacker. (1998b) The 105-kDa polyprotein of southern bean
mosaic virus is translated by scanning ribosomes. Virology, 246: 34–44.
Tamm T., and E. Truve. (2000a) Sobemoviruses. Journal of Virology, 74 (14): 6231-41.
Tamm T., and E. Truve. (2000b) RNA-binding activities of cocksfoot mottle
sobemovirus proteins. Virus Research, 66: 197–207.
Taylor J.M. (2003) Replication of human hepatitis delta virus: recent developments.
Trends in Microbiology, 11: 185–90.
Tremaine J.G., and R.I. Hamilton. (1983) Southern bean mosaic virus. CMI/AAB
Descriptions of Plant Viruses. Commonwealth Mycological Institute and
Association of Applied Biologists. Warwick, England.
Tucker E.B., and R.M. Spanswick. (1985) Translocation in the stamina hairs of
Setcreasea purpurea II. Kinetics of intercellular transport. Protoplasm, 128: 167-
182.
Verhoeven, J.T.J, Roenhorst, D.E., Lesemann, E., Segundo, L. et al. (2003) Southern
bean mosaic virus the causal agent of a new disease of Phaseolus vulgaris beans
in Spain. European Journal of Plant Pathology, 109: 935-41.
Voinnet O., Pinto Y. M., and D.C. Baulcombe. (1999) Suppression of gene silencing: a
general strategy used by diverse DNA and RNA viruses of plants. Proceedings of
the National Academy of Sciences United States of America, 96:14147–52.
Wei T., Zhang C., Hong J., Xiong R., et al. (2010) Formation of complexes at
plasmodesmata for potyvirus intercellular movement is mediated by viral protein
115
P3N-PIPO. Public Library of Science Pathogens, 6 (6): e1000962.
Wu S., Rinehart C. A., and P. Kaesberg. (1987) Sequence and organization of southern
bean mosaic virus genomic RNA. Virology, 161: 73–80.
Zaumeyer W.J. and L.L. Harter. (1943) Inheritance of symptom expression of bean
mosaic virus. Journal of Agricultural Research, 67: 295-300.
Zavriev S. K., Hickey C. M., and S.A. Lommel. (1996) Mapping of the red clover
necrotic mosaic virus subgenomic RNA. Virology, 216: 407–10.
Zhu Y., Qi Y., Xun Y., Owens R., and B. Ding. (2002) Movement of potato spindle tuber
viroid reveals regulatory points of phloem-mediated RNA traffic. Plant
Physiology, 130: 138–46.
