Replication infidelity via a mismatchwith Watson–Crick geometryKatarzyna Bebeneka,b, Lars C. Pedersenb, and Thomas A. Kunkela,b,1

aLaboratory of Molecular Genetics and bLaboratory of Structural Biology, National Institute of Environmental Health Sciences, National Institutes ofHealth, Department of Health and Human Services, Research Triangle Park, NC 27709

Edited by Stephen J. Benkovic, Pennsylvania State University, University Park, PA, and approved December 6, 2010 (received for review August 30, 2010)

In describing the DNA double helix, Watson and Crick suggestedthat “spontaneous mutation may be due to a base occasionallyoccurring in one of its less likely tautomeric forms.” Indeed, amongmany mispairing possibilities, either tautomerization or ionizationof bases might allow a DNA polymerase to insert a mismatch withcorrect Watson–Crick geometry. However, despite substantialprogress in understanding the structural basis of error preventionduring polymerization, no DNA polymerase has yet been shown toform a natural base–basemismatchwithWatson–Crick-like geome-try. Here we provide such evidence, in the form of a crystal struc-ture of a human DNA polymerase λ variant poised to misinsertdGTP opposite a template T. All atoms needed for catalysis arepresent at the active site and in positions that overlay with thosefor a correct base pair. The mismatch has Watson–Crick geometryconsistent with a tautomeric or ionized base pair, with the pHdependence of misinsertion consistent with the latter. The resultssupport the original idea that a base substitution can originatefrom a mismatch havingWatson–Crick geometry, and they suggesta common catalytic mechanism for inserting a correct and an incor-rect nucleotide. A second structure indicates that after misinser-tion, the now primer-terminal G•T mismatch is also poised forcatalysis but in the wobble conformation seen in other studies,indicating the dynamic nature of the pathway required to createa mismatch in fully duplex DNA.

mutagenesis ∣ replication fidelity ∣ nascent base pair ∣ mispair

In their work describing the structure of DNA (1, 2), Watson andCrick proposed that spontaneous base substitutions could be a

consequence of bases spontaneously pairing in rare tautomericforms (1). They suggested two possible transition mispairs, G•Tand A•C, involving the enol form of guanine or thymine and theimino form of adenine or cytosine, respectively. Both mispairsfit well within the dimensions of the DNA double helix to pre-serve the geometry of a correct Watson–Crick base pair. Thus, thepotential importance of mispair geometry to base substitutionmutagenesis was implied even before the discovery of DNA poly-merases (3). Since then, many other mispairing possibilities havebeen proposed (4, 5), some involving ionized mispairs with cor-rect geometry (6). Moreover, many structural and biochemicalstudies of DNA polymerases have indicated that the fidelity ofDNA synthesis heavily depends on base pair geometry (7, 8).While all DNA polymerases studied to date can occasionallyincorporate an incorrect nucleotide, misincorporation is usuallyrare. This is because most DNA polymerases employ a series ofprechemistry conformational transitions as checkpoints for exclu-sion of incorrect substrates (9–11). For this reason it is difficult toobtain structural support for Watson and Crick’s hypothesis onthe origin of spontaneous base substitutions.

This difficulty is revealed by elegant structural studies of DNApolymerases in the process of preventing misincorporation. Mul-tiple crystal structures of polymerases with mismatched base pairsat the active site have been solved. For example, a number ofhigh-resolution structures are available of the large fragmentof Bacillus stearothermophilus DNA polymerase bound to pri-mer–terminal mispairs (12). They indicated that each of the 12

possible mispairs distorts the polymerase active site when presentat the primer terminus, causing polymerase stalling. The natureand extent of the distortion, and the effect on further extension,depends on the composition of the mispair. Distorted polymeraseactive site geometry has also been observed in the structures ofDpo4 (13) and Pol β (14), members of family Y and X, respec-tively, in ternary complexes with DNA and an incorrect incomingnucleotide. In the Dpo4 structure, the incoming dGTP formedeither a wobble base pair or was not coplanar with a templateT, and the incoming dGTP did not stack well with the primer–terminal base. Structures of Pol β complexes with DNA and anonhydrolyzable dAMPCPP opposite template G or C capturedthe enzyme in a closed conformation with the incoming incorrectnucleotide occupying a position similar to that of a correct incom-ing nucleotide. However, the templating nucleotide was shiftedupstream, such that the incoming incorrect dAMPCPP was boundopposite an abasic pocket. Thus, structures of DNA polymerasesbound to mismatched substrates have provided important insightsinto the mechanisms of polymerase error prevention. However,they leave open the question of how DNA polymerases actuallydo misinsert a natural (i.e., undamaged) incorrect dNTP.

Here we address this question by using DNA polymerase λ(Pol λ) as a structural model for misincorporation. Pol λ is amonomeric X family DNA polymerase that lacks a 3′ exonucleaseactivity (15, 16). Its cellular function is to fill short gaps in DNAgenerated during base excision repair and nonhomologous endjoining of double strand breaks in DNA. We previously describedseveral structures of Pol λ that provide information on how thispolymerase incorporates a correct dNTP (17–19). In addition, wedescribed structures of Pol λ containing single unpaired nucleo-tides in the template strand upstream of the active site (20, 21). Inthese structures, the active site geometry was consistent with cat-alysis, indicating that these structures are relevant to Pol λ’s abil-ity to generate single nucleotide deletion errors at a relativelyhigh rate (22). However, like many DNA polymerases, Pol λ isconsiderably more adept at preventing single base substitutionerrors that require misinsertion at the primer terminus followedby mismatch extension (7, 23). Consistent with this property, ourprevious attempts to obtain crystal structures of Pol λ with singlebase–base mismatches have met with limited success; i.e., thedescription of one mismatch containing structure with aberrant

Author contributions: K.B., L.C.P., and T.A.K. designed research; K.B. performed research;K.B., L.C.P., and T.A.K. analyzed data; and K.B., L.C.P., and T.A.K. wrote the paper.

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

Freely available online through the PNAS open access option.

Data deposition: The structure factors have been deposited in the Protein Data Bank,www.pdb.org (crystal structure of a polymerase lambda variant with a dGTP analog opposite atemplatingThasbeenassigned theRCSB ID code rcsb062557andPDB ID code3PML; ternarycrystal structure of polymerase lambda variantwith a GTmispair at the primer terminus hasbeen assigned theRCSB ID code rcsb062559andPDB ID code3PMN; ternary crystal structureof a polymerase lambda variant with a GT mispair at the primer terminus and sodium atcatalytic metal site has been assigned the RCSB ID code rcsb062584 and PDB ID code 3PNC).1To whom correspondence should be addressed. E-mail: kunkel@niehs.nih.gov.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1012825108/-/DCSupplemental.

1862–1867 ∣ PNAS ∣ February 1, 2011 ∣ vol. 108 ∣ no. 5 www.pnas.org/cgi/doi/10.1073/pnas.1012825108

Dow

nloa

ded

by g

uest

on

June

1, 2

020

geometry (24). During investigation of this error prevention abil-ity, we recently identified a derivative of Pol λ (25) that lacks fiveamino acids in a loop upstream of the polymerase active site (Polλ DL). Deleting these residues did not reduce catalytic activity oralter polymerase active site geometry for correct incorporation.However, Pol λ DL generates single base substitution errors atrates that increased for all twelve mismatches. This property isconsistent with the elimination of one (or more) of the kineticcheckpoints that prevent misincorporation (9). It is also consis-tent with quantum mechanical and molecular mechanical calcu-lations of Pol β, a homolog of Pol λ, indicating that the majorfactor preventing incorrect nucleotide insertion is the free energyrequired to achieve active site geometry compatible with catalysis(26). We posited that this energy barrier might be reduced in Pol λDL to the degree required to obtain structures of ternary Pol λDL–DNA-incorrect dNTP complexes with active site geometrythat is compatible with catalysis. We demonstrate here that thisis indeed the case.

Results and DiscussionStructure of a dG•T Mispair at the Polymerase Active Site. We wereable to crystallize Pol λ DL in complex with a physiologicallyrelevant one-nucleotide gapped DNA substrate and a nonhydro-lyzable derivative of dGTP (dGMPCPP) paired with template T.The 2.6-Å structure (PDB ID code 3PML) contains two Pol λDLternary (Pol λ + primer-template + incoming dGMPCPP) com-plexes in the asymmetric unit, designated molecules A and B. Theelectron density at the active site in molecule B is consistent withmultiple conformations for the template strand as well as forresidues Phe506, Arg514, and Arg517. One set of conformationsfor Phe506, Arg514, Arg517, and the template strand has beenmodeled in a manner similar to that of molecule A (precatalyticconformation, see below) (Fig. S1). The other conformation setresembles the inactive form of the molecule, similar to what hasbeen seen in the binary structures of polymerase λ, where Phe506is rotated toward Tyr505, Arg517 occupies the position of thetemplating base in the nacent binding pocket, and Arg514 is alsoshifted (Fig. S1). We modeled the dGMPCPP with full occu-pancy, suggesting that it is binding in both conformations but onlybase pairing with the template strand in the precatalytic confor-mation. The multiple conformations of template DNA in mole-cule B create a blurring of the bases, rendering tenuous anydiscussion of the precise positions of atoms.

Fortunately, the DNA and the protein are in a single confor-mation in molecule A, and this conformation overlays well (thermsd of 0.593 Å for 265 C-α atoms) with the structure of a ternarycomplex of Pol λ DL (25) containing correct incoming ddTTPpaired opposite template A (Fig. 1). This structure also overlayswell (Fig. 2A, the rmsd of 0.434 Å for 261 C-α atoms) with a tern-ary complex of wild-type Pol λ containing a correct A•dUMPNPPbase pair in the binding pocket (19). The use of nonhydrolyzablenucleotides in these studies, as initially used in studies of polβ (27), allows visualization of the geometry of the polymeraseactive site in a precatalytic state, yet containing all the atomsrequired for catalysis (Fig. 2B and Fig. S2), including the attack-ing 3′-oxygen and two metal ions. In the mismatched structure,two metal ions are bound at the active site, and they, and the cat-alytic carboxylates with which they coordinate, overlay well withthe equivalent atoms at the active site of the structure containingthe correct base pair (Fig. 2B). The coordination spheres of bothmetals have octahedral geometry (Fig. 2B) consistent with mag-nesium ions occupying both metal sites. In the G•T-containingstructure, the primer–terminal base pair occupies the same posi-tion as in the structure with the correct base pair, except for aslight twist in the position of the template strand base. The nas-cent mispair stacks with the primer–terminal correct base pair,just as observed in the structure with the correct base pair.The 3′-O of the primer–terminal nucleotide is in position for

in line attack on the α-phosphate of the incoming nucleotide(Fig. 2B), and these atoms are separated by 3.9 Å. This distanceis comparable to the separation between the 3′-O and the α-phos-phate observed in the structures of ternary complexes of wild-typePol λ (3.7 Å) (19), Pol β (3.4 Å) (28) and pol η (3.2 Å) (29), all ofwhich contain a correct nascent base pair. Therefore, active sitegeometry with the G•T mismatch is similar to that for the correctbase pair and is consistent with catalysis. This is particularlyinteresting because the incoming dG is paired with template Tin a Watson–Crick conformation (Fig. 4A and compare with 4B).Thus, the conformation of the dGMPCPP•T mispair within thePol λDL nascent base pair binding pocket and its position relativeto the primer–terminal base pair differs significantly from thatreported for the dGTP•T mispair in the structure of the Dpo4ternary complex (13).

pH Dependence of Single Nucleotide Misincorporation. ThedGMPCPP•T mispair in the Pol λ active site could conceivablycontain either an ionized or rare tautomeric base. At alkaline pH,the N3 of thymine and the N1 of guanine deprotonize, increasingthe ratio of ionized to tautomeric bases. Because the equilibriumbetween the keto and the rare enol tautomer is pH independent,the increase in ionized bases should concomitantly decrease theconcentration of the rare enol tautomer that could mispair.Consequently, as discussed by Yu et al. (6), if an ionized base isinvolved, the efficiency of dGTP misinsertion opposite templateT should increase with increasing pH, whereas if a rare tautomeris involved, the efficiency of dGTP misinsertion opposite tem-plate T should decrease with increasing pH. In an initial attemptto distinguish between the involvement of enol tautomers and

Fig. 1. Superposition of Pol λ DL ternary complexes. The complex with adGMPCPP•T nascent mispair [the protein is green, the primer strand is yellow,the template strand is orange, the incoming dGMPCPP is magenta, and theactive site metal ions (Me) are bright green] is overlaid with the ddTTP•Anascent base pair-containing complex, PDB ID code 3MGI (the protein is lightcyan, the primer strand is beige, the template strand is light brown, and theincoming ddTTP is dark brown).

Bebenek et al. PNAS ∣ February 1, 2011 ∣ vol. 108 ∣ no. 5 ∣ 1863

BIOCH

EMISTR

Y

Dow

nloa

ded

by g

uest

on

June

1, 2

020

ionized bases, we measured the efficiency of single nucleotidemisinsertion of dGTP opposite template T by Pol λ DL as a func-tion of pH. The results (Table 2 and Fig. S3) demonstrate thatwild-type Pol λ and Pol λ DL misinsert dGTP opposite templateT at substantially higher efficiencies in reactions performed atpH 9.0 as compared to pH 7. The relative misinsertion efficiency(fmis in Table 2), expressed as the ratio of catalytic efficiencies forincorrect dGTP relative to correct dATP, is increased by 90- and13-fold, respectively, for wild-type pol λ and pol λ DL. Theseincreases are in agreement with the results of Yu et al. (6) andare consistent with the possible involvement of an ionized base

pair. On the other hand, the distance (2.7 Å), between the O6atom of the guanine base and O4 of thymine in the dGMPCPP•Tmispair at the pol λ active site suggests that a proton could beinvolved in the hydrogen bond between the two, which is consis-tent with a tautomeric base pair.

Structure of a Ternary Complex of Pol λ DL with Primer–Terminal dG•TMispair. Stable misincorporation to yield a single base substitutionmutation requires that the G•T mismatch be extended by correctincorporation. To visualize this, we crystallized Pol λ DL in com-plex with a one-nucleotide gap DNA containing a G•T mispair at

Fig. 2. Watson–Crick conformation of a dGMPCPP•T mispair at the active site. (A) Superposition of the ternary complexes of Pol λ DL (green) in complex withDNA (primer strand is olive, template strand is orange) and incoming dGMPCPP (magenta) opposite template T (orange) and the WT Pol λ ternary complex(2PFO) (protein is gray, template strand is light orange, incoming dUMPNPP is light purple, and template adenine is brown. The metal ions A and B (Me) in thecomplex of Pol λ DL and WT Pol λ are green and purple, respectively. (B) Close up of the active site of the ternary complex of Pol λ DL wih the dGMPCPP•Tnascent mispair. The magnesium ions are green, and active site H2O molecules are light red.

Table 1. Crystallographic data and statistics

Dataset G•T nascent pocket (Mg, Mg) G•T primer terminus; (Mn, Mg) G•T primer terminus; (Na, Mg)

PDB ID code 3PML 3PMN 3PNCWavelength (Å) 1.000 1.5418 1.5418Unit cell (a,b,c) (Å) 97.04, 191.57, 59.08 56.39, 62.42, 139.88 56.18, 62.27, 139.82Space Group P21212 P212121 P212121Resolution (Å) 25.0–2.6 50.0–2.2 50.0–2.0# of observations 244,249 98,923 320,923Unique reflections 34,636 25,329 33,148Redundancy 7.1(7.0) 3.9(2.5) 9.7(5.7)Rsym (%) * † 7.0 (57.2) 9.0 (43.1) 8.2(53.7)I∕σI 10.6 (3.5) 17.6 (2.4) 9.5(2.5)Mosaicity range 0.5–1.1 1.2–1.7 0.4–0.5Completeness (%) 99.9 (99.8) 99.2 (98.2) 97.7(87.3)Refinement statistics

Rcryst‡ §, Rfree (%) 23.3, 27.1 21.3, 24.3 20.8, 23.6

No. of waters 168 202 310Overall Wilson B value (Å2) 53.1 41.1 38.3Average B for:Protein atoms 54.3 42.7 40.2DNA 58.9 31.9 28.5Incoming nucleotide 49.8 23.2 19.3Water 43.0 40.1 42.4rmsd from ideal values

Bond length (Å) 0.007 0.005 0.008Bond angle (°) 1.2 1.0 1.3Dihedral angle (°) 21.5 21.3 21.6Ramachandran statistics ¶

Favored (98%) regions (%) 93.9 96.0 96.5Allowed (>99.8%) regions (%) 99.8 99.7 100

*Rsym ¼ ∑ðjIi-hIijÞ∕∑ðIiÞ where Ii s the intensity of the ith observation and hIi is the mean intensity of the reflection.†Last resolution shell is in parentheses.‡Rcryst ¼ ∑ jjFoj-jFcjj∕∑ jFoj calculated from working dataset.§Rfree was calculated from 5% of data randomly chosen not to be included in refinement.¶Ramachandran results were determined by MolProbity.

1864 ∣ www.pnas.org/cgi/doi/10.1073/pnas.1012825108 Bebenek et al.

Dow

nloa

ded

by g

uest

on

June

1, 2

020

the 3′ terminus and correct dGMPCPP paired opposite templateC. The crystals refined to 2 Å and contained one molecule of theternary complex in the asymmetric unit (Table 1). The polymeraseand the template strand were in the active conformation, butcatalytic metal ion A did not have octahedral geometry, andthe attacking 3′-O was not in line with the α-phosphorus ofthe incoming nucleotide (Table 1, Fig. S4). Therefore, to obtaina structure of a catalytically competent complex we soaked thesecrystals in a solution containing MnCl2, a procedure that pre-viously induced active conformations with correct substratesbound to wild-type Pol λ (19) and Pol β (14). The resulting crystaldiffracted to 2.2 Å (Table 1). Just as for the G•T mismatch in thenascent base pair binding pocket (Fig. 2), this structure overlayswell with the precatalytic, wild-type Pol λ ternary complex(Fig. 3 A and B). Two metal ions are present (A ¼ manganese,B ¼ magnesium) and coordinated with octahedral geometry,all amino acid side chains are in their active conformations,and the 3′O on the primer–terminal mismatched dG is in linewith the α phosphorus of the incoming nucleotide (3.7 Å apart)and the leaving group; i.e., this geometry is consistent withcatalysis. However, unlike the G•T mismatch in the nascent basepair binding pocket, the template T of the primer–terminalmismatch is shifted toward the major groove, such that it is pairedwith the primer dG in a wobble conformation (Fig. 4A). This doesnot affect normal base pairing in the binding pocket, because theincoming correct dGMPCPP is paired with the templating C inthe standard Watson–Crick conformation (Fig. 4A).

Previous studies have described unusual, noncatalytic confor-mations of DNA polymerases bound to mismatched substrates

(12–14, 27), including G•Tmismatches in a wobble conformation(12, 13). Because these structures are inconsistent with catalysis,they have provided important insight into how base–base mis-matches are prevented during DNA synthesis. The present studycomplements those studies by providing structures of a DNApolymerase with a G•T mismatch whose geometry appears to beconsistent with misinsertion and with mismatch extension. Theresults suggest a catalytic mechanism for misinsertion and mis-match extension that is in common with correct incorporation,and they support Watson and Crick’s original idea that sponta-neous base substitutions, in this case A•T to G•C transitionmutations, may result from mismatches shaped like correct basepairs.

Materials and MethodsProtein Expression and Purification. Pol λ DL was expressed in Escherichia coliand purified as described (18).

Crystallization and Data Collection. Crystals of the G•T basepair in the nascentbinding pocket were obtained by the vapor diffusion sitting drop methodby mixing 1 ul of preequilibrated protein/DNA/dGMPCPP solution (9.7 μgprotein, 0.7 mM DNA, 1 mM dGMPCPP, 36 mM Tris, pH 7.5 and 10 mMMgCl2) with 1 ul of a reservoir solution consisting of 0.1 M NaCl, 0.1 M HepespH 7.5, and 10%PEG 4000. Crystals were transferred to a cryosolutionconsisting of 0.1 M Hepes pH 7.5, 0.1 M NaCl, 20% PEG 4000, 10 mMMgCl2, 1 mM dGMPCPP and 17.5% ethylene glycol, flash frozen in liquid ni-trogen, and then placed in a stream of nitrogen gas cooled to −180 C for datacollection. Data were collected at the SER-CAT beamline at the AdvancedPhoton Source. After the data had been processed and scaled, a model ofpolymerase lambda derived from the crystal structure of the binary complex

Table 2. pH dependence of misinsertion

dNTP Km (μM) kcat (1∕s) kcat∕Km fmis *

WT Pol λ

pH 7.0dATP 0.30 ± 0.08 0.02 ± 0.008 6.7 × 10−2 � 0.9 × 10−2

dGTP 5.1 ± 2.5 0.0003� 6.7 × 10−5 5.4 × 10−5 � 1.5 × 10−5 0.8 × 10−3

pH 9.0dATP 1.0 ± 0.40 0.012 ± 0.0035 1.2 × 10−2 � 0.25 × 10−2

dGTP 1.2 ± 0.40 0.001 ± 0.0003 8.6 × 10−4 � 3.1 × 10−4 72 × 10−3

Pol λ DL

pH 7.0dATP 0.3 ± 0.06 0.0055 ± 0.0013 1.9 × 10−2 � 1.5 × 10−2

zdGTP 13 ± 4.2 0.005 ± 0.0035 3.6 × 10−4 � 1.2 × 10−4 1.9 × 10−2

pH 9.0dATP 1.4 ± 0.40 0.013 ± 0.0035 1 × 10−2 � 0.058 × 10−2

dGTP 4.8 ± 1.09 0.012 ± 0.0042 2.5 × 10−3 � 1.1 × 10−3 25 × 10−2

The kinetic constants (shown with standard deviations) are an average of 3 to 5 independent determinations.*1fmis is the relative efficiency of misincorporation expressed as the ratio of ½kcat∕KmdGTP�∕½kcat∕KmdATP�.

Fig. 3. G•T terminal mispair in the ternry complex of Pol λ DL. (A) Superposition of Pol λ DL ternary complex with a G•T terminal mispair and the WT Pol λcomplex (2PFO). Pol λ DL is light gray, the template and primer strands are gray, and the G•T terminal mispair is bright green; the incoming dGMPCPP ismagenta, and the active site metal ions A and B are purple and pea green, respectively. In the WT Pol λ complex, the protein is light blue, the DNA is lightyellow, the incoming dUMPNPP is pink, and themetal ions A and B are light purple and dark green, respectively. (B) Close up of the active site of Pol λDL ternarycomplex with a G•T terminal mispair.

Bebenek et al. PNAS ∣ February 1, 2011 ∣ vol. 108 ∣ no. 5 ∣ 1865

BIOCH

EMISTR

Y

Dow

nloa

ded

by g

uest

on

June

1, 2

020

of Pol λ DL (PDB ID code 3MGH) was refined against the data utilizing thesame test reflections. The asymmetric unit consists of two molecules of poly-merase lambda each binding DNA and an incoming nucleotide.

A crystal of the G•T base pair at the primer terminus site with a Na1þ andMg2þ in the active site was obtained using the vapor diffusion sitting dropmethod by mixing 0.35 ul of preequilibrated protein/DNA/dGMPCPP solution(3.4 μg protein, 0.7 mM DNA, 1 mM dGMPCPP, 36 mM Tris pH 7.5, and 10 mMMgCl2) with 0.35 ul of 2 M formate. For data collection, a crystal was trans-ferred directly to 0.1 M Tris pH 7.5, 100 mM NaCl, 1 mM dGMPCPP, 2.2 M Naformate and 17.5% ethylene glycol. Data were collected on an in-houseMicroMax 007HF generator with VarimaxHF mirrors and a Saturn92 detectorto a resolution of 2.0 Å. The ternary complex with the G•T basepair in thenascent binding pocket was used as the search model for molecular replace-ment using MOLREP (30). The asymmetric unit consists of one molecule ofpolymerase λ with DNA and an incoming nucleotide bound. The structurewith two Mn2þ in the active site was obtained from a crystal from the samedrop as the Na/Mg dataset but soaked in 2 M formate and 20 mM MnCl2 for25 min before being transferred to the cryosolution consisting of 20 mMMnCl2, 0.1 M Tris pH 7.5, 100 mM NaCl, 1 mM dGMPCPP, 2.2 M Na formateand 17.5% ethylene glycol. The dataset was collected using the samein-house system at 2.2-Å resolution. Data were processed and the structurerefined using the same test reflections as for the Na1þ∕Mg2þ dataset. Alldata were processed using HKL2000 (31) and refined using iterative cyclesof refinement in CNS (32) and model building using O (33). The quality ofthe geometry for the structures was analyzed using Molprobity (34).

Kinetic Analysis of Nucleotide Insertion. The steady state measurements ofsingle nucleotide incorporation were performed as described in (25). DNAsubstrates were prepared by hybridizing a 32P-5′-end-labled 17-nucleotide

primer (P17T, 5′GTACGACTGAGCAGTAC) and a 14-nucleotide downstreamprimer (DPT, 5′ GCCGGACGACGGAG) with a phosphate on the 5′ end to a32-mer template (T32GT, 5′CTCCGTCGTCCGGCTGTACTGCTCAGTCGTAC) tocreate a one-nucleotide gap substrate. Reaction mixtures (10 μl) contained50 mM Tris, pH 7 or pH 9, 1 mM dithiothreitol, 4% glycerol, 0.1 mg∕ml bovineserum albumin, 2.5 mMMgCl2, 200 nMDNA, and 4 nM full-lengthWT pol λ orpol λ DL. Reactions were initiated by adding dATP at one of nine concentra-tions (0.05, 0.1, 0.2, 0.5, 1, 2, 5, 10, 20 μM) and incubated at 37 °C for 3 min. Tomeasure misinsertion, reaction mixtures contained 50 or 100 nM WT pol λ or5 or 7 nM pol λ DL. Reactions were initiated by adding dGTP at one of theconcentrations (1, 2, 5, 10, 25, 50, 100, or 150 μM to reactions with WT pol λand pol λ DL at pH 7 or 0.1, 0.3, 1, 2, 5, 8, 15, 20, 30 μM at pH 9) and incubatedat 37 °C for 4 or 6 min at pH 9 and pH 7, respectively. After adding an equalvolume of 99% formamide, 5 mM EDTA, 0.1% xylene cyanol, and 0.1% bro-mophenol blue, products were resolved on a 12% denaturing polyacrylamidegel and quantified by phosphor screen autoradiography. The data were fit tothe Michaelis–Menten equation using nonlinear regression.

ACKNOWLEDGMENTS. We thank Lee Pedersen and William Beard for helpfuldiscussions and critical reading of the manuscript. Data were collected atSoutheast Regional Collaborative Access Team (SER-CAT) 22-ID (or 22-BM)beamline at the Advanced Photon Source, Argonne National Laboratory.Supporting institutions may be found at www.ser-cat.org/members.html.Use of the Advanced Photon Source was supported by the US Departmentof Energy, Office of Science, Office of Basic Energy Sciences, under ContractW-31-109-Eng-38. This work was supported by the Division of IntramuralResearch of the National Institutes of Health, National Institute of Environ-mental Health Sciences (Project Z01 ES065070 to T.A.K.).

1. Watson JD, Crick FH (1953) Genetical implications of the structure of deoxyribonucleicacid. Nature 171:964–967.

2. Watson JD, Crick FH (1953) Molecular structure of nucleic acids; a structure fordeoxyribose nucleic acid. Nature 171:737–738.

3. Lehman IR, Bessman MJ, Simms ES, Kornberg A (1958) Enzymatic synthesis ofdeoxyribonucleic acid. I. Preparation of substrates and partial purification of anenzyme from Escherichia coli. J Biol Chem 233:163–170.

4. Drake JW, Baltz RH (1976) The biochemistry of mutagenesis. Annu Rev Biochem45:11–37.

5. Topal MD, Fresco JR (1976) Complementary base pairing and the origin of substitutionmutations. Nature 263:285–289.

6. Yu H, Eritja R, Bloom LB, Goodman MF (1993) Ionization of bromouracil andfluorouracil stimulates base mispairing frequencies with guanine. J Biol Chem268:15935–15943.

7. Echols H, Goodman MF (1991) Fidelity mechanisms in DNA replication. Annu RevBiochem 60:477–511.

8. Kool ET (2002) Active site tightness and substrate fit in DNA replication. Annu RevBiochem 71:191–219.

9. Joyce CM, Benkovic SJ (2004) DNA polymerase fidelity: Kinetics, structure, andcheckpoints. Biochemistry 43:14317–14324.

10. Christian TD, Romano LJ, Rueda D (2009) Single-molecule measurements ofsynthesis by DNA polymerase with base-pair resolution. Proc Natl Acad Sci USA106:21109–21114.

11. Santoso Y, et al. (2010) Conformational transitions in DNA polymerase I revealed bysingle-molecule FRET. Proc Natl Acad Sci U S A 107:715–720.

12. Johnson SJ, Beese LS (2004) Structures of mismatch replication errors observed in aDNA polymerase. Cell 116:803–816.

13. Vaisman A, Ling H, Woodgate R, Yang W (2005) Fidelity of Dpo4: Effect of metal ions,nucleotide selection and pyrophosphorolysis. EMBO J 24:2957–2967.

14. Batra VK, Beard WA, Shock DD, Pedersen LC, Wilson SH (2008) Structures of DNApolymerase beta with active-site mismatches suggest a transient abasic site intermedi-ate during misincorporation. Mol Cell 30:315–324.

15. Garcia-Diaz M, et al. (2000) DNA polymerase lambda (Pol lambda), a novel eukaryoticDNA polymerase with a potential role in meiosis. J Mol Biol 301:851–867.

16. Moon AF, et al. (2007) The X family portrait: Structural insights into biologicalfunctions of X family polymerases. DNA Repair 6:1709–1725.

Fig. 4. Geometry of G•T mispairs in Pol λ DL complexes. (A) Watson–Crick conformation of dGMPCPP•T nascent base pair from the ternary, precatalyticcomplex. (B) Correct dGMPCPP•C nascent base pair from the precatalytic complex with the G•T primer–terminal base pair. (C) G•T primer–terminal base pairin wobble conformation in the precatalytic, ternary complex. Simulated annealing Fobs-Fcalc omit maps contoured at 3.5σ are shown in dark blue. (D) Base pairparameters (derived using 3DNA software v.1.5, Lu and Olson), including H-bond information [atom, pair, and length (Å)], base pair width [C1′—C1′ distance(Å)], and lR and lY angles (in degrees) between the line joining the C1′—C1′ and the N9-C1′ (purine) and N1-C1′ (pyrimidine) glycosidic bonds. The positions ofatoms in a G•C base pair are indicated.

1866 ∣ www.pnas.org/cgi/doi/10.1073/pnas.1012825108 Bebenek et al.

Dow

nloa

ded

by g

uest

on

June

1, 2

020

17. Garcia-Diaz M, et al. (2004) A structural solution for the DNA polymerase lambda-dependent repair of DNA gaps with minimal homology. Mol Cell 13:561–572.

18. Garcia-Diaz M, Bebenek K, Krahn JM, Kunkel TA, Pedersen LC (2005) A closed confor-mation for the Pol lambda catalytic cycle. Nat Struct Mol Biol 12:97–98.

19. Garcia-Diaz M, Bebenek K, Krahn JM, Pedersen LC, Kunkel TA (2007) Role of thecatalytic metal during polymerization by DNA polymerase lambda. DNA Repair6:1333–1340.

20. Garcia-DiazM, Bebenek K, Krahn JM, Pedersen LC, Kunkel TA (2006) Structural analysisof strand misalignment during DNA synthesis by a human DNA polymerase. Cell124:331–342.

21. Bebenek K, et al. (2008) Substrate-induced DNA strand misalignment during catalyticcycling by DNA polymerase lambda. EMBO Rep 9:459–464.

22. Bebenek K, Garcia-Diaz M, Blanco L, Kunkel TA (2003) The frameshift infidelity ofhuman DNA polymerase lambda. Implications for function. J Biol Chem 278:34685–34690.

23. Kunkel TA, Bebenek K (2000) DNA replication fidelity. Annu Rev Biochem 69:497–529.24. Picher AJ, et al. (2006) Promiscuous mismatch extension by human DNA polymerase

lambda. Nucleic Acids Res 34:3259–3266.25. Bebenek K, Garcia-Diaz M, Zhou R-Z, Povirk LF, Kunkel TA (2010) Loop1 modulates the

fidelity of DNA polymerase λ. Nucleic Acids Res 38:5419–5431.

26. Lin P, et al. (2008) Incorrect nucleotide insertion at the active site of a G:A mismatchcatalyzed by DNA polymerase beta. Proc Natl Acad Sci USA 105:5670–5674.

27. Batra VK, Beard WA, Shock DD, Pedersen LC, Wilson SH (2005) Nucleotide-inducedDNA polymerase active site motions accommodating a mutagenic DNA intermediate.Structure 13:1225–1233.

28. Batra VK, et al. (2006) Magnesium-induced assembly of a complete DNA polymerasecatalytic complex. Structure 14:757–766.

29. Biertumpfel C, et al. (2010) Structure and mechanism of human DNA polymerase eta.Nature 465:1044–1048.

30. Vagin A, Teplyakov A (1997) MOLREP: An automated program for molecular replace-ment. J Appl Crystallogr 30:1022–1025.

31. Otwinowski Z, Minor W (1997) Processing of X-ray diffraction data collected in oscilla-tion mode. Method Enzymol 276:307–326.

32. Brunger AT, et al. (1998) Crystallography & NMR system: A new software suite formacromolecular structure determination. Acta Crystallogr D 54:905–921.

33. Jones TA, Zou JY, Cowan SW, Kjeldgaard M (1991) Improved methods for buildingprotein models in electron density maps and the location of errors in these models.Acta Crystallogr A47:110–119.

34. Lovell SC, et al. (2003) Structure validation by Calpha geometry: phi,psi and Cbetadeviation. Proteins 50:437–450.

Bebenek et al. PNAS ∣ February 1, 2011 ∣ vol. 108 ∣ no. 5 ∣ 1867

BIOCH

EMISTR

Y

Dow

nloa

ded

by g

uest

on

June

1, 2

020