Regulation of chemokine receptor expression in human microglia and astrocytes

Regulation of chemokine receptor expression in human

microglia and astrocytes

Geraldine Flynn, Seema Maru, Jane Loughlin, Ignacio A. Romero, David Male*

Department of Biological Sciences, The Open University, Milton Keynes MK7 6AA, UK

Received 30 August 2002; received in revised form 30 December 2002; accepted 31 December 2002

Abstract

It has been proposed that the positioning of mobile cells within a tissue is determined by their overall profile of chemokine receptors. This

study examines the profiles of chemokine receptors expressed on resting and activated adult human microglial cells, astrocytes and a

microglial cell line, CHME3. Microglia express highest levels of CXCR1, CXCR3 and CCR3. Astrocytes also have moderate levels of

CXCR1 and CXCR3, and some CCR3, while both cell types also expressed CCR4, CCR5, CCR6, CXCR2, CXCR4 and CXCR5 at lower

levels. Activation of the cells with the inflammatory cytokine tumour necrosis factor-a (TNFa) and interferon-g (IFNg) increased the

expression of some but not all receptors over a period of 24 h. Microglia showed moderate enhancement of receptor expression, while

astrocytes responded particularly strongly to TNFa with enhanced CXCR3, CCR3 and CXCR1. However, the migratory and proliferative

responses of the microglia and astrocytes to the same chemokine were different, with microglia migrating and astrocytes proliferating in

response to CXCL10. The data indicates a mechanism by which activated microglia and astrocytes become selectively more sensitive to

inflammatory chemokines during CNS disease, and the paper discusses which of the many chemokines present in CNS would have priority

of action on microglia and astrocytes.

D 2003 Elsevier Science B.V. All rights reserved.

Keywords: Chemotaxis; Inflammation; Chemokines; Microglia; Astrocytes

1. Introduction

There is growing evidence for the role of chemokines in

the regulation of CNS disease. Elevated levels of chemo-

kines have been observed in several brain diseases, suggest-

ing that these molecules function as regulators of brain

inflammation (Karpus and Ransohoff, 1998; Glabinski and

Ransohoff, 1999). Chemokines were first described as

small, chemotactic cytokines that selectively recruit specific

subsets of leukocytes into different tissues. More recently,

they have been shown to activate a variety of other cellular

functions.

The chemokine family consists of more than 40 members

and is subdivided into four groups: a (CXC), h (CC), y(CX3C) and g (C), according to the number of amino acids

separating two cysteine residues within a highly conserved

region of the chemokine. Chemokine receptors are classified

similarly according to which group of chemokines they bind

and are designated CXCR1–CXCR6, CCR1–CCR11,

CX3CR1 and XCR1 (Horuk, 2001). Understanding how

cells respond to chemokines is complex because most

chemokines bind to more than one receptor and most

receptors bind to several chemokines (Rossi and Zlotnik,

2000). Thus, the ability of cells to respond to chemokines

depends on the set of chemokine receptors that they express

which may vary depending on the state of activation of the

cell. In addition, the type of response elicited by a chemo-

kine is dependent on the level of the mediator and the

responding cell type. To date, the majority of research

0165-5728/03/$ - see front matter D 2003 Elsevier Science B.V. All rights reserved.

doi:10.1016/S0165-5728(03)00009-2

Abbreviations: BSA, bovine serum albumin; CCR, CC chemokine

receptor; CXCR, CXC chemokine receptor; CCL, CC chemokine ligand;

CXCL, CXC chemokine ligand; FACS, fluorescence-activated cell sorter;

FMLP, formyl–methionyl– leucyl–phenylalanine peptide; GFAP, glial

fibrillary acidic protein; GM-CSF, granulocyte macrophage colony-

stimulating factor; HBSS, Hank’s buffered saline solution; IFNg,

interferon-g; IL-8, interleukin-8; IP-10, inducible protein-10; MCP,

macrophage chemotactic protein; MIP, macrophage inflammatory protein;

MS, multiple sclerosis; PBS, phosphate-buffered saline; RANTES,

regulated on activation, normal T-cell expressed and secreted; TNFa,

tumour necrosis factor-a.

* Corresponding author. Tel.: +44-1908-659226; fax: +44-1908-

654167.

E-mail address: [email protected] (D. Male).

www.elsevier.com/locate/jneuroim

Journal of Neuroimmunology 136 (2003) 84–93

investigating the role of chemokines in CNS disease has

addressed either their secretion by brain parenchymal cells,

including microglia and astrocytes, or their leukocyte attrac-

tant properties (Glabinski and Ransohoff, 1999). However,

the effects these mediators have on the responses of brain

parenchymal cells, in particular astrocytes and microglia, is

less clear.

Although chemokines were first identified in relation to

inflammation, they also have important roles in controlling

cell migration within tissues during development, angio-

genesis and tissue repair (Horuk, 1998). For example,

chemokines such as CXCL8 (IL-8) and CCL2 (MCP-1),

which are induced during inflammation, are also expressed

transiently during CNS development where they are thought

to control migration of microglial precursors (Male and

Rezaie, 2001). In the adult, microglia and astrocytes play

important but distinct roles in CNS inflammation and

several studies have identified individual chemokine recep-

tors on microglia or astrocytes from humans and rodents

(Andjelkovic et al., 1999; Albright et al., 1999; Bajetto et

al., 1999; Biber et al., 2002; Dorf et al., 2000; Han et al.,

2000; Harrison et al., 1998; Hesselegesser and Horuk, 1999;

Maciejewski-Lenoir et al., 1999; Ohtani et al., 1998; Rezaie

et al., 2002). Several of these studies have shown that glia

respond to individual chemokines in vitro by migration or

division. However, it is difficult to extrapolate from this

information to say how the cells might react in vivo when

subject to complex mixtures and gradients of chemokines.

The first step in understanding how glia would respond to

multiple signals is to define the overall profile of their

receptors, which was one aim of this study.

Establishing receptor profiles is also important following

a recent shift in our understanding of how cell migration is

controlled within tissues. The established view of cell

migration (e.g., in inflammation) proposes that cells move

towards a chemotactic stimulus, and that cells have a large

variety of receptors, so they can respond to a wide variety of

chemokines. Recently, a new idea has emerged from studies

on the development of immune responses within lymph

nodes. B cells adjust their position within the tissue by

modulating the relative levels of the chemokine receptors

CXCR5 and CCR7 (Reif et al., 2002), i.e., the cell’s position

is determined by changes in its receptors, rather than the

underlying chemokine gradients. Since microglia are tissue-

resident cells which disperse throughout the CNS during

development, but can also accumulate to inflammatory sites,

the distribution and migration of these cells could also relate

to their chemokine receptor profiles.

The aims of this study were to delineate and compare the

profiles of chemokine receptors present on human microglia

and astrocytes, and to determine how inflammatory cyto-

kines might affect expression of the receptors. We then used

the chemokine CXCL10 (IP-10), which has been implicated

in inflammatory reactions in brain and for which there are

receptors on both microglia and astrocytes, to determine

how these cells respond to chemokine stimulation. We used

primary adult human glial cells and derived additional

information from an immortalised microglial cell line.

2. Materials and methods

2.1. Isolation of primary human microglia

Adult human brain tissue was obtained from temporal

lobe resections carried out at Kings College Hospital,

London, following the guidelines of the Local Ethics

Committee. Microglia were prepared according to the

method of DeGroot et al. (2000), using approximately 3 g

tissue. Following isolation, the cells were plated out in

leucomax (Novartis, UK) containing GMCSF at a final

concentration of 25 ng/ml. The medium was replenished

every 3–4 days. For 3–4 days preceding assays, cells were

cultured in a maintenance medium lacking growth factors

(Dulbecco’s modified Eagle medium supplemented with

10% heat-inactivated fetal calf serum, 100 IU/ml penicillin

and 100 Ag/ml streptomycin). Experiments were carried out

in the 4 weeks following the isolation procedure (passages

0–1), at which time at least 80% of cells expressed CD68 as

determined by immunocytochemistry. Cultures were typi-

cally >90% pure with small numbers of other glia and cells

from microvessels. All cultures were maintained at 37 jC in

a humidified 5% CO2 atmosphere. The human microglial

cell line, CHME3 (a kind gift of Professor Marc Tardieu,

Paris, France), was cultured in the same conditions.

2.2. Isolation of primary human astrocytes

Tissue was collected from adult temporal lobe resections

as above using approximately 1 g tissue per preparation.

Meninges and visible blood vessels were removed before

mincing the tissue. The tissue fragments were transferred to a

suspension of Hank’s balanced salts containing 10 mM

HEPES, 50 U/ml penicillin and 50 Ag/ml streptomycin,

and 2.5 Ag/ml fungizone (Invitrogen, UK) and centrifuged

for 5 min at 300� g. The pellet was resuspended in a 1 g/l

collagenase dispase solution containing 10 mg/l DNase I and

0.147 mg/l N-p-tosyl-L-lysine chloromethyl ketone (TLCK)

and incubated for 1 h at 37 jC. After digestion, the astrocyteswere separated from microvessel fragments and other mate-

rial by density-dependent centrifugation on 25% bovine

serum albumin (BSA). The floating myelin layer was iso-

lated and plated onto poly-L-ornithine coated 75-cm2 flasks

(1.5 g/l; Sigma, UK) in 1:1 nutrient mixture F-10 and MEM

alpha medium, supplemented with 10% heat-inactivated

foetal calf serum/1% human serum 50 U/ml penicillin and

50 Ag/ml streptomycin (Invitrogen). After 48 h, the medium

was changed to remove unattached cells and myelin debris.

Cells resembling astrocytes grew to confluence within 2–3

weeks. Following passage, >95% of the cells were GFAP

positive as determined by FACS analysis. Human astrocytes

were used for experiments up to passage 6.

G. Flynn et al. / Journal of Neuroimmunology 136 (2003) 84–93 85

2.3. Flow cytometry

Chemokine receptor expression on human microglia

(CHME3) and adult astrocytes was determined using a

panel of phycoerythrin-conjugated antibodies for CCR1,

CCR2, CCR3, CCR5 and CCR6 and CXCR1–CXCR5

(R&D Systems) and for CCR4 (Santa Cruz Technologies).

The clonal designations of these antibodies are CCR1–

CCR6: 53504, 48607, 61828, SC-7936, 455049, 53103,

respectively, and CXCR1–CXCR5: 42705, 48311, 49801,

12G5, 51505, respectively. These receptors were selected

because they include those which bind to chemokines

expressed in inflamed CNS. The antibody panel from

R&D was selected as the widest available from a single

supplier. It was, therefore, possible to use a single staining

protocol for these antibodies, facilitating comparison of

receptor densities. Human astrocytes and CHME3 cells

were grown to confluence in T 175-cm2 flasks, washed

and trypsinized using 0.25% trypsin/EDTA (Invitrogen).

The cells were fixed using 1 ml 4% formaldehyde in PBS

for 10 min at 4 jC, and the cells were centrifuged at 300� g

for 5 min in a microcentrifuge. The cells were permeabilised

using 0.1% Triton X-100 in PBS for 1 min at room

temperature, centrifuged at 300� g for 5 min, resuspended

in 1 ml of blocking solution (0.1 mg/ml human IgG/10%

normal goat serum in PBS) and incubated for 30 min at

4 jC. Cells were counted and resuspended at 8� 106 cells/

ml. For the assay, 25 Al of the cell suspension (2� 105 cells)

was placed in a 1.5-ml eppendorf microcentrifuge tube and

10 Al of appropriate antibodies added using the manufac-

turer’s recommended concentrations. The rabbit polyclonal

anti-CCR4 antibody was used at a final concentration of 5

Ag/ml. The secondary anti-rabbit fluorescein-labelled anti-

body was used at 1:200 (Chemicon, UK). Appropriate

isotype-matched controls were used. Cells were incubated

with antibody for 1 h at 4 jC, then washed once using PBS

and resuspended in 0.4 ml PBS for analysis. For CCR4,

incubation with the secondary antibody was carried out for 1

h at 4 jC, and the cells washed and resuspended in 0.4 ml

PBS as above for analysis. Astrocytes were stained with

antibody to glial fibrillary acidic protein (GFAP, Chemicon)

and microglia were stained with anti-CD68 (Dako, UK) to

determine cell purity. The flow cytometry data was acquired

and analysed using the FACScalibur flow cytometer and

CellQuestk software (Becton Dickinson, UK).

2.4. Immunocytochemistry

Immunostaining was performed on CHME3 cells, pri-

mary adult human microglia and astrocytes. Cells were

grown to 20–50% confluence on poly-L-lysine-coated cov-

erslips and fixed using 4% formaldehyde in PBS for 5 min

at room temperature. The fixative was then removed and the

cells were permeabilised using 0.1% Triton X-100 in PBS

for 1 min at room temperature. The cells were then incu-

bated with a blocking solution of 0.1 mg/ml human IgG/

10% normal goat serum in PBS for 30 min at 4 jC.Following blocking, 10 Al of antibody was added to each

coverslip and incubated for 1 h at 4 jC using the same

antibodies as for FACS, except that staining for minor

receptors (CXCR4, CCR5) was done using FITC-conju-

gated antibodies. The preparations were washed twice with

PBS before viewing with a Leica confocal microscope.

2.5. RT-PCR

RNA was isolated from monolayers of cells grown to

50% confluence for a period of 3 days following passage.

They were then either untreated or treated for 24 h with 25

ng/ml TNFa (R&D) before isolation of RNA. Total RNA

was isolated using 10 ml per 175-cm2 flask of RNAzol B

(Biogenesis, UK) according to the manufacturer’s protocol.

The integrity of the RNA samples was confirmed by gel

electrophoresis and by reverse transcription-PCR using

primers for housekeeping genes (clathrin, actin, glycerol

phosphate dehydrogenase; Invitrogen gene checker).

RT-PCR was carried out using the RT-PCR Master-Amp

kit (Epicentre Technologies, UK), with primers shown in

Table 1, using 20 min of reverse transcription at 60 jCfollowed by 40 cycles of amplification (94 jC, 30 s/melting

temperature (Tm) minus 5 jC, 30 s/72 jC, 30 s). Cyclophilinwas used as a positive control and to ensure equal-loading.

Table 1

Chemokine receptor primers for RT-PCR

Primer Sequence Tm

CXCR1-F CCATTGCTGAAACTGAAGAGG 57

CXCR1-R TTGTTTGGATGGTAGCCTGG 60

CXCR2-F CGAAGGACCGTCTACTCATC 54

CXCR2-R AGTGTGCCCTGAAGAAGAGC 56

CXCR3-F CCTTCCTGCCAGCCCTCTACAG 60

CXCR3-R TGGGCATAGCAGTAGGCCATGA 56

CXCR4-F CTGGTCATGGGTTACCAGAA 52

CXCR4-R TTGGAGTGTGACAGCTTGGAGAT 54

CCR1-F ACGAAAGCCTACGAGAGTG 53

CCR1-R GGTGAACAGGAAGTCTTGG 52

CCR2-F GATTACGGTGCTCCCTGTC 49

CCR2-R GCCACAGACATAAACAGAATC 46

CCR3-F TGATCCTCATAAAATACAGGA 46

CCR3-R GTCATCCCAAGAGTCTCTGTCAC 57

CCR4-F ATGAACCCCACGGATATAGCAG 55

CCR4-R CTACAGAGCATCATGGAGATCAT 50

CCR5-F GACAAACTCTCCCTTCACTC 45

CCR5-R ACAAGTCTCTCGCCTGGTTC 51

CCR6-F CAGCGATGTTTTCGACTCCAGTG 58

CCR6-R TCACATAGTGAAGGACGACGCATTG 60

CCR10-F AGAGCCTGCTCCTTGCTAC 54

CCR10-R AGCCTCACCAAGACACAAC 52

CCR11-F ATGGCTTTGGAACAGAACCAGTCAAC 60

CCR11-R GCTAAAAGTACTGGTTGGCTCTGTAGG 57

Cyclo-F AGCACTGGAGAGAAAGGATT 55

Cyclo-R GGAGGGAACAAGGAAAACAT 55

Primer sequences used for RT-PCR indicating forward (F) and reverse (R)

primers. The melting temperature (Tm) in degrees centigrade is given for

each primer.

G. Flynn et al. / Journal of Neuroimmunology 136 (2003) 84–9386

The products were analysed in a 1.5% agarose gel in Tris/

acetate/EDTA buffer.

2.6. Chemotaxis assay

Cells were grown to confluence in a 75-cm2 flask and

washed three times with HBSS before loading with

Celltrackerk (CMFDA; Molecular Probes, USA) at a final

concentration of 5 AM for 1 h at 37 jC. The cells were thenwashed and resuspended in serum-free medium for 30 min

at 37 jC before use. For the migration assay, the Fluo-

roblokk (Becton Dickinson) transwell system was used.

The membrane of the well permits detection of the fluo-

rescent cells that have migrated to the underside of mem-

brane but not those cells which remain in the upper

chamber. A total of 300 Al of 3� 105 cells/ml was placed

in the upper chamber and 700 Al of serum-free medium

containing the chemokine was placed in the lower chamber.

Serum-free medium alone or medium containing 100 nM

fMetLeuPhe were used as negative and positive controls,

respectively. The migration chamber was incubated for 6 h

at 37 jC. Cells which had crossed the membrane were

counted using an Olympus IX70 with � 400 magnification.

The migrated fluorescent cells were also detected using a

fluorescence plate reader (Wallac Flite) after scraping the

upper surface of the filter using a cotton bud and lysing the

cells on the underside, including those in the well itself,

using 1% Triton X-100. Lysates were read in the fluorimeter

as a measure of the number of migrating cells.

2.7. Proliferation assay

Cell growth was measured by conversion of MTT (3-

(4,5-dimethylthiazol)-2,5-diphenyltetrazolium bromide).

Fig. 1. (a) Chemokine receptor expression on CHME3 cells and primary human astrocytes. The values shown are the mean fluorescence (F S.D.) of duplicate

FACS plots in one experiment which was indicative of the profile of expression levels seen in three independent experiments. Control values have been

subtracted. (b) Representative FACS histograms show expression of GFAP on primary astrocytes and CD68 on the microglial cell line CHME3. The lower

panels show CCR3 and CXCR3 expression on primary human astrocytes (dark line) and CHME3 (light line). Negative controls are shown as filled histograms.


CHME3 and astrocytes were grown to 50% confluence in

96-well plates in serum-free medium for 24 h prior to assay,

and were then incubated in medium with chemokine for 48

h. Cells were washed in PBS, and 5 mg/ml of MTT (Sigma,

UK) in PBS was added for a further 4 h at 37 jC. Themedium was then aspirated leaving a formazan crystal

residue which was dissolved in 150 Al of DMSO, and the

optical density was read at 492 nm. Each assay was

performed in triplicate wells, and three independent experi-

ments were conducted.

3. Results

3.1. Chemokine receptor expression and regulation by IFNcand TNFa

The microglial line CHME3 expressed high levels of

CCR3, CXCR1 and CXCR3 with lower levels of CCR4,

CCR5, CCR6, CXCR2, CXCR4 and CXCR5. (Fig. 1a). The

primary astrocytes had a similar profile of receptors,

although the levels of CCR3 and CXCR3 were considerably

less than on the microglial line. Expression of CCR1 and

CCR2 was only slightly above background on both cell

types. The barchart represents mean fluorescence values

(n = 2) from a given experiment indicative of the profile

seen in three determinations. Representative histograms for

CCR3 and CXCR3 expression are shown in Fig. 1b. The

expression of the chemokine receptors on both cell types for

all receptors showed a single peak on the histograms,

indicating that chemokine receptor expression does not

distinguish subpopulations of either cell type.

Primary adult human microglia and astrocytes and

CHME3 cells were stained to detect chemokine receptors.

Strongest staining was seen for CCR3, CXCR1 and CXCR3

on CHME3 cells and astrocytes, which corresponded with

the FACS analysis (data not shown). Primary adult microglia

also expressed these receptors as well as CCR5 and CXCR4

(Fig. 2). Expression of receptors on primary adult microglia

was qualitatively similar to that seen on CHME3 cells. On

both primary microglia and CHME3 cells, CCR3, CXCR1

and CXCR3 were distributed over the whole cell surface.

However, CCR5 showed mainly vesicular staining on both

cell types (Fig. 2). Vesicular staining was sometimes seen,

Fig. 2. Chemokine receptor staining on primary human microglia and CHME3 cells. Single immunofluorescence staining for CCR5, CCR3, CXCR1, CXCR3

and CXCR4 on primary microglia and CCR5 on CHME3 cells (lower left). Direct staining with fluorescein-conjugated antibodies was carried out for the less

prevalent receptors (CCR5, CXCR4) and with PE-conjugated antibodies for the more prevalent receptors. CCR3, CXCR1 and CXCR3 showed a predominant

surface staining extending over the cell body and processes. CXCR4 showed staining around the cell bodies, with occasional vesicular staining, while CCR5

was predominantly vesicular on both primary microglia and CHME3 cells.


but less markedly, with CXCR4. The staining of primary

microglia was repeated as a double stain with CD68, in order

to confirm the identity of the cells expressing receptors. The

fluorescence microscopy data suggest that primary microglia

maintain an intracellular reserve of some chemokine recep-

tors, which could be mobilised if required.

The effect of inflammatory cytokines on chemokine

receptor expression was examined using astrocytes and

CHME3 cells treated for 24 h with either 25 ng/ml TNFa

or 200 U/ml IFNg (Fig. 3). These concentrations optimally

activate both cell types for a number of functions; the dose–

response curves being sigmoidal. Insufficient primary

microglia were available for flow cytometry. CCR3 was

significantly induced on CHME3 cells by TNFa. CXCR1

was not induced by the cytokines. CXCR3 was increased in

all experiments (n = 3), but this did not reach significance in

individual experiments (Fig. 3A). The other receptors

including CCR5 and CXCR4 were also examined following

cytokine stimulation, but there was no increase over the

levels seen on unstimulated CHME3 cells. In comparison,

astrocytes (Fig. 3B) showed a substantial increase in expres-

sion of CCR3, CXCR1 and CXCR3 following treatment

with TNFa. The levels on activated astrocytes approached

that seen on microglia. IFNg also significantly enhanced

CXCR1 and CXCR3 expression, although less effectively

than TNFa.

3.2. Effect of TNFa on chemokine receptor mRNA

To understand the basis of the enhanced expression of

these chemokine receptors, we examined the incidence of

specific mRNA in resting and TNFa-activated astrocytes

and CHME3 cells using RT-PCR. The results are shown in

Fig. 4. The levels of mRNA for CXCR3 were clearly

enhanced by TNFa in both cell types. This accords with

the increase in CXCR3 expression detected on astrocytes by

flow cytometry and the small but consistent increases in

CXCR3 mRNA in CHME3 cells. Results for CCR3 and

CXCR1 were less clear with similar levels or small

increases in mRNA in activated microglia and astrocytes

compared with resting cells. The different results obtained

by flow cytometry and RT-PCR, for CXCR1 in particular,

may relate to receptor modulation by induced chemokine

Fig. 3. Chemokine receptor expression following treatment with TNFa or

IFNg for 24 h. Cells were treated for 24 h with 200 U/ml IFNg or 25 ng/ml

TNFa and chemokine receptor expression measured by flow cytometry.

Data displayed are mean fluorescence values of duplicate samples

(F S.D.). Students t-test was used to compare values of cytokine-treated

and control cells. *p< 0.05, yp< 0.01, zp< 0.001.

Fig. 4. Chemokine receptor mRNA expression by CHME3 (top) and

astrocytes (bottom). mRNA for the chemokine receptors indicated was

detected in untreated (C) and TNFa-treated (T) CHME3 cells and

astrocytes by RT-PCR. Cyclophilin was used as positive control and to

ensure equal loading. The same pairs of RNA samples were used for all of

the assays shown. Each assay was carried out two to four times using

different pairs of samples and producing similar results.

Fig. 5. Chemotaxis assay using CXCL10 (IP-10). Cells (105) were placed in

the upper chamber with the lower chamber containing CXCL10 (50 ng/ml)

or fMLP (100 nM), and allowed to migrate for 6 h at 37 jC. Migrated cells

were detected by fluorimetry. Results are shown as a percentage increase

above controlF S.D. (n= 3) (i.e., with control migration subtracted).

Student’s t-test confirmed significant migration of CHME3 cells in response

to CXCL10 (IP-10) and fMLP ( p< 0.01).


(CXCL8) or to other factors, as discussed below. We also

noted a clear increase in mRNA for CCR10 in activated

microglia (but not astrocytes) and could, therefore, expect

enhanced CCR10 expression on these cells. However, we

could not confirm this by FACS analysis since no specific

CCR10 antibody is currently available. We also assayed a

range of other chemokine receptors (see Table 1) corre-

sponding to those detected by flow cytometry, but found no

consistent changes in TNFa-activated cells. The data indi-

cate that the increase in CXCR3 in response to TNFa is

mediated, at least in part, by enhanced transcription. We

subsequently compared mRNA levels for CCR3, CXCR1

and CXCR3, with and without IFNg stimulation. There was

an increase in CCR3 mRNA levels in IFNg-stimulated

astrocytes, but for the other receptors in both cell types,

the differences between IFNg-stimulated and unstimulated

cells were small (data not shown).

3.3. Chemotaxis

The migratory response of CHME3 cells and primary

human astrocytes was assessed using CXCL10 (IP-10) at a

concentration of 50 ng/ml which had previously been

determined as optimum. The chemoattractant fMLP (100

nM; Sigma) was used as a positive control and serum-free

medium alone was used as a negative control. CHME3 cells

migrated in response to CXCL10 and fMLP, whereas

primary human astrocytes did not (Fig. 5). Data from cell

counts was similar, but the fluorimetry data is less suscep-

tible to observer-related experimental error. We also noted

that the activated microglia, but not astrocytes, became

polarised and showed evidence of actin-polymerisation

when stained with TRITC-phalloidin (data not shown).

These findings are consistent with the observation that

CXCL10 acts to induce migration of microglia, but not

astrocytes.

3.4. Proliferation

We also measured the effect of CXCL10 on proliferation

of the two cell types (Fig. 6). The data show that astrocyte

growth is promoted by 5 ng/ml CXCL10, but not by 0.5 or

50 ng/ml—the dose response curves of many cell types to

chemokines typically show bell-shaped curves with optimal

responses in the range 2–20 ng/ml. In contrast, proliferation

of CHME3 cells was inhibited by CXCL10. This indicates

that microglia respond to CXCL10 by enhanced migration

and reduced division.

4. Discussion

Chemokines are thought to play a central role in inflam-

mation of the brain. Histological examinations of postmor-

tem brain sections from multiple sclerosis patients have

identified a number of chemokines, including CXCL10 (IP-

10), CXCL9 (Mig), CCL5 (RANTES), CCL2 (MCP-1),

CCL8 (MCP-2), CCL7 (MCP3), CCL3 (MIP-1a) and

CCL4 (MIP-1h) (McManus et al., 1998; Simpson et al.,

1998, 2000a,b; Zhang et al., 2000). Moreover, during

relapses in multiple sclerosis, the levels of CXCL10,

CXCL9, CCL5 and CCL3 in cerebrospinal fluid are fre-

quently elevated (Sorensen et al., 1999; Miyagishi et al.,

1995). Since the infiltrating T cells in demyelinating lesions

and in CSF selectively express CXCR3 (which binds

CXCL9 and CXCL10) and CCR5 (which binds CCL3,

CCL4 and CCL5), this implies that these chemokines

promote the leukocyte infiltration (Balashov et al., 1999).

Hence, chemokines presented on the lumenal surface of

brain endothelium are thought to be key mediators promot-

ing leukocyte migration into CNS during disease. However,

the ways in which chemokines would act within the brain

parenchyma on microglia, astrocytes and the infiltrating

leukocytes is less clear because cells within tissues are

subject to complex gradients of different chemokines. One

theory states that cellular positioning within a tissue

depends on the profile of receptors expressed by individual

cells, as well as the underlying pattern of chemokines

expressed in different areas (Reif et al., 2002).

This study provides a detailed comparison of chemokine

receptor expression and profiles on human microglia and

astrocytes. We have shown that the major receptors of

microglia are CCR3, CXCR1 and CXCR3. with intermedi-

ate expression of CCR6 and lower expression of several

other receptors, including CCR5 and CXCR4. Although the

level of expression on astrocytes was lower than on micro-

glia, CXCR1 and CXCR3 are also primary receptors.

Fig. 6. Proliferation of astrocytes and CHME3 cells were treated with 0–50

ng/ml CXCL10 for 24 h, and cell proliferation measured by MTT assay.

Data shown are the percentages of the values in wells containing no

chemokine (meanF S.D., n= 3) for astrocytes (dark bars) and microglia

(light bars). Analysis of variance showed significant difference between

groups ( p< 0.01), and two-tailed t-test comparing different levels of

chemokine with untreated cells showed increased proliferation of astrocytes

at 5 ng/ml ( p< 0.001) and inhibition of microglial proliferation with 5 and

50 ng/ml chemokine ( p < 0.01). The results shown are from one

experiment, representative of three separate experiments, which gave

concordant results. yp< 0.01, zp< 0.001.


Activation of astrocytes with TNFa increased their expres-

sion of CCR3, CXCR3 and CXCR1. TNFa also increased

CCR3 significantly and CXCR3 slightly on CHME3 cells.

TNFa was more effective in this respect than IFNg. How-

ever, although the levels of some receptors increases, the

overall profile of major receptors remains the same, e.g., on

microglia CXCR3>CCR3 =CXCR1. The overall profiles

were very consistent although absolute fluorescence values

between different experiments varied; this could be due to

biological variation, but is more probably due to the

characteristic of FACS data.

We were interested in the possibility that cytokine

activation might change the receptor profile and, thus, cause

cells to reposition. This is not so for the major receptors, but

enhanced expression of these chemokine receptors may

provide a means by which glia would become more sensi-

tive to chemokine signals when inflammatory reactions

develop in the CNS. The increase in CCR3 was perhaps

unexpected, since CCL11 (eotaxin) and CCR3 are involved

in the TH2-type of immune response, which is less com-

monly observed in the CNS. However, TNFa has been

shown to induce CCR3 in mouse fibroblasts via activation

of NFnB (Huber et al., 2002), and similar mechanisms could

act in glia.

Comparison of the data from RT-PCR and flow cytom-

etry (Figs. 3 and 4) suggest that the increase of CXCR3 on

astrocytes (and possibly CHME3) is due to increased tran-

scription, but data for the other receptors was less clear. In

particular, the increase in CXCR1 on astrocytes was not

reflected in increased CXCR1 mRNA, and a small increase

in CXCR1 mRNA in CHME3 cells did not relate to

increased CXCR1 expression. There are two possible

explanations for such discrepancies. Direct immunofluores-

cence (FACS) produces results which are related to receptor

density in a linear way; by contrast, RT-PCR is very

sensitive to small variations in the initial mRNA template

and interfering mRNAs, and the detection system is loga-

rithmic. The alternative explanation is that the changes in

expression of mRNA (CXCR1 in particular) are genuinely

not reflected in protein expression. This could be due to

alterations in the rate of translation, or membrane turnover

of CXCR1. For example, we have noted that TNFa stimu-

lated CHME3 cells produce moderately high levels (30 ng/

ml) of CXCL8 (IL-8, a ligand for CXCR1) over 24 h. It is

possible, therefore, that any increase in CXCR1 expression

is offset by enhanced turnover caused by ligation of the

receptor with CXCL8 produced by the activated cells. The

RT-PCR data also suggest that CCR10 is expressed on

microglia and may be induced by TNFa.

The set of chemokine receptors expressed allows both

cell types to respond to a wide range of chemokines

including those associated with the TH1 type of immune

response (CXCR3) and those associated with a TH2-type

response (CCR3). As expected, the set of receptors seen on

both the primary microglia and the microglial line is related

to that on other mononuclear phagocytes (Murphy et al.,

2000), except that the expression of CCR1, CCR2 and

CCR5 is lower. In a separate study, we were similarly

unable to identify significant levels of CCR5 on resting

foetal microglia in vitro (Rezaie et al., 2002), even though

we had been able to identify CCR5 on populations of

microglia in the developing human cortex at 22 weeks of

gestation (Rezaie and Male, 1999). The low level of CCR5

on the adult microglia was unexpected since other work has

identified CCR5 as the principle coreceptor for HIVon adult

microglia (Albright et al., 1999; He et al., 1997) and

histochemical studies have identified CCR5 in brains from

normal individuals and patients with Alzheimer’s disease

(Xia et al., 1998). The relatively low expression of these

receptors may, however, be another incidence of the pro-

gressive down-regulation of many microglial surface mole-

cules that occurs after the precursors colonise the brain,

during early gestation. This process is thought to contribute

to the partial immunological privilege of the brain.

Considering those chemokines identified in inflamma-

tory diseases of the brain, it means that adult microglia

would be most sensitive to CXCL8, CXCL9, CXCL10 and

CXCL11 and CCL3, CCL5 and CCL7. The cells could also

respond to chemokines, such as CCL2 which is induced in

inflammation, trauma (Glabinski et al., 1996) and ischaemia

(Wang et al., 1995), but it would likely require higher levels

of CCL2 to trigger a response. Because receptor density is

generally higher on resting microglia (CHME3) than astro-

cytes, it suggests that in vivo, microglia would be affected

by inflammatory chemokines in a wider zone around a site

of inflammation than astrocytes.

Previous studies on astrocytes have identified a wide

variety of receptors including CCR1, CCR2, CCR3, CCR5,

CXCR2, CXCR3 and CXCR4 (Andjelkovic et al., 1999;

Biber et al., 2002; Dorf et al., 2000; Klein et al., 1999;

Rezaie et al., 2002). Although we could detect most of these

receptors, the levels, particularly of CCR1, CCR2 and

CXCR2, were very low on unstimulated cells. Again, this

may be due to our use of adult astrocytes, while the studies

above were carried out primarily on foetal astrocytes.

Notably, however, the major receptor on astrocytes was

CXCR3, which confirms a recent finding by Biber et al.

(2002). CXCR3 is a key receptor in TH1-type immune

responses, since it allows cells to respond to the IFNg-

inducible chemokines, CXCL9, CXCL10 and CXCL11.

Even when microglia and astrocytes express the same

receptor, their responses to the ligands were different. We

observed a chemotactic response of microglia, but not

astrocytes, to CXCL10. We do not think that the failure of

astrocytes to migrate to CXCL10 is due to defective signal-

ling of CXCR3, since we have noted that CXCL10 stim-

ulation of astrocytes causes phosphorylation of ERK, as

well as inducing actin polymerisation. Other studies using

the CHME3 cell line have shown migratory responses to a

variety of chemokines, including CCL3, CCL4, CCL5 and

CCL8 and CXCL8 and CXCL10 (Cross and Woodroofe,

1999). Our conclusion is related to that of Peterson et al.


(1997), who observed that microglia and astrocytes behave

differently in response to chemokine treatments. They

showed that CCL3, CCL4 and CCL8 could all induce

migration of microglia but not astrocytes in vitro. However,

they differ from those of Biber et al. (2002), who showed

that CXCL10 could enhance both microglial and astrocyte

migration, using similar doses to the levels used here, even

though the basal levels of migration seen with astrocytes

were much lower than with microglia. The reason for the

difference is uncertain, but may relate to the state of

maturation of the astrocytes.

The different responses of each cell type for each chemo-

kine has important implications for CNS pathology. Micro-

glia often become activated and migrate to sites of

inflammation during acute inflammation or following

trauma. CXCL10 is a chemokine induced by IFNg, a product

of activated TH1 cells. This study shows how the presence of

active TH1 cells and consequent CXCL10 release by astro-

cytes, microglia or brain endothelium, could lead to micro-

glial accumulation. Astrocytes do respond in inflammatory

reactions, but this is seen over longer time periods and results

in gliosis, which may persist after the acute reaction has

subsided. Previously, we have shown that CCL3 and CCL2

promote division of foetal astrocytes (Rezaie et al., 2002),

and here we show that CXCL10 also has an effect on

proliferation of adult astrocytes. Although chemokines could

contribute to astrogliosis, they are unlikely to be the only

factor, since several conventional growth factors, such as

PDGF also promote astrocyte proliferation. The phased

appearance of different chemokines in acute and chronic

inflammation is clearly important (Kennedy et al., 1998),

but the different ways in which the populations of cells

respond to them is equally relevant. By studying receptor

profiles, we aimed to elucidate which of the many chemo-

kines present in CNS disease would be most important in

activating astrocytes and microglia.

All of the studies in vitro, including this one, have aimed

to use optimal concentrations of single chemokines, some-

times at high levels. The situation in vivo is much more

complex because the cells are subject to a mix of different

chemokines, and the levels will vary across the response

curves for each chemokine. There is considerable potential

for synergy or cross-inhibition between chemokines. Our

current work is aimed at elucidating how microglia respond

when exposed to gradients of different chemokines and

identifying differences in the signalling pathways and

responses between the two glial cell types.

Acknowledgements

This research project was funded by the Multiple

Sclerosis Society of Great Britain and Northern Ireland.

We would like to thank Charles Polkey, Richard Selway, Dr.

Andrew Dean and the staff at King’s College Hospital for

supplying us with tissue, and Professor Marc Tardieu

(Universite Paris-Sud, France) for the immortalised cell line

CHME3.

References

Albright, A.V., Shieh, J.T., Itoh, T., Lee, B., Pleasure, D., O’Connor, M.J.,

Doms, R.W., Gonzalez-Scarano, F., 1999. Microglia express CCR5,

CXCR4 and CCR3, but of these CCR5 is the principal coreceptor for

human immunodeficiency virus type 1 dementia isolates. J. Virol. 73,

205–213.

Andjelkovic, A.V., Kerkovich, D., Shanley, J., Pulliam, L., Pachter, J.S.,

1999. Expression of binding sites for beta chemokines on human as-

trocytes. Glia 28, 225–235.

Bajetto, A., Bonavia, R., Barbero, S., Piccioli, P., Costa, A., Florio, T.,

Schettini, G., 1999. Glial and neuronal cells express functional chemo-

kine receptor CXCR4 and its natural ligand, stromal-cell derived factor.

J. Neurochem. 73, 2348–2357.

Balashov, K.E., Rottman, J.B., Weiner, H.L., Hancock, W.W., 1999.

CCR5+ and CXCR3+ T cells are increased in multiple sclerosis and

their ligands MIP-1a and IP-10 are expressed in demyelinating brain

lesions. Proc. Natl. Acad. Sci. U. S. A. 96, 6873–6878.

Biber, K., Dijkstra, I., Trebst, C., De Groot, C.J.A., Ransohoff, R.M.,

Boeddeke, H.W.G.M., 2002. Functional expression of CXCR3 in cul-

tured mouse and human astrocytes and microglia. Neuroscience 112,

487–497.

Cross, A.K., Woodroofe, M.N., 1999. Chemokines induce migration and

changes in actin polymerization in adult rat brain microglia and a hu-

man fetal microglial cell line in vitro. J. Neurosci. Res. 55, 17–23.

DeGroot, C.J.A., Montagne, L., Janssen, I., Ravid, R., Van Der Valk, P.,

Veerhuis, R., 2000. Isolation and characterization of adult human micro-

glial cells and oligodendrocytes derived from postmortem human brain

tissue. Brain Res. Protoc. 5, 85–94.

Dorf, M.E., Berman, M.A., Tanabe, S., Heesen, M., Luo, Y., 2000. Astro-

cytes express functional chemokine receptors J. Neuroimmunology 111,

109–121.

Glabinski, A.R., Ransohoff, R.M., 1999. Chemokines and chemokine re-

ceptors in CNS pathology. J. Neurovirol. 5, 3–12.

Glabinski, A.R., Balasingham, V., Tani, M., Kunkel, S.L., Strieter, R.M.,

Yong, V.W., Ransohoff, R.M., 1996. Chemokine monocyte chemoat-

tractant protein-1 is expressed by astrocytes after mechanical injury to

the brain. J. Immunol. 156, 4363–4368.

Han, Y., Wang, J., Zhou, Z., Ransohoff, R.M., 2000. TGF-h1 selectively

upregulates CCR1 expression in primary murine astrocytes. Glia 30,

1–10.

Harrison, J.K., Jiang, Y., Chen, S., Xia, Y., Maciejewski, D., McNamara,

R.K., Streit, W.J., Salafranca, M.N., Adhikara, S., Thompson, D.A.,

Botti, P., Bacon, K.B., Feng, L., 1998. Role for neuronally derived

fractalkine in mediating interactions between neurons and CXC3R1-

expressing microglia. Proc. Natl. Acad. Sci. U. S. A. 9, 10896–10901.

He, J., Chen, Y., Farzan, M., Choe, H., Ohagen, A., Gartner, S., Busciglio,

J., Yang, X., Hofman, W., Newman, W., McKay, C.R., Sodroski, J.,

Gabuzda, D., 1997. CCR3 and CCR5 are coreceptors for HIV-1 infec-

tion of microglia. Nature 385, 645–649.

Hesselegesser, J., Horuk, R., 1999. Chemokines and chemokine receptor

expression in the central nervous system. J. Neurovirol. 5, 13–26.

Horuk, R., 1998. Chemokines beyond inflammation. Nature 393, 524–525.

Horuk, R., 2001. Chemokine receptors. Cytokine & Growth Factor Rev.

12, 313–335.

Huber, M., Denk, A., Peter, R., Weber, L., Kraut, N., Wirth, T., 2002. The

IKK-2/InBa/NF-n B pathway plays a key role in the regulation of

CCR3 and eotaxin-1 in fibroblasts. A critical link to dermatitis in

InBa-deficient mice. J. Biol. Chem. 277, 1268–1275.

Karpus, W.J., Ransohoff, R.M., 1998. Chemokine regulation of experimen-

tal autoimmune encephalomyelitis: temporal and spatial patterns govern

disease pathogenesis. J. Immunol. 161, 2667–2671.


Kennedy, K.J., Strieter, R.M., Kunkel, S.L., Lukacs, N.W., Karpus, W.J.,

1998. Acute and relapsing experimental autoimmune encephalomyelitis

are regulated by differential expression of the CC chemokines macro-

phage inflammatory protein-1a and monocyte chemotactic protein-1.

J. Neuroimmunol. 92, 98–108.

Klein, R.S., Williams, K.C., Alvarez-Hernandez, X., Westmoreland, S.,

Force, T., Lackner, A.A., Luster, A.D., 1999. Chemokine receptor ex-

pression and signalling in macaque and human fetal neurons and as-

trocytes: implications for the neuropathogenesis of AIDS. J. Immunol.

163, 1636–1646.

Maciejewski-Lenoir, D., Chen, S., Feng, L., Maki, R., Bacon, K.B., 1999.

Characterisation of fractalkine in rat brain cells: migratory and activa-

tion signals for CX3CR1-expressing microglia. J. Immunol. 163,

1628–1635.

Male, D.K., Rezaie, P., 2001. Colonisation of the human central nervous

system by microglia: the roles of chemokines and vascular adhesion

molecules. Prog. Brain Res. 132, 81–96.

McManus, C., Berman, J.W., Brett, F.M., Staunton, H., Farrell, M.,

Brosnan, C.F., 1998. MCP-1, MCP-2 and MCP-3 expression in multi-

ple sclerosis lesions: an immunohistochemical and in situ hybridization

study. J. Neuroimmunol. 86, 20–29.

Miyagishi, R., Kikuchi, S., Fukuzawa, T., Tashiro, K., 1995. Macrophage

inflammatory protein-1a in the cerebrospinal fluid of patients with

multiple sclerosis and other inflammatory neurological diseases. J. Neu-

rosci. 129, 223–227.

Murphy, P.M., Baggiolini, M., Charo, I.F., Herbert, C.A., Horuk, R., Mat-

sushima, K., Miller, L.H., Oppenheim, J.J., Power, C.A., 2000. Interna-

tional Union of Pharmacology: XXII. Nomenclature for chemokine

receptors. Pharmacol. Rev. 52, 145–176.

Ohtani, Y., Minami, M., Kawaguchi, N., Nishiyori, A., Yamamoto, J.,

Takami, S., Satoh, M., 1998. Expression of stromal cell-derived factor

and CXCR4 chemokine receptor mRNAs in cultured rat glial and neu-

ronal cells. Neurosci. Lett. 249, 163–166.

Peterson, P.K., Hu, S., Salak-Johnson, J., Molitor, T.W., Chao, C.C., 1997.

Differential production of and migratory response to h chemokines by

human microglia and astrocytes. J. Infect. Dis. 175, 478–481.

Reif, K., Ekland, E.H., Ohl, L., Nakano, H., Lipp, M., Forster, R., Cyster,

J.G., 2002. Balanced responsiveness to chemoattractants from adjacent

zones determines B-cell position. Nature 416, 94–99.

Rezaie, P., Male, D., 1999. Colonisation of the developing human brain and

spinal cord by microglia: a review. Microsc. Res. Tech. 45, 359–382.

Rezaie, P., Trillo-Pazos, G., Everall, I.P., Male, D.K., 2002. Expression of

h-chemokines and chemokine receptors in human fetal astrocyte and

microglial co-cultures: potential role of chemokines in the developing

CNS. Glia 37, 64–75.

Rossi, D., Zlotnik, A., 2000. The biology of chemokines and their recep-

tors. Annu. Rev. Immunol. 18, 217–244.

Simpson, J.E., Newcombe, J., Cuzner, M.L., Woodroofe, M.N., 1998. Ex-

pression of monocyte chemoattractant protein-1 and other h-chemo-

kines by resident glia and inflammatory cells in multiple sclerosis

lesions. J. Neuroimmunol. 84, 238–249.

Simpson, J.E., Newcombe, J., Cuzner, M.L., Woodroofe, M.N., 2000a.

Expression of the interferon-g-inducible chemokines IP-10 and Mig

and their receptor, CXCR3, in multiple sclerosis lesions. Neuropathol.

Appl. Neurobiol. 26, 133–142.

Simpson, J., Rezaie, P., Newcombe, J., Cuzner, M.L., Male, D., Wood-

roofe, M.N., 2000b. Expression of the h-chemokine receptors CCR2,

CCR3 and CCR5 in multiple sclerosis central nervous system tissue. J.

Neuroimmunol. 108, 192–200.

Sorensen, T.L., Tani, M., Jensen, J., Pierce, V., Lucchinetti, C., Folcik,

V.A., Qin, S., Rottman, J., Sellebjerg, F., Strieter, R., Frederiksen,

J.L., Ransohoff, R.M., 1999. Expression of specific chemokines and

chemokine receptors in the central nervous system of multiple scle-

rosis patients. J. Clin. Invest. 103, 807–815.

Wang, X., Yue, T.L., Barone, F.C., Fuerstein, G.Z., 1995. MCP-1 mRNA

expression in rat ischaemic cortex. Stroke 26, 661–665.

Xia, M.Q., Qin, S.X., Wu, L.J., Mackay, C.R., Hyman, B.T., 1998. Immu-

nohistochemical study of the h-chemokine receptors CCR3 and CCR5

and their ligands in normal and Alzheimer’s disease brains. Am. J.

Pathol. 153, 31–37.

Zhang, L., He, T., Talal, A., Wang, G., Frankel, S.S., Ho, D.D., 2000.

Chemokines and chemokine receptors in the pathogenesis of multiple

sclerosis. Mult. Scler. 6, 3–13.


Regulation of chemokine receptor expression in human microglia and astrocytes

Documents

Transcript of Regulation of chemokine receptor expression in human microglia and astrocytes