Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence...
-
Upload
alexandrina-russell -
Category
Documents
-
view
216 -
download
2
Transcript of Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence...
![Page 1: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/1.jpg)
Reconstruction of regulatory modules based on heterogeneous data sources
Karen Lemmens
PhD DefenceSeptember 29th 2008
![Page 2: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/2.jpg)
29 September 2008 Karen LemmensPhD defence
Outline
1. Introduction & objectives
2. Strategy– Data integration– Association rule mining algorithms
3. Main achievements– ReMoDiscovery: Unraveling the yeast transcriptional
network– DISTILLER: Condition-dependent combinatorial regulation
in E. coli
4. Conclusions and perspectives
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 3: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/3.jpg)
29 September 2008 Karen LemmensPhD defence
DNA1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 4: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/4.jpg)
29 September 2008 Karen LemmensPhD defence
DNA & genes
TATCCCTCCCTGTTTATCATTAATTTCTAATTATCAGCGTTTTTGGCTGGCGGCGTAGCGATGCGCTGGTTACTCTGAAAACGTCTATGCAAATTAACAAAAGAGAATAGCTATGCATGATGCAAACATCCGCGTTGCCATCGCGGGAGCCGGGGGGCGTAGGGCCGCCAGTTGATTCAGGCGGCGCTGGCATTAGAGGGCGTGCAGTTGGGCGCTGCGCTGGAGCGTGAAGGATCTTCTGAGATCACCCATAAGGCGTCCAGCCGTATGACATTTGCTAACGGCGCGGTAAGATCGGCTTTGTGGTTGAGTGGTAAGGAAAGCGGTCTTTTTGATATGCGAGATGTACTTGATCTCAATAATTTGTAACCACAAAATATTTGTTATGGTGCAAAAATAACACATTTAATTTATTGATTATAAAGGGCTTTAATTTTTGGCCCTTTTATTTTTGGTGTTATGTTTTTAAATTGTCTATAAGTGCCAAATCGTCGGTAAGCAGATTTGCATTGATTTACGTCATCATTGTGAATTAATATGCAAATAAAGTGAGTGAATATTCTCTGGAGGGTGTTTTGATTAAGTCAGCGCTATTGGTTCTGGAAGACGGAACCCAGTTTCACGGTCGGGCCATAGGGGCAACAGGTTCGCCTGACCATCGTTCCGGCGCAAACTTCTGCGGAAGATGTGCTGAAAATGAATCCAGACGGCATCTTCCTCTCCAACGGTCCTGGCGACCCGGCCCCGTGCGATTACGCCATTACCGCCATCCAGAAATTCCTCGAAACCGATATTCCGAATTACATGTTTTG
DNA
mRNA
protein
GENE 1
GENE 2
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 5: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/5.jpg)
29 September 2008 Karen LemmensPhD defence
DNA & genes
TATCCCTCCCTGTTTATCATTAATTTCTAATTATCAGCGTTTTTGGCTGGCGGCGTAGCGATGCGCTGGTTACTCTGAAAACGTCTATGCAAATTAACAAAAGAGAATAGCTATGCATGATGCAAACATCCGCGTTGCCATCGCGGGAGCCGGGGGGCGTAGGGCCGCCAGTTGATTCAGGCGGCGCTGGCATTAGAGGGCGTGCAGTTGGGCGCTGCGCTGGAGCGTGAAGGATCTTCTGAGATCACCCATAAGGCGTCCAGCCGTATGACATTTGCTAACGGCGCGGTAAGATCGGCTTTGTGGTTGAGTGGTAAGGAAAGCGGTCTTTTTGATATGCGAGATGTACTTGATCTCAATAATTTGTAACCACAAAATATTTGTTATGGTGCAAAAATAACACATTTAATTTATTGATTATAAAGGGCTTTAATTTTTGGCCCTTTTATTTTTGGTGTTATGTTTTTAAATTGTCTATAAGTGCCAAATCGTCGGTAAGCAGATTTGCATTGATTTACGTCATCATTGTGAATTAATATGCAAATAAAGTGAGTGAATATTCTCTGGAGGGTGTTTTGATTAAGTCAGCGCTATTGGTTCTGGAAGACGGAACCCAGTTTCACGGTCGGGCCATAGGGGCAACAGGTTCGCCTGACCATCGTTCCGGCGCAAACTTCTGCGGAAGATGTGCTGAAAATGAATCCAGACGGCATCTTCCTCTCCAACGGTCCTGGCGACCCGGCCCCGTGCGATTACGCCATTACCGCCATCCAGAAATTCCTCGAAACCGATATTCCGAATTACATGTTTTG
DNA
mRNA
protein
GENE 1
GENE 2
GENE 1 GENE 2
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 6: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/6.jpg)
29 September 2008 Karen LemmensPhD defence
DNA & genes
TATCCCTCCCTGTTTATCATTAATTTCTAATTATCAGCGTTTTTGGCTGGCGGCGTAGCGATGCGCTGGTTACTCTGAAAACGTCTATGCAAATTAACAAAAGAGAATAGCTATGCATGATGCAAACATCCGCGTTGCCATCGCGGGAGCCGGGGGGCGTAGGGCCGCCAGTTGATTCAGGCGGCGCTGGCATTAGAGGGCGTGCAGTTGGGCGCTGCGCTGGAGCGTGAAGGATCTTCTGAGATCACCCATAAGGCGTCCAGCCGTATGACATTTGCTAACGGCGCGGTAAGATCGGCTTTGTGGTTGAGTGGTAAGGAAAGCGGTCTTTTTGATATGCGAGATGTACTTGATCTCAATAATTTGTAACCACAAAATATTTGTTATGGTGCAAAAATAACACATTTAATTTATTGATTATAAAGGGCTTTAATTTTTGGCCCTTTTATTTTTGGTGTTATGTTTTTAAATTGTCTATAAGTGCCAAATCGTCGGTAAGCAGATTTGCATTGATTTACGTCATCATTGTGAATTAATATGCAAATAAAGTGAGTGAATATTCTCTGGAGGGTGTTTTGATTAAGTCAGCGCTATTGGTTCTGGAAGACGGAACCCAGTTTCACGGTCGGGCCATAGGGGCAACAGGTTCGCCTGACCATCGTTCCGGCGCAAACTTCTGCGGAAGATGTGCTGAAAATGAATCCAGACGGCATCTTCCTCTCCAACGGTCCTGGCGACCCGGCCCCGTGCGATTACGCCATTACCGCCATCCAGAAATTCCTCGAAACCGATATTCCGAATTACATGTTTTG
DNA
mRNA
protein
GENE 1
GENE 2
GENE 1 GENE 2
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 7: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/7.jpg)
29 September 2008 Karen LemmensPhD defence
DNA & genes
TATCCCTCCCTGTTTATCATTAATTTCTAATTATCAGCGTTTTTGGCTGGCGGCGTAGCGATGCGCTGGTTACTCTGAAAACGTCTATGCAAATTAACAAAAGAGAATAGCTATGCATGATGCAAACATCCGCGTTGCCATCGCGGGAGCCGGGGGGCGTAGGGCCGCCAGTTGATTCAGGCGGCGCTGGCATTAGAGGGCGTGCAGTTGGGCGCTGCGCTGGAGCGTGAAGGATCTTCTGAGATCACCCATAAGGCGTCCAGCCGTATGACATTTGCTAACGGCGCGGTAAGATCGGCTTTGTGGTTGAGTGGTAAGGAAAGCGGTCTTTTTGATATGCGAGATGTACTTGATCTCAATAATTTGTAACCACAAAATATTTGTTATGGTGCAAAAATAACACATTTAATTTATTGATTATAAAGGGCTTTAATTTTTGGCCCTTTTATTTTTGGTGTTATGTTTTTAAATTGTCTATAAGTGCCAAATCGTCGGTAAGCAGATTTGCATTGATTTACGTCATCATTGTGAATTAATATGCAAATAAAGTGAGTGAATATTCTCTGGAGGGTGTTTTGATTAAGTCAGCGCTATTGGTTCTGGAAGACGGAACCCAGTTTCACGGTCGGGCCATAGGGGCAACAGGTTCGCCTGACCATCGTTCCGGCGCAAACTTCTGCGGAAGATGTGCTGAAAATGAATCCAGACGGCATCTTCCTCTCCAACGGTCCTGGCGACCCGGCCCCGTGCGATTACGCCATTACCGCCATCCAGAAATTCCTCGAAACCGATATTCCGAATTACATGTTTTG
DNA
mRNA
protein
GENE 1
GENE 2
GENE 1 GENE 2
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
TRANSCRIPTION
![Page 8: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/8.jpg)
29 September 2008 Karen LemmensPhD defence
DNA & genes
TATCCCTCCCTGTTTATCATTAATTTCTAATTATCAGCGTTTTTGGCTGGCGGCGTAGCGATGCGCTGGTTACTCTGAAAACGTCTATGCAAATTAACAAAAGAGAATAGCTATGCATGATGCAAACATCCGCGTTGCCATCGCGGGAGCCGGGGGGCGTAGGGCCGCCAGTTGATTCAGGCGGCGCTGGCATTAGAGGGCGTGCAGTTGGGCGCTGCGCTGGAGCGTGAAGGATCTTCTGAGATCACCCATAAGGCGTCCAGCCGTATGACATTTGCTAACGGCGCGGTAAGATCGGCTTTGTGGTTGAGTGGTAAGGAAAGCGGTCTTTTTGATATGCGAGATGTACTTGATCTCAATAATTTGTAACCACAAAATATTTGTTATGGTGCAAAAATAACACATTTAATTTATTGATTATAAAGGGCTTTAATTTTTGGCCCTTTTATTTTTGGTGTTATGTTTTTAAATTGTCTATAAGTGCCAAATCGTCGGTAAGCAGATTTGCATTGATTTACGTCATCATTGTGAATTAATATGCAAATAAAGTGAGTGAATATTCTCTGGAGGGTGTTTTGATTAAGTCAGCGCTATTGGTTCTGGAAGACGGAACCCAGTTTCACGGTCGGGCCATAGGGGCAACAGGTTCGCCTGACCATCGTTCCGGCGCAAACTTCTGCGGAAGATGTGCTGAAAATGAATCCAGACGGCATCTTCCTCTCCAACGGTCCTGGCGACCCGGCCCCGTGCGATTACGCCATTACCGCCATCCAGAAATTCCTCGAAACCGATATTCCGAATTACATGTTTTG
DNA
mRNA
protein
GENE 1
GENE 2
GENE 1 GENE 2
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
TRANSCRIPTION
TRANSLATION
![Page 9: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/9.jpg)
29 September 2008 Karen LemmensPhD defence
Condition-dependent transcription
DNA
mRNA
protein
GENE 1
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 10: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/10.jpg)
29 September 2008 Karen LemmensPhD defence
Condition-dependent transcription
DNA
mRNA
protein
GENE 1
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 11: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/11.jpg)
29 September 2008 Karen LemmensPhD defence
Condition-dependent transcription
DNA
mRNA
protein
GENE 1
TRANSCRIPTION
TRANSLATION
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 12: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/12.jpg)
29 September 2008 Karen LemmensPhD defence
Condition-dependent transcription
DNA
mRNA
protein
GENE 1 GENE 1
TRANSCRIPTION
TRANSLATION
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 13: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/13.jpg)
29 September 2008 Karen LemmensPhD defence
Condition-dependent transcription
DNA
mRNA
protein
GENE 1 GENE 1
TRANSCRIPTION
TRANSLATION
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 14: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/14.jpg)
29 September 2008 Karen LemmensPhD defence
Condition-dependent transcription
DNA
mRNA
protein
GENE 1 GENE 1
TRANSCRIPTION
TRANSLATION
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 15: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/15.jpg)
29 September 2008 Karen LemmensPhD defence
Transcriptional regulation
GENE 1
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 16: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/16.jpg)
29 September 2008 Karen LemmensPhD defence
Transcriptional regulation
Regulatory motifs
GENE 1
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 17: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/17.jpg)
29 September 2008 Karen LemmensPhD defence
Transcriptional regulation
Regulatory motifs
GENE 1
GENE 1
Regulators
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 18: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/18.jpg)
29 September 2008 Karen LemmensPhD defence
Transcriptional regulation
Regulatory motifs
GENE 1
GENE 1
Regulators
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 19: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/19.jpg)
29 September 2008 Karen LemmensPhD defence
Transcriptional regulation
Regulatory motifs
GENE 1
GENE 1
Regulators
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 20: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/20.jpg)
29 September 2008 Karen LemmensPhD defence
Transcriptional regulation
Regulatory motifs
GENE 1
GENE 1 GENE 1
Regulators
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 21: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/21.jpg)
29 September 2008 Karen LemmensPhD defence
Transcriptional regulation
Regulatory motifs
GENE 1
GENE 1 GENE 1
Regulators
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 22: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/22.jpg)
29 September 2008 Karen LemmensPhD defence
Transcriptional network1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 23: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/23.jpg)
29 September 2008 Karen LemmensPhD defence
Transcriptional network1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 24: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/24.jpg)
29 September 2008 Karen LemmensPhD defence
Transcriptional network1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 25: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/25.jpg)
29 September 2008 Karen LemmensPhD defence
Transcriptional network1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 26: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/26.jpg)
29 September 2008 Karen LemmensPhD defence
Transcriptional network1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 27: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/27.jpg)
29 September 2008 Karen LemmensPhD defence
Transcriptional network1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 28: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/28.jpg)
29 September 2008 Karen LemmensPhD defence
Transcriptional network1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 29: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/29.jpg)
29 September 2008 Karen LemmensPhD defence
Transcriptional network1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 30: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/30.jpg)
29 September 2008 Karen LemmensPhD defence
Transcriptional modules1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 31: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/31.jpg)
29 September 2008 Karen LemmensPhD defence
Outline
1. Introduction & objectives
2. Strategy– Data integration– Association rule mining algorithms
3. Main achievements– ReMoDiscovery: Unraveling the yeast transcriptional
network– DISTILLER: Condition-dependent combinatorial regulation
in E. coli
4. Conclusions and perspectives
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 32: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/32.jpg)
29 September 2008 Karen LemmensPhD defence
Data integration
GENE 1
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 33: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/33.jpg)
29 September 2008 Karen LemmensPhD defence
Data integration
GENE 1
Library of strains, eachwith a tagged regulator
Chromatin IP toenrich promoters
bound by regulatorin vivo
Microarray to identifypromoters bound by
regulator in vivo
Regulator Tag
Library of strains, eachwith a tagged regulator
Chromatin IP toenrich promoters
bound by regulatorin vivo
Microarray to identifypromoters bound by
regulator in vivo
Regulator Tag
Library of strains, eachwith a tagged regulator
Chromatin IP toenrich promoters
bound by regulatorin vivo
Microarray to identifypromoters bound by
regulator in vivo
Regulator Tag
Library of strains, eachwith a tagged regulator
Chromatin IP toenrich promoters
bound by regulatorin vivo
Microarray to identifypromoters bound by
regulator in vivo
Regulator Tag
ChIP-chip data
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 34: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/34.jpg)
29 September 2008 Karen LemmensPhD defence
Data integration
GENE 1
Library of strains, eachwith a tagged regulator
Chromatin IP toenrich promoters
bound by regulatorin vivo
Microarray to identifypromoters bound by
regulator in vivo
Regulator Tag
Library of strains, eachwith a tagged regulator
Chromatin IP toenrich promoters
bound by regulatorin vivo
Microarray to identifypromoters bound by
regulator in vivo
Regulator Tag
Library of strains, eachwith a tagged regulator
Chromatin IP toenrich promoters
bound by regulatorin vivo
Microarray to identifypromoters bound by
regulator in vivo
Regulator Tag
Library of strains, eachwith a tagged regulator
Chromatin IP toenrich promoters
bound by regulatorin vivo
Microarray to identifypromoters bound by
regulator in vivo
Regulator Tag
Regulatory motifs
ChIP-chip data
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 35: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/35.jpg)
29 September 2008 Karen LemmensPhD defence
Data integration
GENE 1
Library of strains, eachwith a tagged regulator
Chromatin IP toenrich promoters
bound by regulatorin vivo
Microarray to identifypromoters bound by
regulator in vivo
Regulator Tag
Library of strains, eachwith a tagged regulator
Chromatin IP toenrich promoters
bound by regulatorin vivo
Microarray to identifypromoters bound by
regulator in vivo
Regulator Tag
Library of strains, eachwith a tagged regulator
Chromatin IP toenrich promoters
bound by regulatorin vivo
Microarray to identifypromoters bound by
regulator in vivo
Regulator Tag
Library of strains, eachwith a tagged regulator
Chromatin IP toenrich promoters
bound by regulatorin vivo
Microarray to identifypromoters bound by
regulator in vivo
Regulator Tag
Regulatory motifs
ChIP-chip data
Microarray data
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 36: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/36.jpg)
29 September 2008 Karen LemmensPhD defence
Network reconstruction
• Several methods for reconstruction of the transcriptional network exist
Not all aspects of transcription taken into account by these methods
** Van den Bulcke T., Lemmens K., Van de Peer Y., Marchal K. (2006) Inferring Transcriptional Networks by Mining Omics Data. Current Bioinformatics, vol. 1, no. 3, pp. 301-313. ** Dhollander T., Sheng Q., Lemmens K., De Moor B., Marchal K., Moreau Y. (2007) Query-driven module discovery in microarray data. Bioinformatics, vol. 23, no. 19, pp. 2573-2580.
BooleanODEBayesianAssociation (CLR, ARACNE)
ClusteringBiclustering Query-driven biclusteringMethod of Segal et al.LeMoNe
BayesianSEREND
GRAM MA-NetworkerSAMBA InferelatorCOGRIM
Expression data Data integration
Individual interactions
Transcriptional modules
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 37: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/37.jpg)
29 September 2008 Karen LemmensPhD defence
Association rule mining
• Association rule mining algorithms
– Advantages:• Enable exhaustive search• Elegant and concurrent data integration• No co-expression assumption between regulator and target• Overlapping modules
– Problems• Binary or discretized data • Filtering method necessary
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 38: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/38.jpg)
29 September 2008 Karen LemmensPhD defence
Outline
1. Introduction & objectives
2. Strategy– Data integration– Association rule mining algorithms
3. Main achievements– ReMoDiscovery: Unraveling the yeast transcriptional
network– DISTILLER: Condition-dependent combinatorial regulation
in E. coli
4. Conclusions and perspectives
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 39: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/39.jpg)
29 September 2008 Karen LemmensPhD defence
ReMoDiscovery: Unraveling the yeast transcriptional network
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 40: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/40.jpg)
29 September 2008 Karen LemmensPhD defence
ReMoDiscovery: Unraveling the yeast transcriptional network
Represent data in a mathematical way
Library of strains, eachwith a tagged regulator
Chromatin IP toenrich promoters
bound by regulatorin vivo
Microarray to identifypromoters bound by
regulator in vivo
Regulator Tag
Library of strains, eachwith a tagged regulator
Chromatin IP toenrich promoters
bound by regulatorin vivo
Microarray to identifypromoters bound by
regulator in vivo
Regulator Tag
Library of strains, eachwith a tagged regulator
Chromatin IP toenrich promoters
bound by regulatorin vivo
Microarray to identifypromoters bound by
regulator in vivo
Regulator Tag
Library of strains, eachwith a tagged regulator
Chromatin IP toenrich promoters
bound by regulatorin vivo
Microarray to identifypromoters bound by
regulator in vivo
Regulator Tag
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 41: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/41.jpg)
29 September 2008 Karen LemmensPhD defence
ReMoDiscovery: Unraveling the yeast transcriptional network
• Transcriptional module– Genes are regulated by a minimum number of regulators– Genes share minimum number of common regulatory
motifs– Genes are co-expressed
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 42: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/42.jpg)
29 September 2008 Karen LemmensPhD defence
ReMoDiscovery: Unraveling the yeast transcriptional network
• Transcriptional module– Genes are regulated by a minimum number of regulators– Genes share minimum number of common regulatory
motifs– Genes are co-expressed
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 43: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/43.jpg)
29 September 2008 Karen LemmensPhD defence
ReMoDiscovery: Unraveling the yeast transcriptional network
• Transcriptional module– Genes are regulated by a minimum number of regulators– Genes share minimum number of common regulatory
motifs– Genes are co-expressed
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 44: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/44.jpg)
29 September 2008 Karen LemmensPhD defence
ReMoDiscovery: Unraveling the yeast transcriptional network
• Transcriptional module– Genes are regulated by a minimum number of regulators– Genes share minimum number of common regulatory
motifs– Genes are co-expressed
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 45: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/45.jpg)
29 September 2008 Karen LemmensPhD defence
ReMoDiscovery: Unraveling the yeast transcriptional network
• Regulatory program:
Regulators: Motifs:
MBP1
SWI4
SWI6
STB1
• Co-expressed genes:
YDL003W YER001W YGR109C YGR189CYGR221C YHR149C YER070W YPL256CYNL300W YPL163C YPL267W YPR120CYMR199W YMR199W YMR179W YML027WYKL113C
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 46: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/46.jpg)
29 September 2008 Karen LemmensPhD defence
ReMoDiscovery: Unraveling the yeast transcriptional network
• ReMoDiscovery outperforms related methods for module detection– GRAM– SAMBA
• Conclusions– Meaningful biological results– Better performance than related methods
association rule mining algorithms are well suited for identification of regulatory modules through data integration
Lemmens K., Dhollander T., De Bie T., Monsieurs P., Engelen K., Smets B., Winderickx J., De Moor B., Marchal K. (2006) Inferring transcriptional module networks from ChIP-chip-, motif- and microarray data. Genome Biology, vol. 7, no. 5, pp. R37.
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 47: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/47.jpg)
29 September 2008 Karen LemmensPhD defence
ReMoDiscovery: Unraveling the yeast transcriptional network
• Many aspects of transcription into account:– Regulatory motifs– Regulators– Co-expression of genes
Condition dependency of the interactions is missing
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 48: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/48.jpg)
29 September 2008 Karen LemmensPhD defence
ReMoDiscovery: Unraveling the yeast transcriptional network
• Many aspects of transcription into account:– Regulatory motifs– Regulators– Co-expression of genes
Condition dependency of the interactions is missing
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 49: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/49.jpg)
29 September 2008 Karen LemmensPhD defence
ReMoDiscovery: Unraveling the yeast transcriptional network
• Many aspects of transcription into account:– Regulatory motifs– Regulators– Co-expression of genes
Condition dependency of the interactions is missing
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 50: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/50.jpg)
29 September 2008 Karen LemmensPhD defence
Outline
1. Introduction & objectives
2. Strategy– Data integration– Association rule mining algorithms
3. Main achievements– ReMoDiscovery: Unraveling the yeast transcriptional
network– DISTILLER: Condition-dependent combinatorial regulation
in E. coli
4. Conclusions and perspectives
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 51: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/51.jpg)
29 September 2008 Karen LemmensPhD defence
DISTILLER: Condition-dependent combinatorial regulation in E. coli
• ReMoDiscovery:
– Co-expression in all conditions by correlation
– Apriori algorithm
– No filtering procedure
• DISTILLER:
– Condition dependency: bandwidth concept
– CHARM algorithm
– Filtering procedure to identify the most interesting modules
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 52: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/52.jpg)
29 September 2008 Karen LemmensPhD defence
DISTILLER: Condition-dependent combinatorial regulation in E. coli
Pastor D., Cortes-Calabuig A., Lemmens K., De Moor B., Marchal K., Denecker M. (2007) GeneReg: Integration of Experimental Data on the DNA Transcription Process. Proceedings of BNAIC 2007.
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 53: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/53.jpg)
29 September 2008 Karen LemmensPhD defence
DISTILLER: Condition-dependent combinatorial regulation in E. coli
• Example: FNR module
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 54: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/54.jpg)
29 September 2008 Karen LemmensPhD defence
DISTILLER: Condition-dependent combinatorial regulation in E. coli
• Example: FNR module
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 55: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/55.jpg)
29 September 2008 Karen LemmensPhD defence
DISTILLER: Condition-dependent combinatorial regulation in E. coli
• Example: FNR module
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 56: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/56.jpg)
29 September 2008 Karen LemmensPhD defence
DISTILLER: Condition-dependent combinatorial regulation in E. coli
• FNR = one of the most extensively studied regulators
• Experimental validation of novel FNR targets
– High confidence: • ydhY (b1674) Partridge et al, 2008• yfgG (b2504)• hscC (b0650)• treF (b3519)
– Medium confidence:• yjhB (b4279)• ydjX (b1750)• yjtD (b4403)• ydaT (b1358)• yehD (b2111)• yhjA (b3518) Partridge et al, 2007• ftnB (b1902)
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 57: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/57.jpg)
29 September 2008 Karen LemmensPhD defence
DISTILLER: Condition-dependent combinatorial regulation in E. coli
• Condition dependency
– Arrays were grouped into conditional categories
– Colors show to what extent the conditions of the modules of a particular regulator are enriched for a specific category
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 58: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/58.jpg)
29 September 2008 Karen LemmensPhD defence
DISTILLER: Condition-dependent combinatorial regulation in E. coli
• Combinatorial regulation
– Static
– Highly combinatorial:• 42 regulons one regulator• 66 complex regulons two regulators• 70 complex regulons three or more regulators (maximum
of 8)
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 59: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/59.jpg)
29 September 2008 Karen LemmensPhD defence
DISTILLER: Condition-dependent combinatorial regulation in E. coli
• Combinatorial regulation at the module level
• Lower combinatorial complexity• 25/150 modules at least two regulators (maximum of 3)• 24 modules involve at least one global regulator such as CRP,
FNR or ArcA
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 60: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/60.jpg)
29 September 2008 Karen LemmensPhD defence
DISTILLER: Condition-dependent combinatorial regulation in E. coli
• Combinatorial regulation at connector gene level
One regulator may be sufficient to alter the expression of a connector gene upon a specific environmental cue
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 61: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/61.jpg)
29 September 2008 Karen LemmensPhD defence
DISTILLER: Condition-dependent combinatorial regulation in E. coli
• Conclusions
– Reliable predictions
– Dynamic view on the network
– Combinatorial regulation
** Lemmens K., De Bie T., Dhollander T., Monsieurs P., De Moor B., Collado-Vides J., Engelen K., Marchal K. (2008) The condition-dependent transcriptional network in Escherichia coli. Accepted for publication in Annals of NYAS, DREAM2.
** Lemmens K., De Bie T., Dhollander T., De Keersmaecker S., Thijs I., Schoofs G., De Weerdt A., De Moor B., Vanderleyden J., Collado-Vides J., Engelen K., Marchal K. (2008) DISTILLER: a data integration framework to reveal condition dependency of complex regulons in Escherichia coli. Submitted to Genome Biology.
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 62: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/62.jpg)
29 September 2008 Karen LemmensPhD defence
Outline
1. Introduction & objectives
2. Strategy– Data integration– Association rule mining algorithms
3. Main achievements– ReMoDiscovery: Unraveling the yeast transcriptional
network– DISTILLER: Condition-dependent combinatorial regulation
in E. coli
4. Conclusions and perspectives
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 63: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/63.jpg)
29 September 2008 Karen LemmensPhD defence
Conclusions
• Main contributions of this thesis:– Automated collection of data– ReMoDiscovery– DISTILLER
• Goals obtained via:– Data integration – Association rule mining algorithms well suited for
data integration and reconstruction of transcriptional network
• Several algorithmic problems were solved
• Novel biological findings
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 64: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/64.jpg)
29 September 2008 Karen LemmensPhD defence
Perspectives
• Conceptual extensions:– Inclusion of other data sources
• Additional motifs from de novo motif detection• Small RNAs
– Comparison of networks
• Implementation-related and algorithmic improvements:– User-friendly interface– Microarray compendium– Filtering step– Motif detection algorithms
1. Introduction 2. Strategy 3. Achievements 4. Conclusions
![Page 65: Reconstruction of regulatory modules based on heterogeneous data sources Karen Lemmens PhD Defence September 29th 2008.](https://reader036.fdocuments.net/reader036/viewer/2022062717/56649e2c5503460f94b1acee/html5/thumbnails/65.jpg)
29 September 2008 Karen LemmensPhD defence
Acknowledgements
• CMPG - BioI– Prof. Dr. K. Marchal– BioI group
• ESAT/SCD – BioI– Prof. Dr. B. De Moor– Prof. Dr. Y. Moreau– BioI group
– Prof. Dr. T. De Bie
• CMPG– Prof. Dr. J. Vanderleyden– Dr. S. De Keersmaecker
• Computer Sciences– Prof. Dr. M. Denecker– A. Cortés Calabuig
– Prof. Dr. J. Collado-Vides
1. Introduction 2. Strategy 3. Achievements 4. Conclusions