Recombinant DNA &

Biotechnology

Recombinant DNA

• recombinant DNA molecules contain DNA from different organisms

– any two DNAs are joined by DNA ligase

5’GGATCATGTA-OH P-CCCGATTTCAAT

3’CCTAGTACAT-P HO-GGGCTAAAGTTA

5’GGATCATGTACCCGATTTCAAT

3’CCTAGTACATGGGCTAAAGTTA

DNA ligase

figure 17-01.jpgfigure 17-01.jpg

restriction enzymes degrade invading viral DNA

Figure 16.1

Cleaving and Rejoining DNA• RE produce many different DNA fragments

restriction enzymes recognize specific DNA sequences (recognition sites)

5’GGATCGAATTCCCGATTTCAAT3’CCTAGCTTAAGGGCTAAAGTTA

EcoRI

a palindrome reads the same left-to-right in the top strand

and right-to-left in the bottom strand

staggered cuts produce “sticky ends”Figure 16.4

Cutting and Rejoining DNA

• restriction enzymes (RE) produce specific DNA fragments for ligation

– RE are defensive weapons against viruses

– RE “cut” (hydrolyze) DNA at specific sites

– RE “staggered cuts” produce “sticky ends”– sticky ends make ligation more efficient

gel electrophoresis

Figure 16.2

Cleaving and Rejoining DNA

• RE produce many different DNA fragments

– for a 6 bp recognition site

1/46 = 1/4096 x 3x109 bp/genome =

7.3 x105 different DNA fragments

• gel electrophoresis sorts DNA fragments by size

• hybridization with a labeled probe locates specific DNA fragments

Southern hybridizatio

n of a

labeled probe to a

DNA target

Figure 16.3

gel electrophoresis & Southern hybridization

Cloning Genes

• genetic engineering requires lots of DNA

– cloning produces lots of exact copies

– DNA clones are replicated by host cells

– DNA is cloned in a DNA vector

– a DNA vector has an origin of replication (ori) that the host cell recognizes

pBR322 is a historical bacterial cloning plasmid a Yeast Artificial Chromosome vector has yeast ori, centromere and telomeres

Agrobacterium Ti plasmid has an Agrobacterium ori and T DNA that integrates into plant DNA

Figure 16.5

Cloning Genes

• a DNA vector with its ligated insert must be introduced into the host cell

• chemical treatment makes cells “competent” - ready for heat shock transformation

• electroporation opens pores in the plasma membrane

• mechanical treatment inserts DNA physically

Cloning Genes

• vectors carry reporter genes

– antibiotic resistance protects host cells that carry a vector (selection)

– proteins such as -galactosidase, luciferase or Green Fluorescent Protein (GFP) identify transformed cells (screening)

bacterial plasmid pBR322 is a

cloning vector that encodes

ampicillin & tetracycline antibiotic resistances

insertion of a target DNA inactivates tetracycline resistance

Figure 16.6

ligating vector to insert

+each cut with the same RE

DNAligase

~4300 bp; 0.1 µg; 1.7 x 1011 molecules

900 bp; 0.063 µg; 5.7 x 1010 molecules

ligation/transformation

• ligation of vector to insert produces several products

– vector ligated to itself (recircularized)

– insert ligated to itself (circularized, no ori)

– two vectors ligated together

– two (or more) inserts ligated together

– several DNAs ligated together, but not circularized

– 1 vector ligated to 1 insert DNA

ligation/transformation

• transformation is a very inefficient process

1µg typical plasmid vector = 3 x 1011 copies

added to highly competent E. coli cells

yields

at best

109 antibiotic resistant colonies

3 x 1011/109 = 300 vectors/transformed E. coli

ligation/transformation

• ligation produces a mess of products

• transformation is an inefficient random process

• selection (antibiotic) sorts out successful vector transformations

• screening identifies transformants with the insert in the vector

37 form colonies

8.5 x 107 cells are plated

24 contain vectors with inserts

bacterial transformation has several potential outcomes

Figure 16.6

creation of a

DNA library in

host bacteria using a

plasmid vectorFigure 16.7

Sources of DNA for Cloning• chromosomal DNA restriction fragments

– ligated to vectors cut with the same RE

– transferred into bacteria

= a genomic DNA library

• a target DNA is identified by hybridization

reverse transcription

produces DNA from

an RNA template

Figure 16.8

Sources of Genes for Cloning

• mRNAs reverse transcribed into cDNAs

– tissue-specific; age specific; treatment vs. normal, etc. cDNAs

– ligated to vectors

– grown in host cells and screened by hybridization

Sources of Genes for Cloning

• make DNA sequences synthetically

– custom oligonucleotides duplicate natural sequences or create mutant sequences

• site-directed mutagenesis makes an exact change (mutation) in a cloned gene

What to do With a Cloned (Altered?) Gene

• compare gene expression in two cell types

– a “gene chip” (microarray) displays short synthetic oligonucleotides

– mRNAs from two different sources are labeled differently

– mRNAs bind to their complements

– a scanner detects mRNA binding by one cell type, the other, or both

microarray analysis compares

gene expression in

two different samples

Figure 16.10

What to do With a Cloned (Altered?) Gene

• mutational analysis

– classical genetics found mutations and studied their effects

– cloning technology causes mutations and studies their effects

• “knockout” mutations

insertion of an

inactivated gene by

homologous recombination

Figure 16.9

What to do With a Cloned (Altered?) Gene

• RNA interference (RNAi) produces a “knockdown” phenotype

– a gene transcribed “backwards” makes an antisense transcript

• antisense transcript + normal mRNA = double-stranded RNA

– small interfering RNA (siRNA) forms double-stranded RNA with normal mRNA

– some viruses inject double-stranded RNA

What to do With a Cloned (Altered?) Gene

• eukaryotic cells attack d.s. RNA– enzymes “cut” d.s. RNA into 21-23 nt

siRNAs (“dicer”)– siRNAs guide enzymes to cut target RNAs

(“slicer”)– siRNAs guide RNA dependent RNA

polymerase to make more d.s. RNA

– [miRNAs control developmental gene expression]

siRNA is used to

silence gene expression

Figure 16.11

What to do With a Cloned (Altered?) Gene

• search for “invisible” interactions

– two hybrid systems identify a receptor’s ligand

• split a transcription activator into DNA-binding and activating domains

• fuse receptor to DNA-binding domain

• fuse cDNA library to activating domain

• activate a reporter gene when receptor and ligand bind

a two-hybrid system detects

binding proteins

Figure 16.12

What to do With a Cloned (Altered?) Gene

• make the protein…

– a cloning vector tells the cell to replicate it (with an ori)

– an expression vector tells a cell to efficiently transcribe and translate a gene in it

an expression vector

instructs a

host cell to

make a proteinFigure 16.13

tissue plasminogen activator is a clot buster

Figure 16.14

Table 16.1

What to do With a Cloned (Altered?) Gene

• medically useful proteins have been expressed

• plant biotechnology speeds up crop improvement

– endogenous insecticides

– herbicide resistance

– improved nutrition

– stress tolerance

• “biotech” animals serve as bioreactors to produce useful proteins

“somatic cell nuclear transfer”

with engineered cells

makes a

sheep that produces

a useful protein

CSI

• Short Tandem Repeats (STRs) are used to identify individuals by “DNA Fingerprinting”

– many sets of STRs exist in the human genome

– the lengths of STR markers differs for different individuals

– different-sized STR markers run differently on agarose gels

DNA fingerprint

analysis using an

STR markerFigure 16.17

Figure 16.18