JOURNAL OF CLINICAL MICROBIOLOGY, Mar. 2010, p. 697–702 Vol. 48, No. 30095-1137/10/$12.00 doi:10.1128/JCM.02021-09Copyright © 2010, American Society for Microbiology. All Rights Reserved.

Rapid Identification and Discrimination of Brucella Isolates by Use ofReal-Time PCR and High-Resolution Melt Analysis�

Jonas M. Winchell,1* Bernard J. Wolff,1 Rebekah Tiller,2 Michael D. Bowen,1 and Alex R. Hoffmaster2

National Center for Immunization and Respiratory Diseases1 and National Center for Zoonotic, Vector-Borne,and Enteric Diseases,2 Centers for Disease Control and Prevention, Atlanta, Georgia 30333

Received 14 October 2009/Returned for modification 29 November 2009/Accepted 21 December 2009

Definitive identification of Brucella species remains a challenge due to the high degree of genetic homologyshared within the genus. We report the development of a molecular technique which utilizes real-time PCRfollowed by high-resolution melt (HRM) curve analysis to reliably type members of this genus. Using a panelof seven primer sets, we tested 153 Brucella spp. isolates with >99% accuracy compared to traditionaltechniques. This assay provides a useful diagnostic tool that can rapidly type Brucella isolates and has thepotential to detect novel species. This approach may also prove helpful for clinical, epidemiological andveterinary investigations.

The Brucella genus is composed of nine recognized species,six of which are classical members (Brucella abortus, B. suis, B.melitensis, B. canis, B. ovis, and B. neotomae), along with newlydesignated species B. ceti, B. pinnipedialis, and B. microti andthe proposed species B. inopinata (5, 6, 15, 16). These small,facultative intracellular, aerobic, Gram-negative coccobacillihave a worldwide distribution and share over 90% nucleic acidsequence homology (19). As the causative agent of brucellosis,a zoonotic disease resulting in high rates of reproductive fail-ure and sterility in livestock, these agents are most commonlytransmitted to humans through the consumption of unpasteur-ized milk products, direct contact with infectious animal tis-sues, or inhalation of aerosolized droplets (13). B. melitensis, B.suis, B. abortus, and rarely B. canis are responsible for over500,000 human infections per year worldwide, with the firstthree species classified as select agents due to their potentialfor bioterrorism (4, 5). Members of this genus also pose asignificant risk for laboratory-acquired infections.

Historically, the Brucelleae were named according to theirhost preference, while taxonomy and species discriminationrelied on biochemical, antigenic, and metabolic differences.Conventional laboratory tests such as CO2 requirement, dyesensitivities, phage susceptibility, H2S production, oxidativemetabolic patterns, and antiserum reactivity are used to deter-mine phenotypic characteristics in order to identify an isolate(20). These tests are often laborious and time-consuming, posea risk of infection, and can generate discordant results. Recentmolecular approaches such as whole genome sequence com-parisons, single nucleotide polymorphism (SNP) analysis, mul-tilocus variable-number tandem-repeat (VNTR) analysis(MLVA), and various real-time PCR approaches have greatlyenhanced the ability to rapidly characterize members of thisgenus (1, 3, 7, 11, 17, 18, 21). Although these methodologieshave proved greatly beneficial to the study of this genus, the

assay described here provides an alternative approach to fur-ther delineate and augment the ability to rapidly identify theseagents.

We report the development of a real-time PCR assay thatutilizes high-resolution melt (HRM) analysis to specificallydetect and discriminate members of this genus. HRM is arelatively new technology that allows for superb resolution andcharacterization of amplified nucleic acid targets by using aprecisely regulated melting temperature profile that providesexceptional sensitivity for discerning minor differences (22).The major aim of the present study was to design a rapid andsimple molecular assay capable of specifically detecting anddiscriminating major species of the genus and yet have thepotential to identify unusual or novel isolates by exploiting theinherent advantages of HRM technology. To our knowledge,this is the first report to demonstrate the utility of this tech-nology for characterizing this genus. The assay described hereuses PCR amplification of seven independent loci, followed bydissociation curve analysis with five of the target regions, al-lowing multiple targets to be concurrently evaluated to make apositive species determination. Lastly, this assay may be usefulfor detecting Brucella spp. in clinical specimens and provideinsight into epidemiological, clinical, and veterinary studies.

MATERIALS AND METHODS

Bacterial strains and DNA preparation. A total of 153 Brucella strains (rep-resenting eight species) from a collection of more than 1,000 were selected torepresent temporal, geographic, and source diversity (Table 1). These isolateswere obtained from 1973 to the present and represent a broad geographicdistribution (the United States [including Hawaii], Europe, Puerto Rico, China,Mexico, Egypt, and Australia). A wide variety of sources were also represented,including blood, tissue, and fluids from humans, marine mammals, cattle, dogs,sheep, and rodents. All strains were stored at �70°C in defibrinated rabbit blooduntil testing. Identification of all strains was carried out using standard micro-biological procedures as previously described (20). Bacteria were grown by plat-ing one loop (1 �l) of stock cell suspension on Trypticase soy agar with 5% sheepblood agar (BBL Microbiology Systems, Cockeysville, MD) and incubating thebacteria aerobically for 1 to 2 days at 37°C with 5% CO2. DNA template wasprepared as previously described (8).

Real-time PCR and HRM analysis of Brucella spp. Primers were manuallydesigned to amplify selected regions for species determination by using publicallyavailable sequence data within the NCBI database. The primer designation,sequence, targeted loci used, and specificity for each marker are listed in Table

* Corresponding author. Mailing address: Centers for Disease Con-trol and Prevention, 1600 Clifton Rd., NE, MS: G-03, Atlanta, GA30333. Phone: (404) 639-4921. Fax: (404) 718-1855. E-mail: jwinchell@cdc.gov.

� Published ahead of print on 6 January 2010.

697

on April 20, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

2. Briefly, targeted sequences for each marker were aligned using CLUSTAL W,and primers were designed to provide discriminating HRM profiles. The markerspecificities were as follows: Bspp, all Brucella spp.; Bmel, B. melitensis; Bcan, B.canis; Bmar, marine strains (B. ceti and B. pinnipedialis); Bneo, B. neotomae; Boa,B. ovis and B. abortus; and Bsui, B. suis. The real-time PCR assay was preparedusing a Universal SYBR GreenER qPCR kit (Invitrogen, Carlsbad, CA) con-taining the following components per reaction: 12.5 �l of 2� master mix, a 100nM final concentration of the forward and reverse primers, �2 ng of template,and nuclease-free water (Promega, Madison, WI) to a total reaction volume of25 �l. The real-time PCR was performed in triplicate on a Corbett Rotor-Gene6000 (Qiagen, Valencia, CA) with the following run conditions: 1 cycle of 50°Cfor 2 min and 1 cycle of 95°C for 10 min, followed by 40 cycles of 95°C for 5 s and60°C for 30 s, with data acquired at the 60°C step in the green channel. Afteramplification, a high-resolution melt was performed between 73 and 88°C at arate of 0.03°C per step. HRM curves for five markers were normalized using thespecific temperature regions listed in Table 2 prior to performing final analysisfor reasons previously described (23). A positive/negative amplification growthcurve only is required for the genus-specific marker (Bspp) and the B. suis-specific marker (Bsui).

Specificity and sensitivity testing. A panel of 16 closely related non-Brucellaspecies (n � 31) and human DNA was selected to test the specificity of the assay.These includes Ochrobactrum anthropi 5D (n � 4), Ochrobactrum intermedium,Agrobacterium radiobacter (n � 2), Agrobacterium tumefaciens, Agrobacteriumradiobacter (n � 2), Oligella urethralis (n � 4), Afipia felis, Afipia broomeae,

Haemophilus influenzae (n � 2), Psychrobacter phenylpyruvicus, Escherichia coli(n � 2), Salmonella enterica serovar Typhi (n � 3), Vibrio cholerae (n � 2),Yersinia enterocolitica (n � 3), Mycoplana spp., and Rhizobium spp. These weretested at 20 to 50 ng per reaction in duplicate.

The sensitivity of each marker was tested by using quantitated DNA of theappropriate Brucella species diluted in 10-fold serial dilutions. Each were testedin triplicate to determine the lower limit of detection (LLOD), defined as allthree replicates displaying a positive growth curve and a reliable dissociationcurve.

RESULTS

Specificity and sensitivity testing. All primer sets used in thepresent assay were tested for specificity against a panel ofnear-neighbor organisms and human DNA as listed above. Allorganisms demonstrated no reactivity with the seven markersused when tested at the �2-ng concentration used for testingBrucella spp. isolates (data not shown). The Bspp marker dis-played no reactivity with any of the organisms. The LLOD foreach marker was determined for detection (Bspp and Bsui)and, where applicable, reliable HRM curve analysis. Thesevalues ranged from 1 to 100 fg (Table 2). Four of the five meltcurve dependent markers required only 100 fg for dependablecurve interpretation (1 pg was needed for Bmel).

Real-time PCR and HRM analysis. All Brucella isolates (n �153, Table 1), representing eight recognized species and mul-tiple biovars, were tested by real-time PCR using seven primersets: Bspp, Bmel, Bcan, Bmar, Bneo, Boa, and Bsui (Table 2).The Bspp marker specifically detects all members of the genusand displays only a positive amplification curve when Brucellaspecies are present (data not shown). HRM curves for the sixspecies-specific markers are illustrated in Fig. 1. HRM analysisis required for Bmel, Bcan, Bmar, Bneo, and Boa markers (Fig.1A to E) to determine the specific species of Brucella basedupon unique dissociation profiles for each marker. B. melitensisisolates are shown in Fig. 1A as possessing an earlier melting

TABLE 1. Brucella species isolates used in screening assaysa

SpeciesNo. of isolates per biovar

Total1 2 3 4 5 Vaccine NA

B. abortus 13 4 1 6 3 27B. canis 22 22B. ceti 6 6B. melitensis 7 7 31 9 54B. neotomae 1 1B. ovis 7 7B. pinnipedialis 2 2B. suis 24 1 1 1 7 34

a Brucella species isolates (n � 153) were examined. The biovar is listed(biovars 1 to 5) when known. NA, biovar not available.

TABLE 2. Oligonucleotide sequences for primers used to detect Brucella speciesa

MarkerPrimer Amplicon

size (bp)

Normalization region LLOD(fg)

Reliablemelt curve

(amt)Gene target SNP or genetic

identityOrientationb Sequence (5��3�) First Second

Bspp F GTGGCGATCTTGTCCG Plus/minusR ACGGCGATGGATTTCCG 67 NA NA 100 NA vdcc

Bcan F GCAACTACTCTGTTGACCCGA A; B. canis, B. suisbv3 and bv4

R TGCCGATCAGGCTGTGTTG 88 76.5–77 81–81.5 100 100 fg int-hyp G; other spp.

Bmar F CGCATTCATGGGCTTCGTC IS711 insertion inR GCTCTAGGGCGTGTCTGCATT 69 74.5–75 81–81.5 10 100 fg BP26/IS711 marine spp.

Bmel F GAGCGATCTTTACACCCTTGT T; B. melitensisR GGACGGTGTAATAAACCCATTGG 125 82.5–83 87.5–88 1 1 pg int-hyp G; other spp.

Bneo F CACCGAACGCGACTACCAGATT G; B. neotameR GCCCAGATAGAGGTTGCG 105 81–81.5 85–85.5 10 100 fg glk A; other spp.

Bsui F TGCGCTATGATCTGGTTACGTT Plus/minusR AGCGCGGTTTTCTGAAGGT 69 NA NA 100 NA Transposase

Boa F GACCTCTTCGCCACCTATCTGG A, A; B. ovis G;other spp.

R CCTTGTGCGGGGCCTTGTCCT 163 83–83.5 87–87.5 100 100 fg glk A; B. abortus G;other spp.

a NA, not applicable.b F, forward; R, reverse.

698 WINCHELL ET AL. J. CLIN. MICROBIOL.

on April 20, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

curve compared with all other isolates. This separation is dueto a G3T transversion found within the int-hyp gene of B.melitensis species. A similar pattern is seen for B. canis isolatesin Fig. 1B when the Bcan primer was used; however, this iscaused by a transition of G to A within the int-hyp locus. Themarine strains (B. ceti and B. pinnipedialis) showed more vari-ability in their melting profiles; however, they were easily dis-

tinguished from all other members when the Bmar primer wasused (Fig. 1C). These distinct HRM curves are attributed tospecies-specific changes within the targeted BP26 locus. Theseisolates demonstrated an overall higher melting curve temper-ature (shifted right) compared to the other six Brucella species.A transition (A3G) within the Glk gene accounts for theunique melting profile of B. neotomae when using the Bneo

FIG. 1. Specific identification of Brucella spp. Real-time PCR followed by HRM analysis (when applicable) was performed in triplicate onrepresentatives of all known Brucella spp. isolates. HRM is shown in the normalization graph function. The colors are standardized in panels Athrough F as follows: B. melitensis, gray; B. canis, black; marine strains, green; B. neotomae, olive; B. ovis, yellow; B. abortus, orange; and B. suis,red. The primer sets Bmel (a), Bcan (b), Bmar (c), Bneo (d), Boa (e), and Bsui (f) are shown in the indicated panels, along with the species thateach is able to discriminate. The Bsui marker is a “�/�” amplification assay (where � represents amplification and � represents no amplification)specific for B. suis only; Bspp is a “�/�” amplification marker that detects all known species of the Brucella genus.

VOL. 48, 2010 HRM IDENTIFICATION OF BRUCELLA spp. 699

on April 20, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

marker (Fig. 1D.) Lastly, both B. ovis and B. abortus displaydistinctive melting curves from one another and all other Bru-cella species when the Boa primer set was used (Fig. 1E). TheBoa primer set produces the earliest melting curve for B ovisstrains due to two transitions (both G3A) within the targetedregion of the Glk gene, whereas B. abortus contains a singletransition (G3A) at a distinct locus within the same amplicon,thus resulting in a slightly higher melting temperature (Fig.1E). All other species display a dissociation curve that lies

furthermost to the right due to the conservation of the threeguanine residues at these two loci. The Bsui primer set displaysa positive growth curve for B. suis strains only and fails toamplify all other species (Fig. 1F).

A recently described isolate (BO2) that has been proposedas a lineage of the new B. inopinata species was tested using thecurrent assay (R. Tiller, unpublished data). A positive ampli-fication using Bspp (data not shown) was followed by the sixspeciation markers. Although three markers (Bcan, Bmar, and

FIG. 2. Identification of a novel Brucella sp. Real-time PCR and HRM analysis was used to identify a novel Brucella species. Bmel (Fig. 2A)and Boa (Fig. 2E) show unique HRM curves for this isolate. All other markers display melt curves consistent with known species, including theBspp (data not shown).

700 WINCHELL ET AL. J. CLIN. MICROBIOL.

on April 20, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

Bneo) showed HRM curves that were consistent with knownBrucella spp., the Bmel and Boa HRM profiles show uniquedissociation curves that are different from any known Brucellaisolates tested (Fig. 2). The Bmel marker shows a discerniblecurve shifted to the left of the B. melitensis isolates, attributedto a single transition of C3T (Fig. 2A), while the HRM profilefrom the Boa assay displays a dramatic shift, again to the left,a finding indicative of a lower melting temperature due tothree C3T transitions within the targeted amplicon (Fig. 2E).The Bsui marker displayed no amplification, indicating a con-sistency with the isolate not being a B. suis species (Fig. 2F).

An earlier reported isolate (BO1) which prompted the pro-posal of B. inopinata as a novel species was also tested. Thisisolate did not display the same HRM curve patterns as BO2;however, it was unique because it did not match a profile forany of the known Brucella species. For each marker tested, thisisolate always grouped with the “all other” Brucella species andwas positive with Bspp and negative for Bsui.

DISCUSSION

We report the development of a real-time PCR assay thathas taken advantage of the sensitivity of a postamplificationhigh-resolution melt to differentiate members of the Brucellagenus. By specifically targeting discriminating loci within thegenomes of Brucella spp., this assay is able to generate distinc-tive melt curves under the same thermocycling program thatare highly reproducible among different strains of the samespecies. This approach was used to accurately identify 152 of153 Brucella isolates at the species level, demonstrating thereliability of the assay. Although the six-marker speciationpanel proved to be sufficient for accurate determination of thespecies, we chose to also incorporate the Bspp marker. Thismarker serves as an initial identifying indicator of inclusion inthe Brucella genus and detects all members of this genus. Theabsence of a positive amplification curve with this markerwould preclude any further analysis of an isolate. All Brucelleaemembers tested demonstrated robust amplification curves,whereas near neighbors did not.

The HRM assay described here can identify novel or un-usual isolates. Three reports describe real-time PCR assays forthe detection of different Brucella spp.; however, none arebased upon HRM analysis or are able to identify novel strains(6, 9, 10). Gopaul et al. recently reported a minor-groovebinding-based assay to detect species-specific SNPs of the sixclassical members, as well as marine mammal strains (9). Thatstudy screened more than 300 isolates and found that B. suisbv5 was unable to be positively identified and that B. suis bv1to bv4 could not be separated from B. canis isolates. Althoughthe assay holds great utility, it requires the use of proprietarychemistry and two separate probes in each of the seven reac-tion wells which results in a substantial increase in cost. Incontrast, the method described in the present study uses com-mon and widely available reagents and equipment, along withinexpensive unlabeled oligonucleotides. To our knowledge,this assay is the first to specifically identify B. suis using real-time PCR. All other existing real-time PCR-based assays iden-tify this species through indirect testing algorithms. Further-more, this assay can identify unusual Brucella isolates such asBO1 and BO2. The unique melting profiles of these strains

represent an important “plasticity” feature of this assay. Bytargeting multiple loci and employing HRM analysis, an atyp-ical Brucella isolate can be recognized and be further exam-ined.

This assay also proved successful for discriminating B. suisfrom B. canis, an objective that has proved to be challengingusing real-time PCR approaches (7, 10). Interestingly, our as-say was unable to accurately differentiate a B. suis bv4 from B.canis. This particular B. suis biovar has previously been re-ported to exhibit a genotypic pattern identical to B. canis, andit is still debated as to whether this is truly a unique biovar ofB. suis (2, 11, 21). Further, B. canis has historically been shownto be very closely related to B. suis through a variety of mo-lecular studies (21). This observation underscores the complex-ity involved with discriminating these two species of Brucella.

A main objective of our study was to provide a rapid mo-lecular typing assay for Brucella isolates that is easily interpret-able and possess the ability to identify unusual strains. OptimalCT values should be between 15 and 35 and display the char-acteristic sigmoid-shaped curve for reliable HRM data. Be-cause sufficient quantity of DNA should be readily availablefrom the isolates, this should not pose a problem. We observedreliable HRM curves down to 100 fg with all but one marker(Bmel), which required 1 pg. These differences may be due tothe intrinsic amplification efficiencies within primer sets. Not-withstanding, these data demonstrate the sensitive nature ofthe assay and provide an easily achievable range of DNAconcentrations for reliably performing the assay. This assay hasnot been tested on clinical specimens suspected of containingBrucella spp. However, the HRM technique has been used todetect other pathogens in clinical specimens and may beapplicable with further optimization for such specimens (12,14, 23).

The genetically monomorphic nature of the Brucella genuscontinues to be a challenge for both microbiologists and tax-onomists. We present here a methodology that can enhanceand supplement existing procedures to identify Brucella spp.This assay has the potential to improve the timely reporting ofresults, provide a means for greater characterization of iso-lates, aid in epidemiological investigations, and contribute to amore comprehensive typing system for this genus.

REFERENCES

1. Bricker, B. J., D. R. Ewalt, and S. M. Halling. 2003. Brucella “HOOF-Prints”: strain typing by multilocus analysis of variable number tandemrepeats (VNTRs). BMC Microbiol. 3:15.

2. Bricker, B. J., and S. M. Halling. 1994. Differentiation of Brucella abortus bv.1, 2, and 4, Brucella melitensis, Brucella ovis, and Brucella suis bv. 1 by PCR.J. Clin. Microbiol. 32:2660–2666.

3. Chain, P. S. G., D. J. Comerci, M. E. Tolmasky, F. W. Larimer, S. A.Malfatti, L. M. Vergez, F. Aguero, M. L. Land, R. A. Ugalde, and E. Garcia.2005. Whole-genome analyses of speciation events in pathogenic brucellae.Infect. Immun. 73:8353–8361.

4. Code of Federal Regulations. 2005. Code of Federal Regulation: 7 CFR Part331, 9 CFR Part 121, and 42 CFR Part 73. U.S. Government Printing Office,Washington, DC.

5. Cutler, J. S., A. M. Whatmore, and N. J. Commander. 2005. Brucellosis: newaspects of an old disease. J. Appl. Microbiol. 98:1270–1281.

6. Foster, G., B. S. Osterman, J. Godfroid, I. Jacques, and A. Cloeckaert. 2007.Brucella ceti sp. nov. and Brucella pinnipedialis sp. nov. for Brucella strainswith cetaceans and seals as their preferred hosts. Int. J. Syst. Evol. Microbiol.57:2688–2693.

7. Foster, J. T., R. T. Okinaka, R. Svensson, K. Shaw, B. K. De, R. A. Robison,W. S. Probert, L. J. Kenefic, W. D. Brown, and P. Keim. 2008. Real-timePCR assays of single-nucleotide polymorphisms defining the major Brucellaclades. J. Clin. Microbiol. 46:296–301.

8. Gee, J. E., B. K. De, P. N. Levett, A. M. Whitney, R. T. Novak, and T. Popovic.

VOL. 48, 2010 HRM IDENTIFICATION OF BRUCELLA spp. 701

on April 20, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

2004. Use of 16S rRNA gene sequencing for rapid confirmatory identifica-tion of Brucella isolates. J. Clin. Microbiol. 42:3649–3654.

9. Gopaul, K., M. Koylass, C. Smith, and A. Whatmore. 2008. Rapid identifi-cation of Brucella isolates to the species level by real time PCR based singlenucleotide polymorphism (SNP) analysis. BMC Microbiol. 8:86.

10. Hinic, V., I. Brodard, A. Thomann, Z. Cvetnic, P. V. Makaya, J. Frey, and C.Abril. 2008. Novel identification and differentiation of Brucella melitensis, B.abortus, B. suis, B. ovis, B. canis, and B. neotomae suitable for both conven-tional and real-time PCR systems. J. Microbiol. Methods 75:375–378.

11. Huynh, L. Y., M. N. V. Ert, T. Hadfield, W. S. Probert, B. H. Bellaire, M.Dobson, R. J. Burgess, R. S. Weyant, T. Popovic, S. Zanecki, D. M. Wagner,and P. Keim. 2008. Multiple locus variable number tandem repeat (VNTR)analysis (MLVA) of Brucella spp. identifies species-specific markers andinsights into phylogenetic relationships, p. 47–54. Humana Press, Totowa,NJ.

12. Mitchell, S. L., B. J. Wolff, W. L. Thacker, P. G. Ciembor, C. R. Gregory,K. D. E. Everett, B. W. Ritchie, and J. M. Winchell. 2009. Genotyping ofChlamydophila psittaci by real-time PCR and high-resolution melt analysis.J. Clin. Microbiol. 47:175–181.

13. Pappas, G., N. Akritidis, M. Bosilkovkis, and E. Tsianos. 2005. Brucellosis.N. Engl. J. Med. 352:2325–2335.

14. Pietzka, A. T., A. Indra, A. Stoger, J. Zeinzinger, M. Konrad, P. Hasen-berger, F. Allerberger, and W. Ruppitsch. 2009. Rapid identification ofmultidrug-resistant Mycobacterium tuberculosis isolates by rpoB gene scan-ning using high-resolution melting curve PCR analysis. J. Antimicrob. Che-mother. 63:1121–1127.

15. Scholz, H. C., Z. Hubalek, I. Sedlacek, G. Vergnaud, H. Tomaso, S. AlDahouk, F. Melzer, P. Kampfer, H. Neubauer, A. Cloeckaert, M. Maquart,S. M. Zygmunt, M. A. Whatmore, E. Falsen, P. Bahn, C. Gollner, M. Pfefer,B. Huber, H. J. Busse, and K. Nockler. 2008. Brucella microti sp. nov.,isolated from the common vole Microtus arvalis. Int. J. Syst. Evol. Microbiol.58:375–382.

16. Scholz, H. C., K. Nockler, C. Gollner, P. Bahn, G. Vergnaud, H. Tomaso, S.

Al-Dahouk, P. Kampfer, A. Cloeckaert, M. Maquart, M. S. Zygmunt, A. M.Whatmore, M. Pfeffer, B. Huber, H. J. Busse, and B. K. De. 2009. Brucellainopinata sp. nov., isolated from a breast implant infection. Int. J. Syst. Evol.Microbiol. doi10.1099/ijs. 0.011148-0.

17. Scott, J. C., M. S. Koylass, M. R. Stubberfield, and A. M. Whatmore. 2007.Multiplex assay based on single-nucleotide polymorphisms for rapid identi-fication of Brucella isolates at the species level. Appl. Environ. Microbiol.73:7331–7337.

18. Tiller, R. V., B. K. De, M. Boshra, L. Y. Huynh, M. N. Van Ert, D. M.Wagner, J. Klena, T. S. Mohsen, S. S. El-Shafie, P. Keim, A. R. Hoffmaster,P. P. Wilkins, and G. Pimentel. 2009. Comparison of two multiple locusvariable number tandem repeat (VNTR) analysis (MLVA) methods formolecular strain typing human Brucella melitensis isolates from the MiddleEast. J. Clin. Microbiol. 47:2226–2231.

19. Verger, J. M., F. Grimont, P. Grimont, and M. Grayon. 1985. Brucella, amonospecific genus as shown by deoxyribonucleic acid hybridization. Int. J.Syst. Bacteriol. 35:292–295.

20. Weyant, R. S., C. W. Moss, R. E. Weaver, D. G. Hollis, J. G. Jordan, E. C.Cook, and M. I. Daneshvar. 1996. Identification of unusual pathogenicgram-negative aerobic and facultatively anaerobic bacteria. The Williams &Wilkins Co., Baltimore, MD.

21. Whatmore, A. M., L. L. Perrett, and A. P. Macmillan. 2007. Characterizationof the genetic diversity of Brucella by multilocus sequencing. BMC Micro-biol. 7:34.

22. White, H., and G. Potts. 2006. Mutation scanning by high resolution meltanalysis: evaluation of RotorGene 6000™ (Corbett Life Science), HR1™,and 384 well LightScanner™ (Idaho Technology). National Genetics Refer-ence Laboratory, Wessex, United Kingdom.

23. Wolff, B. J., W. L. Thacker, S. B. Schwartz, and J. M. Winchell. 2008.Detection of macrolide resistance in Mycoplasma pneumoniae by real-timePCR and high resolution melt analysis. Antimicrob. Agents Chemother.52:3542–3549.

702 WINCHELL ET AL. J. CLIN. MICROBIOL.

on April 20, 2020 by guest

http://jcm.asm

.org/D

ownloaded from