Rac GTPase regulation of GLUT4 traffic in muscle cells ... · Rac GTPase regulation of GLUT4...

Rac GTPase regulation of GLUT4 traffic in muscle cells:

mechanisms and implications

Ting (Tim) Chiu

A thesis submitted with requirements for the degree of Doctor of Philosophy in

Biochemistry

Graduate Department of Biochemistry

University of Toronto

© Copyright by Ting (Tim) Chiu (2014)

ii

Rac GTPase regulation of GLUT4 traffic in muscle cells: mechanisms and implications

Doctor of Philosophy in Biochemistry, Graduate Department of Biochemistry, University of Toronto

Ting (Tim) Chiu (2014)

Abstract

One of the hallmarks of postprandial glucose homeostasis is the ability of insulin

to promote glucose uptake into skeletal muscles. Insulin achieves this feat by enhancing

the recruitment of glucose transporter 4 (GLUT4) from an intracellular compartment to

the plasma membrane of muscles in order to create a net increase in surface GLUT4,

which results in elevated glucose uptake. From a molecular perspective, this insulin-

regulated GLUT4 traffic action requires the independent activation of Akt and Rac-1 in

muscle cells because perturbation of either molecule results in an impaired response.

Although Rac-1 has been validated as key component of insulin response, its

downstream signalling capacity contributing to GLUT4 translocation remains unexplored.

Studies on Rac-1 have shown that it is responsible for the formation of cortical

remodelled actin that facilitates GLUT4 translocation following insulin stimulation.

However, the downstream Rac-dependent molecules governing this actin remodelling

are undetermined. Here we identified Arp2/3 and cofilin as the Rac-dependent

regulators of insulin-induced actin remodelling in muscle cells. While Arp2/3 acts to

initiate a burst of actin polymerization, cofilin balances out the actin dynamics through

its severing/depolymerizing activity. Inhibition of either molecule’s function leads to

defective GLUT4 translocation mediated by insulin in muscle cells, suggesting the

requirement of actin dynamics to facilitate GLUT4 traffic to the plasma membrane.

iii

Furthermore, given the importance of Rac-1 in insulin-mediate GLUT4 traffic, its

application potential to reverse insulin resistance has never been explored. We

discovered that providing muscle cells with additional Rac-1 activity produces an insulin-

independent gain in surface GLUT4 with magnitude comparable to that normally elicited

by insulin. This phenotype is accomplished because of the concomitant cross-activation

of Akt pathway when supplying the cells with active Rac-1. Interestingly, this response

can bypass signalling defects imposed by cellular insulin resistance conditions, leading

to restoration of GLUT4 translocation in muscle cells.

Overall, these results not only reinforce the functional impact of Rac-1 on GLUT4

traffic but also identify additional molecules governed by Rac-1 contributing to the

integrity of this insulin-mediated response in muscle cells.

iv

Table of content

Abstract ......................................................................................................................................................... ii

Preface ....................................................................................................................................................... viii

Published papers ........................................................................................................................................ viii

Acknowledgements ...................................................................................................................................... ix

Figure list ...................................................................................................................................................... xi

Table list ...................................................................................................................................................... xii

Abbreviations ..............................................................................................................................................xiii

CHAPTER 1: Introduction ............................................................................................................................. 1

1.1: Background on Rho GTPase family .................................................................................................... 2

1.2: Regulation of GTP/GDP cycles in Rho GTPases .................................................................................. 3

1.2-1: GEFs and GAPs ............................................................................................................................ 4

1.2-2: Prenylation .................................................................................................................................. 5

1.2-3: GDI .............................................................................................................................................. 5

1.2-4: Covalent modifications and miRNAs .......................................................................................... 6

1.3: Cellular functions of Rho GTPases ..................................................................................................... 7

1.4: The dynamic control of actin cytoskeleton ........................................................................................ 8

1.4-1: Actin polymerization ................................................................................................................... 9

1.4-1-I: Monomer actin binding proteins: thymosin-β4 and profilin .............................................. 10

1.4-1-II: Actin nucleators ................................................................................................................. 10

1.4-1-II-A: Formin ........................................................................................................................ 10

1.4-1-II-B: Arp2/3 ........................................................................................................................ 12

1.4-1-II-B.1: WASP and N-WASP ............................................................................................. 14

1.4-1-II-B.2: WAVE ................................................................................................................... 15

1.4-1-II-B.3: WASH .................................................................................................................. 16

1.4-1-II-B.4: WHAMM ............................................................................................................. 16

1.4-1-II-B.5: JMY ...................................................................................................................... 17

1.4-1-II-B.6: Cortactin .............................................................................................................. 18

1.4-1-II-C: WH2-repeat nucleators .............................................................................................. 18

1.4-2: Severing and depolymerization ................................................................................................ 19

1.4-2-I: Gelsolin ............................................................................................................................... 19

1.4-2-II: ADF/Cofilin ......................................................................................................................... 20

v

1.4-3: Other actin modulations - capping protein (CP) and bundling protein .................................... 21

1.5: Rho GTPases-dependent controls on actin ...................................................................................... 22

1.5-1: Vesicle traffic regulated by Rho GTPase-mediated actin dynamics ......................................... 23

1.5-1-I: Exocytosis ........................................................................................................................... 24

1.5-1-II: Endocytosis ........................................................................................................................ 24

1.5-1-III: Endosomal sorting ............................................................................................................ 25

1.6: Regulation of glucose homeostasis by GLUTs.................................................................................. 26

1.6-1: GLUT4 traffic ............................................................................................................................. 29

1.6-1-I: Recycling GLUT4 vesicles versus GLUT4 storage vesicles ................................................... 30

1.6-1-II: Insulin signalling cascade leading to GLUT4 translocation ................................................ 32

1.6-1-II-A: IR->IRS1/2->PI3K ........................................................................................................ 33

1.6-1-II-B: Akt->AS160->Rabs ...................................................................................................... 34

1.6-1-III: Rho-induced actin regulation in GLUT4 traffic ................................................................. 36

1.6-1-III-A: TC-10 in adipocytes? ................................................................................................. 38

1.6-1-III-B: Rac-1 in muscles ........................................................................................................ 39

1.6-1-IV: Akt and Rac-1 function independently but both lie downstream of PI3K ....................... 40

1.6-1-V: Functions of insulin-induced remodelled actin in GLUT4 traffic ....................................... 42

1.6-1-V-A: Tethering of GLUT4 vesicles ...................................................................................... 43

1.6-1-V-B: Scaffold for signalling molecules ............................................................................... 44

1.6-1-V-C: Tracks for GLUT4 vesicles ........................................................................................... 45

1.6-1-VI: Rac-dependent actin remodelling during insulin resistance in muscle cells ................... 45

1.7: RATIONALE AND HYPOTHESES ......................................................................................................... 47

CHAPTER 2: Materials and Methods.......................................................................................................... 50

2.1: Materials .......................................................................................................................................... 51

2.1-1: Cell culture reagents ................................................................................................................. 51

2.1-2: General reagents ...................................................................................................................... 51

2.1-3: Antibodies ................................................................................................................................. 51

2.1-4: cDNAs ........................................................................................................................................ 52

2.1-5: siRNAs ....................................................................................................................................... 52

2.1-6: PCR primers .............................................................................................................................. 53

2.2: Experimental protocols .................................................................................................................... 53

2.2-1: Growing L6 myoblasts............................................................................................................... 53

vi

2.2-2: Cell treatments ......................................................................................................................... 54

2.2-3: cDNA transfection ..................................................................................................................... 54

2.2-4: siRNA transfection .................................................................................................................... 55

2.2-5: RNA isolation ............................................................................................................................ 56

2.2-6: cDNA generation from purified RNA ........................................................................................ 57

2.2-7: PCR ............................................................................................................................................ 57

2.2-8: Cell lysates, immunoprecitation and immunoblotting ............................................................. 57

2.2-9: Cell-surface GLUT4myc and total GLUT4myc detection by immunofluorescence microscopy 58

2.2-10: Rounded-up myoblasts assay ................................................................................................. 59

2.2-11: Detection and quantification of actin remodelling/polymerized dorsal actin ....................... 59

2.2-12: 125I-Transferrin recycling ......................................................................................................... 60

2.2-13: Rac-1-GTP pulldown assay ...................................................................................................... 61

2.2-14: 2D immunoblots ..................................................................................................................... 62

2.2-15: Statistics .................................................................................................................................. 63

CHAPTER 3: Arp2/3- and cofilin-coordinated actin dynamics is required for insulin-mediated GLUT4

translocation to the surface of muscle cells .............................................................................................. 64

3.1: Abstract ............................................................................................................................................ 65

3.2: Introduction ..................................................................................................................................... 66

3.3: Results .............................................................................................................................................. 68

3.3-1: Arp2/3 is required for insulin-mediated actin remodelling ...................................................... 68

3.3-2: Depletion of Arp2/3 reduces insulin-mediated GLUT4 gain on the cell surface ...................... 72

3.3-3: Insulin causes cofilin dephosphorylation that depends on slingshot ....................................... 76

3.3-4: Arp2/3-mediated actin remodelling signals to insulin-stimulated cofilin dephosphorylation 80

3.3-5: Cofilin knockdown promotes F-actin accumulation and decreases insulin-mediated GLUT4

translocation ....................................................................................................................................... 82

3.4: Discussion ........................................................................................................................................ 87

3.4-1: Insulin induces concerted actin branching and severing .......................................................... 87

3.4-2: Arp2/3 activation and cofilin dephosphorylation are required for insulin-dependent GLUT4

translocation ....................................................................................................................................... 89

3.4-3: Possible mechanisms whereby a dynamic actin network supports GLUT4 traffic ................... 90

CHAPTER 4: Rac-1 superactivation triggers insulin-independent GLUT4 translocation that bypasses

signalling defects exerted by JNK- and ceramide-induced insulin resistance .......................................... 94

4.1: Abstract ............................................................................................................................................ 95

vii

4.2: Introduction ..................................................................................................................................... 96

4.3: Results .............................................................................................................................................. 99

4.3-1: Rac-1 activation via overexpression of GFP-CA-Rac or Tiam1-GFP induces a gain in surface

GLUT4 independent of insulin ............................................................................................................ 99

4.3-2: Acute activation of Rac-1 is also capable of eliciting an insulin-like increase in basal surface

GLUT4 ................................................................................................................................................ 103

4.3-3: Rac-1 superactivation signals through PI3K, Akt and AS160 to increase surface GLUT4 ....... 108

4.3-4: Rac-1 superactivation relieves defective GLUT4 translocation imposed by JNK and ceramide

.......................................................................................................................................................... 115

4.4: Discussion ...................................................................................................................................... 120

4.4-1: Rac-1 superactivation leading to PI(3,4,5)P3 production, Akt and AS160 phosphorylation ...... 121

4.4-1-I: PI(3,4,5)P3 accumulation ...................................................................................................... 121

4.4-1-II: Akt phosphorylation ........................................................................................................ 123

4.4-1-III: AS160 phosphorylation .................................................................................................. 125

4.4-2: Rac-1 superactivation overcomes insulin resistance .............................................................. 126

CHAPTER 5: Summary and future directions ........................................................................................... 129

5.1: Summary ........................................................................................................................................ 130

5.2: Future directions ............................................................................................................................ 134

5.2-1: Regulation of Rac-1 activity during insulin stimulation .......................................................... 134

5.2-1-I: Activation by GEFs ............................................................................................................ 134

5.2-1-II: Inactivation by GAP ......................................................................................................... 137

5.2-2: The role of PAK in GLUT4 translocation .................................................................................. 138

5.2-3: Function of remodelled actin in GLUT4 traffic in muscle cells ............................................... 140

5.2-4: Bridging microtubule and F-actin in insulin-stimulated GLUT4 vesicle traffic ....................... 141

CHAPTER 6: References ............................................................................................................................ 145

viii

Preface

The work presented in this Ph.D. thesis is the research conducted from Sept 2007 to

June 2013 under the supervision of Dr. Amira Klip in Programme in Cell Biology, The

Hospital for Sick Children, Toronto, ON, Canada. Financial support was provided by

grants from Canadian Institutes of Health Research and Canadian Diabetes Association.

Financial stipend to Ting (Tim) Chiu was provided by from the Canadian Institutes of

Health Research, National Sciences and Engineering Research Council, and

Restracomp at Hospital for Sick Children. Results previously published in journals are

reprinted in this thesis with the copyright permission from the respective journals.

Published papers

1. Chiu TT, Sun Y, Koshkina A, and Klip A. Rac-1 superactivation triggers an

insulin-mimetic GLUT4 translocation response that bypasses signalling defects

exerted by JNK- and ceramide-induced insulin resistance. J Biol Chem. 2013

May 2.

2. Sylow L, Jensen TE, Kleinert M, Mouatt JR, Maarbjerg SJ, Jeppesen J, Prats

C, Chiu TT, Boguslavsky S, Klip A, Schjerling P, Richter EA. Rac1 Is a Novel

Regulator of Contraction-Stimulated Glucose Uptake in Skeletal Muscle.

Diabetes. 2012 Dec 28.

3. Pillon NJ, Arane K, Bilan PJ, Chiu TT, Klip A. Muscle cells challenged with

saturated fatty acids mount an autonomous inflammatory response that activates

macrophages. Cell Commun Signal. 2012 Oct 19;10(1):30.

4. Boguslavsky S, Chiu T, Foley KP, Osorio-Fuentealba C, Antonescu CN, Bayer

KU, Bilan PJ, Klip A. Myo1c binding to submembrane actin mediates insulin-

induced tethering of GLUT4 vesicles. Mol Biol Cell. 2012 Oct;23(20):4065-78.

5. Chiu TT, Jensen TE, Sylow L, Richter EA, Klip A. Rac1 signalling towards

GLUT4/glucose uptake in skeletal muscle. Cell Signal. 2011 Oct;23(10):1546-54.

6. Tamrakar AK, Schertzer JD, Chiu TT, Foley KP, Bilan PJ, Philpott DJ, Klip A.

NOD2 activation induces muscle cell-autonomous innate immune responses and

insulin resistance. Endocrinology. 2010 Dec;151(12):5624-37.

7. Chiu TT, Patel N, Shaw AE, Bamburg JR, Klip A. Arp2/3- and cofilin-coordinated

actin dynamics is required for insulin-mediated GLUT4 translocation to the

surface of muscle cells. Mol Biol Cell. 2010 Oct 15;21(20):3529-39.

http://www.ncbi.nlm.nih.gov/pubmed/23274900














ix

Acknowledgements

The journey began with a 23 year old young man who thought he could breeze

through Ph.D. program in 4 quick years. Boy, was he ever wrong about that! 6 years

and many new wrinkles on my face later, I have finally reached the finish line. Although

it took longer than I expected, I can honestly say that I have zero regret spending the

extra time on this wonderful journey. This life-changing experience would not be

possible without the careful guidance of my supervisor Dr. Amira Klip. Her mentorship

style has provided me with ample research opportunities to develop my scientific

credentials and intellectual freedom to explore my own ideas. Her remarkable

generosity also kept my stomach full by taking the lab out for celebratory feast and

giving me awesome Mexican goat milk candies. My intellectual advance over this past 6

years is the direct result of her continuous shaping and molding. For these reasons, I

feel extremely fortunate to be supervised and mentored by Amira. I would also like to

thank my supervising committee members, Dr. Allen Volchuk and Dr. Margaret Rand,

for their inputs on my project over the years. Their guidance and friendship have made

this voyage that much more enjoyable.

To all the Klipsters who have overlapped with me over the years, I thank

everyone for creating a hard-working yet friendly environment in the lab. I would like to

say thank you to: Phil for scientific advices and summer BBQ at his place, Zhi for cells

and reagents, Yi for molecular expertise and yummy Chinese dumplings, Kevin for

“whitifying” me, Nico for discovering unusually hilarious research articles, Sheila for

organizational tips and Introduction 101 to Disney World, Kenny for showing it is

possible to study a molecule with the same initials as yours, Paymon for embarrassing

x

me by having too much results in his first 8 months of Masters degree, Girish for

consolidated effort to pull off pranks on Yi, Constantine for important life lessons,

Akhilesh for jamming Indian music in the lab, Jonathan for showing me cell lysate

tricks that saved my western blots, Alex for making us laugh by wearing yellow

stockings to the lab, Shuhei for setting the standard in the lab so high by working

everyday, Costin for demonstrating the real passion for science, Ilana for teaching me

rounded-up myoblast assay, Varinder for advices on experimental problems, Thom for

the share of love for NBA basketball, Liz for showing what couples really do on lunch

breaks, Wenyan for goodies from China, Shlomit for constant input on my project,

Cesar for enlightening me on coffee with legs, Qing for funny moments of lost in

translation, Lykke for authentic Danish cooking, Emily for daily chitchat, Liane for

constantly avoiding my 1-on-1 basketball challenge, Daniela for not getting mad when

my beer exploded to her ceiling, and Kevin again for bringing out the fun in the lab. If I

missed anyone, it simply means that you meant too much to me that I could not begin to

put it into words.

Finally, I would like to thank my mom for her incredible courage, independence,

and strength to live by herself in Vancouver without me and my brothers around to take

care of her. My pursuit for higher education outside of B.C. would not have been

possible without her ability to take care of herself. This thesis is for you : )

xi

Figure list

Figure 1-1: The regulation of Rho GTPases. Figure 1-2: Regulation of actin dynamics. Figure 1-3: Domain structures of formins and DRFs. Figure 1-4: Domain structures and regulation of nucleation promoting factors for Arp2/3. Figure 1-5. Rho-dependent signalling regulation on actin dynamics. Figure 1-6. Insulin-stimulated signalling cascade leading to GLUT4 traffic in muscle cells. Figure 1-7: Insulin-induced actin remodelling in myoblasts and myotubes. Figure 1-8: Proposed functions of remodelled actin in insulin-mediated GLUT4 traffic in muscle cells. Figure 3-1: Arp3-GFP colocalizes with remodelled actin following insulin stimulation in myoblasts. Figure 3-2: Down-regulation of Arp3 prevents the formation of remodelled actin and reduces GLUT4 translocation following insulin stimulation in myoblasts. Figure 3-3: Down-regulation of p34 inhibits the formation of remodelled actin and decreases GLUT4 translocation. Figure 3-4: Arp2/3 functions downstream of Rac in insulin signal pathway. Figure 3-5: Down-regulation of Arp3 or p34 does not interfere with insulin-stimulated Akt phosphorylation. Figure 3-6: Expression of Dictyostellium Arp3-GFP restores actin remodelling and GLUT4 translocation in Arp3 knockdown myoblasts. Figure 3-7: Knockdown of either p34 or cofilin does not alter transferrin recycling. Figure 3-8: Stress fiber does not contribute to the decrease in GLUT4 traffic observed in p34 knockdown. Figure 3-9: Relative percent of cofilin, ADF, phosphorylated-cofilin and phosphorylated ADF. Figure 3-10: Insulin stimulation in L6GLUT4myc muscle cells causes dephosphorylation of cofilin. Figure 3-11: Insulin-induced dephosphorylation of cofilin is slingshot-dependent. Figure 3-12: Down-regulation of LIMK1 does not affect insulin-induced cofilin dephosphorylation. Figure 3-13: SSH1 redistributes to the zone of actin remodelling upon insulin stimulation. Figure 3-14: Insulin-stimulated dephosphorylation of cofilin is dependent on remodelled actin. Figure 3-15: Cofilin is localized to the remodelled actin upon insulin stimulation. Figure 3-16: Down-regulation of cofilin increases F-actin aggregates and reduces insulin-induced GLUT4 translocation. Figure 3-17: Expression of Xenopus cofilin-WT-GFP, but not cofilin-S3E-GFP mutant, restores normal F-actin morphology and GLUT4 translocation. Figure 3-18. Proposed mechanism of insulin-regulated actin dynamics in muscle cells. Figure 4-1: Overexpression of GFP-CA-Rac stimulates GLUT4 translocation in muscle cells. Figure 4-2: Overexpression of WT- or CA-Cdc42 does not produce an insulin-like increase in surface GLUT4 and GFP-CA-Rac expression does not change total GLUT4myc levels.

xii

Figure 4-3: Overexpression of Tiam1-GFP induced Rac-1 activation and GLUT4 translocation in muscle cells. Figure 4-4. Insulin stimulated Rac-1 activation is much lower than Rac-1 activation from CA-Rac expression. Figure 4-5: Rapamycin triggers the redistribution of YF-probes towards the Lyn-FRB at the plasma membrane. Figure 4-6: Co-transfection of Lyn-FRB and YF-CA-Rac or YF-Tiam1 allows rapamycin-inducible actin remodelling. Figure 4-7: Rapamycin triggers GLUT4 translocation in muscle cells when co-expressed with Lyn-FRB and YF-CA-Rac or YF-Tiam1. Figure 4-8: Overexpression of GFP-CA-Rac does not cause tyrosine phosphorylation of IRS-1. Figure 4-9: Overexpression of GFP-CA-Rac causes the redistribution of PH-Akt-RFP to the plasma membrane. Figure 4-10: Overexpression of GFP-CA-Rac induces a modest gain in Akt phosphorylation. Figure 4-11: Inhibition of PI3K, Akt, and actin remodelling by inhibitors impair the Rac-1 superactivation-driven GLUT4 translocation response. Figure 4-12: AS160 is phosphorylated upon GFP-CA-Rac overexpression and is required for the Rac-1-induced gain in surface GLUT4. Figure 4-13: Overexpression of FLAG-AS160-4A blocks the GLUT4 translocation induced by CA-Rac. Figure 4-14: Rac-1 superactivation triggers GLUT4 translocation response that bypasses the signal defects exerted by CA-JNK. Figure 4-15: Rac-1 superactivation partially restores the C2-ceramide-induced GLUT4 traffic defect. Figure 4-16: Akti1/2 does not affect insulin-stimulated Rac-1 activation. Figure 4-17: Model of Rac-1 superactivation-induced GLUT4 translocation in muscle cells. Figure 5-1: Expression profile of candidate Rac-GEFs in L6 myoblasts measured by semi-quantitative PCR. Figure 5-2: Vav-2 undergoes insulin-induced tyrosine phosphorylation but does not influence insulin-dependent Rac activation in myoblasts. Figure 5-3: Tiam1 knockdown reduces insulin-mediated Rac activation. Figure 5-4: IPA-3 inhibits insulin-mediated Rac activation and actin remodelling. Figure 5-5: Insulin stimulates the phosphorylation of GDI and the release of Rac from GDI. Table list

Table 1. Summary of Rho GTPases-mediated cellular processes. Table 2-1: List of primers used for semi-quantitative PCR. Table 2-2: Summary of compounds used and their pretreatment concentration and time.

xiii

Abbreviations

ADP Adenosine diphosphate Akti1/2 Akt inhibitor 1/2 AMPK AMP-activated protein kinase AS160 Akt substrate of 160kDa ATP Adenosine triphosphate BAR Bin–Amphiphysin–Rvs CA Constitutively active CC Compound C CD Cytochalasin D ChREBP Carbohydrate responsive element binding protein CLIP-1 CAP-GLY domain containing linker protein 1 CP Capping protein CRIB Cdc42/Rac interacting binding domain DAD Diaphanous autoregulatory domain DH Dbl homology DID Diaphanous inhibitory domain DN Dominant negative DRF Diaphanous-related formins F-actin Filamentous actin FH Formin homology FKBP FK506-binding protein G Gelsolin-like domain G-actin Globular actin GAP GTPase activating protein GBD GTPase-binding domain GDI Guanine nucleotide dissociation inhibitor GDP Guanine diphosphate GEF Guanine nucleotide exchange factor GLUT4 Glucose transporter 4 GTP Guanine triphosphate GTPase Guanosine triphosphatases IQGAP Ras GTPase-activating-like protein IR Insulin receptor IRAP Insulin responsive aminopeptidase IRS Insulin receptor substrate JMY Junction-mediating regulatory protein LB Latrunculin B LIMK LIM domain kinase LPS Lipopolysaccharide miRNA MicroRNA MLC Myosin light chain myo1c Myosin1c myo5 Myosin5 NAP1 NCK-associated protein 1 NPF Nucleation promoting factor

xiv

N-WASP Neural WASP PAK p21-activated kinase PAS anti-phospho Akt substrate antibody PH Pleckstrin homology PI(4,5)P2 Phosphatidylinositol-4,5-biphosphate PI3K Phosphatidylinositol-3-kinase PMA Phorbol 12-myristate 13-acetate, PRD Proline rich domain pY Phospho-tyrosine ROCK Rho-associated kinase SHD SCAR homology domain SNARE Soluble NSF attachment protein receptor SRA1 Specifically Rac-associated protein 1 SSH Slingshot Tf Transferrin TGN Tran-Golgi network TIRF Total internal reflection fluorescence TOCA Transducer of Cdc42-dependent actin assembly VAMP2 Vesicle-associated membrane protein 2 WASH WASP and SCAR homologue WASP Wiskott–Aldrich syndrome protein WAVE WASP-family verprolin homologue WH WASP homology WHAMM WASP homologue associated with actin, membranes and microtubules WM Wortmannin WT Wildtype YF YFP-tagged FKBP YF-CA-Rac YF-CA-Rac lacking the CAAX motif YF-Tiam1 YF-linked DH-PH domain of Tiam1

1

CHAPTER 1: Introduction

2

With increasing number of proteins being identified and their interactomes being

characterized, the number of signalling cascade combination within a cell appears to be

endless and extremely complex. Yet, the cell somehow knows precisely where, when,

and how long to turn on the molecules in order to achieve the correct biological

response. As the result, there must be delicate ways for the cell to regulate signals

spatially-temporally. For this reason, cells are equipped with many proteins that function

as molecular switches at distinct regions within the cell to allow timely signal

transduction. One of such regulatory mechanisms is the spatial and temporal control of

Rho guanosine triphosphatases (GTPases). Known as the masters of actin regulation,

different members of Rho GTPase family must be activated at the right place and right

time for the actin-dependent cellular processes to work. One of the most important

biological responses that Rho GTPases and actin contribute to is the insulin-dependent

recruitment of glucose transporter-4 (GLUT4) to the cell surface of muscle cells. This

thesis will take a closer look at the interplay between Rho GTPases and actin during

insulin stimulation and the role of the Rho GTPase-mediated changes in actin in the

overall journey of GLUT4 vesicles to the plasma membrane.

1.1: Background on Rho GTPase family

Rho GTPases belong to a subclass of Ras superfamily of small GTPases, which

consists of 5 major subclasses based on their sequence and function similarities: Ras,

Rho, Rab, Arf, and Ran (1). They share conserved G box GDP/GTP-binding domains

and GTPase motifs that allow them to function as molecular switches upon cycling of

their GDP/GTP-bound forms. There are a spectrum of cellular functions controlled by

3

the Ras superfamily small GTPases. Rho GTPases in particular have received

enormous research interests due to their unique control of the actin cytoskeleton.

To date, there are 22 mammalian genes encoding for Rho GTPases. Based on

sequence similarities, they can be further categorized into 8 subgroups: Cdc42 [Cdc42,

TC10, TCL (TC10-like), Chp, Wrch-1], Rac (Rac1–3, RhoG), Rho (RhoA–C), Rnd (Rnd1,

Rnd2, Rnd3/RhoE), RhoD (RhoD and Rif), RhoH/TTF, Rho BTB (RhoBTB1 and

RhoBTB 2) and mitochondrial Rho (Miro-1 and Miro-2) (2). Among the subgroups, Rho,

Cdc42, and Rac are studied extensively due to the knowledge of their specific

modulation of the actin cytoskeleton. Although other members have also been

implicated in alterations in actin cytoskeleton, their precise biological functions are less

understood.

1.2: Regulation of GTP/GDP cycles in Rho GTPases

Similar to other family of small GTPases, Rho GTPases act as molecular

switches by cycling between the inactive GDP bound state and the active GTP bound

state. However, due to the low intrinsic exchange and GTP hydrolysis rate, the guanine

nucleotide cycle is regulated by additional proteins and covalent modifications (Figure 1-

1).

4

Figure 1-1. The regulation of Rho GTPases. Rho GTPases switch between the inactive GDP- and active GTP-bound form with the help of GTPase activating proteins (GAPs) and gunanine nucleotide exchange factors (GEFs) respectively. Prenylation of Rho GTPases and the interaction with guanine nucleotide dissociation inhibitor (GDI) regulate the membrane-association and cytoplasmic sequestration of Rho GTPases. Additional covalent modifications such as ubiquitination, phosphorylation, sumoylation, and palmitoylation impact the stability and the activation status of Rho GTPases.

1.2-1: GEFs and GAPs

Guanine nucleotide exchange factors (GEFs) catalyze the exchange of GDP to

GTP so that the Rho GTPases become active. Since the initial discovery of the Dbl

protein that catalyzes the GTP loading of Cdc42 in Saccharomyces cerevisiae (3), the

Dbl homology (DH) and adjacent C-terminal pleckstrin homology (PH) domain have

been used as the conserved sequence marker to search for potential Rho GEFs. Up-to-

date, 69 members of DH-PH containing GEFs have been identified with varying

substrate specificities. More recently, Dock180 related proteins containing Dock

5

homology region-2 domains have emerged as a second family of GEFs for Rho

GTPases (4). Nonetheless, both families initiate GTP loading by promoting an

intermediate nucleotide-free state in the GTPases during which GTP binds to the

GTPases due to its higher concentration than that of GDP in cells.

On the contrary, GTPase activating proteins (GAPs) inactivate Rho GTPases by

stimulating their intrinsic GTPase activity to promote the hydrolysis of GTP to the

inactive GDP. Despite having identified ~70 GAPs containing RhoGAP domains, the

precise biological function of each member remains largely elusive due to the functional

redundancy that exists within this large family.

1.2-2: Prenylation

In addition to controlling the magnitude of Rho GTPase activation via the guanine

nucleotide exchange, the specific subcellular localization of the GTPases is also a major

determinant of their biological function within a cell. At a given time, only a small portion

of the total Rho GTPases is active and anchored to the plasma membrane or

endomembrane. The membrane localization cue is controlled by the post-translational

lipid modification on the C-terminal CAAX motif of the Rho GTPases (C = cysteine, A =

aliphatic amino acid, and X = terminal amino acid). Depending on the amino acid at X,

the cysteine residue is covalently modified with either a farnesyl or geranylgeranyl

isoprenoid lipid to enhance the hydrophobicity of the GTPase and its membrane

insertion (5).

1.2-3: GDI

In contrast to lipid modification, Rho specific guanine nucleotide dissociation

inhibitors (GDIs) work in reverse to sequester the majority of the Rho GTPases inactive

6

in the cytoplasm. The interaction between Rho GTPases and RhoGDIs not only

prevents the nucleotide exchange but also inhibits the GTPase activity. Having a higher

affinity for GDP bound Rho GTPases in a membrane environment, RhoGDIs are

capable of extracting inactive Rho GTPases from the membrane by shielding the

isoprenyl moiety away from water to maintain a stable folding of Rho GTPase in the

cytoplasm. This function enables GDI to shuttle Rho GTPases between cytosol and the

membrane compartments as inactive and active pools, respectively.

1.2-4: Covalent modifications and miRNAs

Additional regulation arises from covalent modifications of Rho GTPases and the

control of their expression. Phosphorylation of Rho GTPases by different kinases such

as cAMP dependent kinase PKA, cGMP dependent kinase PKG, Src tyrosine kinase,

and Akt have been reported to increase interactions with RhoGDI and reduce GTP

binding capacity (6-8). Ubiquitination involves the covalent attachment of the 8 kDa

ubiquitin polypeptide to lysine residues on the target molecule to trigger degradation

controlled by ubiquitin–proteasome system. Ubiquitination of Rho GTPases was

suggested by the reduction or enhancement in the amount of Rho GTPases upon

changes in the expression of ubiquitin ligase (9). Sumoylation and palmitoylation of

Rac1 have also been reported and they assist in optimal loading of GTP and stability of

Rac1 at the membrane, respectively (10,11). To control the protein expression level,

endogenous microRNAs (miRNAs) silence the targeted genes by degrading their

mRNAs to suppress protein translation. Changes in Rho GTPases miRNA levels

leading to fluctuating amount of Rho GTPase expression can be observed in disease

development and cell proliferation (12).

7

1.3: Cellular functions of Rho GTPases

Years of research have discovered the participation of Rho GTPases in

numerous cellular processes such as cell-cycle progression, cellular morphogenesis,

gene transcription, cell adhesion and migration, vesicle traffic, and enzymatic activities.

The contribution of Rho, Cdc42, and Rac towards each category is summarized in

Table 1.

Table 1. Summary of Rho GTPases-regulated cellular processes.

Categories Functions Rho GTPases and Mechanisms Ref

Cell cycle

G1 progression

Rac/Cdc42: control cyclin D expression

Rho: down-regulate CDK inhibitor expression

(13,14)

Mitosis Cdc42: mediate microtubule connection to kinectochore via mDia3

(15)

Cytokinesis Rho: govern actin-myosin contractile ring at the cleavage furrow

(16)

Cell

morphogenesis

Cell-cell adhesion

Rho/Cdc42/Rac: assist in formation of adherent junction through actin cytoskeleton

(17)

Cell polarity Rho/Cdc42/Rac: regulate the formation of tight junction via actin cytoskeleton

(18)

Cell movement

Cell migration

Rho/Rac: stimulate retraction and protrusion at the rear and front of the cell respectively

(19)

Directionality Cdc42: maintain cell polarity in the direction of chemoattractant-gradient

(20)

Vesicle traffic

Golgi-ER transport

Cdc42: interact with COPI to promote actin and microtubule dependent vesicle transport

(21)

Exocytosis Rho/Rac: modify actin cytoskeleton for vesicle traffic

(21)

Endocytosis Rho/Cdc42/Rac: modulate endocytic processes through actin reorganization

(21)

Enzymatic activity

NADPH oxidase

Rac: increase ROS production (22)

PI5K Rho/Cdc42/Rac: modulate PI5K activity (23)

8

1.4: The dynamic control of actin cytoskeleton

Despite the complexity of biological functions in which Rho GTPases participate,

the majority of the changes arise because of their impact on actin cytoskeleton. Actin is

one of the most abundant and evolutionarily conserved proteins in the cell. It is a 42kDa

ATP-binding protein that exists as monomeric globular actin (G-actin) and assembled

into filamentous actin (F-actin). Due to the intrinsic structural polarity of G-actin and the

head-to-tail polymerizing orientation, the assembled F-actin is also polarized, with a

growing barbed end (+ end) and a trailing pointed end (- end). While ATP bound G-actin

is incorporated to extend F-actin at the barbed end, previously assembled G-actin at the

pointed end undergoes ATP hydrolysis to create an ADP-bound state. This hydrolytic

property creates an ATP-actin- and ADP-actin-rich zone at the barbed and pointed ends,

respectively. Under this polarized biochemical and structural constraint, actin

polymerization becomes favourable at the ATP barbed end while actin depolymerization

dominates at the ADP pointed end (Figure 1-2).

In the cell, the dynamic actin turnover is the main driver of the actin cytoskeleton

network which remodels to create structural scaffolds, mechanical force, and tracks for

traffic events. These fundamental properties contribute significantly to biological

functions such as morphogenesis, migration, cytokinesis and vesicle transport.

Needless to say, emphasis has been placed on identifying various actin-binding

molecules that regulate this dynamic behaviour and their mechanisms of action. In

particular, studies on proteins that control actin polymerization or depolymerization have

provided insights on this tightly regulated intricacy of F-actin network (Figure 1-2).

9

Figure 1-2. Regulation of actin dynamics. F-actin is assembled from monomeric G-actin to create a polymerizing barbed end rich in ATP-actin and a depolymerizing pointed end with ADP-actin. The growth of F-actin can be accomplished through either spontaneous, branched actin, or linear actin polymerization. This increase in actin assembly is balanced out by the severing/depolymerisation at the pointed end to regenerate a free pool of G-actin ready for additional rounds of actin growth. F-actin bundling proteins can crosslink assembled F-actin to provide strengthened structural integrity. Proper control of these regulatory steps determines the overall dynamics of actin in the cell.

1.4-1: Actin polymerization

Spontaneous actin polymerization involves two main stages, nucleation and

elongation, before finally reaching to a steady state level in which no net filament growth

is obtained. Nucleation begins with the formation of G-actin dimer/trimer. However, this

step is often rate limiting due to the instability of the trimer complex (24). Therefore,

10

factors such as monomeric actin binding molecules, which control the availability of G-

actin, and actin nucleators, which stabilize the initial actin multimer, would influence the

rate of actin polymerization.

1.4-1-I: Monomer actin binding proteins: thymosin-β4 and profilin

Thymosin-β4 and profilin interact with monomeric actin by competing for an

overlapping binding site on G-actin. The exchange rate of G-actin between the two

molecules is rapid due to the high dissociation constants of actin with either protein (25).

The interaction of thymosin-β4 and profilin with G-actin makes them the two major

proteins responsible for maintaining a pool of monomeric actin in the cytosol and limiting

filament spontaneous polymerization. On their own, thymosin-β4 and profilin have

inhibitory and promoting actions towards actin polymerization, respectively. While

thymosin-β4 maintains G-actin in ADP-bound form, profilin catalyzes the exchange of

ADP to ATP on the associated actin monomer (26,27). At the same time, profilin

prevents the intrinsic hydrolytic activity of actin so that the G-actin is primed with ATP

for additional rounds of actin polymerization at the barbed ends.

1.4-1-II: Actin nucleators

1.4-1-II-A: Formin

In mammalian cells, there are 15 different formins which can be divided into 2

large subfamilies, formins and Diaphanous-related formins (DRFs) (Figure 1-3). They

share the formin homology (FH) domains FH1 and FH2 but differ in their N-terminal

regulatory domains. In all formins, the FH2 domain and its ability to homodimerize are

essential for formin-mediated actin assembly (28,29). Structurally, the FH2 domain

interacts directly with the actin polymerization dimer intermediate and stabilizes it to

11

accelerate polymerization (30). The FH1 domain, on the other hand, associates with

profilin via its proline-rich segment and brings ATP-actin in close proximity to the actin

assembly site. Given their higher affinity for ATP-bound actin at the barbed end of F-

actin, formins move along with the growing filament to allow rapid addition of G-actin.

This processive activity also prevents capping proteins from binding to the barbed end

and stopping filament growth, which enables the formation of longer F-actin structures

like stress fibers and filopodia (31). It is because of this elongation property that formin

has been implicated in cellular functions involving actin cables, filopodia, stress fibers,

actin-rich cell adhesions, and cytokinesis.

DRFs are better understood than formins due to their characterized regulatory

cues. In resting cells, the C-terminal diaphanous autoregulatory domain (DAD) binds

with the N-terminal diaphanous inhibitory domain (DID) to create an autoinhibitory state

(32). Only upon binding of active Rho GTPases to the adjacent GTPase-binding domain

(GBD) would the molecule become activated. Depending on the members of DRFs,

interaction with different Rho GTPases (RhoA-C, Cdc42) to the GBD can alleviate the

autoinhibitory conformation (33). However, additional factors are required to achieve a

full activation because only partial actin polymerizing activity was obtained with the

addition of Rho GTPase to DRFs in vitro (34).

12

Figure 1-3: Domain structures of formins and DRFs. DAD and DID interaction confers DRFs in an autoinhibitory state at rest. Binding of GTP-loaded Rho to GBD releasea this inhibitory association leading to activation. FH: formin homology domain, GBD: GTPase binding domain, DID: diaphanous inhibitory domain, DAD: diaphanous autoregulatory domain.

1.4-1-II-B: Arp2/3

Arp2/3 is a 220kDa complex consisting of 7 subunits (ARP2, ARP3, ARPC1-5)

that are evolutionarily conserved among the eukaryotic cells (35). It functions by binding

to the existing F-actin at the pointed end to initiate new branched filament formation at a

70o angle. Structurally, ARP2 and ARP3 are actin-related proteins that also harbor ATP-

binding ability. They orient themselves to form the initial dimer of the new branched

filament while ARPC1-5 positions the complex stably on the existing filament. By itself,

Arp2/3 is relatively inefficient at promoting nucleation and the subsequent actin

polymerization. Although phosphorylation of ARP2 has been reported to increase its

binding to the filament (36), the most well characterized mechanism to increase its

activity is via the engagement with nucleation promoting factors (NPFs).

Most NPFs contain a WCA domain that is comprised of WASP homology 2

(WH2), amphipathic connector region, and acidic peptides. The CA portion interacts

with multiple subunits of Arp2/3 to exert conformational changes that prime ARP2 and

13

ARP3 for nucleation while the W region binds and delivers G-actin to the barbed end of

ARP2-ARP3 dimer.

There are two classes of NPFs. The class I NPFs display a C-terminal WCA

domain while diversified N-terminal regions confer to them differential regulations.

Members of class I NPFs include: WASP and neural WASP (N-WASP); WASP-family

verprolin homologue (WAVE/SCAR), WASP and SCAR homologue (WASH), WASP

homologue associated with actin, membranes and microtubules (WHAMM), and

junction-mediating regulatory protein (JMY). The class II NPF, cortactin, contains only

the acidic peptide portion of WCA domain but retains the ability to interact with Arp2/3.

The overview of each NPF is illustrated in Figure 1-4 and each member will be

described in the following section.

14

Figure 1-4: Domain structures and regulation of nucleation promoting factors for Arp2/3. The common feature among all the member of NPFs is the ability to interact and stabilize Arp2/3 via the WCA domain or the A domain, in the case of cortactin, for the initiation of branched actin formation. The signature behind each NPF’s activity, stability, and cellular localization is determined by the variable functional domains situated N-terminal to the WCA region. PRD: proline-rich domain, CRIB: Cdc42/Rac-interacting binding domain, B: polybasic region, I: autoinhibitory motif, WH2: Wasp homology 2, SHD: SCAR homology domain, WHD: WASHhomology domain, TBR: tubulin binding region, CC: coiled-coiled domain.

1.4-1-II-B.1: WASP and N-WASP

WASP is specifically expressed in haematopoietic cells while N-WASP is found

in most cell types. Both of them contain the N-terminal WASP homology 1 domain, a

basic region, a Cdc42/Rac interacting binding domain (CRIB), an autoinhibitory motif,

and a proline rich domain (PRD) followed by the characteristic WCA region. At rest,

WASP remains inactive due to the intramolecular interaction between the WCA and its

autoinhibitory region. This inactive state is further stabilized by WASP-interacting

protein (WIP) binding to the WH1 domain (37). Upon growth factor stimulation, binding

15

of active Cdc42 to the CRIB domain causes conformational changes that relieve the

steric hindrance on WCA (38). Additional regulatory components, such as PI(4,5)P2

interaction with the basic residues of WASP, SH3-containing proteins binding to PRD,

and inducible clustering of WASP molecules at the membrane, integrate together with

Cdc42-dependent control to promote higher activity from WASP family proteins (39-41).

WASP and N-WASP participate in a vast number of actin-dependent cellular processes.

Disruption of WASP/N-WASP results in impaired filopodia formation, dorsal membrane

ruffling, membrane invagination, and endocytosis (42).

1.4-1-II-B.2: WAVE

Three isoforms of WAVE are expressed in mammalian cells. WAVE1 and

WAVE2 are distributed in most cell types but all three isoforms appear to concentrate in

the brain. Unlike WASP, WAVE lacks the CRIB domain to interact with Rho GTPases

but contains an N-terminal SCAR homology domain (SHD), a basic region, and a PRD

precedes the common terminal WCA domain. Through this unique SHD, WAVE forms a

heteropentameric complex by associating with BRICK1, ABI1, NCK-associated protein

1 (NAP1) and specifically Rac-associated protein 1 (SRA1). This multimeric state is

crucial for the stability of WAVE because perturbation of any subunit disrupts the

function and localization of the whole complex (43,44). Similar to WASP, WAVE is

natively inactive due to masking of WCA domain by SRA1/NAP1 subunits (45). Several

factors assist the activation of WAVE. GTP-bound Rac binding to SRA1, PI(3,4,5)P3

interaction with the basic residues, IRSp53’s association with PRD, and phosphorylation

act synergistically to induce conformational changes in WAVE that favour the interaction

with Arp2/3 to enact actin branch polymerization (46-48). The main function of WAVE is

16

to generate lamellipodia and plasma membrane protrusions for cell migration. Although

there are functional similarities among the WAVE isoforms, the redundancy is not

sufficient to prevent defects that manifest in individual isoform gene knockout conditions.

1.4-1-II-B.3: WASH

Initially discovered as one of several subtelomeric genes, WASH was found to

have actin polymerization capacity driven through Arp2/3 (49). In addition to the

conserved WCA element, it also encodes an N-terminal WASH homology domain 1,

and a tubulin binding region followed by a PRD. Similar to WAVE, WASH is found in a

multiprotein complex that consists of FAM21, Strumpellin, SWIP, Ccdc53, and capping

protein (CapZ). Although the precise function of each subunit associated with WASH is

not fully understood, it is appreciated that they contribute to the overall stability of the

complex, as down-regulation of one affects the expression of others (50). Depending on

the purification techniques, it is debated whether the WASH complex is natively active

or inhibited like the WAVE multimers. The precise mode of WASH activation is not clear.

Nonetheless, the association of capping protein CapZ with WASH appears to enhance

the Arp2/3-dependent actin polymerization (51). Functionally, WASH is uniquely

positioned in early and slow recycling endosomes via the interactions between retromer

complex subunit VPS35 and its FAM21 subunit and the association with microtubules

through its tubulin binding region (52-54). This specific localization primes WASH to

exert actin-dependent control over endosomal shape, biogenesis, and traffic.

1.4-1-II-B.4: WHAMM

17

WHAMM is another protein discovered during bioinformatics searches for

proteins containing WCA domain. It is ubiquitously expressed and contains N-terminal

WHAMM membrane interacting domain and a coiled-coiled domain preceding the WCA

region. The regulatory mechanism for WHAMM’s activity in vivo is not fully understood

but it is not autoinhibited like the WASP family nor does it exist in a complex like WAVE

and WASH. When expressed exogenously in cells, it localizes to the cis-Golgi and

tubulovesicular ER-Golgi intermediate compartment (55). Such distribution pattern is the

result of binding to microtubules via its coiled-coiled domain and the interaction between

the WHAMM membrane-interacting domain and the Golgi tethering factor. The unique

placement of WHAMM allows it to control Golgi morphology and ER-Golgi transport in

an actin- and microtubule-dependent manner (55).

1.4-1-II-B.5: JMY

Although JMY has the conserved WCA domain, it also encodes two additional

WH2 domains separated by a linker region directly N-terminal to WCA to create a

WWLWCA segment. This special arrangement enables JMY to initiate actin nucleation

by both Arp2/3-depedent and Arp2/3-independent mechanisms (56). While the Arp2/3-

mediated polymerization is derived from the WCA of JMY, the Arp2/3-independent

mode arises from the ability to cluster 3 actin monomers closer to one another due to

the proximity of the 3 WH2 domains. This is similar to the mechanism of other Arp2/3-

independent nucleation molecules, such as formin and Spire, relying on means of three

or four clustered actin monomers (57). Nonetheless, the functional relevance of JMY is

still under investigation. Its ability to act also as a co-factor for the transcriptional

18

regulator of p53 has suggested the potential of integrating actin cytoskeletal changes

with stress responses (58).

1.4-1-II-B.6: Cortactin

Cortactin differs from the class I NPFs by not encoding the full WCA domain.

Instead, it contains only the acidic portion at the N-terminus, which retains the ability to

interact with Arp2/3, a middle repeating sequence responsible for F-actin binding, a

PRD domain rich in phospho-regulatory sites, and an SH3 domain at the C-terminus. By

itself, both the acidic region and F-actin binding repeats are required for the activity of

cortactin towards Arp2/3 but It has a weaker nucleation promoting action compared to

N-WASP (59). Nonetheless, interactions between the cortactin SH3 domain and PRD of

N-WASP can liberate N-WASP from its autoinhibitory state. This complex formation

between cortactin and N-WASP allows synergistical enhancement of Arp2/3’s

nucleation activity (60). Complicated phospho-regulatory mechanisms with both positive

and negative effects have been proposed based on identified serine and tyrosine

residues on cortactin (61). Their precise contribution will most likely be context- and

stimulus-specific. Functionally, cortactin is involved in invadopodia formation (62).

Although it has also been implicated in membrane protrusion, the main contribution of

cortactin is towards lamellipodia persistency rather than formation by promoting new

adhesion at actin-based protrusion sites (63).

1.4-1-II-C: WH2-repeat nucleators

More recently, a new class of nucleators was identified that is characterized by a

common repeating cluster of 3 or more G-actin binding motifs, such as WH2. These

19

proteins exert nucleation activity by recruiting multiple actin monomers in close

proximity and organizing them into a nucleation complex (64). Members of this family

include spire, cordon-bleu, leiomodin, and interestingly some bacterial nucleators (42).

Little is known about their regulatory mechanism and exact biological functions except

for cordon-bleu’s involvement in neurite branching and leiomodin’s role in sacromeric

actin organization due to their respective high expression in hippocampal neurons and

skeletal/cardiac muscles (65,66).

1.4-2: Severing and depolymerization

Actin turnover is a dynamic process in which the polymerization needs to be

properly balanced by breaking down F-actin via severing and depolymerization in order

to regenerate the free pool of G-actin for future assembly. Because growth at the

barbed end is relatively fast and can be accelerated by the nucleators, other factors are

also required to increase the rate of depolymerization at the pointed end to maintain the

equilibrium. Besides liberating free G-actin, severing can also promote subsequent

polymerization by increasing the number of plus ends where actin monomers can be

newly incorporated. Two major molecules responsible for severing and

depolymerization include gelsolin and actin depolymerizing factor (ADF)/cofilin.

1.4-2-I: Gelsolin

Gelsolin is characterized by the 6 gelsolin-like domain (G) that mediates calcium-

dependent severing and capping. Biochemical analysis reveals the presence of three

actin binding sites including G1: calcium-independent binding to G-actin, G2-3: calcium-

independent binding to F-actin, and G4-6: calcium-dependent binding to G-actin (67).

G1-3 is the severing component while G4-6 acts in cooperative manner to assist the

20

activity (68). Intramolecular interaction between the C-terminal tail and G2 normally

keeps gelsolin in an autoinhibitory form. Upon binding of calcium, a conformational

change relieves this constrain and increases gelsolin’s affinity for the ADP-associated

actin filament to initiate active severing and capping (69-71). However, in the presence

of PI(4,5)P2, its severing activity is reduced due to decreased binding to F-actin (72).

1.4-2-II: ADF/Cofilin

ADF/cofilin is an actin-binding family protein that possess an ADF‐homology

domain. Members of this family function to sever aged filaments and induce

depolymerization to replenish free monomeric actin. It binds to both F-actin and G-actin

via the G/F binding site, which is critical for its severing and depolymerizing activity (67).

The major biochemical difference between ADF and cofilin is that ADF causes a greater

steady-state actin depolymerization than cofilin (73). The critical regulatory component

for ADF and cofilin is centred on their conserved Ser-3 located at the N-terminal G/F

site. Phosphorylation of Ser-3 significantly reduces the ability of ADF and cofilin to bind

to actin leading to the reduced activity while dephosphorylation promotes their activation

(74). While kinases like LIMK and testicular protein kinase are responsible for the

phosphorylation of ADF/cofilin (75,76), phosphatases such as slingshot and chronophin

act to counter their effect (77,78). Interestingly, LIMK is a downstream effector of Rho-

associated kinase (ROCK) and p21-activated kinase (PAK), which are controlled by

Rho and Cdc42/Rac respectively (79,80). This allows for a Rho GTPase-dependent

influence on ADF/cofilin activity. Other regulatory mechanisms include decrease in actin

binding and severing upon association with PI(4,5)P2 and stronger depolymerizing activity

at basic pH (81,82). However, the pH effect is more limited to ADF compared to cofilin.

21

In addition, competitive actin-binding can also influence the activity of ADF/cofilin.

Tropomyosin competes with ADF/cofilin on F-actin binding to stabilize the filament while

profilin extract depolymerized G-actin from ADF/cofilin to induce nucleotide exchange to

generate an ATP-bound actin for subsequent polymerization (83,84). Although

additional molecules such as actin interacting protein 1 and coronin act to augment

ADF/cofilin’s filament turnover activity, the exact mechanism behind this stimulatory

effect remains to be defined (85).

1.4-3: Other actin modulations - capping protein (CP) and bundling protein

As the name suggests, the heterodimer CP functions to cap barbed ends to

inhibit filament growth. At the same time, it prevents depolymerization occurring at the

capped end, leading to preferred breakdown at the pointed end (86). Interaction with

PI(4,5)P2 has been demonstrated to inhibit the capping ability and is hypothesized to be a

key element in generating membrane protrusion where active polymerization is required

(86). Additional regulatory molecules, such as CARMIL and CKIP-1, can associate with

CP to interfere with its binding to the barbed end (87,88).

F-actin can be further packaged into superstructures by the help of actin bundling

proteins. They act to form tight parallel actin bundles or looser orthogonal meshworks

via their two actin binding sites to crosslink actin filaments. Such structures provide

improved cellular rigidity and mechano-sensing ability that ultimately contribute to

biological functions such as invadopodia/filapodia formation, cell-cell junction integrity,

stress fiber and cortex maintenance. Various proteins including, spectrin, filamin, alpha-

actinin, dystrophin, myosin II, and fascin, have been identified to have this bundling

ability and their respective function depends on the cellular context (89).

22

1.5: Rho GTPases-dependent controls on actin

In order for actin to achieve its diversified biological functions that require

dynamic filament turnover at specific locations within a cell, molecules that modulate

actin dynamics need to be precisely governed in a spatial-temporal manner. In

accordance with these criteria, Rho GTPases are often referred to as the master

regulators of actin because of their ability to function as switches that can be acutely

turned on and off in a timely controlled fashion. Many of the above mentioned molecules

that regulate actin dynamics are under the stringent control of Rho GTPases (Figure 1-

5).

Active RhoA can turn on ROCK by relieving it from its autoinhibitory state. ROCK

enhances myosin activity by direct phosphorylation of MLC and inhibition of the MLC

phosphatase function via phosphorylation of its myosin phosphatase-targeting subunit 1

(90,91). This strengthens the actin-myosin interaction for force generation. In addition,

ROCK can induce the activation of LIMK to prevent the severing activity of cofilin via

LIMK-regulated phosphorylation (92). Furthermore, mDia1 is activated upon binding of

active RhoA to stimulate longitudinal F-actin polymerization (93). All together, these

controls by RhoA initiate stress fiber formation/stability, cytokinesis, and cell polarity

during migration by facilitating detachment at the trailing end.

Cdc42 governs actin dynamics by interacting with nucleation promoting factors

N-WASP and mDia to stimulate branched and linear F-actin formation, respectively.

Moreover, Cdc42 binds to PAK to mediate LIMK activation and its subsequent phospho-

regulation on cofilin’s severing activity. These Cdc42-mediated actin responses

23

contribute to filapodia formation, neurite extension, and directional sensing during

migration (94).

Rac initiates Arp2/3 dependent actin branching and polymerization, specifically

by engaging in WAVE to promote the augmented activity. Similar to Cdc42, Rac can

activate PAK and can limit cofilin activity via LIMK. Rac’s activity towards actin is crucial

for lamellipodia formation, membrane protrusion, axon growth and migration (94).

Figure 1-5: Rho-dependent signalling regulation on actin dynamics. Rho, Cdc42, and Rac engage in different downstream molecules such as ROCK, mDia, WASP, WAVE, or PAK to initiate the chain of actin modifying events that contribute to actin dynamics in a cell at a given moment.

1.5-1: Vesicle traffic regulated by Rho GTPase-mediated actin dynamics

All together, the precision of controls on actin filament dynamics establishes the

basis of actin-regulated cellular biology. Of the actin-dependent functions, a

fundamental aspect is the regulation on vesicle traffic. Eukaryotic cells are composed of

distinct membrane-enclosed compartments/organelles that actively communicate with

24

one another through the exchange of protein-containing vesicles. These carrier vesicles

relay information and content among the different organelles through endosomal traffic

and communicate with the extracellular milieu via vesicle-mediated exocytosis and

endocytosis at the plasma membrane. Although Rab family proteins are considered as

the guiding cues for vesicle sorting, Rho GTPase-dependent F-actin reorganization has

also been implicated in assisting a diversity of vesicle traffic steps.

1.5-1-I: Exocytosis

During exocytosis in neuroendocrine cells, intrinsic cortical actin acts as a barrier

that must to be broken down via activation of severing molecules such as scinderin, a

gelsolin-family protein, in order to release vesicles for fusion with the plasma membrane

(95). However, actin polymerization also plays a role in exocytosis as evident by the

requirement of Cdc42- and Rac-dependent Arp2/3 polymerization at the exocytic sites

(96-98). For the release of larger granules, an actin coat has been visualized to form

around the base of the fused vesicles to provide additional stability for fusion and to

facilitate content expulsion via actin-myosin-dependent force generation (99-101). This

de novo actin coat assembly is driven by the activity of Cdc42 and the subsequent

recruitment of N-WASP and Arp2/3 (102). Accordingly, neutrophils from Rac-2 null mice

exhibit reduced granule release, likely due to defective actin dynamics during the

exocytic process (103). In addition to the contribution by branched cortical actin to

vesicle fusion at the plasma membrane, linear F-actin polymerization induced by spire

and formin can serve as tracks for long range transport of vesicle to the plasma

membrane (104).

1.5-1-II: Endocytosis

25

In the process of vesicle internalization from the plasma membrane, force

generated via actin polymerization pushes outwards to the membrane to propel the

formation of the endocytic vesicle (105). This actin-mediated action for endocytosis is

completely required in yeast but has varying degree of participation in mammalian cells

depending on the amount of membrane tension the cell encounters (106). Nonetheless,

some evidences support the participation of Cdc42-stimulated actin polymerization

during clathrin-mediated endocytosis via interaction with intersectin, which is a

scaffolding modulator in the formation of clathrin-coated vesicles (107). As endocytic

processes involve bending of the membrane, BAR domain-containing proteins are

positioned to stabilize the membrane curvature required for membrane tubulation prior

to vesicle formation. One of such molecules, TOCA-1, contains an F-BAR domain for

curvature sensing and also associates with Cdc42 to stage N-WASP->Arp2/3 F-actin

generation to assist in membrane tubulation (108).

1.5-1-III: Endosomal sorting

Once internalized, vesicles need to be sorted through distinct endosomal

compartments before arriving at their defined destinations within the cell. During this

process, endosome-associated annexin A2 triggers spire and Arp2/3-mediated actin

polymerization that is required for endosomal intermediate maturation and the eventual

transport from early to late endosomes (109). Furthermore, active RhoB localized to

early endosomes can delay the endosomal traffic of endocytosed vesicles by inducing

association of vesicles with mDia1-generated F-actin (110).

The Trans-Golgi Network (TGN) often functions as a hub for vesicle sorting and

its integrity and function is regulated by Arf. Interestingly, Arf can mediate the

26

recruitment of various RhoGEF and RhoGAP that affects the activity of local Cdc42

residing at the TGN via binding to γCOP, a COPI-vesicle coat protein. The dynamic

regulation of Cdc42 activation status triggers Arp2/3-dependent actin polymerization

that contributes to TGN morphology and vesicle sorting out of the TGN (111,112). Such

actin-regulated Golgi function can also be affected by cofilin-mediated local actin

dynamics as inhibition of cofilin reduces calcium uptake into the TGN via ATPase

SPCA1, which in turn results in defective vesicle sorting (113).

All these findings point to the contribution of Rho GTPase-mediated actin

dynamics in ensuring the proper traffic of vesicles at the cellular level. In a broader

physiological context, regulated vesicle traffic event has profound effects on the

outcome of biological functions including neurotransmitter release from synapses,

hormone secretion into the blood stream, recruitment of immune cells for inflammatory

responses and many more. Of interest here is the ability of insulin to actively recruit

glucose transporter 4 (GLUT4)-containing vesicles from an intracellular compartment to

the plasma membrane of muscle in order to enhance the rate of glucose clearance from

the blood. The main focus of this thesis is to understand whether Rho GTPases and

their actin-dependent function influence the insulin-stimulated traffic event of GLUT4-

containing vesicles.

1.6: Regulation of glucose homeostasis by GLUTs

Glucose has evolved to be the major fuel source to maintain energetic integrity in

higher organisms. Not only is glucose one of the key carbon sources for energy

production, it and its metabolized intermediates can also serve as signalling molecules

for gene expression, enzyme activity, and hormonal secretion. For example,

27

carbohydrate response element binding protein (ChREBP) exerts transcriptional control

on glycolytic and lipogenic gene expression while glycolytic production of NAD+

regulates Sirt1 deacetylase activity (114,115). In addition, glucose-sensing pancreatic β-

cells produce insulin in response to rising blood glucose. These functional impacts of

glucose utilization impose a necessity for proper whole body glucose homeostatic

regulation.

Intake of glucose into most tissues is governed by the availability of glucose

transporters at the cellular surface. Since the discovery of GLUT1 as the 12-

transmembrane facilitative transporter of glucose in the erythrocytes, thirteen other

members of the GLUT/SLC2A family were identified in humans (116). Phylogenetically,

they can be subdivided into class I (GLUT1, 2, 3, 4, 14), class II (GLUT5, 7, 9 , 11) and

class III (GLUT6, 8, 10, 12, 13) (117). GLUT1 is ubiquitously expressed with Km around

5mM (117). Most importantly, it mediates the rate-limiting step of supplying glucose fuel

to proliferating cells during development, erythrocytes, cardiac muscles, blood-brain

barrier endothelial cells, and astrocytes in central nervous system. The amount of cell

surface GLUT1 is governed by its expression level within a given cell. Conditions such

as hypoglycemia and hypoxia can induce an increased expression of GLUT1 in blood-

brain barrier endothelial cells and cancer tumors respectively to achieve enhanced

absorption of glucose (118,119).

Conversely, GLUT2 has an unusually high Km (~11mM) compared to any other

GLUTs, which makes it the predominant transporter in tissues exposed to elevated

glucose concentration such as intestine, pancreas, kidney, and liver. The high Km shifts

the rate determining step in glucose metabolism to the phosphorylation of glucose by

28

glucokinase upon glucose entry to the cytosol, which traps it within the cell. Functionally,

GLUT2 is crucial in glucose reabsorption by the kidney as lost-of-function mutations in

GLUT2 severely impair this process (120). In intestines, GLUT2 is found at the

basolateral membrane of enterocytes to transport glucose to the blood stream. However,

GLUT2 can also be enriched at the apical surface upon detection of high postprandial

sugar concentration in the intestinal lumen to boost glucose absorption together with the

resident Na+/glucose co-transporters (121). In pancreatic β-cells, glucose metabolism

increases the cytoplasmic ATP/ADP ratio, which induces membrane depolarization and

the release of insulin-containing granules (122). Disruption of this glycolytic flux in

GLUT2 knockout mice results in impaired insulin secretion (123). Nonetheless, this

defect is more pronounced in rodents than in humans.

In addition to GLUT1, GLUT3 is another principal glucose transporter in neuronal

cells and its high affinity for glucose (Km = ~1.4mM) among class I GLUTs is ideally

suited to bring in glucose from the cerebrospinal fluid into neurons, as the ambient

glucose concentration surrounding neurons is about 1-2mM (124). GLUT3 is also in

expressed in platelets, lymphocytes and monocytes. In these cell types, GLUT3 is

uniquely present in an intracellular compartment that undergoes regulated-translocation

to the cell surface upon external stimulations such as PMA and LPS (124,125).

Although the mechanism behind GLUT3-containing vesicle traffic is relatively unknown,

the increased glucose uptake induced by GLUT3 provides the surge in energy demand

to initiate clot formation by platelets and immune responses by monocytes.

GLUT4 (Km = ~5mM) is the major transporter in muscles and adipocytes, where

it is responsible for the insulin-responsive glucose uptake. Among all the GLUTs,

29

GLUT4 is the most studied because of its importance in whole body glucose

homeostasis, its intricate signal regulation on GLUT4-containing vesicle traffic by insulin,

and its implication in insulin resistance and type 2 diabetes. Abrogation of GLUT4

function results in hyperglycemia and associated diabetic complications.

Not all GLUTs transport glucose as their preferred substrate. GLUT5, for

example, has higher affinity for fructose and is responsible for dietary absorption at the

apical membrane of intestinal epithelial cells. GLUT9, on the other hand, transports

urate in liver and kidney to maintain uric acid level in the blood. Other GLUTs (6-8, 10-

14) are less characterized and their physiological contributions remain to be determined.

The regulation of each GLUT directly influences the rate at which glucose is

taken up into the respective tissues. For the majority of the GLUT family members, the

determining regulation impinges on their level of expression which ultimately reflects the

amount of GLUT proteins at the cell surface at a given time. GLUT4 stands out from

other GLUTs in terms of the modes of its regulation. A key distinction is that the majority

of GLUT4 is normally sequestered in intracellular pools and it is only recruited to the

plasma membrane upon stimulation by insulin or other selective stimuli such as muscle

contraction and energy deprivation. In combination with insulin’s major role in whole

body glucose homeostasis, this unique traffic feature of GLUT4 has received enormous

amount of research attention.

1.6-1: GLUT4 traffic

GLUT4 is a key component of postprandial insulin-mediated blood glucose

homeostasis. The principal mechanism by which insulin enhances the uptake of dietary

30

glucose is by rapidly increasing the net amount of GLUT4 at the plasma membrane.

This is achieved through the recruitment of GLUT4-containing vesicles from their

intracellular compartment. Although this response takes place in both adipocytes and

muscles, muscles account for the majority (>2/3) of insulin-induced glucose uptake in

the body (126-128). This physiological trait of muscle makes GLUT4-dependent glucose

regulation by insulin a key area of research interest.

To study GLUT4 traffic in muscle cells, our lab has pioneered the GLUT4myc cell

line in which a myc-tagged GLUT4 construct is stably expressed in rat L6 myoblasts

(129). This enables both population and single cell based assessment of the amount of

GLUT4 at the plasma membrane via colourimetric and immunofluorescent assays. The

gain in surface GLUT4 following insulin stimulation in the GLUT4myc cell line is

comparable to that mediated in isolated skeletal muscles, which suggests a similar

insulin-induced traffic between the two systems (130). As a result, the cell line

represents a simpler model for molecular study on insulin actions in comparison to

using the complicated skeletal muscles. This thesis focuses on the mechanism whereby

GLUT4-containing vesicles are mobilized to the cell surface of muscle cells in response

to insulin in L6 GLUT4myc muscle cell line.

1.6-1-I: Recycling GLUT4 vesicles versus GLUT4 storage vesicles

To understand the molecular underpinnings of the insulin-dependent recruitment

of GLUT4 vesicles, studies have relied on cell cultures of adipocytes and muscle cells

as models to characterize the properties of GLUT4-containing vesicles. GLUT4 is a

continuously recycling molecule that cycles between intracellular pools and the plasma

membrane (131). The stability of GLUT4 (half-life: ~48h) allows these cycles to occur

31

repeatedly over several days (132). Built-in within this cycle is the ability of GLUT4 to be

sorted into a sequestered pool referred to as GLUT4 storage vesicles (GSV), which only

progress to the plasma membrane in response to insulin stimulation (133). This

intracellular retention is partly mediated by the C-terminal TELEY motif of GLUT4

because deletion of this motif redistributes more GLUT4 vesicles into the recycling pool

(134). At steady state, ~50% of GLUT4 resides in the constitutively recycling pool while

the other half is sequestered in the GSV (135). Biochemically, GSV differ from the

general recycling population because they do not contain transferrin receptor. Instead,

the presence of vesicle-associated membrane protein 2 (VAMP2) and insulin-regulated

aminopeptidase (IRAP) on the GSV marks this compartment (135,136). Despite

inferring the existence of this specialized compartment of GLUT4 from kinetic and

biochemical data, the precise localization of these GSV within the cell remains difficult

to visualize.

Two models currently exist to explain how GLUT4 distribution is maintained

between recycling and sequestered pools in adipocytes and muscles. In the static

retention model, GLUT4 is stored in the GSV and does not actively exchange with the

recycling pool (137). On the contrary, the dynamic recycling model states that GLUT4 in

GSV slowly traverses to the recycling compartment so that over time all the available

GLUT4 within the cell is accessible to the plasma membrane (138,139). In adipocytes,

similar strategies were used in studies leading to the disparate conclusions in GLUT4

vesicle cycling pattern, and it was recently suggested that the difference may arise from

the cell culture confluency and the precise method of measurement (140). While

debates remain in adipocytes, dynamic recycling is the favoured model in muscle cells.

32

Nonetheless, the common theme remains to be that insulin promotes the recruitment of

GLUT4 vesicles to the plasma membrane from the GSV.

1.6-1-II: Insulin signalling cascade leading to GLUT4 translocation

As for any recycling protein, the gain in surface GLUT4 induced by insulin could

in theory arise from decreased internalization (endocytosis) or increased externalization

(exocytosis) of GLUT4 molecules. When examining insulin’s effect on the endocytosis

of GLUT4, a minor reduction in the rate of GLUT4 internalization was observed in

adipocytes while no changes were reported in muscle cells (141). It is therefore

generally accepted that the major contribution to the insulin-stimulated gain in GLUT4 at

the plasma membrane is the elevated rate of exocytosis of GLUT4-containing vesicles.

For this reason, the signalling molecules activated by insulin to promote this exocytic

step have been studied extensively with various cellular and animal knockout strategies.

The detailed pathway is carefully reviewed in these articles (131,142,143) so a

simplified version will be briefly described (Figure 1-6).

33

Figure 1-6: Insulin-stimulated signalling cascade leading to GLUT4 traffic in muscle cells. Upon binding of insulin to its receptor at the plasma membrane, autophosphorylation of its cytosolic tyrosine residues trigger the recruitment and subsequent phosphorylation of IRS-1. Tyrosine phosphorylated IRS-1 acts as a scaffold that interacts with PI3K, which leads to the membrane production of PI(3,4,5)P3. At this point, the signals bifurcate into two independent pathways characterized by the activation of Akt and Rac-1. While Akt controls the activation of Rabs via inhibition of AS160, Rac-1 regulates the dynamics of actin remodelling following insulin stimulation in muscle cells. Altogether, these signalling molecules initiate the mobilization of GLUT4 vesicles from the GSV to the plasma membrane to achieve the increase in GLUT4 translocation response.

1.6-1-II-A: IR->IRS1/2->PI3K

It is well established that the insulin receptor (IR) undergoes autophosphorylation

on its cytosolic tyrosine residues upon binding of insulin. The result of this is the

subsequent recruitment and tyrosine phosphorylation of insulin-responsive substrate 1/2

(IRS-1/2) to amplify the signal. Differential contribution of IRS-1 and IRS-2 to insulin

signalling has been verified by using both siRNA-mediated down-regulation in cells and

genetic knockout strategies in animals (144). In muscle cells, disruption of IRS-1, but

34

not IRS-2, significantly impairs the insulin-mediated GLUT4 translocation and glucose

uptake and concomitant down-regulation of IRS-1 and IRS-2 produces no additional

deleterious effect (145). However, ablation of IRS-2 creates a greater reduction in the

activity of mitogen-activated protein kinases responsible for cell proliferation. These

observations suggest that IRS-1 is differentially programmed to carry out insulin-

induced glucose uptake in muscles while IRS-2 governs mitogenic responses.

Functioning as a scaffold, phosphorylated IRS-1 binds the regulatory p85 subunit

of phosphatidylinositol-3-kinase (PI3K), which leads to the activation of its catalytic p110

subunit. PI3K phosphorylates the third hydroxyl position of the inositol ring on PI(4,5)P2 to

produce plasma membrane PI(3,4,5)P3. Experiments using PI3K inhibitors, including

wortmannin and LY294002, and overexpression of p85 mutant that does not interact

with p110 not only block the generation of PI(3,4,5)P3 but also significantly reduce insulin-

stimulated GLUT4 translocation and glucose uptake (146,147). On the contrary,

overexpression of constitutively active PI3K stimulates GLUT4 surface level

independent of insulin (148). These findings validate the importance of PI3K-dependent

membrane PI(3,4,5)P3 production in insulin signal cascade leading to GLUT4 mobilization.

1.6-1-II-B: Akt->AS160->Rabs

The presence of PI(3,4,5)P3 at the plasma membrane can channel activation of a

number of downstream molecules notably Akt. Akt is a serine/threonine kinase that

becomes active by phosphorylation at its activation loop (Thr308) and regulatory site

(Ser473) (149,150). Insulin fulfills this requirement by recruiting Akt near the membrane

through association with the plasma membrane PI(3,4,5)P3 via its PH domain, and

inducing the subsequent phosphorylation of Thr308 and Ser473 by PDK1 and mTOR2,

35

respectively. The functional necessity of Akt in insulin-mediated GLUT4 translocation

and glucose uptake was first demonstrated by overexpression of dominant negative

mutant of Akt (147). It was later refined with additional knock out studies in cells and

mice that demonstrated the specificity of Akt2 isoform, rather than the Akt1 and Akt3, in

controlling the insulin-induced regulatory effect on glucose uptake (151).

Although Akt has a number of substrates to exert its biological functions (152),

the exact downstream target required for insulin-stimulated GLUT4 traffic remained a

mystery until the discovery of Akt substrate of 160kDa (AS160). AS160 (also known as

TBC1D4) is phosphorylated by Akt in response to insulin and any decrease in its

phosphorylation status correlates with impaired insulin-induced glucose uptake (153).

Functionally, AS160 serves to retain GLUT4 intracellularly in the steady state. This

action is dependent on its Rab GAP domain, in which the GTPase promoting activity is

turned off upon phosphorylation. This is predicted to result in elevation of GTP-bound

Rabs to liberate GLUT4 vesicles towards the plasma membrane (154). This observation

led to the detailed mining of the Rabs controlled by AS160 following insulin stimulation.

In vitro experiments with purified GAP domain of AS160 first revealed its activity

towards selective Rabs including Rabs 2A, 8A, 8B, 10 and 14 (155). These targets were

subsequently examined in cell cultures via siRNA-mediated knockdown to validate the

action of AS160 towards selective Rabs and the participation of Rabs in insulin-

mediated GLUT4 traffic. While Rab10 is found to be downstream of AS160 in

adipocytes and required for GLUT4 translocation induced by insulin, Rab8a and Rab13,

but not Rab10, are necessary to carry out the same function in muscle cells (155-158).

Accordingly, insulin leads to the activation (GTP-loading) of Rab8a and Rab13 in

36

muscle cells but Rab10 activation in adipocytes remains to be demonstrated (156).

Ongoing research aimed at identifying the effectors of these activated Rabs is beginning

to reveal the participation of motor proteins that may promote GLUT4 mobilization to

and/or fusion with the plasma membrane (157,159).

1.6-1-III: Rho-induced actin regulation in GLUT4 traffic

Given actin’s ability to control a vast amount of cellular processes including

vesicle traffic, an obligatory question over the years has been whether F-actin

participates in the insulin-mediated GLUT4 translocation. This hypothesis was first

tested using cultured L6 myotubes, where it was shown that acute stimulation of insulin

causes a robust cortical actin reorganization (160). In the basal state, staining of F-actin

by rhodamine phalloidin reveals dense longitudinal stress fiber spanning across

myotubes. Following 30 min of insulin stimulation, a dramatic rearrangement of F-actin

occurs which is marked by the dorsal accumulation of F-actin aggregates at discrete

regions of the cell. Time course analysis later illustrated that insulin is capable of

inducing this morphological change in F-actin by as early as 3 min (161). Although the

remodelled F-actin can still be observed after 30 min of insulin treatment, the greatest

magnitude of reorganization is achieved by 10 min, which has become the standard

time point to visualize insulin-mediated actin remodelling in muscle cells. Similar cortical

actin rearrangement can also be reproduced in undifferentiated myoblasts (162).

Representatives of actin remodelling in myoblasts and myotubes following 10 min of

insulin stimulation are illustrated in Figure 1-7.

37

Figure 1-7: Insulin-induced actin remodelling in myoblasts and myotubes. L6 myoblasts and differentiated L6 myotubes were stimulated with 100nM insulin for 10 min before being fixed and examined for actin reorganization. In the basal state, predominant F-actin staining detected by rhodamine phalloidin is cellular stress fibers. Upon stimulation by insulin, F-actin undergoes significant rearrangement to generate cortical remodelled actin (indicated by the arrows). Bar = 20µm.

To decipher the contribution of remodelled actin to the overall insulin response in

muscle cells, Tsakiridis et al. pretreated myotubes with actin disrupting agent

cytochalasin D (CD), which prevents actin polymerization by binding the barbed ends

and promotes F-actin disassembly, and blocked insulin-responsive actin rearrangement

(160). Interestingly, the corresponding GLUT4 translocation and glucose uptake

induced by insulin were significantly decreased following CD treatment while the basal

response was not affected. More importantly, under this actin depolymerizing condition,

phosphorylation of IRS-1 and binding of PI3K to IRS-1 in response to insulin were not

altered. These observations suggest the potential of insulin-elicited changes in actin as

an additional step in regulating GLUT4 traffic in muscle cells. Similar reliance on actin

was also observed in adipocytes (163).

Results from the application of different versions of actin disrupting agents,

including CD, latrunculin B (LB) and jasplakinolide, in cultured and isolated primary

adipocytes and muscle tissue reinforce the concept that insulin-induced actin dynamics

is required for the stimulated glucose uptake or GLUT4 traffic to the plasma membrane

38

(161,163-168). However, the drugs used in the above studies prevent all forms of F-

actin assembly of all kinds within the cells so that it becomes difficult to assess whether

the contribution of actin toward GLUT4 traffic arises from the insulin-induced remodelled

cortical actin, or from the participation of longitudinal stress fibers, or other forms of

actin filaments present even before insulin stimulation. We hypothesize that a useful

strategy to distinguish between these possibilities would be to identify the molecules

that govern the insulin-dependent actin remodelling.

Visually, the insulin-stimulated actin reorganization in both adipocytes and

muscle cells resembles the morphological changes seen with active Rho GTPases, like

that induced by Cdc42 and Rac, which makes Rho GTPases the most likely candidate

in regulating this response. The earliest attempt to address this hypothesis came with

experiments using Clostridium difficile toxin B, which is a general Rho GTPase inhibitory

toxin (164). Treatment of adipocytes with Clostridium difficile toxin B not only blocks

insulin-induced actin remodelling but also prevents the subsequent GLUT4 translocation

(164). This observation laid the groundwork that begins the search for the member of

the Rho GTPases mediating this actin reorganization.

1.6-1-III-A: TC-10 in adipocytes?

Although insulin stimulation causes a rapid remodelling of cortical actin filaments

in both adipocytes and muscle cells, the dependency on Rho GTPases for this

response differs between the two cell types. For adipocytes, it has been proposed that

TC-10, a Cdc42 family GTPase, becomes activated by insulin in a PI3K-independent

manner, and that disruption of TC-10 with dominant negative mutants or siRNA impairs

insulin-induced actin remodelling (169,170). The activity of TC-10 is driven by the

39

recruitment of C3G, a GEF for TC-10, to the plasma membrane through a cascade of

adaptor proteins (171). However, the proposition of TC-10 in insulin-stimulated actin

remodelling has been greatly debated due to conflicting results in adipocytes. The

inhibitory effect of TC-10 on actin is independent of its nucleotide status and down-

regulation of adaptor components necessary for C3G-induced TC-10 activation fails to

reduce insulin-induced glucose uptake (172,173). More recent evidence suggests Rac

might be the Rho GTPase responsible for the actin-mediated action on GLUT4 traffic in

adipocytes (174). The precise molecule remains to be clarified.

1.6-1-III-B: Rac-1 in muscles

Despite TC-10 also being activated in muscle cells, expression of its dominant

negative form did not prevent the formation of insulin-dependent actin remodelling,

heralding the participation of other Rho GTPase in the actin morphology change (175).

Due to the resemblance of remodelled actin to that of Rac-mediated lamellipodia in

migrating cells, it was hypothesized that Rac could be the regulator of insulin-induced

actin reorganization. Indeed, insulin activates Rac-1 as early as 1 min and its GTP-

loaded status peaks by 10 min in muscle cells (175,176). Functionally, both DN-Rac

overexpression and down-regulation of endogenous Rac-1 via siRNA prevent the

generation of remodelled actin in response to insulin and impair GLUT4 translocation

(161,177). No alteration in insulin-induced actin morphology was observed with the

overexpression of dominant negative (DN)-RhoA or DN-Cdc42 in muscle cells, which

reinforces the specificity of Rac1 in this response ((161), JeBailey and Klip, unpublished

results). Unlike actin disrupting agents, perturbation of Rac-1 spares actin stress fiber

dissolution, which allows the discrimination of insulin-induced remodelled actin as the F-

40

actin component participating in GLUT4 traffic. More recently, a skeletal muscle-specific

Rac-1 knockout mouse models have been generated and verified the importance of

Rac-1 in insulin-mediated GLUT4 translocation to the plasma membrane in vivo

(178,179).

The most common mechanisms to activate Rho GTPase are the activation of

their GEFs or inhibition of their GAPs. Little is known about the GEF and GAP that

might participate in GTP loading of Rac-1 by insulin in muscle cells. However, evidence

points to Rac1 being downstream of PI3K because wortmannin prevents both the

formation of remodelled actin and the activation of Rac-1 following insulin stimulation

(175). This observation supports the idea of Rac-GEF participation as many Rac-GEFs

have been documented to be recruited and activated by membrane PI(3,4,5)P3 (180).

FLJ00068 has been suggested to be the GEF for insulin-stimulated Rac-1 activation in

muscle cells (181). Using a constitutively active form of this GEF, Ueda et al. reported

an increase in Rac-1 activation and actin remodelling. On the other hand, siRNA-

mediated down-regulation of FLJ00068 reduced GLUT4 translocation following insulin

stimulation. However, this report did not provide a direct evidence of impaired Rac-1

activation or actin remodelling in FLJ00068 knock-down condition. More experiments

are needed to clarify if this is the only Rac-GEF involved in the insulin signalling

pathway.

1.6-1-IV: Akt and Rac-1 function independently but both lie downstream of PI3K

With Akt also acting as a downstream effector of PI3K, it was paramount to

examine the interplay between Rac-1 and Akt and their respective contribution towards

GLUT4 traffic in muscle cells. Interestingly, insulin-dependent activation of Rac-1 and

41

Akt is independent from each another. Inhibition of Akt with a DN-mutant or a chemical

Akt inhibitor does not affect insulin-induced Rac-1 activation and actin remodelling

(147,182) while normal Akt phosphorylation is preserved in cells with downregulated

Rac-1 (177). These findings champion the concept that signal bifurcation into Rac-1 and

Akt occurs downstream of PI3K upon insulin stimulation of muscle cells. However, a

recent publication by Nozaki et al. using a different version of Akt inhibitor and Akt2

knockdown strategies reported an Akt-dependent activation of Rac-1 during insulin

stimulation (183). The difference may be due to the varying inhibitory mechanism

exerted by the two Akt inhibitors. Specifically, the initial signal bifurcation finding utilized

Akt inhibitor VIII that selectively binds to the PH-domain of Akt to prevent its recruitment

to plasma membrane PI(3,4,5)P3 leading to inactivation (184). In contrast, Akt inhibitor IV

used by Nozaki et al. targets kinase upstream of Akt (185), which when inactivated

could potentially affect other signalling components in addition to Akt. Furthermore,

Nozaki et al. relied on a 2h pretreatment with their Akt inhibitor, which increases the

chances of non-specific effects, in order to observe the decrease in insulin-stimulated

Rac-1 activation while the earlier report utilized only 30 min of acute treatment. While

evidence of an intact insulin-induced remodelled actin following Akt inhibitor VIII

treatment serves as another indicator for signal bifurcation between Akt and Rac-1, this

key Rac-dependent process was never tested in Nozaki’s report. In addition, the effect

of Akt2 knockdown on insulin-stimulated Rac-1 activation could have been easily

demonstrated in a population assay by applying the gold-standard PAK-mediated Rac-

GTP pulldown method to detect endogenous Rac activation. However, Nozaki et al.

chose to visualize this effect with a less convincing and scarcely used overlay single cell

42

assay, which requires immunofluorescent detection of exogenously expressed WT-Rac

in its GTP-bound form by incubating the cells with purified PAK. Therefore, it is

extremely important to reassess the contribution of Akt to Rac-1 activation during insulin

stimulation. Nonetheless, impairing either Akt or Rac-1 reduces insulin-triggered GLUT4

translocation, supporting a contribution from both molecules to the overall process.

1.6-1-V: Functions of insulin-induced remodelled actin in GLUT4 traffic

Although it is undeniable that a Rho GTPase-driven actin dynamics process

participates in GLUT4 traffic, the precise mechanism whereby the remodelled actin

assists in the mobilization and fusion of GLUT4-containing vesicle to the plasma

membrane remains elusive. Several hypotheses have been proposed including

tethering of GLUT4 vesicles, being a scaffold for signalling molecules, and serving as

tracks for mobility (Figure 1-8).

43

Figure 1-8: Proposed functions of cortical remodelled actin in insulin-mediated GLUT4 traffic in muscle cells. Rac-dependent signals trigger a dynamic actin remodelling zone beneath the plasma membrane following insulin stimulation. This area rich in remodelled actin has been hypothesized to act as tracks for myosinV-mediated GLUT4 vesicle movement, tethering zone for GLUT4 vesicles, and insulin signalling molecules to promote the eventual fusion with the plasma membrane.

1.6-1-V-A: Tethering of GLUT4 vesicles

Using both electron and immunofluorescence microscopy, GLUT4 vesicles can

be observed at the site of remodelled actin following insulin stimulation (161,165,166).

The resulting proximity of GLUT4 vesicles to the plasma membrane could ease the

spatial barrier of the subsequent fusion via interaction with the soluble NSF attachment

protein receptor (SNARE) proteins required for GLUT4 vesicle fusion with the

membrane (186). This model is supported by the findings that disruption of cortical actin

with DN-Rac or LB prevented the insulin-induced accumulation of GLUT4 beneath the

plasma membrane of muscle cells (187). In searching for the molecular link that would

anchor GLUT4 vesicles to the F-actin network, the actin bundling protein α-actinin-4,

was found to co-immunoprecipitate with GLUT4 in an insulin-dependent manner

(188,189). Through its simultaneous interactions with F-actin and GLUT4, α-actinin-4

could position GLUT4 vesicles at the site of remodelled actin, and indeed siRNA to α-

actinin-4 prevents the accumulation of GLUT4 vesicles in the actin meshwork and

results in reduced GLUT4 insertion to the plasma membrane (188). This proposed

molecular bridge exerted by α-actinin-4 supports the concept that the remodelled

cortical actin serves as a tether of GLUT4 vesicles in muscle cells.

Myosin1c (myo1c) has also emerged as a candidate linking GLUT4 vesicles to

the cortical actin. Myo1c interacts with actin filaments and the plasma membrane.

Immunofluorescence microscopy and immunoprecipitation data also confirm its direct

44

interaction with GLUT4 but the association is not altered by insulin stimulation (190,191).

Total internal reflection fluorescence (TIRF) microscopy experiments in muscle cells

revealed that myo1c decreases the mobility of GLUT4 vesicles at the cell cortex

following insulin stimulation to stabilize their position for subsequent fusion events (191).

Without perturbation of the remodelled actin, down-regulation of myo1c or transfection

of a myo1c mutant lacking the actin binding domain impairs this immobilization step,

which results in compromised GLUT4 translocation in muscle cells.

This tethering concept is also showcased in adipocytes where LB treatment

causes the loss of cortical remodelled actin and increases the number of mobile GLUT4

vesicles beneath the plasma membrane (192). However, other reports also in

adipocytes showed the opposite phenotype in which disruption of actin reduces fusion

with the membrane without affecting insulin-stimulated submembrane accumulation of

GLUT4 vesicles (193,194). The discrepancies between the above studies may relate to

differences in LB treatment time and concentration. Similar TIRF experiments in muscle

cells treated with LB would clarify any cell difference in the actin-dependent tethering

model.

1.6-1-V-B: Scaffold for signalling molecules

To spatially and temporally regulate GLUT4 traffic, the remodelled cortical actin

could also act as a scaffold to enrich signalling molecules near the plasma membrane

(162). In addition to GLUT4 vesicle presence in the F-actin meshwork, PI3K, Akt, and

Rabs have also been detected in the cortical region of remodelled actin following insulin

stimulation in muscle cells (156,161,162). Their close proximity to GLUT4 vesicles could

form a hub for signal transduction of Akt->AS160->Rab as Rabs are found to associate

45

with GLUT4 vesicles (155). This would result in more efficient GLUT4 traffic at the

plasma membrane. Recent analysis using a photo-switchable GLUT4 construct

identified defined clusters of GLUT4 at the plasma membrane in the steady state (195).

In addition to increasing the arrival of GLUT4 vesicle, insulin stimulation also enhances

the lateral dispersion of GLUT4 away from its membrane clusters to become monomers.

Although the molecules controlling the formation and the dispersion of GLUT4 clusters

are not yet identified, it could be speculated that actin-dependent signalling hubs would

enrich these proteins at the GLUT4 clusters to enhance their lateral dispersion.

1.6-1-V-C: Tracks for GLUT4 vesicles

F-actin can serve as tracks for the motor protein myosin. Among the myosin

family members, myosin5 (myo5) is a processive motor with cargo carrying capacity

that “walks” on actin filaments (196). Indeed, myo5 can be found associated with F-actin

following insulin stimulation in adipocytes (197). siRNA to myo5 or overexpression of a

myo5a DN-mutant causes mislocalization of GLUT4 vesicles and reduces translocation

elicited by insulin (157,197). Interestingly, Rab8a in muscle cells can directly interact

with myo5a in an insulin-dependent manner (Yi and Klip, unpublished results). This

provides a mechanistic explanation for how Rab molecules mobilize GLUT4 vesicles in

response to insulin. However, the reliance on F-actin for mobility is most likely restricted

to short range movement close to the cell cortex where remodelled actin is formed

because evidence supports microtubule rather than actin participating in long range

transport (198,199).

1.6-1-VI: Rac-dependent actin remodelling during insulin resistance in muscle cells

46

The hallmark of insulin resistance is the inability of tissues to respond to insulin

following elevation in blood glucose. With skeletal muscles accounting for ~90% of

postprandial glucose absorption, one of the major contributors to this pathological state

is the decreased GLUT4 traffic to the plasma membrane following insulin stimulation,

which leads to impaired glucose uptake by skeletal muscles (200). The development of

insulin resistance is multifactorial but the most common cause in the developed world is

obesity. Tissues in obese individuals are exposed to excess lipids and are chronically

stressed by low-grade inflammation arising from activated immune cells (201,202).

Experimental manipulations aimed to mimic these obese cellular environments by

addition of excess saturated fatty acid and cytokines produced by activated immune

cells collectively attribute the defect in GLUT4 translocation and glucose uptake to the

partial reduction in insulin-induced Akt activation (203-207). However, studies using

wortmannin and Akt inhibitor reveal that minimal Akt activity is required for maximal

GLUT4 translocation response (208-210). This would suggest that the ~50% inhibition

of Akt typically observed in these insulin resistance models is unlikely to be the sole

reason for the reduction in GLUT4 translocation and glucose uptake.

Because Akt and Rac-1 function independently of one another and both

contribute to the integrity of GLUT4 traffic in muscle cells, combined impairment in Akt

and Rac-1 synergize to cause the observed GLUT4 traffic defect. Part of the detrimental

effect of saturated fatty acid palmitate oversupply is the build-up of intracellular

metabolites such as ceramide and mitochondrial overproduction of reactive oxygen

species (ROS) (211,212). Replicating these stresses via cell-permeable C2-ceramide

and ROS-producing glucose oxidase significantly inhibited insulin-induced Rac-1

47

activation and actin remodelling in muscle cells (177). Notably, Rac-1 activation was

more sensitive to these stress challenges compared to Akt. Additionally, high insulin

and glucose mirroring the hyperglycemic/hyperinsulinemic state of insulin resistance

also prevents the formation of remodelled actin and GLUT4 traffic following insulin

stimulation (145). This demonstrates the contribution of defective Rac-1 activation and

defective Rac-1-dependent actin reorganization to the development of insulin resistance.

Indeed, recent mouse and human studies using acute (intralipid infusion) and chronic

(obesity) insulin resistance confirm the decrease in Rac-1-dependent signals and

pinpoint to Rac-1 as an important regulator of insulin-dependent GLUT4 traffic and

glucose uptake in vivo (179).

1.7: RATIONALE AND HYPOTHESES

Given the importance of skeletal muscles in insulin-mediated glucose

homeostasis and the essence of GLUT4 traffic in achieving this response, it is

imperative to identify the complete molecular cues that trigger the net gain in GLUT4 at

the muscle cell surface. With a thorough understanding of this GLUT4 recruitment

process from intracellular compartments to the plasma membrane, it will become

possible to identify the individual defects underlying insulin resistance in diverse cellular

and organismic settings. This would potentially allow for the development of treatment

strategies designed specifically to bypass or alleviate the signal transmission breakage.

With Rac-1 and Rac-1-dependent actin remodelling emerging as critical components of

insulin-stimulated GLUT4 traffic in muscles, detailed experimental emphasis on Rac-1

and remodelled actin is needed.

48

Although Rac-1 is responsible for initiating actin reorganization in response to

insulin, the downstream effectors of Rac-1 that contribute to this dynamic actin

remodelling phenotype are still unresolved. Uncovering these effectors would not only

decipher how the remodelled actin is generated but also enable the design of molecular

strategies to restore the actin dynamics. By examining the changes in remodelled actin

and GLUT4 traffic after perturbation of Rac-1-dependent effectors, we would better

understand the exact role of remodelled actin and refine the previously proposed tether,

scaffold, and track models. Studies looking at similar Rac-induced actin structures in

migrating cells reveal that Rac-mediated actin remodelling requires a balance between

polymerization and depolymerization (94). This process is commonly associated with

the Arp2/3-dependent branching activity and the cofilin severing/depolymerizing

potential. However, it is unclear whether Arp2/3 and cofilin are the main drivers of actin

dynamics in response to insulin in muscle cells.

Increasing evidence from mouse and human models has confirmed the initial

findings about the functional impact of Rac-1 in insulin signalling (178,179). In their

analysis of insulin resistance, Rac-1 was consistently found to have reduced activity

coinciding with diminished GLUT4 traffic. As a result, it becomes intriguing to examine

whether increasing Rac-1 levels or Rac-1 activity would exert any positive signalling

effect towards insulin-responsive GLUT4 traffic and counteract the impact of insulin

resistance-causing conditions. Of interest, one study reported that constitutive active

(CA)-Rac overexpression can on its own effect in surface GLUT4 (181). However, the

molecular mechanism behind this phenotype is unknown.

To address these two questions, I hypothesize the following:

49

1. The insulin-induced Rac-1-dependent actin remodelling requires the actin

polymerizing factor, Arp2/3, and the depolymerizing factor, cofilin, in order to

achieve the dynamic remodelling of cortical actin filaments to facilitate GLUT4

traffic.

2. Increasing Rac-1 activity in muscle cells will impart a beneficial effect on GLUT4

traffic that could enhance GLUT4 translocation and confer protection from its

defect in insulin resistance-causing conditions.

I will use the established L6 GLUT4myc cell line with various molecular

manipulations to examine these two hypotheses in chapters 3 and 4.

50

CHAPTER 2: Materials and Methods

51

2.1: Materials

2.1-1: Cell culture reagents

α-minimum essential medium (αMEM), fetal bovine serum (FBS), phosphate-

buffered saline (PBS), trypsin, antibiotics were from Wisent (Montreal, QC).

2.1-2: General reagents

Protease inhibitor cocktail (PIC), NaF, Na3VO4, rapamycin, IPA-3, and DMSO

(high pressure liquid chromatography grade) were from Sigma-Aldrich (St. Louis, MO).

Human insulin was purchased from Eli Lilly (Indianapolis, IN). SuperScript® VILO™

cDNA kit, Trizol, Taq PCR DNA polymerase, and rhodamine-phalloidin was from

Invitrogen (Grand Island, NY). Akti inhibitor 1/2 (Akti1/2), compound C (CC), Tween-20,

NP-40, and latrunculin B (LB) were from Calbiochem (Gibbstown, NJ). Wortmannin and

C2-ceramide were from Enzo Life Science (Farmingdale, NY).

2.1-3: Antibodies

Monoclonal anti-P-tyrosine antibody, polyclonal anti-myc antibody (A-14), anti-

Tiam1, anti-Vav-2, anti-GDIα, anti-P-GDIα, and anti-p34-ARC were from Santa Cruz.

Polyclonal anti-phosphorylated cofilin-1, anti-Akt, anti-phosphorylated Akt (Ser473),

Akt(Thr308), anti-phosphorylated Akt substrate (PAS), and anti-phosphorylated LIMK1

antibodies were from Cell Signaling Technology (Danvers, MA). Polyclonal anti-Arp3

was from BD Biosciences. Polyclonal anti-slingshot-1 (anti-SSH1) was from ECM

Biosciences. Affinity purified antibodies against P-AC and cofilin-1 were as described

(213,214). Monoclonal anti-ACTN1 (mouse IgM isotype, clone BM-75.2), anti-β-actin,

polyclonal anti-LIMK1, monoclonal anti-FLAG antibody were from Sigma-Aldrich.

Polyclonal anti-GFP antibody was from Abcam Inc (Cambridge, MA). Monoclonal P-

52

IRS-1(307) antibody was from EMD Millipore (Billerica, MA). Monoclonal anti-HA

antibody was purchased from Covance Inc (Princeton, NJ). Cy3 and Cy5 conjugated

donkey-anti-rabbit and donkey-anti-mouse secondary antibodies and horseradish-

peroxidase (HRP) conjugated goat-anti-rabbit, goat-anti-mouse, and rabbit-anti-goat

secondary antibodies were purchased from Jackson ImmunoResearch (West Grove,

PA). Alexa 488-conjugated goat anti-mouse and anti-rabbit IgG antibodies were from

Invitrogen.

2.1-4: cDNAs

Green fluorescent protein (GFP)-tagged Dictyostelium discoideum Arp3 was

kindly provided by Dr. Sergio Grinstein (University of Toronto, Toronto, ON, CA). GFP-

tagged wildtype and S3E Xenopus cofilin were generated in the laboratory of Dr. J.

Bamburg (215).

The cDNA constructs (Lyn-FRB, YF, YF-CA-Rac, YF-Tiam1, and YF-DN-Rac) used for

rapamycin-induced heterodimerization have been previously described and were

generously provided by Dr. Mary Teruel and Dr. Tobias Meyer (216). WT-Rac- and

GFP-CA-Rac were provided by Dr. Mark R. Philips. HA-IRS1 was provided by Dr. Maria

Rozakis. FLAG-CA-JNK1 was provided by Dr. Gokhan Hotamisligil (217). Tiam1-GFP

was provided by Dr. Sergio Grinstein. CFP tagged WT-Cdc42 and CA-Cdc42 were

provided by Dr. John Brumell.

2.1-5: siRNAs

Small inhibitory RNAs (siRNAs) targeted against p34

(AAGGAACTTCAGGCACACGGA), Arp3 (GAAAGGCGTGGATGACCTATT) (218),

cofilin-1 (AAGGTGTTCAATGAGATGAAA), LIMK1

53

(AAGGAATGTGCCGCTGGCAGATT), slingshot-1 (AAGAACTGAGCGTCTCATTAA),

Tiam1 (CTGCCGGAATTTGGTGTCGGA), Vav-2 (CCAGATGTACACGTTTGACAA), and

non-related control (AATAAGGCTATGAAGAGATAC) were purchased from Qiagen,

prepared as 20uM stock in RNAse-free water, and are here named, respectively, sip34,

siArp3, siCofilin, siLIMK, siSSH1, siTiam1 , siVav-2, and siNR.

2.1-6: PCR primers

Primers are designed using Primer3 software (http://frodo.wi.mit.edu/) and ordered from

ACGT Inc. (Toronto, Ontario).

Table 2-1. List of primers used for semi-quantitative PCR.

Genes Forward Primer Reverse Primer Expected size

(bp)

Vav-1 ggagatccagcagactgagg tgcaataacggccataaaca 254

Vav-2 tcggtccatagtcaaccaca tcatgtcttccgtcttgcag 242

Vav-3 tctgcgtgatttgctggtag ttggcgatcttgtactgctg 405

Tiam1 ctactgccggaatttggtgt agttggtggcattggatctc 296

P-rex1 gttcgtacctgggcagtgat tgatggagctgggtaggttc 300

P-rex2 tggttaattgcacagggtga tttgtcttccagcccaaatc 276

SWAP-70 atgaagaaaggccacaaacg ggtagaatggatggcctgaa 261

SOS-1 tgttcgtccatcaaatccaa cttgagtgaaaagggcttgc 234

SOS-2 tgaagaagggaacagcgact aaatcgaggtggttgtttgc 262

Dock180 atatgatgggaccaccctga gcagaaggttggtgttggat 284

α-PIX ctattcaggcatgggaagga ctaccgtgctaccggtgatt 267

β-PIX tcccatcctctcactccatc gttttggcagcagctttttc 265

FLJ00068 (181) tccgatgtgccccagggcct ggtttgctgaagagcagcag 555

FLJ00068 (PLEKHG4)

ggcagttggtacgacaggat cgaagcgcagtttactttcc 204

GAPDH tgccactcagaagacgtggg ttcagctctgggatgacctt 129

2.2: Experimental protocols

2.2-1: Growing L6 myoblasts

http://frodo.wi.mit.edu/

54

Rat L6 muscle cells expressing GLUT4 with an exofacial myc epitope (L6-

GLUT4myc) were cultured as described previously (219). Myoblasts were cultured in

αMEM supplemented with 10% (vol/vol) FBS and 1% (vol/vol) antibiotics in a humidified

incubator with 5% CO2 at 37 oC. The myoblasts were split every 48h to prevent

aggregation of the cells.

2.2-2: Cell treatments

For experiments looking at insulin-dependent GLUT4 translocation in

L6GLUT4myc myoblasts, cells were serum starved in αMEM for 3h prior to 100nM of

insulin stimulation for 10 min. For experiments with inhibitors, various concentration and

pretreatment time in serum free αMEM were applied prior to 10 min insulin stimulation in

the presence of the compound. The conditions are as follows:

Table 2-2: Summary of compounds and their treatment concentration and time.

Compound Concentration Pretreatment time

Insulin stimulation with

compound

Total treatment

time

LB 250nM (for confluent myoblasts)

20 min 10 min 30 min

200nM (for sparse single

cell)

20 min 10 min 30 min

Wortmannin 100nM 20 min 10 min 30 min

Akti1/2 10µM 30 min 10 min 40 min

Compound C 10µM 30 min 10 min 40 min

C2-ceramide 50µM 2h 10 min 2h 10min

IPA-3 30uM 30 min 10 min 40 min

2.2-3: cDNA transfection

Transfection of cDNA was performed with Lipofectamine 2000 (Invitrogen) or

Fugene HD (Promega) according to the manufacture’s protocol. For immunoflurescence

55

experiments, myoblasts were seeded on 12mm coverslip in 12 well plate a day before

the transfection so that the cell density is ~50% on the day of transfection. cDNA-

lipofectamine was mixed at 0.5µg-to-1µL or 1µg-to-2µL ratio in 100µL serum free

media, incubated at room temperature for 25 min, and mixture was subsequently

applied to the cells in serum free media for 5h before washing 2x with PBS and

exchanging to fresh growth media. Cells were allowed to recover overnight before

experiments in the next day. For experiments with immunoprecipitation of transiently

expressed proteins, myoblasts were seeded on 10cm dishes a day before so they will

be ~70% confluent on the day of the transfection. cDNA-Fugene was mixed at 4µg-to-

12µL ratio in 200µL serum free media, incubated at room temperature for 25 min, and

the mixture was treated with the cells in growth media without antibiotics for 24h to

achieve higher transfection efficiency. After 24h, cells were washed 2x with PBS and

continued with the immunoprecipitation experiments. Maximal transfection efficiency in

L6 myoblasts is ~ 20-30%.

2.2-4: siRNA transfection

For siRNA experiments, myoblasts were seeded a day before so that a cell

density of ~70% is reached on the day of transfection. Transfection of siRNAs was

achieved using the calcium phosphate-based CellPhect Transfection Kit according to

the manufactured protocol (GE Healthcare Bio-Sciences). 200nM siRNA-calcium

phosphate precipitates were removed 12-16 h after addition and cells were maintained

for 72 h until experimentation. Alternatively, siRNA mixture was prepared with JetPrime

from Polyplus Transfection Inc. (Illkirch, France). For each well of a 24 well plate, 3µL of

20µM siRNA stock was mixed with 50µL of JetPrime buffer. 1.5µL of JetPrime reagent

56

was subsequently added to the mixture and vortexed for 10 sec. After incubation at

room temperature for 25 min, the siRNA mixture was added to the well containing

growth media without antibiotics and incubated for 24h. Following the 24h treatment,

cells were washed 2x with PBS, replaced with fresh growth media, and maintained for

another 48h before conducting experiments. For each well in 12 well and 6 well format,

6µL of siRNA+100µL JetPrime buffer+3µL JetPrime reagent and 12µL of siRNA+200µL

JetPrime buffer+6µL JetPrime reagent formulation was used respectively.

2.2-5: RNA isolation

RNA was isolated using Trizol (Invitrogen). Myoblasts were grown to confluency

in 6 well plate. After 2x quick washes with cold PBS, 1mL of Trizol (1mL per 10cm2 ratio)

was added to each well with the plate on ice. The cell lysate were passed through

P1000 pipette 10x before transferring to an eppendorf tube followed by 5 min incubation

at room temperature. 0.2mL of chloroform was added to the homogenized samples

(0.2mL chloroform per 1mL Trizol ratio) and the solution was vortexed for 15 sec before

resting at room temperature for another 2 min. Samples were subsequently centrifuged

at 12000 x g for 15 min at 4oC to separate mixture into lower red phase (phenol-

chloroform), interphase, and colorless aqueous phase at the top. The aqueous top

phase is carefully transferred to a fresh tube. To precipitate RNA, 0.5mL of isopropyl

alcohol was added to the aqueous phase, vortexed, and incubated at room temperature

for 10 min. The mixture was centrifuged at 12000 x g for 10 min at 4oC to form RNA

precipitate at the bottom of the tube. After removal of supernatant, RNA pellet was

washed 2x with 1mL of 75% ethanol and centrifugation at 7500 x g for 5 min at 4oC. The

RNA pellet inside the tube was air-dried completely before redissolved in 20µL DEPC-

treated water. The concentration of each samples were measured by A260/A280 ratio.

57

2.2-6: cDNA generation from purified RNA

Reverse-transcription-dependent cDNA generation was completed using

SuperScript® VILO™ cDNA kit (Invitrogen). 2µg of RNA was mixed with 4µL of 5X

VILO™ Reaction Mix, 2µL of 10X SuperScript® Enzyme Mix, and topped with DEPC-

treated water to 20µL. The mixture was gently mixed and incubated at 25°C for 10 min.

Reaction was started by placing the tube at 42°C for 60 min followed by termination at

85°C for 5 min.

2.2-7: PCR

PCR reaction was achieved using Taq PCR DNA polymerase (Invitrogen). A 20µL

PCR mixture was created as follows: 2µL of 10X PCR buffer, 0.5µL of 50mM MgCl2,

0.4µL of 10mM dNTP mix, 0.4µL of 10µM forward primer, 0.4µL of 10µM reverse primer,

0.1µL of Taq DNA polymerase, 0.4µL of cDNA, and topped up to 20µL with autoclaved

distilled water. The mixture was heated at 95°C for 2 min for denaturation of template

and activation of enzyme. 30 cycles of PCR amplification was performed as follows for

semi-quantitative readouts: denature at 95°C for 30 sec, anneal at 58°C for 40 sec, and

extend at 72°C for 1 minute per kb. The results were analyzed by agarose gel

electrophoresis with the appropriate DNA ladder.

2.2-8: Cell lysates, immunoprecitation and immunoblotting

After transfection and experimental treatments, cells were washed quickly 2x with

cold PBS and lysed with 1% (vol/vol) Triton X-100 in PBS containing 1:500 PIC, 10mM

NaF, and 10mM Na3VO4. Lysates were passed through a 29-gauge syringe needle ten

times, and supernatants were collected by a 10 min spin at 12,000x g. For standard

immunoblotting, concentration of the supernatant was measured to ensure equal

58

loading of samples for comparison. Typically, 10-15µg of proteins was prepared with 2x

Laemmli sample buffer for immunoblotting.

For immunoprecipitation, supernatant was subsequently incubated with protein G

beads conjugated to 1-2µg of epitope antibody at 4oC for at least 4h before subjecting to

3x washes with 0.1% Triton X-100 followed by a last wash with regular PBS without

detergent. Immunoprecipitated protein samples were eluted with 2x Laemmli sample

buffer. All protein samples are subsequently resolved by 7, 10, or 13% SDS-PAGE and

transferred to polyvinylidene difluoride membranes (Bio-Rad, Richmond, CA) at 100V

for 2h. Membranes were subsequently blocked with 3% (vol/vol) BSA in Tris-buffered

saline (500mM Tris-base, 150mM NaCl, 0.5% (vol/vol) Tween-20, 0.5% (vol/vol) NP-40.

pH=7.5) for 1h and immunoblotted with respective antibodies (1:1000) overnight at 4oC.

Primary antibodies were detected with the appropriate HRP-conjugated species-specific

IgG secondary antibodies (1:10000) at room temperature for 1h. Immunoblotting was

completed with Western Lightning Chemiluminescence Reagent Plus and HyBlot CL

autoradiography film from Denville Scientific (Denville, NJ).

2.2-9: Cell-surface GLUT4myc and total GLUT4myc detection by immunofluorescence

microscopy

Immunofluorescence detection of surface GLUT4myc in adhered L6 myoblasts

was performed as previously described (166). Following 3 h serum starvation, cells

were stimulated with/without 100nM insulin for 10 min at 37°C. Cells were quickly

washed twice with cold phosphate-buffered saline supplemented with calcium and

magnesium (PBS+), fixed with 3% (vol/vol) paraformaldehyde, quenched with 0.1M

glycine and blocked with 5% (vol/vol) milk. Surface GLUT4myc was stained by

incubating anti-myc primary antibody followed by Cy2- or Cy3-coupled secondary

59

antibody. For co-staining of surface GLUT4myc and intracellular F-actin, surface

GLUT4myc was labeled first prior to membrane permeabilization with 0.1% Triton X-100

for 3 min before subsequent F-actin staining with rhodamine phalloidin. For co-staining

of tagged cDNA constructs, 3 min permeabilization with 0.1% Triton X-100 and

detection with epitope antibody were applied after labeling of primary myc antibody. For

measurement of rapamycin-induced gain in surface GLUT4myc, 10 min of 1µM

rapamycin treatment was applied to cells transfected with respective components of

rapamycin heterodimerization system. For total GLUT4myc detection, cells were

permeabilized with 0.1% Triton X-100 for 15 min following the quenching step prior to

blocking and labelling with anti-myc primary antibody. Fluorescence images were taken

with a Zeiss LSM 510 laser-scanning confocal microscope (Thornwood, NY). With 63x

objective, cells were scanned along the z-axis, single composite image (collapsed xy

projection) of the optical cuts (1µm) per cell was assembled, and the pixel intensity of

each cell (≥25 cells per condition) was quantified by ImageJ software.

2.2-10: Rounded-up myoblasts assay

Rounded-up myoblasts were generated as previously described (187). Regular

adherent L6 myoblasts or cDNA transfected myoblasts were incubated in PBS without

calcium and magnesium at 37oC for 10 min to allow detachment. After careful removal

of PBS, cells were re-suspended in serum free media with/without insulin or rapamycin

before attached on the coverslip for 10 min at 37oC followed by fixation. For staining of

surface GLUT4myc in rounded-up myoblasts, standard surface detection protocol of

surface GLUT4myc is employed as described above.

2.2-11: Detection and quantification of actin remodelling/polymerized dorsal actin

60

Following treatment with or without insulin for 10 min at 37 °C, adhered or

rounded-up L6 myoblasts were fixed, quenched, permeabilized with 0.1% Triton X-100

in PBS for 3 min, blocked with 5% milk and stained with rhodamine phalloidin for F-

actin. For rapamycin-triggered changes in F-actin, cDNA-transfected myoblasts were

first treated with/without rapamycin for 10 min at 37°C before following the staining with

rhodamine phalloidin. Cells were imaged by Zeiss LSM 510 laser scanning confocal

microscope. Acquisition parameters were adjusted to minimize saturation of the signal.

To quantify actin remodelling, the F-actin pixel intensity from compiled dorsal optical

slices of basal and insulin-stimulated cells were analyzed with ImageJ software (>30

cells per condition). The optical slices quantified began from the outermost confocal

fluorescent signal detected and continued towards the interior of the cell but skipping

the last 2-3 optical slices dominated by actin stress fibers. By eliminating from the

quantification the focal planes enriched in parallel arrays of stress fibers, which are still

devoid of crisscrossed arrays of branched actin (vastly present in the top half of the

cells towards the dorsal surface), we quantify cortical remodelling. The method may

potentially underestimate this response, but not magnify it.

2.2-12: 125I-Transferrin recycling

The recycling of transferrin (Tf) was measured essentially as previously

described (220). Following siRNA treatment and 3 h serum starvation, myoblasts were

labeled with 125I-Tf (1µg/ml) for 30 min at 37°C. Cells were placed on ice, washed once

with cold medium (-MEM, 1% BSA, 20mM HEPES), once with cold acid solution

(0.15M NaCl, 0.1M glycine, pH=3.0), and again with cold medium. Cells were then

chased with medium containing 200µg/ml holo-Tf with/without insulin at 37°C and the

61

medium was collected at the indicated time points. Following another wash with cold

medium, cells were scraped and lysed in 1M NaOH. Radioactivity in cell lysates

(internalized Tf) and medium collected (externalized Tf) was measured in a gamma

counter. Data for each time point were measured in triplicate. Tf recycling was

expressed as the ratio of externalized Tf over internalized Tf. Data were corrected for

non-specific binding of 125I-Tf by the addition of 200µg/ml holo-Tf during the initial

labeling.

2.2-13: Rac-1-GTP pulldown assay

Rac-1 activation assay was performed as previously described (175). For

preparation of GST-CRIB beads, bacterial stock containing the GST-CRIB expression

plasmid was inoculated in 10mL of LB containing 100ug/mL ampicillin and grown

overnight at 37oC under rotation. The next day, 10mL of bacteria was added into a flask

of fresh 250mL LB. Growth is continued at 37oC with rotation until the optical density at

600 (OD600) is reached between 0.4~0.6. At this point, a final concentration of 0.5µM

IPTG was added to the flask to induce protein expression for 4h at 37oC with shaking.

At the end of the induction, bacteria was spun down at 6000x g for 15 min and frozen at

-80oC until purification with French press.

Frozen bacterial pellet was resuspended in cold STE buffer (10mM Tris, 150mM

NaCl, 1mM EDTA) containing 1:500 PIC. The solution was passed through French

press at 1000 psi 2x to liberate proteins by breaking bacterial membranes. Triton X-100

was added next to a final concentration of 1% vol/vol. The solution was mixed under

rotation at 4oC for 30 min before spin down at 12000x g for 30 min. During the spin

down, ~1mL of glutathione sepharose beads were washed 3x with STE buffer before

the supernatant from the spin down was added to the beads. Incubation was permitted

62

at 4oC under rotation for 1h. The resulting conjugated beads were washed 3x with 15mL

of STE buffer each. Final conjugated GST-CRIB beads were aliquoted and stored at -

80oC.

To perform the active Rac-1 pulldown assay, myoblasts were grown to

confluency on 10cm dishes before experiments. Cells were serum starved for 3h before

stimulation with/without 100nM insulin for 10 min. After 2x wash with cold PBS, lysates

were collected with MLB buffer (25mM Hepes, 150mM NaCl, 1% NP-40, 10mM MgCl2,

1mM EDTA, 2% glycerol) supplemented with 1:500 PIC+10mM NaF+10mM Na3VO4,

span down at 12,000x g for 1 min, and incubated with GST-CRIB beads under rotation

at 4oC for 45 min. After 3x washes with MLB followed by last wash with PBS without

detergent, the pulldown proteins were eluted with 2x Laemmli sample buffer and

resolved in 10% SDS-PAGE for immunoblotting for Rac-1. For Akti1/2 experiments,

inhibitor or DMSO was applied in the last 1h of serum starvation. For Rac activation with

GFP-WT-Rac or GFP-CA-Rac, myoblasts were transfected with the respective

constructs for 24h before the experiments. The pulldown Rac-GTP was detected with

GFP antibody.

2.2-14: 2D immunoblots

2D immunoblots were performed according to the previously published method

(214). Cell extract with ~100µg of protein was placed in a 1.5mL tube and the protein

was precipitated with chloroform/methanol. Protein pellets were air-dried and solubilized

in 8M urea containing 2% IGEPAL CA-630 and 20 mM DTT. Before loading onto 7cm

IPG strips for isoelectric focusing, IPG buffer (pH 3–10, Amersham Biosciences) was

added to the sample to a final concentration of 0.5%. Samples were allowed to

63

rehydrate the strips overnight and focusing was performed on an IPGphor IEF system

(Amersham Biosciences) for 4h (1h at 500V, 1h at 1000V, and 2h at 8000V). The buffer

was then exchanged on the strips by soaking in 50mM Tris, pH 8.8, 6M urea, 30%

glycerol, 2% SDS, 2 mg/mL DTT and a trace of bromophenol blue for 15min. Strips

were layered horizontally on a 1mm thick 15% acrylamide SDS-gels with a 4% stacking

gel for electrophoresis in the second dimension. Immunoblotting of the spots from the

2D gel was performed as described for regular immunoblots.

2.2-15: Statistics

Statistical analyses were carried out using Prism 4.0 software (GraphPad

Software, San Diego, CA). When more than 2 groups are present, they were compared

using one-way ANOVA with Newman-Keuls post-hoc analysis. For two groups,

Student’s t-test is applied. p < 0.05 was considered statistically significant.

64

CHAPTER 3: Arp2/3- and cofilin-coordinated actin dynamics is required for

insulin-mediated GLUT4 translocation to the surface of muscle cells

Tim Ting Chiu*, †, Nish Patel*, Alisa E. Shaw‡, James R. Bamburg‡, Amira Klip*, †,§

*Program in Cell Biology, The Hospital for Sick Children, 555 University Ave., Toronto,

ON, Canada, M5G 1X8

†Department of Biochemistry, University of Toronto, Toronto, ON, Canada, M5S 1A8

‡Department of Biochemistry and Molecular Biology, and Molecular, Cellular and

Integrative Neuroscience Program, Colorado State University, Fort Collins, CO, USA,

80523-1870

This research was originally published in Mol. Biol. Cell. 2010 Oct 15;21(20):3529-39

65

3.1: Abstract

GLUT4 vesicles are actively recruited to the muscle cell surface upon insulin

stimulation. Key to this process is Rac-dependent reorganization of filamentous actin

beneath the plasma membrane, but the underlying molecular mechanisms had yet to be

elucidated. Using L6 rat skeletal myoblasts stably expressing myc-tagged GLUT4, we

found that Arp2/3, acting downstream of Rac-1 GTPase, is responsible for the cortical

actin polymerization evoked by insulin. siRNA-mediated silencing of either Arp3 or p34

subunits of the Arp2/3 complex abrogated actin remodelling and impaired GLUT4

translocation. Insulin also led to dephosphorylation of the actin-severing protein cofilin

on Ser-3, mediated by the phosphatase slingshot. Cofilin dephosphorylation was

prevented by strategies depolymerizing remodelled actin (latrunculin B or p34

silencing), suggesting that accumulation of polymerized actin drives severing to enact a

dynamic actin cycling. Cofilin knockdown via siRNA caused overwhelming actin

polymerization that subsequently inhibited GLUT4 translocation. This inhibition was

relieved by re-expressing Xenopus wild type cofilin-GFP but not the S3E-cofilin-GFP

mutant that emulates permanent phosphorylation. Transferrin recycling was not affected

by depleting Arp2/3 or cofilin. These results suggest that cofilin dephosphorylation is

required for GLUT4 translocation. We propose that Arp2/3 and cofilin coordinate a

dynamic cycle of actin branching and severing at the cell cortex, essential for insulin-

mediated GLUT4 translocation in muscle cells.

66

3.2: Introduction

A major function of insulin is to regulate glucose uptake by muscle and fat

tissues. This is achieved through a rapid and dynamic gain in GLUT4 at the cell surface

(131,221,222). Notably, this process becomes defective in insulin resistance states and

type 2 diabetes (223-226). To date, defects in insulin signalling and GLUT4 traffic per se

have been invoked to underlie such defects (227,228).

Upon normal insulin action, the recruitment of IRS-1/2 to active insulin receptors

leads to activation of PI3K (146,229). In muscle cells, signalling bifurcates downstream

of PI3K into two independent arms characterized by phosphorylation of Akt (147) and

GTP activation of the small GTPase Rac-1 leading to actin remodelling (161,175). The

two pathways are independent of one another because neither Akt dominant-negative

mutants (147) nor the Akt inhibitor (182) prevent insulin-induced Rac activation or its

consequent actin remodelling, and disruption of Rac-1 via siRNA fails to reduce Akt

phosphorylation by insulin (177). Both signalling arms are required to elicit proper

insulin-mediated GLUT4 translocation as perturbation of either one significantly reduces

the GLUT4 response to insulin in muscle cells (131,147,157,177).

While much emphasis has been placed on the effectors downstream of Akt such

as AS160 and Rab GTPases (154,155,158,230-232), the function of Rac-1 remains less

explored. Rac-1 belongs to the small Rho GTPase family whose activity is regulated by

GTP loading (180,233). Insulin promotes GTP loading of Rac-1 within the first 1-5

minutes of stimulation (175,176). Once activated, Rac-1 induces the reorganization of

cortical actin filaments (161,177). This actin remodelling is a critical component in

insulin-stimulated GLUT4 translocation because overexpression of a dominant negative

Rac mutant (161) or siRNA-mediated Rac-1 knockdown (177) not only prevent actin

67

remodelling but also markedly diminish the insulin-mediated recruitment of GLUT4 to

the surface. A similar reduction in insulin response is observed upon preventing actin

remodelling with inhibitors of actin polymerization such as LB and CD (160,161), or by

precluding actin depolymerization with jasplakinolide (165). Altogether, these findings

reveal the importance of peripheral actin reorganization in insulin-dependent GLUT4

translocation in muscle cells. However, the precise regulation of this dynamic actin

change, and the elements acting downstream of Rac-1 are undefined. Moreover, a

model that incorporates both actin polymerization and depolymerization, as required for

dynamic remodelling, has not been proposed.

Here we test the hypothesis that insulin produces a dynamic regulation of actin

remodelling involving cycles of branching and depolymerization. Using a well-

established muscle cell model of L6 GLUT4myc myoblasts displaying insulin-induced

GLUT4myc exocytosis, we identify the Arp2/3 complex as a downstream effector of

Rac-1 that governs cortical actin polymerization, and cofilin as a regulator promoting

actin filament depolymerization. Cofilin dephosphorylation requires prior buildup of

polymerized actin driven by Arp2/3. Therefore, an integrated mode for active actin

cycling is proposed that enables insulin-mediated GLUT4 translocation/insertion into the

muscle cell membrane.

68

3.3: Results

3.3-1: Arp2/3 is required for insulin-mediated actin remodelling

We have previously reported that insulin causes marked actin polymerization at

the cortical periphery of L6 myoblasts and myotubes, that has a branched appearance

when visualized by fluorescence (161,162) and electron (187) microscopy, and that

manifests even in suspended myoblasts lacking stress fibers (175,187). The small

GTPase Rac is a major regulator of such cortical actin remodelling (161,175,177).

Known effectors of the Rho-family of small G proteins that modify actin filament

organization in general include the branching complex Arp2/3 (234), capping proteins

such as gelsolin and severing proteins such as cofilin (67). Here we hypothesize that

Arp2/3 acts directly downstream of Rac-1 to initiate the insulin-dependent actin

polymerization process. Arp2/3 is a seven-subunit complex consisting of Arp2, Arp3,

p16, p20, p21, p34, and p40 (234). By transiently expressing the Arp3-GFP subunit into

L6 GLUT4myc myoblasts, we sought to examine changes in the localization of Arp2/3

following insulin stimulation. In the unstimulated state, myoblasts displayed normal

cellular stress fibers and Arp3-GFP was mainly cytosolic (Figure 3-1). When challenged

with insulin, an actin meshwork formed at the periphery of the cells and Arp3-GFP

redistributed to the zone of remodelled actin, suggesting its involvement at this region

(Figure 3-1).

69

Figure 3-1: Arp3-GFP colocalizes with remodelled actin following insulin stimulation in myoblasts. L6 GLUT4myc myoblasts were transiently transfected with Arp3-GFP. Following 3 h serum starvation, cells were stimulated with 100 nM insulin for 10 min. Subsequent staining of F-actin by rhodamine-phalloidin was performed to observe the changes in the localization of Arp3-GFP with respect to the remodelled actin. Representative images of 4 independent experiments are shown. Bars, 20 µm. To functionally establish the role of Arp2/3 in insulin-responsive actin remodelling,

we interfered with the complex by silencing expression of its Arp3 subunit via siRNA-

mediated knockdown. Significant down-regulation of Arp3 (by 77%) was achieved in

siArp3-treated cells compared to cells treated with a non-related siRNA (siNR)

sequence (Figure 3-2A). In Arp3 knockdown cells, the aspect and density of basal-state

stress fibers remained unchanged. However, the insulin-induced actin remodelling was

lost (Figure 3-2B). Quantitative analysis of remodelled actin revealed a 70% decrease in

dorsal actin remodelling upon Arp3 down-regulation compared to control NR-treated

cells (Figure 3-2C).

70

Figure 3-2: Down-regulation of Arp3 prevents the formation of remodelled actin and reduces GLUT4 translocation following insulin stimulation in myoblasts. A) Myoblasts were transfected with 200 nM of non-related (NR) siRNA control or Arp3 siRNA for 72 h. Total cell lysates were prepared and 10 µg protein were loaded and immunoblotted for Arp3 and actinin-1 (as loading control). Representative blots of 5 independent experiments are shown. B) Myoblasts transfected with NR or Arp3 siRNA were treated with/without insulin for 10 min followed by staining surface GLUT4myc in non-permeabilized cells, then permeabilized to label actin filaments with rhodamine-phalloidin. Dorsal actin remodelling was calculated from the pixel quantification in fluorescence optical cuts of the dorsal surface of adhered myoblasts (see Methods). Representative images of 3 independent experiments are shown. Bars, 20 µm. C) Quantification of changes in insulin-stimulated dorsal actin remodelling relative to NR control (mean ± S.E.). D) Quantification of fold increases in surface GLUT4myc relative to NR basal in NR and Arp3 knockdown conditions (mean ± S.E., #p<0.05).

This deleterious effect was further validated by inhibiting the function of Arp2/3

via down-regulation of another Arp2/3 subunit, p34. As with siArp3, siRNA-mediated

knockdown of p34 (sip34) by 60% also prevented the formation of remodelled actin

structures at the cell periphery upon insulin stimulation (Figure 3-3A,B).

A)

C) D)

B)

71

Figure 3-3: Down-regulation of p34 inhibits the formation of remodelled actin and decreases GLUT4 translocation. A) L6GLUT4myc myoblasts were transfected with 200 nM of non-related (NR) siRNA control or p34 siRNA for 72 h. Total cell lysates were prepared and 10 µg protein were loaded and immunoblotted for p34 and actinin-1 (as loading control). Representative blots of 5 independent experiments are shown. B) Myoblasts transfected with NR or p34 siRNA were treated with/without insulin for 10 min followed by co-staining of surface GLUT4myc in the non-permeabilized state, then permeabilized to label actin filaments with rhodamine-phalloidin. Representative images of 5 independent experiments are shown. Bars, 20 µm. C) Quantification of changes in insulin-stimulated dorsal actin remodelling relative to NR control (mean ± S.E.). D) Quantification of fold increases in surface GLUT4myc relative to NR basal in NR and p34 knockdown conditions (mean ± S.E., #p<0.05).

To illustrate that Arp2/3 functions downstream of Rac-1 to generate the dorsal

actin meshwork, we took advantage of a constitutively active Rac-GFP mutant (GFP-

CA-Rac) that remodels actin without insulin stimulation when transfected into

myoblasts. In the control of siNR-transfected cells expressing GFP-CA-Rac, distinctive

actin remodelling was observed, compared to neighboring non-transfected cells.

A) B)

C) D)

72

However, GFP-CA-Rac failed to elicit actin remodelling after Arp3 knockdown (Figure 3-

4). This result suggests that Arp2/3 is a major effector downstream of Rac governing

actin remodelling in muscle cells.

Figure 3-4: Arp2/3 functions downstream of Rac in insulin signal pathway. L6GLUT4myc myoblasts transiently expressing GFP-CA-Rac were transfected with NR or Arp3 siRNA. Following 3 h serum starvation, unstimulated cells were labelled with rhodamine-phalloidin. Representative images of 3 independent experiments are shown. Bars, 20 µm. 3.3-2: Depletion of Arp2/3 reduces insulin-mediated GLUT4 gain on the cell surface

Because inhibition of Arp2/3 function averted actin remodelling, we explored its

effect on insulin-responsive GLUT4 translocation. Following siRNA-mediated disruption

of Arp2/3 function, co-staining of surface GLUT4myc and intracellular F-actin was

applied to identify cells lacking the insulin-induced actin rearrangement and their

corresponding GLUT4myc levels on the plasma membrane. Surface GLUT4myc

showed the typical speckled distribution (162,230); that may suggest insertion into hot-

spots. These may represent specific plasma membrane domains or may correspond to

ruffled areas supported by the remodelled actin, consistent with the predominant

localization of GLUT4myc in ruffles determined by immuno-gold labeling and scanning

electron microscopy (165). Down-regulation of Arp3 did not alter the surface level of

73

GLUT4myc in the basal state, compared to control cells treated with siNR (Figure 3-2B).

In contrast, siRNA to Arp3 not only prevented insulin-mediated peripheral actin

remodelling but also significantly decreased the amount of GLUT4myc at the plasma

membrane (Figure 3-2B). Quantification of surface GLUT4myc indicated a 44%

inhibition in GLUT4 translocation after the down-regulation of Arp3 (Figure 3-2D).

Furthermore, a strong reduction (60%) was achieved by knocking down the p34 subunit

of Arp2/3 (Figure 3-3B,D). Neither Arp3 nor p34 knockdown altered the overall insulin-

stimulated Akt phosphorylation (Figure 3-5), suggesting that the Akt signalling arm of

insulin action remained intact.

Figure 3-5: Down-regulation of Arp3 or p34 does not interfere with insulin-stimulated Akt phosphorylation. L6GLUT4myc myoblasts were transfected with NR, p34, or Arp3 siRNA. Insulin (100 nM) was applied for 10 min after 3 h of serum starvation. Total cell lysates were then collected and immunoblotted for A) p34, P-Akt, actinin-1 and B) Arp3, P-Akt, actinin-1. Representative blots of 3 independent experiments are shown.

To demonstrate the specificity of Arp2/3 in GLUT4 translocation, we rescued

Arp2/3 expression by transfecting Dictyostelium discoideum Arp3-GFP, which is

resistant to siArp3 due to variance within the targeted sequence, into siArp3-treated

cells. Under this setting, insulin-stimulated actin remodelling was restored (Figure 3-

6A,B), and the deleterious effect of Arp3 down-regulation on insulin-mediated GLUT4

translocation was alleviated (Figure 3-6C). More importantly, expression of

74

Dictyostelium Arp3-GFP alone did not change the basal actin filament morphology or

surface GLUT4 in unstimulated cells, indicating that Arp2/3 only exerts its functional

action upon insulin stimulation.

Figure 3-6: Expression of Dictyostellium Arp3-GFP restores actin remodelling and GLUT4 translocation in Arp3 knockdown myoblasts. A) Dictyostellium Arp3-GFP was transiently expressed in L6GLUT4myc myoblasts transfected with NR or Arp3 siRNA. After 3 h serum starvation, cells were challenged with 100 nM insulin for 10 min. F-actin was stained with rhodamine phalloidin to indicate actin remodelling. Representative images of 4 independent experiments are shown. Bars, 20 µm. B) Quantification of changes in insulin-stimulated dorsal actin remodelling relative to siNR control (mean ± S.E.). C) Myoblasts with NR or Arp3 siRNA were transfected with/without Dictyostellium Arp3-GFP. Following serum depletion, cells were stimulated with insulin for 10 min. Surface GLUT4myc content was measured via single cell

A)

B) C)

75

detection of surface myc fluorescent intensity and quantified as fold increases over siNR basal (mean ± S.E., n=6, #p<0.05).

The fact that depletion of Arp2/3 components only altered the insulin-dependent

component of surface GLUT4 but did not change the basal levels of the transporters at

the cell membrane suggests that the constitutive recycling of GLUT4 does not require

Arp2/3 input. To establish if the effect of Arp2/3 interference is selective to GLUT4 traffic,

we examined the effect of depletion of p34 of the Arp2/3 complex on transferrin

recycling, which depends on endosome recycling. As shown in Figure 3-7, transferrin

recycling in either basal or insulin stimulated state was similar in cells treated with

siRNA to p34 as in siNR-treated cells, implying that the inhibition of Arp2/3 did not affect

the traffic of transferrin.

Figure 3-7: Knockdown of either p34 or cofilin does not alter transferrin recycling. L6GLUT4myc myoblasts were treated with NR, p34, or cofilin siRNA. Following 3 h serum starvation, to 125I-Tf recycling was determined as described in Materials and Methods, in basal and insulin stimulated conditions. Transferrin recycling is displayed as the ratio of externalized Tf over internalized Tf (mean± S.D.). n=3.

The above results indicate that Arp2/3 is required for cortical actin remodelling

and GLUT4 translocation including full exposure at the cell surface. To ascertain that the

76

effect of Arp2/3 knockdown is independent of possible changes in actin stress fibers, we

analyzed suspended myoblasts devoid of stress fibers. In this rounded-up configuration,

myoblasts show actin filaments exclusively at the cell periphery (175,187,188).

Myoblasts treated with siRNA to p34 of the Arp2/3 complex or with siNR were

suspended, stimulated with insulin and analyzed for actin remodelling and surface

GLUT4 levels. Whereas siNR-treated cells showed the habitual cortical actin

arborizations and gain in surface GLUT4 in response to insulin, sip34 treatment

markedly abolished both responses to insulin (Figure 3-8). These results suggest that it

is the cortical actin structures regulated by Arp2/3 that are required for GLUT4

translocation in response to the hormone.

Figure 3-8: Stress fiber does not contribute to the decrease in GLUT4 traffic observed in p34 knockdown. p34 knockdown abolishes cortical actin remodeling in rounded-up myoblasts and prevents gain in surface GLUT4myc in response to insulin. Bars, 10 µm. Representative of 2 independent experiments.

3.3-3: Insulin causes cofilin dephosphorylation that depends on slingshot

Actin dynamics is regulated by concerted actin polymerization and

depolymerization. In fact, a spatial/temporal burst in actin polymerization and branching,

as caused by Arp2/3, requires available sources of actin monomer, which are typically

77

provided by the continuous depolymerization of actin filaments (235,236). Hence, we

sought to identify molecules in the actin-depolymerization pathway that may respond to

insulin, which would contribute to the balance of actin dynamics. ADF/cofilin are highly

related, actin-severing and monomer-sequestering proteins, whose activity is mainly

regulated by the phosphorylation status of Ser3 (74). Phosphorylation and

dephosphorylation of ADF/cofilin leads to its inactivation and activation, respectively.

Insulin elicited ADF/cofilin dephosphorylation in cells that do not represent

metabolically-determining tissues and do not express GLUT4 (HT4 neuronal and 293T

cells) (213,237), but the function of cofilin in these cells and the metabolic

consequences of its activation were not investigated. We therefore examined whether

insulin stimulation in muscle cells alters the ADF/cofilin phosphorylation status and its

possible contribution to GLUT4 traffic. We utilized a rabbit antibody that recognizes both

ADF and cofilin-1 and their phosphorylated forms to an equal extent and cofilin-2 to a

somewhat lesser extent (214). By two-dimensional gel electrophoresis of L6 cell lysates,

we calculated the relative ratio of cofilin:ADF in L6 myoblasts to be 7:1. This approach

also revealed that about 9% of the cellular content of cofilin is phosphorylated (inactive)

in unstimulated cells, and insulin caused a 4-fold decrease in the phosphorylation of this

protein (Figure 3-9).

78

Figure 3-9: Relative percent of cofilin, ADF, phosphorylated-cofilin and phosphorylated ADF. Basal and insulin-stimulated L6GLUT4myc myoblasts were lysed and subjected to two-dimensional gel electrophoresis and assessment of ratios of ADF, cofilin and their phosphorylated versions, essentially as described in methods.

By SDS-PAGE and immunoblotting with an antibody selective to cofilin

phosphorylated on P-Ser3, phosphorylation of cofilin in unstimulated cells was also

ascertained (Figure 3-10A). Upon insulin stimulation, a reduction in the level of

phosphorylated cofilin (P-cofilin) was observed without changes in total cofilin, indicating

a shift to its active state (Figure 3-10A). This was evident as early as 3 min and was

most significant 10 min following insulin treatment (Figure 3-10B). Inhibiting PI3K with

wortmannin prevented cofilin dephosphorylation in response to insulin (not shown),

paralleling the response in 293T cells (237).

A) B)

79

Figure 3-10: Insulin stimulation in L6GLUT4myc muscle cells causes dephosphorylation of cofilin. L6GLUT4myc myoblasts were serum-starved for 3 h prior to insulin stimulation (100 nM) for the indicated time periods. A) Total lysates immunoblotted for P-cofilin, cofilin, P-Akt, actin (as loading control). Representative blot of 4. B) Quantification of insulin-dependent cofilin dephosphorylation expressed as P-Cofilin/Cofilin ratio relative to time 0 (n=4, mean ± S.E., #p<0.05). The balance of cofilin phosphorylation/dephosphorylation is primarily achieved by

the action of kinases LIMK and testicular kinase, and of the phosphatases slingshot

(SSH), chronophin (238) and to some degree PP1/PP2A (213). Because net

dephosphorylation of cofilin was observed following insulin stimulation, we examined

first the participation of the phosphatases in this response. Treatment of myoblasts with

SSH1 siRNA reduced the expression of SSH1 by 73% (Figure 3-11A). Down-regulation

of this phosphatase notably prevented the dephosphorylation of cofilin evoked by insulin

compared to the degree observed in NR siRNA controls (Figure 3-11B). This revealed

that insulin signals primarily via SSH1 to dephosphorylate cofilin, which would lead to

cofilin activation.

Figure 3-11: Insulin-induced dephosphorylation of cofilin is slingshot-dependent. A-B) Lysates from myoblasts treated with SSH1 siRNA (siSSH1) were prepared to determine the knockdown effect on SSH1 and its contribution towards insulin-induced cofilin dephosphorylation by immunoblotting for P-Cofilin.

Regarding the kinases mediating cofilin phosphorylation, LIMK is attractive since

A) B)

80

it is typically activated by phosphorylation via Rac-dependent, p21-activated-kinase

(80). Although LIMK1 knockdown did not increase the steady-state phosphorylation of

cofilin in the basal state, LIMK knockdown potentiated cofilin dephosphorylation in

response to insulin (Figure 3-12). This observation suggests that, in response to insulin,

LIMK1 may partially restore phosphorylation of cofilin, which is however more

dominantly dephosphorylated by SSH1.

Figure 3-12: Down-regulation of LIMK1 does not affect insulin-induced cofilin dephosphorylation. Lysates from myoblasts treated with LIMK1 siRNA were prepared to determine the extent of LIMK knockdown and its contribution towards insulin-induced cofilin dephosphorylation by immunoblotting for P-Cofilin. Representative blots of 3 independent experiments are shown.

3.3-4: Arp2/3-mediated actin remodelling signals to insulin-stimulated cofilin

dephosphorylation

The net effect of cofilin dephosphorylation induced by insulin suggests the

activity of SSH1 outweighed that of LIMK1. One of the possible explanations could be a

surge in the phosphatase activity of SSH1 following insulin stimulation. Indeed, addition

of F-actin to purified SSH1 markedly augments its phosphatase activity (239,240).

Analogously, the remodelled actin produced in muscle cells by insulin could serve as

the stimulus that boosts the activity of SSH1 in vivo to cause a shift towards cofilin

dephosphorylation because SSH1 accumulated at the remodelled actin following insulin

81

stimulation (Figure 3-13). This shift in localization to the peripheral remodelled actin is

insulin-dependent as SSH1 in unstimulated cells was uniformly distributed in the cytosol

(results not shown).

Figure 3-13: SSH1 redistributes to the zone of actin remodelling upon insulin stimulation. L6 myoblasts were transiently transfected with SSH1 cDNA, serum-deprived cells and stimulated with 100 nM insulin for 10 min, followed by fixation and permeabilization, to allow detection of transfected SSH1 and F-actin. Representative images of 3 independent experiments are shown. Bars, 10 µm.

Knowing that the inhibition of Arp2/3 prevented actin remodelling, we examined

this hypothesis by examining changes in P-cofilin levels upon p34 knockdown. In control

cells treated with siNR, cofilin dephosphorylation occurred normally as evident from the

decrease in P-cofilin level after 5 and 10 min of insulin stimulation (Figure 3-14A). In

contrast, and notably, this insulin-dependent decrease in the level of P-cofilin was

lacking in p34 knockdown cells (Figure 3-14A). Similar results were obtained when the

actin filament-disrupting agent LB was used to stop the formation of remodelled actin by

insulin. Under LB treatment, the dephosphorylation of cofilin by insulin was also

prevented, so that the levels of P-cofilin at 5 and 10 min of stimulation were comparable

to that of unstimulated cells (Figure 3-14B). In neither case was the ability of insulin to

signal to Akt affected. These findings support the idea that the remodelled actin

functions as a stimulus that augments the activity of SSH1 to generate the net

82

dephosphorylation of cofilin following insulin stimulation in muscle cells.

Figure 3-14: Insulin-stimulated dephosphorylation of cofilin is dependent on remodelled actin. Myoblasts were: A) transfected with p34 siRNA or B) subjected to 250 nM latrunculin B treatment for 30 min, and the effect of insulin on P-Cofilin was assessed. Representative blots of >3 independent experiments are shown. 3.3-5: Cofilin knockdown promotes F-actin accumulation and decreases insulin-

mediated GLUT4 translocation

Given that insulin activates cofilin via its dephosphorylation, it became intriguing

to explore the functional implication that cofilin has on the dynamics of insulin-

responsive actin remodelling. Immunofluorescence detection of endogenous cofilin in

myoblasts revealed its redistribution from the cytosol to the peripheral zone where actin

remodels upon insulin stimulation (Figure 3-15A). The localization of the phosphorylated

form was determined using an antibody to phosphorylated ADF/cofilin that is compatible

with immunofluorescence approaches. Co-staining of total cofilin and phosphorylated

ADF/cofilin (P-AC) revealed that insulin stimulation decreased the ratio of P-AC/cofilin at

the cell periphery/remodelled actin (by 31%, p<0.05), indicating that cofilin undergoes

dephosphorylation in response to the hormone at this region of the cell (Figure 3-

15B,C), consistent with the localization of SSH1.

A) B)

83

Figure 3-15: Cofilin is localized to the remodelled actin upon insulin stimulation. A) L6GLUT4myc myoblasts were serum-starved for 3 h and stimulated with 100 nM insulin for 10 min, followed by labeling with rhodamine-phalloidin for F-actin and cofilin specific antibody for endogenous cofilin. Representative images of 3 independent experiments are shown. Bars, 10 µm. B) Serum-starved L6 myoblasts were stimulated with or without 100 nM insulin for 10 min, followed by fixation and permeabilization. The cells were labelled for phosphorylated AC and total cofilin using specific affinity-purified antibodies. C) Areas of similar size of the cell periphery containing remodelled actin, and background areas that did not contain any cells, were selected. The fluorescence intensity in these regions from 50 basal-state and 43 insulin-stimulated cells were determined, averaged and plotted as ratio of P-AC/cofilin signal (mean ± S.E., #p<0.05).

To explore if cofilin dephosphorylation is required for insulin action on actin

dynamics and GLUT4 translocation, siRNA against cofilin was applied to achieve an

82% knockdown compared to the siNR control (Figure 3-16A). As expected from

existing literatures (241,242), down-regulation of cofilin caused a massive increase in

the level of random F-actin aggregates in the basal state and this morphological change

was scored via polymerized dorsal actin assay (Figure 3-16B,C). When challenged with

insulin, these cells displayed a further elevation in polymerized actin (Figure 3-16C),

C)

A) B)

*

84

suggesting that potentially there were still some available actin monomers to respond to

the actin polymerization cues evoked by insulin. However, this remodelled actin was

morphologically more diverse and was not confined to the cell periphery compared to

that in NR control cells stimulated by insulin (Figure 3-16B).

Figure 3-16: Down-regulation of cofilin increases F-actin aggregates and reduces insulin-induced GLUT4 translocation. A) Total lysates from myoblasts transfected with NR or cofilin siRNA were prepared and immunoblotted for cofilin and actinin-1 (loading control). Representative blots of 5 independent experiments are shown. B) Myoblasts with siNR or siCofilin were treated with/without insulin followed by co-staining of surface GLUT4myc and F-actin. Representative images of 4 independent experiments are shown. Bars, 20 µm. C) Quantification of dorsal polymerized actin relative to NR basal after cofilin knockdown (mean ± S.E.). D) Quantification of fold increases in surface GLUT4myc relative to NR basal in NR and siCofilin conditions (mean ± S.E., #p<0.05).

A)

B)

C) D)

85

Although insulin-dependent actin polymerization continued upon down-regulation

of cofilin, the visually excessive/abnormal remodelling suggests that the dynamics of F-

actin at the zone of remodelling may have been impeded. We therefore explored

whether under these conditions the insulin-dependent GLUT4 translocation was

affected. As shown in Figure 3-16 B and D, cofilin knockdown caused a major reduction

(66%) in insulin-dependent gain in surface GLUT4, yet transferrin recycling, in either

absence or presence of insulin, was not significantly disrupted (Figure 3-7). This

observation allowed us to test whether cofilin re-expression restores normal GLUT4

translocation, and if such restoration would be dependent on the phosphorylation status

of cofilin. Transfecting Xenopus cofilin-WT-GFP into myoblasts with down-regulated

cofilin expression restored the normal F-actin pattern in the basal state by eliminating

the excessive F-actin accumulation (Figure 3-17A,B). Moreover, such re-expression

also alleviated the defect in insulin-dependent GLUT4 translocation (Figure 3-17C).

Strikingly, neither the recovery of actin dynamics nor that of GLUT4 translocation was

achieved when the inactive cofilin-S3E-GFP mutant was transfected into myoblasts with

down-regulated cofilin. This mutant is unable to severe actin filaments. Overall, these

results argue that the insulin-induced increase in the severing function of cofilin is

critical for the dynamics of actin remodelling, which in turn allows proper insulin-

stimulated GLUT4 translocation to proceed.

86

Figure 3-17: Expression of Xenopus cofilin-WT-GFP, but not cofilin-S3E-GFP mutant, restores normal F-actin morphology and GLUT4 translocation. A) L6GLUT4myc myoblasts transfected with NR or cofilin siRNA were further transfected with cDNA to either GFP as control, cofilin-WT-GFP, or cofilin-S3E-GFP. Following serum starvation, F-actin was labelled with rhodamine-phalloidin in the basal state to detect changes in actin morphology. Representative images of 6 independent experiments are shown. Bars, 20 µm. B) Quantification of F-actin aggregates relative to NR+GFP basal (mean ± S.E.). C) Surface GLUT4myc levels in siCofilin-treated myoblasts cotransfected with cofilin-WT or S3E mutant expression in siCofilin myoblasts were measured by fluorescent detection of single cells and are presented as fold increases in surface GLUT4myc relative to NR basal are also shown (mean ± S.E., n=6, #p<0.05).

A)

B) C)

87

3.4: Discussion

Since muscle is the major insulin-regulated storage of blood glucose, it is

imperative to define the signalling events that promote the gain of GLUT4 at the surface

to increase glucose uptake into this tissue. In parallel to the well-established Akt-AS160

pathway (154,230), we recently showed that insulin induces a rapid activation of the

small GTPase Rac-1 that is PI3K-dependent and leads to cortical actin remodelling

(161,165,175,177). Interestingly, Rac-1 activation and actin remodelling fail in several

models of insulin resistance, such as elevated ROS and ceramide accumulation,

despite intact upstream IRS-1 phosphorylation and PI3K activation, which reinforces the

significance of the Rac-1 pathway in insulin-stimulated GLUT4 translocation

(165,177,243). Here we identify Arp2/3 as the effector downstream of Rac-1 that

promotes formation of remodelled actin, while the activity of cofilin maintains the active

turnover of actin in the remodelling zone. Disruption of either protein yielded abnormal

actin remodelling and subsequent inhibition in insulin-mediated GLUT4 translocation

(Figure 3-2, 3-3, 3-12).

3.4-1: Insulin induces concerted actin branching and severing

F-actin contributes to maintaining structural integrity, promoting cellular migration,

and aiding in vesicle traffic. In order to be functional, these cellular processes depend

on the dynamic nature of actin regulation. Cytoplasmic actin exists as monomers and

oligomerized F-actin. Uncapped F-actin undergoes constant polymerization at the

barbed ends while depolymerization occurs at the point ends to regenerate a steady

pool of monomeric actin for further rounds of polymerization (236). Such dynamic

turnover is tightly controlled by actin-modifying proteins including actin nucleating and

severing proteins (236). Arp2/3 initiates branching at 70o on existing actin filaments and

88

is firmly established in the Rac-dependent formation of lamellipodia in migrating cells

(47,244). Here we report that Arp2/3 contributes to the Rac-mediated, cortical actin

remodelling following insulin stimulation. Down-regulation of Arp2/3 through siRNA

against its Arp3 or p34 subunits abrogated insulin-induced actin remodelling, suggesting

that Arp2/3-initiated actin polymerization is responsible for the genesis of dorsally

remodelled actin in muscle cells (Figure 3-2B, 3-3B). Overexpressing Arp3-GFP did not

promote actin polymerization in the basal state (Figure 3-1), suggesting that Arp2/3

activation is tightly controlled by insulin stimulation. Conceivably, this occurs in response

to insulin-activated Rac-1 and its downstream effectors. Indeed, constitutively active

Rac caused Arp2/3-mediated actin branching (Figure 3-4).

In both L6 muscle cells (this study) and 3T3-L1 adipocytes (245), insulin caused

Arp2/3 colocalization with the peripheral remodelled actin, and cortical actin remodelling

is required for GLUT4 translocation (164-166). However, this phenomenon is

differentially regulated in both cell types, as only in the muscle cells is the insulin-

dependent actin remodelling downstream of PI3K (162,175). Moreover, the Rho-family

G proteins engaged by each cell type also differ, Rac-1 determining actin remodelling in

the muscle cells and TC10 (related to Cdc42) in adipocytes (169,175). Arp2/3 is

regulated by the nucleation promoting factors N-WASP, WAVE and cortactin (246-248),

and a dominant negative mutant of N-WASP prevented the TC10-mediated insulin-

induced actin reorganization in adipocytes (245). In contrast, WAVE, rather than N-

WASP, is the nucleating factor downstream of Rac-1 that activates Arp2/3 and its

consequent actin filament branching (247). Thus, WAVE2 may be the Arp2/3 activator in

insulin-stimulated muscle cells, a possibility worthy of future exploration.

89

Insulin also activated the actin severing protein cofilin by inducing its

dephosphorylation on Ser3 (Figure 3-10). This may be required to generate a dynamic,

rapid turnover of the branching network, and to provide a continuous supply of

monomeric actin. Because cofilin phosphorylation and dephosphorylation are governed

by LIMK1 and SSH1 respectively (75,77), we propose that insulin must activate the

phosphatase and this enzyme has a predominant effect over the kinase to produce the

net dephosphorylation (249). In muscle cells, cofilin is already phosphorylated in the

absence of stimuli (Figure 3-10), ostensibly due to a low, tonic activity of LIMK1 and a

relatively inactive SSH1. Upon insulin stimulation, cofilin undergoes SSH1-dependent

dephosphorylation (Figure 3-11). The surge in SSH1 activity may arise in response to

the formation of the cortical network of branched, polymerized actin, since F-actin

binding is required for significant phosphatase activity of SSH1 (239,240,249). This

model is supported by our observations that LB and p34 knockdown, strategies that

prevent insulin-induced actin polymerization, avert cofilin dephosphorylation (Figure 3-

14). Consistent with this scenario, SSH1 concentrated along the peripherally

remodelled actin upon insulin stimulation (Figure 3-13). Moreover, there is precedent for

F-actin tilting the balance from LIMK1 to SSH1 dominance over cofilin (250). A dynamic

interplay between LIMK1 and SSH1 likely enables spatial temporal control over cofilin

activity especially at the zone of insulin-induced actin remodelling.

3.4-2: Arp2/3 activation and cofilin dephosphorylation are required for insulin-dependent

GLUT4 translocation

A key observation of this study is that silencing two components of the Arp2/3

complex prevents GLUT4 translocation in response to insulin. This result is reminiscent

of the well-documented abrogation of GLUT4 translocation by LB in fat cells (163,164)

90

and muscle cells (161,166) in culture, and in primary adipocytes (168) and muscle

tissue (167). However, since LB inhibits actin remodelling by sequestering actin

monomers, it impedes actin polymerization not only at the cell cortex but also at the

level of stress fiber (251). Instead, disruption of Arp2/3 allowed us to assign the

selective participation of branched actin remodelling in GLUT4 translocation,

irrespective of stress fibers or other actin filament-containing structures.

When actin severing was impaired by siRNA-mediated knockdown of cofilin, actin

polymerization was extensive and widely prevalent across the cell (Figure 3-16B), and

this abnormality paralleled a reduction in insulin-dependent GLUT4 translocation (Figure

3-16D). This finding is reminiscent of the effect of jasplakinolide, an actin-stabilizing

agent that causes excessive actin aggregates resembling those produced in cells with

cofilin knockdown (252). Likewise, jasplakinolide also interferes with GLUT4 vesicle

traffic to the surface of muscle and adipose cells (164-166). All these considerations

point to the need for a dynamic, concerted actin polymerization and severing induced by

insulin and required for GLUT4 translocation. Perhaps the strongest support of this

model is the fact that the defect in GLUT4 traffic caused by cofilin knockdown was

rescued by expression of active cofilin-WT-GFP (which is amenable to phosphorylation

and dephosphorylation) but could not be restored by the expression of inactive cofilin-

S3E-GFP (Figure 3-17C). These results buttress the participation of insulin-induced,

cofilin-mediated actin depolymerization to facilitate GLUT4 translocation, and show for

the first time that cofilin dephosphorylation is essential for insulin-dependent vesicle

traffic.

3.4-3: Possible mechanisms whereby a dynamic actin network supports GLUT4 traffic

The remodelled actin filaments may act as a tether for GLUT4 vesicles close to the

91

plasma membrane, so that their subsequent docking/fusion can occur more readily

(161,165,187). Indeed, in insulin-stimulated muscle cells, GLUT4 vesicles accumulate

within the cortical actin mesh visualized by electron microscopy (165,187). GLUT4 itself

may tether to actin filaments via α-actinin-4 (188,189), and indeed upon α-actinin-4

silencing, GLUT4 vesicles do not accumulate at the muscle cell periphery and there is

no insulin-dependent gain in surface GLUT4 (188). Similarly, when actin filament

remodelling is inhibited by expressing dominant negative Rac or by LB, the enrichment

of GLUT4 beneath the plasma membrane is lost, leading to the collapse of GLUT4

vesicles back to perinuclear regions (187). It is also plausible that the remodelled actin

clusters insulin signalling molecules close to GLUT4 vesicles near the plasma

membrane (162). Although preventing actin remodelling by Arp2/3 knockdown did not

reduce the overall level of P-Akt (Figure 3-5), failure to accumulate phosphorylated Akt

near the membrane may be a factor in the loss of insulin-induced GLUT4 translocation

(253-256).

On the other hand, actin polymerization is abundant in cells with down-regulated

cofilin yet the resulting polymerized actin filaments seem morphologically distinct and

disseminated across the cell (Figure 3-16B). We speculate that, in this case, the

impaired gain in surface GLUT4 is due to vesicle retention in a static mesh that no

longer undergoes severing. By analogy, in neuronal cells, thick patches of

submembrane F-actin present at rest act as a barrier to inhibit basal exocytosis of

neurotransmitters (257). In cells with down-regulated cofilin, the imbalance in dynamic

cycles of actin depolymerization and branching may lead to uncoordinated growth of

‘static’ actin filaments that could similarly turn into a barrier for GLUT4 vesicles,

92

preventing them from gaining access to interaction with membrane SNAREs required

for fusion (187).

We propose a model (Figure 3-18) whereby insulin stimulation leads to Arp2/3

activation downstream of Rac that initiates dorsal actin polymerization. The increase in

polymerized actin stimulates the phosphatase activity of SSH1, leading to cofilin

dephosphorylation and consequential increase in its severing action. Active actin

depolymerization by cofilin can then free up actin monomers for Arp2/3-dependent

polymerization and a dynamic actin turnover of insulin-stimulated actin remodelling is

achieved. This dynamic status must be sustained to allow GLUT4 vesicle positioning

and proper interaction with elements of the vesicle fusion machinery. This framework

will allow testing the fidelity of its individual steps during insulin resistance, and may

reveal so far unsuspected steps that may be altered in this condition.

Figure 3-18. Proposed mechanism of insulin-regulated actin dynamics in muscle cells. Insulin stimulation in muscle cells promotes dynamic actin remodelling. The formation of the remodelled actin is achieved by the polymerization activity of Arp2/3 acting downstream of active Rac. The accumulation of polymerized F-actin poses a stimulatory factor in the phosphatase activity of SSH, which leads to net dephosphorylation and activation of cofilin. Hereon, the actin severing function of cofilin

93

maintains the flexibility of remodelled actin and enables regeneration of free monomeric actin for further polymerization. This active cycling of actin mediated by insulin keeps proper actin dynamics at the cortical zone in order to facilitate GLUT4 insertion onto the cellular surface.

94

CHAPTER 4: Rac-1 superactivation triggers insulin-independent GLUT4

translocation that bypasses signalling defects exerted by JNK- and ceramide-

induced insulin resistance

Tim Ting Chiu‡,§, Yi Sun‡, Alexandra Koshkina‡, and Amira Klip‡,§,1

‡Program in Cell Biology, The Hospital for Sick Children, Toronto, ON, Canada, M5G

1X8

§Department of Biochemistry, University of Toronto, Toronto, ON, Canada, M5S 1A8

This research was originally published in J. Biol. Chem. 2013 Jun 14;288(24):17520-31.

© the American Society for Biochemistry and Molecular Biology

95

4.1: Abstract

Insulin activates a cascade of signalling molecules, including Rac-1, Akt, and

AS160, to promote the net gain of GLUT4 at the plasma membrane of muscle cells.

Interestingly, constitutively active Rac-1 expression results in a hormone-independent

increase in surface GLUT4, yet the molecular mechanism and significance behind this

effect remains unresolved. Using L6 myoblasts stably expressing myc-tagged GLUT4,

we found that overexpression of constitutively active, but not wild type Rac-1, sufficed to

drive GLUT4 translocation to the membrane, of comparable magnitude to that elicited

by insulin. Stimulation of endogenous Rac-1 by Tiam1 overexpression elicited a similar

hormone-independent gain in surface GLUT4. This effect on GLUT4 traffic could also

be reproduced by acutely activating a Rac-1 construct via rapamycin-mediated

heterodimerization. Strategies triggering Rac-1 ‘superactivation’ (i.e., to levels above

those attained by insulin alone) produced a modest gain in plasma membrane PI(3,4,5)P3,

moderate Akt activation and substantial AS160 phosphorylation, which translated into

GLUT4 translocation and negated the requirement for IRS-1. This unique signalling

capacity exerted by Rac-1 superactivation bypassed the defects imposed by JNK- and

ceramide-induced insulin resistance and allowed full and partial restoration of GLUT4

translocation response, respectively. We propose that potent elevation of Rac-1

activation alone suffices to drive insulin-independent GLUT4 translocation in muscle

cells, and such strategy might be exploited to bypass signalling defects during insulin

resistance.

96

4.2: Introduction

Insulin-stimulated glucose uptake into skeletal muscle is a major determinant of

whole body glucose homeostasis, as muscle is the primary tissue responsible for the

vast majority of dietary glucose disposition (258). Insulin binding to its receptor at the

muscle cell surface initiates a complex signalling cascade leading to the net recruitment

of GLUT4-containing vesicles from an intracellular compartment to the plasma

membrane (142). Identifying the full complement of insulin-triggered signals regulating

GLUT4 translocation in muscle could provide a valuable asset in overcoming defects

that lead to insulin resistance and its consequent type 2 diabetes.

In L6 muscle cells in culture, the first post-receptor event leading to GLUT4

translocation is the selective tyrosine phosphorylation of IRS-1 (145) with consequent

activation of PI3K to elevate membrane PI(3,4,5)P3 (162,210). Downstream of PI3K,

insulin signalling in muscle cells bifurcates into two independent pathways,

characterized, respectively, by activation of the serine/threonine kinase Akt and the

Rho-family GTPase Rac-1 (147,175,177). Akt in turn phosphorylates the protein AS160

to inhibit its GAP activity towards Rab GTPases (154,230,259). This enables the

activation (GTP-loading) of Rabs 8A and 13 to prevail and provide mobilization cues for

GLUT4 vesicle delivery to the muscle cell plasma membrane (156,157). The other

signalling arm involves PI3K-dependent Rac-1 activation (GTP-loading) that triggers a

cycle of branching and severing of cortical actin filaments (260). The resulting cortical

mesh of branched actin filaments may serve as a tether for both signalling molecules

and GLUT4 vesicles (162,177,187,188,260). Activation of Rac-1 is thought to depend

on either activation of dedicated GEFs and/or inhibition of dedicated GAPs (180,261).

97

In vivo, muscle Akt is readily activated in response to insulin, and Akt-2 gene

knockout mice show reduced insulin-dependent glucose uptake into muscle (151).

Similarly, recent studies show that insulin activates Rac-1 in mouse muscle, and mice

with muscle-specific Rac-1 gene deletion have diminished insulin-dependent GLUT4

translocation and glucose uptake (178,179). The latter results parallel observations of

abated GLUT4 translocation in L6 muscle cells in culture depleted of Rac-1 via siRNA-

dependent gene silencing (177).

Importantly, both Akt and Rac-1 are required for proper insulin-induced GLUT4

translocation, as overexpressing dominant-negative mutants of each one or silencing

their endogenous gene expression, impair the insulin response of GLUT4 without

mutually inhibiting one another (147,161,177). In spite of this apparent independence of

the Akt and Rac-1 signalling arms, overexpression of constitutively active Rac-1 in

muscle cells increases surface GLUT4 (181), though the molecular underpinnings are

unknown. Here, we build on that observation and unravel the signalling mechanism.

Using acute (rapamycin-inducible) and chronic modalities of Rac-1 superactivation (i.e.,

activation surpassing the activation levels caused by insulin), including activation of a

Rac-specific GEF, Tiam1, we achieved an insulin-comparable GLUT4 translocation

response without input from insulin. Unexpectedly, this hormone-independent Rac-1

activation generated a modest increase in membrane-associated PI(3,4,5)P3 that in turn

caused mild Akt phosphorylation. Downstream signalling was amplified, achieving

substantial AS160 phosphorylation and GLUT4 translocation. Rac-1 superactivation

bypassed the requirement for IRS-1 phosphorylation. Finally, we show that Rac-1

superactivation relieves the GLUT4 traffic defect imposed by two strategies that cause

98

insulin resistance: activation of the stress kinase JNK and ceramide exposure. Hence,

Rac-1 is mechanistically identified as a viable target for the treatment of insulin

resistance in a cellular model. By crossover activation of Akt, Rac-1 activation enacts

the full complement of insulin-derived distal responses that mobilize GLUT4 in muscle

cells, independently of IRS-1 participation.

99

4.3: Results

4.3-1: Rac-1 activation via overexpression of GFP-CA-Rac or Tiam1-GFP induces a

gain in surface GLUT4 independent of insulin

We first verified that elevating Rac-1 activity would raise GLUT4 surface levels.

L6 myoblasts stably expressing myc-tagged GLUT4 (L6-GLUT4myc) were transiently

transfected with wild-type (WT)- or constitutively active (CA)-Rac-GFP. In control L6-

GLUT4myc cells, GFP expression alone did not change the basal surface GLUT4 level

while insulin stimulation enhanced it by 2.2-fold (Figure 4-1A,B). GFP-WT-Rac

overexpression did not alter surface GLUT4 levels compared to GFP-expressing control

cells (Figure 4-1A,B). However, when GFP-CA-Rac was introduced, surface GLUT4

was significantly higher compared to that in neighbouring untransfected cells (Figure 4-

1A). The 2.4-fold increase in basal surface GLUT4 elicited by GFP-CA-Rac

overexpression was similar to that caused by insulin stimulation in the GFP-expressing

controls (Figure 4-1B). Addition of insulin to GFP-CA-Rac expressing cells did not cause

a further enhancement in surface GLUT4 compared to the already augmented amount

detected in the absence of insulin (Figure 4-1A,B).

A) B)

100

Figure 4-1: Overexpression of GFP-CA-Rac stimulates GLUT4 translocation in muscle cells. A-B) GLUT4myc myoblasts were transfected with GFP, GFP-WT-Rac, or GFP-CA-Rac followed by stimulation with insulin for 10 min or left untreated to measure changes in surface GLUT4myc and quantified relative to GFP basal (mean ± SE, *p<0.05). Representative images of 3 independent experiments are shown. Bar = 10 µm.

This gain in surface GLUT4 was specific to active Rac-1 because neither the

overexpression of WT-Cdc42 nor CA-Cdc42, a closely related Rho-GTPase, raised

surface GLUT4 compared to the level observed with CA-Rac overexpression (Figure 4-

2A-B). More importantly, transient overexpression of GFP-CA-Rac did not alter the total

amount of cellular GLUT4myc compared to the GFP controls (Figure 4-2C), which

eliminates the possibility of elevated GLUT4myc expression contributing to the

heightened surface GLUT4 level observed in GFP-CA-Rac expressing cells.

A) B)

C)

101

Figure 4-2: Overexpression of WT- or CA-Cdc42 does not produce an insulin-like increase in surface GLUT4 and GFP-CA-Rac expression does not change total GLUT4myc levels. A-B) GLUT4myc myoblasts were transfected with CFP, CFP-WT-Cdc42, or CFP-CA-Cdc42 followed by measurement of basal surface GLUT4 and quantified relative to CFP-expressing, unstimulated controls (basal) (mean ± SE, *p<0.05). Representative images of 3 independent experiments are shown. Bar = 10 µm. C) Total GLUT4myc in cells expressing GFP or GFP-CA-Rac was measured as described, and quantified relative to the levels in GFP-expressing control cells (mean ± SE). (n=3).

To validate the effect of transiently transfected GFP-CA-Rac, we activated

endogenous Rac-1 through overexpression of a Rac-specific GEF, Tiam1 (262). As

shown in the literature (263), in the absence of growth factor stimulation, Tiam1-GFP

overexpression generated F-actin rich ruffles that resembled those evoked by GFP-CA-

Rac, suggesting that the endogenous Rac-1 was activated in Tiam1 overexpressing

cells (Figure 4-3A). Surface GLUT4 levels were significantly higher in Tiam1

overexpressing cells compared to GFP-expressing or untransfected cells (Figure 4-3B).

The net gain in GLUT4 at the plasma membrane was again similar to the increase

induced by insulin in GFP-expressing controls (Figure 4-3C). These results mirrored the

data obtained in CA-Rac expressing cells, reinforcing the observation that potent

activation of Rac-1 alone exerts a full, insulin-like response on GLUT4 traffic to the

plasma membrane.

102

Figure 4-3: Overexpression of Tiam1-GFP induced Rac-1 activation and GLUT4 translocation in muscle cells. A) Myoblasts transfected with GFP, GFP-CA-Rac or Tiam1-GFP were permeabilized and stained with rhodamine phalloidin to visualize changes in F-actin. B-C) GLUT4myc myoblasts expressing GFP or Tiam1-GFP were stimulated with insulin for 10 min or left untreated followed by staining for surface GLUT4myc and quantification relative to GFP basal (mean ± SE, *p<0.05). Representative images of 3 independent experiments are shown. Bar = 10 µm.

To compare the level of Rac-1 activation achieved by insulin stimulation and

GFP-CA-Rac overexpression, we analyzed the amount of GTP-loaded Rac in WT- or

GFP-CA-Rac expressing myoblasts stimulated with or without insulin. GFP-WT-Rac

overexpressing cells exhibited an increase in Rac-1 activation following 10 min of insulin

stimulation (Figure 4-4). However, the level of GTP-loaded Rac-1 evoked by insulin was

much lower compared to that in myoblasts overexpressing GFP-CA-Rac. Therefore, the

effect achieved by GFP-CA-Rac expression in myoblasts can comparatively be

C)

A) B)

103

considered to be a Rac-1 superactivation, and this term is adopted throughout this

manuscript.

Figure 4-4. Insulin stimulated Rac-1 activation is much lower than Rac-1 activation from CA-Rac expression. GLUT4myc myoblasts were transfected with WT- or GFP-CA-Rac, then stimulated with/without insulin for 10 min, followed by assaying Rac-1 activation using the pulldown assay. Pulled down GTP-Rac was detected with anti-GFP antibody.

4.3-2: Acute activation of Rac-1 is also capable of eliciting an insulin-like increase in

basal surface GLUT4

While overexpression of CA-Rac and Tiam1 served as good models of activating

Rac-1 alone, their effects more closely resembled the consequence of a “chronic” Rac-1

activity in the span of 24h post-transfection. In contrast, insulin induces GTP loading of

Rac-1 within 1 min of addition and promotes maximal activation by 10 min (175,176).

Therefore, to explore if the gain in basal surface GLUT4 observed with chronic Rac-1

activation would be recapitulated in an acute manner, we took advantage of a

rapamycin-inducible heterodimerization system (264). The cell permeating rapamycin

has high affinity towards the FK506-binding protein (FKBP), that within cells interacts

tightly with the FRB domain of the protein kinase FRAP. Based on this principle, upon

addition of rapamycin, a synthetic construct consisting of the protein of interest fused to

104

FKBP can be rapidly recruited to FRB. FRB can further be localized to the plasma

membrane via a genetically engineered targeting sequence of Lyn kinase. Because

active Rac-1 is normally localized to the plasma membrane due to prenylation of its C-

terminal CAAX motif (265,266), the rapamycin-inducible strategy can be used to

investigate acute Rac-1 activation by either a) replacing the C-terminal CAAX motif on

CA-Rac with FKBP so that it remains cytosolic until recruited to the membrane by

rapamycin, or b) generating an FKBP-chimeric protein containing the DH-PH domain of

Tiam1 (domain required for the GEF activity towards Rac) (216). Using these two

approaches to also eliminate any possible confounding effect arisen from the 24h GFP-

CA-Rac expression, we investigated the effect of acute Rac-1 activation on GLUT4

traffic.

As proof of principle, we first examined whether co-expression of Lyn-FRB and

YFP-tagged FKBP (YF) constructs would allow recruitment of YF to the plasma

membrane upon the addition of rapamycin. In rounded-up myoblasts, which retain

signalling capability but also provide improved spatial resolution compared to adhered

cells (187), YF remained cytosolic in DMSO-treated control (Figure 4-5). In contrast,

after 10 min of rapamycin treatment, the YF signal began to redistribute to the plasma

membrane while cells without Lyn-FRB co-expression did not display this membrane

recruitment (Figure 4-5). Similar rapamycin-triggered movement to the periphery was

observed with either YF-CA-Rac lacking the CAAX motif (YF-CA-Rac) or a YF-linked

DH-PH domain of Tiam1 (YF-Tiam1) co-expressed with Lyn-FRB (Figure 4-5).

105

Figure 4-5: Rapamycin triggers the redistribution of YF-probes towards the Lyn-FRB at the plasma membrane. YF, YF-CA-Rac, or YF-Tiam1 were co-transfected with/without Lyn-FRB in myoblasts. Cells were treated with/without rapamycin for 10 min followed by: A) rounded-up assay and detecting the redistribution of the YFP signal. Representative images of 3 independent experiments are shown. Bar = 10 µm.

To ascertain that Rac-1 activation only occurred after rapamycin-triggered

recruitment of YF-CA-Rac and YF-Tiam1 to the plasma membrane, we probed for the

characteristic Rac-mediated membrane ruffles (262). In DMSO-containing controls,

neither YF-CA-Rac nor YF-Tiam1 expression generated membrane ruffling (Figure 4-

6A). However, upon rapamycin addition (10 min), cells displayed extensive actin

remodelling, evinced by the accumulation of phalloidin-decorated F-actin at sites of

membrane ruffles (Figure 4-6A). On the contrary, rapamycin did not cause actin

rearrangement in myoblasts expressing YF or YF-DN-Rac with Lyn-FRB (Figure 4-6B).

Despite YF-CA-Rac being mostly concentrated in the nucleus due to the absence of

prenylation and the presence of a nuclear localization sequence at the C-terminus of

Rac-1, the addition of rapamycin was still able to mobilize it towards the plasma

membrane to initiate actin remodelling (Figure 4-5, 4-6) These results demonstrate the

ability of rapamycin to selectively trigger acute Rac-1 activation in myoblasts by

106

recruiting YF-CA-Rac and YF-Tiam1 to the plasma membrane when co-expressed with

Lyn-FRB.

Figure 4-6: Co-transfection of Lyn-FRB and YF-CA-Rac or YF-Tiam1 allows rapamycin-inducible actin remodelling. A-B) YF, YF-CA-Rac, YF-DN-Rac, or YF-Tiam1 were co-transfected with/without Lyn-FRB in myoblasts. Cells were treated with/without rapamycin for 10 min followed by permeabilization and staining with rhodamine phalloidin to measure changes in F-actin. Representative images of 3 independent experiments are shown. Bar = 10 µm.

Utilizing this rapamycin-inducible Rac-1 activation strategy, we examined the

changes in surface GLUT4 following 10 min of acute Rac-1 activation. As shown in

Figure 4-7, expression of YF-CA-Rac did not alter the amount of surface GLUT4

detected in the DMSO-containing control. However, upon 10 min of rapamycin

treatment, which provided a surge in Rac-1 activity, the corresponding surface GLUT4

was significantly elevated compared to neighboring untransfected cells. This gain in

surface GLUT4 was also reproduced by expressing YF-Tiam1 in myoblasts to turn on

endogenous Rac-1 following rapamycin treatment, while YF-expressing controls failed

to exert any change in GLUT4 at the plasma membrane (Figure 4-7B). Interestingly, the

rapamycin-triggered elevation in surface GLUT4 achieved in cells with YF-CA-Rac or

YF-Tiam1 was comparable to that observed in YFP controls after insulin stimulation

B) A)

107

(Figure 4-7A,B). These data suggested that, similar to the overexpression of GFP-CA-

Rac (Figure 4-1), acute Rac-1 activation was sufficient to drive an insulin-like response

on GLUT4 translocation.

A)

B)

108

Figure 4-7: Rapamycin triggers GLUT4 translocation in muscle cells when co-expressed with Lyn-FRB and YF-CA-Rac or YF-Tiam1. A-B) YF, YF-CA-Rac, or YF-Tiam1 were co-transfected with/without Lyn-FRB in myoblasts. Cells were treated with/without rapamycin for 10 min followed by measurement of surface GLUT4myc. Changes were compared to those in YFP-expressing myoblasts stimulated with/without insulin and quantified relative to the YFP basal signal (mean ± SE, *p<0.05). Representative images of 3 independent experiments are shown. Bar = 10 µm.

4.3-3: Rac-1 superactivation signals through PI3K, Akt and AS160 to increase surface

GLUT4

Because Akt activation is a prerequisite for insulin-dependent GLUT4

translocation, we were surprised that Rac-1 superactivation would cause GLUT4

translocation, as in response to insulin both signals appear to dissociate downstream of

PI3K (147,177). Hence, we hypothesized that Rac-1 superactivation might potentially

exert signalling cues to Akt and/or to the upstream canonical insulin signalling

molecules IRS-1 and PI3K. To start, we analyzed whether IRS-1 is tyrosine

phosphorylated upon Rac-1 superactivation. For these experiments, we used the

chronic, sustained active Rac-1 approach. Myoblasts were co-transfected with HA-

tagged IRS-1 and GFP-CA-Rac (or GFP as control), then IRS-1 was

immunoprecipitated via its HA epitope and the corresponding level of P-tyr (pY) was

examined with anti-pY antibody. When GFP was co-expressed with HA-IRS-1, the basal

level of pY was negligible while insulin stimulation visibly enhanced pY in IRS-1 (Figure

4-8). IRS-1 immunoprecipitated from myoblasts expressing GFP-CA-Rac did not show

any increase in pY compared to the basal amount in GFP-expressing controls (Figure 4-

8), implying that IRS-1 is not engaged by Rac-1 activation.

109

Figure 4-8: Overexpression of GFP-CA-Rac does not cause tyrosine phosphorylation of IRS-1. HA-IRS-1 was co-transfected with GFP or GFP-CA-Rac before stimulating myoblasts with/without insulin for 10 min, followed by immunoprecipitation using anti-HA antibody. Immunoprecipitates were stained with anti-P-tyr antibody to detect phosphorylation of IRS-1. Representative images of 3 independent experiments are shown.

Next we evaluated whether GFP-CA-Rac would increase the levels of PI(3,4,5)P3

at the plasma membrane, as an index of PI3K activation. Changes in PI(3,4,5)P3 at the

cell periphery were assessed by transfecting a PI(3,4,5)P3 -reporter constituted by the PH

domain of Akt linked to RFP (PH-Akt-RFP) (267) and imaging rounded-up myoblasts. In

unstimulated cells expressing GFP, the PI(3,4,5)P3-reporter remained mostly cytosolic

and only a faint peripheral signal was observed (Figure 4-9A). Upon insulin stimulation,

the signal at the plasma membrane was clearly evident, corroborating that the hormone

triggers PI(3,4,5)P3 production (Figure 4-9A). When PH-Akt-RFP was co-expressed with

GFP-WT-Rac, its distribution pattern was similar to that displayed in unstimulated cells

expressing GFP (Figure 4-9A). Notably, however, expression of GFP-CA-Rac caused a

clear redistribution of PH-Akt-RFP towards the plasma membrane, albeit lower than that

caused by insulin (Figure 4-9A). This enrichment of PH-Akt-RFP at the membrane was

not due to the increase in membrane folding caused by Rac-dependent actin

reorganization because co-expression of RFP alone with GFP-CA-Rac failed to exhibit

a similar reporter accumulation (Figure 4-9C). Assessment of the ratio of the PH-Akt-

110

RFP signal at the plasma membrane over the cytosolic signal (PM/cyto) in each

condition revealed that Rac-1 superactivation via GFP-CA-Rac expression elevated

PI(3,4,5)P3 production to approximately 20% of the maximal insulin response while GFP-

WT-Rac had no effect (Figure 4-9B).

Figure 4-9: Overexpression of GFP-CA-Rac causes the redistribution of PH-Akt-RFP to the plasma membrane. A-B) PH-Akt-RFP was co-expressed along with GFP, GFP-WT-Rac, or GFP-CA-Rac. Rounded-up myoblasts were generated and stimulated for 10 min with/without insulin, following which the redistribution of the PH-Akt-RFP to the membrane was determined. PM/Cyto ratio of RFP in each condition was quantified and is expressed relative to the % of the parallel, maximal insulin response, in units normalized to GFP-expressing control cells. C) Myoblasts were co-transfected with GFP-CA-Rac and RFP. Myoblasts were rounded-up and used to visualize the distribution of RFP signal. Representative images of 3 independent experiments are shown. Bar = 10 µm. (mean ± SE).

The small gain in PI(3,4,5)P3 in cells with increased Rac-1 activity served as a

potential gateway to study Akt activation. Thus, using myoblasts co-expressing HA-Akt

and either the GFP, GFP-WT-Rac or GFP-CA-Rac, we investigated the activation status

C)

A) B)

111

of Akt by probing for phosphorylation at the Thr308 and Ser473 sites necessary for

functional Akt (149,150,268). As expected, insulin stimulation significantly increased the

phosphorylation of Akt at Thr308 and Ser473 compared to unstimulated cells co-

expressing GFP (control) (Figure 4-10A). When GFP-CA-Rac was co-expressed, in the

absence of insulin, the phosphorylation of Thr308 and Ser473 was elevated to 26% and

62%, respectively, of the maximal insulin response measured in parallel (Figure 4-

10A,B,C). In contrast, expression of GFP-WT-Rac also induced a 35% enhancement in

Ser473 phosphorylation relative to the maximal action of insulin, but with little if any gain

in Thr308 phosphorylation (Figure 4-10A,B,C).

Figure 4-10: Overexpression of GFP-CA-Rac induces a modest gain in Akt phosphorylation. A-C) Myoblasts expressing HA-Akt + GFP, GFP-WT-Rac, or GFP-CA-Rac were stimulated with/without insulin for 10 min before immunoprecipitation with HA antibody. Immunoprecipitates were analyzed for p-Akt using anti-p-Thr308 or p-Ser473 antibodies. Changes in P-Akt/total HA-Akt in each condition were quantified and are presented as % of the parallel, maximal insulin response, in units normalized to the GFP-expressing control. Representative images of 3-4 independent experiments are shown. (mean ± SE).

To ascertain whether the Rac-driven PI3K and Akt participate in the insulin-

independent GLUT4 translocation caused by Rac-1 superactivation, we examined the

A) B) C)

112

ability of wortmannin (WM) and Akt inhibitor 1/2 (Akti1/2) to interfere with this response.

For these experiments, we used the acute Rac-1 superactivation assay (rapamycin-

triggered) to avoid confounding effects of prolonged action of inhibitors. As shown in

Figure 4-11, pretreatment of myoblasts with WM or Akti1/2 lowered the effectiveness of

rapamycin-induced acute Rac-1 superactivation to elicit the increase in surface GLUT4

by 58% and 40%, respectively. On the contrary, pretreatment with compound C (CC), at

concentration previously shown to prevent AMPK activity (269), did not alter the

rapamycin-triggered response, which suggests that AMPK does not participate in the

Rac-1 superactivation-mediated GLUT4 translocation (Figure 4-11). In parallel, we

assessed the effect of LB to explore if actin dynamics is required for acute Rac-1

superactivation to increase surface GLUT4. Figure 4-11 illustrates that, indeed, LB

significantly reduced the GLUT4 response, showing that, as in the case of insulin

stimulation, actin dynamics is an obligated component of Rac-1 superactivation-driven

elevation in surface GLUT4 (165,166).

Figure 4-11: Inhibition of PI3K, Akt, and actin remodelling by inhibitors impair the Rac-1 superactivation-driven GLUT4 translocation response. GLUT4myc myoblasts transfected with Lyn-FRB + YF-CA-Rac were pretreated with DMSO, 100nM WM, 10µM Akti1/2, 200nM LB, or 10µM CC for 20 or 30 min (Akti1/2 and CC) followed by 10 min rapamycin treatment in the presence of inhibitors. The changes in surface GLUT4myc

113

were quantified and illustrated as % of the maximal rapamycin-induced response, relative to DMSO-treated control cells. (mean ± SE, *p<0.05 vs DMSO). Representative images of 3-4 independent experiments are shown.

It is well documented that submaximal Akt phosphorylation is sufficient to

transmit downstream responses, and that there is amplification in the Akt pathway

leading to GLUT4 translocation (147,208,209,270). We therefore explored whether the

modest increase in Akt phosphorylation caused by GFP-CA-Rac sufficed to propagate

the signal down to AS160, an essential component for the net gain of surface GLUT4 in

response to insulin. When FLAG-AS160 was co-expressed with GFP (control), insulin

promoted AS160 phosphorylation as detected by the increase in reactivity with PAS

(anti-phospho Akt substrate antibody) (Figure 4-12A). This gain did not occur in

unstimulated cells co-expressing GFP-WT-Rac and FLAG-AS160, whereas a

substantial FLAG-AS160 phosphorylation, equivalent to 70% of the maximal insulin

response, was observed in cells expressing GFP-CA-Rac (Figure 4-12A,B).

Figure 4-12: AS160 is phosphorylated upon GFP-CA-Rac overexpression and is required for the Rac-1-induced gain in surface GLUT4. A-B) FLAG-AS160 was co-expressed with GFP, GFP-WT-Rac, or GFP-CA-Rac before immunoprecipitation with anti-FLAG antibody. Immunoprecipitates were stained with PAS antibody to detect changes in AS160 phosphorylation. The intensity of PAS/total FLAG-AS160 in each condition was quantified and is depicted as % of the parallel, maximal insulin response, in units normalized to the GFP-expressing control. (mean ± SE). Representative images of 3 independent experiments are shown.

B) A)

114

Finally, we explored the participation of AS160 in the response of GLUT4 to Rac-

1 superactivation. As previously observed (154,230), overexpression of the AS160-4A

mutant, with mutations in four key residues normally phosphorylated by Akt in response

to insulin, dampened the insulin-stimulated elevation in surface GLUT4 in control cells

(co-expressing GFP) (Figure 4-13A,B). However, the AS160-4A mutant co-expressed

with GFP-CA-Rac, prevented the characteristic gain in surface GLUT4 exerted by Rac-1

superactivation (Figure 4-13A,B). In fact, AS160-4A had a quantitatively similar effect on

the response of GLUT4 to either insulin or Rac-1 superactivation (achieving only 37%

and 30% increases in surface GLUT4, respectively) (Figure 4-13B). Collectively, these

results substantiate the involvement of PI3K, Akt and AS160 in Rac-1 superactivation-

driven GLUT4 translocation.

115

Figure 4-13: Overexpression of FLAG-AS160-4A blocks the GLUT4 translocation induced by CA-Rac. A-B) FLAG-AS160-4A was co-transfected with GFP or GFP-CA-Rac followed by stimulation with/without insulin to measure changes in surface GLUT4. Quantification of each condition is presented as % of the parallel, maximal insulin response, normalized to GFP-expressing insulin-stimulated cells. (mean ± SE, *p<0.05). Representative images of 3 independent experiments are shown. Bar = 10 µm.

4.3-4: Rac-1 superactivation relieves defective GLUT4 translocation imposed by JNK

and ceramide

A)

B)

116

Insulin resistance of muscle and of muscle cells is typified by a lower GLUT4

translocation in response to the hormone, consequently reducing glucose uptake

(271,272). During high-fat feeding, muscle insulin resistance involves the gain in lipids

and their derivatives, with resulting activation stress kinases such as JNK that in turn

interfere with IRS-1 tyrosine phosphorylation. In particular, JNK activation causes IRS-1

phosphorylation at Ser307, thereby functionally uncoupling IRS-1 from the insulin

receptor and promoting IRS-1 degradation (217,273,274). Because the GLUT4

translocation elicited by Rac-1 superactivation illustrated above bypasses a requirement

for IRS-1, we hypothesized that this feature might be utilized to restore defective insulin

downstream of IRS-1. We therefore reconstituted the JNK-mediated insulin resistance

in myoblasts by overexpressing a constitutively active JNK construct (FLAG-CA-JNK)

recently shown to cause insulin resistance in vivo due to aborted signalling at the level

of IRS-1 (217). As a proof of principle, co-expression of FLAG-CA-JNK and HA-IRS-1

significantly reduced the total level of HA-IRS-1 and enhanced the relative amount of

IRS-1 phosphorylation of Ser307 (Figure 4-14A). Under these conditions, FLAG-CA-

JNK significantly lowered the insulin-induced gain in surface GLUT4, attesting to the

establishment of insulin resistance (Figure 4-14B,C). Notably, however, FLAG-CA-JNK

did not prevent the gain in surface GLUT4 elicited by GFP-CA-Rac (Figure 4-14B,C).

This observation suggests that the signalling components responsible for Rac-1

superactivation-driven GLUT4 translocation are not hindered by active JNK. Hence,

Rac-1 superactivation is not susceptible to inhibition by insults causing insulin

resistance at the level of IRS-1.

117

Figure 4-14: Rac-1 superactivation triggers GLUT4 translocation response that bypasses the signal defects exerted by CA-JNK. A) HA-IRS-1 was co-transfected with FLAG or FLAG-CA-JNK followed by immunoprecipitation with HA antibody to detect changes in Ser307 phosphorylation and degradation of IRS-1. B-C) GLUT4myc myoblasts co-expressed with FLAG-CA-JNK + GFP or GFP-CA-Rac were stimulated with/without insulin followed by surface GLUT4 staining. Surface GLUT4myc in each condition was quantified and is presented as % of the maximal, parallel insulin response, normalized to GFP-expressing, insulin-stimulated cells. (mean ± SE, *p<0.05). Representative images of 3 independent experiments are shown. Bar = 10 µm.

C)

A)

B)

118

We and others have previously shown that insulin resistance can also arise as a

result of intracellular ceramide accumulation (whether exogenously supplied or driven

by excess saturated fatty acids), and such insulin resistance involves signalling steps

downstream of IRS-1 (177,275,276). Delivery of cell permeating C2-ceramide has been

used to recapitulate this model of lipotoxic insulin resistance. C2-ceramide reduces the

insulin-induced activation of both Akt and Rac-1 (177,275,276). To investigate the

susceptibility of the Rac-induced GLUT4 translocation to C2-ceramide, we pre-treated

myoblasts with C2-ceramide before subjecting them to acute Rac-1 superactivation.

Unlike the DMSO-containing YF control, whose insulin-mediated GLUT4 translocation

significantly dropped to 21% with C2-ceramide treatment, Rac-1-induced GLUT4 gain at

the membrane was far less affected, as the response was still 71% of the maximal

attainable response (Figure 4-15). Presumably, Rac-1 superactivation allowed for

sufficient Rac-1 and Akt activity to drive a partial GLUT4 translocation, even in the

presence of C2-ceramide. We surmise that Rac-1 superactivation may be a principle to

be applied in the future to counteract, at least in part, the defective GLUT4 traffic

imposed by excess lipid supply.

119

Figure 4-15: Rac-1 superactivation partially restores the C2-ceramide-induced GLUT4 traffic defect. GLUT4myc myoblasts co-expressing Lyn-FRB + YF or YF-CA-Rac were pretreated with DMSO or 50µM C2-ceramide (C2) for 2h followed by treatment with/without insulin or rapamycin before staining for surface GLUT4. Results in each condition were quantified and are represented as % of the maximal, parallel insulin response relative to DMSO-treated, YF-expressing insulin-stimulated cells. (mean ± SE, *p<0.05). n=3.

120

4.4: Discussion

In response to insulin, Rac-1 acts in concert with the Akt AS160 signalling

cascade to enact the net mobilization of GLUT4 vesicles to the plasma membrane of

muscle cells. It is proposed that Rac-mediated actin remodelling results in a dynamic

submembrane tether that enriches GLUT4 vesicles and signalling molecules for

subsequent fusion (162,177,187,188). Only a fraction of the total cellular Rac-1

complement is activated in response to insulin, based on the comparison of Rac-GTP

pulled down from cells expressing WT-Rac and CA-Rac (Figure 4-4), or from the

comparison of the level of Rac-1 activation in insulin stimulated cells vs GTPγS-treated

lysates (175). While the AktAS160 and the Rac-1actin arms of insulin signalling

operate independently of each other, supported by the inability of Rac-1 knockdown and

Akti1/2 to inhibit respective Akt phosphorylation (177) and Rac-1 activation (Figure 4-

16), it has been reported that overexpression of constitutively active Rac-1 can promote

GLUT4 translocation (181). However, the underpinning molecular mechanism was not

explored, and this question prompted the present study.

Figure 4-16: Akti1/2 does not affect insulin-stimulated Rac-1 activation. Myoblasts were pretreated with DMSO or 10µM Akti1/2 for 1h followed by insulin stimulation for 10 min, followed by assaying Rac-1 activation with the pulldown assay. Pulled down proteins were resolved on SDS-10% PAGE and immunoblotted with anti-Rac-1 antibody. Rac-1-GTP signal was quantified and normalized to total Rac-1 cell lysate. (mean ± SE, *p<0.05 vs basal). Representative images of 4 independent experiments are shown.

121

Surprisingly, we found that Rac-1 superactivation led to activation of PI3K, Akt

and AS160 and these signals, along with the ongoing Rac-mediated actin remodelling,

mirror the typical response elicited by insulin stimulation resulting in GLUT4

translocation to the cell membrane. AMPK does not participate in this insulin-

independent response because a) application of compound C did not impair the Rac-1

superactivation-induced GLUT4 translocation (Figure 4-11), and b) insulin stimulation to

GFP-CA-Rac expressing cells did not cause an additional gain in surface GLUT4,

contrasting with the previously reported additive effect of AMPK and insulin (277,278).

Notably, Rac-1 superactivation restored the GLUT4 response in muscle cells rendered

insulin resistant via JNK activation or ceramide delivery.

4.4-1: Rac-1 superactivation leading to PI(3,4,5)P3 production, Akt and AS160

phosphorylation

4.4-1-I: PI(3,4,5)P3 accumulation

The finding that PI(3,4,5)P3 production was induced by Rac-1 superactivation

(Figure 4-9A,B) was surprising because growth factor-dependent Rac-1 activation is

linked to PI(3,4,5)P3-mediated recruitment and activation of Rac GEFs such as Tiam1, P-

Rex, and Vav (279-281). Nonetheless, overexpression of CA-Rac and acute Rac-1

superactivation bypassed this prerequisite and each led to accumulation of a PI(3,4,5)P3-

sensitive probe at the plasma membrane of muscle cells (Figure 4-9A,B), fibroblasts,

and neutrophils without a need of stimulus (282,283). On the other hand, expression of

CA-Cdc42 did not provoke significant PI(3,4,5)P3 production (282), and this small GTPase

was also unable to increase surface GLUT4 (Figure 4-2). Hence, a potential feedback

mechanism to elevate PI(3,4,5)P3 appears to be Rac-specific, but the molecular basis for

122

this step remains elusive. A potential explanation is an interaction between Rac-1 and

PI3K. A pulldown of cytosolic proteins bound to GST-Rac-1 loaded with GTP was found

to contain PI3K activity, and it was subsequently revealed that the p85 subunit of PI3K

can interact with Rac-1 in a GTP-dependent manner in vitro (284). Because active Rac-

1 is naturally anchored at the plasma membrane through prenylation, such interaction

between Rac-1 and PI3K would bring PI3K close to the vicinity of its substrate PI(4,5)P2

at the plasma membrane for Rac-mediated PI(3,4,5)P3 production. However, in vivo

evidence of this interaction during growth factor stimulation is lacking.

Another contributing factor for the increased PI(3,4,5)P3 generation by Rac-1

superactivation could be the accumulation of active PI3K units in the Rac-induced

branched cortical actin (162). Biochemical evidence supports a PI3K-actin filament

interaction, as PI3K was enriched in detergent insoluble fraction containing polymerized

F-actin in chemotaxic Dictyostelium discoideum cells, and its localization to membrane

was lost after treatment with Latrunculin A (285). More importantly, the catalytic subunit

p110 of PI3K accumulated at the site of remodelled cortical actin following insulin

stimulation in muscle cells (162). These observations support a role for cortical actin in

positioning PI3K close to the membrane. Indeed, when Rac superactivation-mediated

actin remodelling was perturbed by actin disrupting agents, the consequent PI(3,4,5)P3

production at the plasma membrane was blocked (282,286). This may explain why LB

treatment was most effective at blocking the GLUT4 translocation induced by Rac-1

superactivation (Figure 4-11), as disrupting the cortical actin lattice would prevent Akt

activation secondarily to impaired PI(3,4,5)P3 production, along with the elimination of

Rac-mediated actin remodelling.

123

4.4-1-II: Akt phosphorylation

Akt must be phosphorylated at both its activation site (Thr308) and its regulatory

site (Ser473) in order to become fully active (149,150). Thr308 phosphorylation provides

partial activation, while Ser473 phosphorylation on its own allows minimal activity but

contributes to potentiation of Akt activity and substrate specificity (150,287-289).

According to these findings, the phosphorylation of Akt at both Thr308 and Ser 473

must have activated the kinase, as reflected by the phosphorylation of its downstream

target AS160 (Figures 4-10A, 4-12A). On the other hand, although overexpression of

GFP-WT-Rac in myoblasts contributed to slight elevation in Ser473 phosphorylation

(Figure 4-10C), no Thr308 phosphorylation was achieved, and there was no ensuing

AS160 phosphorylation (Figures 4-10B, 4-12A,B).

Phosphorylation of Akt at Thr308 is controlled by PDK1 (149). The rise in

PI(3,4,5)P3 at the plasma membrane serves as a cue to recruit and enhance PDK1

activity. Because Akt is also enriched at the plasma membrane via its PI(3,4,5)P3-binding

PH domain (290), Akt and PDK1 may come in close proximity, favouring Akt

phosphorylation. As seen in Figures 4-9A and B, the amount of membrane-bound

PI(3,4,5)P3 in GFP-CA-Rac expressing cells is equivalent to about 20% of the maximal

insulin-dependent response. This modest gain correlates well with the 26% increase in

phospho-Thr308 Akt achieved by Rac-1 superactivation, relative to the maximal insulin

response, suggesting linear transmission of the PI(3,4,5)P3 signal amplitude to PDK1Akt

(Figure 4-10B). Consistent with this calculation, Thr308 phosphorylation of Akt is

considered the limiting determinant for Akt activation (287,288,291,292).

On the other hand, mTORC2 is the kinase responsible for Ser473

phosphorylation of Akt in response to insulin (293). mTORC2 exists in a complex

124

containing mTOR, mLTST8, and Rictor; however, the mechanism of mTORC2

activation is unknown (294). Recently, it was revealed that Rac interacts with mTOR in

the mTORC2 complex in a GTP-independent manner (295). This interaction provides

spatial regulation to mTORC2, as enrichment of active Rac at the plasma membrane

would bring along mTORC2. Accordingly, Rac-1 activation by CA-Rac-GTP may

position mTORC2 near the plasma membrane, where Akt is recruited by PI(3,4,5)P3. The

close proximity of mTORC2 and Akt might contribute to the increase in phospho-Ser473

Akt observed with Rac-1 superactivation without the need of insulin stimulation (Figure

4-10A,C).

In addition to PDK1 and mTORC2, the kinase PAK1 can phosphorylate Ser473

of Akt in vitro (296). Interestingly, PAK1 inhibition reduces IGF-1 stimulated Akt

activation and the Akt hyperactivity of cancer cells (296-298). PAK1 can also act as a

scaffold for both PDK1 and Akt (299). Because PAK1 is recruited through its CRIB

domain to GTP-loaded Rac-1, an association of PAK1, PDK1, and Akt at the plasma

membrane would provide an additional avenue, independent of PI(3,4,5)P3 production,

driving Akt phosphorylation following Rac-1 activation.

Because WM and Akti1/2 prevent the production of plasma membrane PI(3,4,5)P3 and

sterically bind to the PH-domain of Akt respectively (300), both agents impair Akt

activation by hindering the recruitment of Akt to the plasma membrane. However, the

above mentioned PAK1-Akt-PDK1 complex and direct Rac-mTORC2 interaction could

alleviate the complete reliance on the traditional membrane PI(3,4,5)P3 and PH-domain of

Akt to trigger Akt activation. This could explain why only partial inhibitory effect was

observed with WM and Akti1/2 on the Rac-1 superactivation-induced GLUT4

125

translocation (Figure 4-11). Alternatively, the extensive actin remodelling generated

during Rac-1 superactivation could be the main driver of this insulin-like translocation

response. Because remodelled actin can act as scaffold to position insulin signaling

molecules such as Akt close to the plasma membrane (162), the inhibitory effect of WM

and Akti1/2 on Akt recruitment would be reduced compared to the normal insulin

stimulation. This scenario is consistent with the near complete reduction of rapamycin-

triggered GLUT4 translocation with LB (Figure 4-11).

4.4-1-III: AS160 phosphorylation

In spite of the low level of Rac-1 superactivation-mediated Akt activation relative

to the maximal insulin response (26%), downstream phosphorylation of AS160

amounted to approximately 70% of the maximal insulin response (Figure 4-12B). This

signal amplification from Akt to AS160 has also been recently appreciated for the insulin

signalling cascade. Insulin dose-dependence and Akt inhibitor studies in adipocytes and

muscle cells suggest that very little Akt activity is required for near maximal AS160

phosphorylation (208,209). From those studies, 30% insulin-stimulated phospho-Thr308

Akt corresponds to approximately 80% of maximal phospho-AS160, approximating our

measurements of phospho-Thr308 and phospho-AS160 in response to GFP-CA-Rac

(Figure 4-12B). Moreover, we have shown that 19±10% Akt activity suffices for maximal

GLUT4 translocation in insulin stimulated muscle cells (147,270) and similarly, a WM-

mediated reduction in phosphor-Thr308 Akt to 20% of the maximal value allowed for

greater than 50% of the maximal GLUT4 translocation (210). These observations

reinforce the concept that Akt phosphorylation/activity does not correlate linearly with

insulin-mediated GLUT4 translocation, but rather the phosphorylation status of AS160

closely matches GLUT4 translocation. These calculations are in good agreement with

126

the corresponding responses of Akt, AS160 and GLUT4 to Rac-1 superactivation

observed in the present study.

4.4-2: Rac-1 superactivation overcomes insulin resistance

The level of Rac-1-GTP achieved in response to either chronic expression of

GFP-CA-Rac or acute superactivation via rapamycin is likely to be much higher than the

insulin-mediated activation of endogenous Rac-1 (Figure 4-4). siRNA-mediated

silencing of endogenous Rac-1 does not affect insulin-mediated Akt activation,

suggesting that Rac-1 activation does not influence Akt during normal insulin stimulation

(177). This may be due to the low level of Rac-1 activation and the high level of Akt

phosphorylation evoked by the hormone. Much higher levels of Rac-1 activity in the

absence of hormonal stimulation, such as those imposed by the chronic and acute

strategies described here, are required to visualize the Rac-mediated Akt activation.

Nonetheless, Rac-1 superactivation suffices to elicit enough Akt activation to trigger an

insulin-like GLUT4 translocation in muscle cells. This feature was explored in this study

to counteract the effect of strategies that cause insulin resistance.

Obesity is a leading factor in the development of insulin resistance because of

the lipotoxic and low-grade inflammatory environment created by excessive

accumulation of saturated fatty acids (271,301). Both saturated fatty acids and

inflammatory cytokines impact on skeletal muscle to activate stress kinases, including

JNK, leading to IRS-1 serine phosphorylation and degradation (273,302). When this

JNK-induced blockage of IRS-1 signalling was reproduced via overexpression of active

JNK, insulin-dependent GLUT4 translocation was significantly diminished (Figure 4-

14B,C). However, active JNK did not preclude the GLUT4 translocation evoked by Rac-

1 superactivation (Figure 4-14B,C), ostensibly because the latter response bypasses

127

the requirement of IRS-1. Therefore, in vivo, when defects at the level of IRS-1 arise,

Rac-1 activation may be a gateway to trigger downstream signalling of Akt and AS160

to drive a full GLUT4 translocation response.

Unlike JNK activation, intracellular ceramides produced from saturated fatty acid

excess can directly inhibit insulin signalling downstream of IRS-1 (205,275,276,303).

Ceramides can inactivate Akt without influencing IRS-1 or PI3K by both preventing

recruitment of Akt to the plasma membrane and increasing PP2A activity that

dephosphorylates Akt (304,305). In muscle cells, C2-ceramide not only reduces Akt but

also insulin-dependent Rac-1 activation, while IRS-1 tyrosine phosphorylation remains

intact (177). Interestingly, C2-ceramide only exerted a 29% reduction in superactivated

Rac-1-driven GLUT4 translocation compared to a 78% decrease in GLUT4 insulin

response (Figure 4-15). This suggests that Rac-1 superactivation provides enough

surge in both Rac-1 and Akt activities to partially overcome the barrier imposed by

ceramide, and hence averts the negative effects of the lipid metabolite.

Although reduced insulin-dependent glucose uptake is a key factor in the development

of whole-body insulin resistance leading to type 2 diabetes, none of the currently

treatments of the disease (metformin, sulfonylureas, and dipeptidyl peptidase inhibitors)

acts directly on muscle, targetting instead hepatic glucose production and insulin

secretion. Here we identify that Rac-1 activation alone suffices to trigger an insulin-like

GLUT4 translocation without insulin stimulation (Figure 4-17). Unlike insulin, Rac-1

superactivation bypasses IRS-1 yet triggers signalling through PI3K, Akt and AS160.

This response is resistant to the deleterious effects of JNK activation or ceramide

accumulation, which cause insulin resistance. IRS-1 is a common target of agents and

128

conditions causing insulin resistance (271,272), hence improving insulin action

downstream of IRS-1 should be considered strategically advantageous to improve

metabolic outcomes, compared to approaches that require IRS-1 participation.

Compounds that would turn on a Rac-specific GEF or inhibit Rac-specific GAP activity

in time and tissue-selective manner would be particularly useful tools to design

therapies for insulin resistance. In the future, strategies that could enhance Rac-1

activation to a more physiological level that is comparable to insulin stimulation will

reveal additional insight about the potential of this concept of Rac-1-mediated insulin-

like response.

Figure 4-17: Model of Rac-1 superactivation-induced GLUT4 translocation in muscle cells. Left: Normal insulin response observed in cells expressing endogenous levels of Rac-1. Right: Rac-1 superactivation promotes membrane accumulation of PI(3,4,5)P3, which results in moderate phosphorylation of Akt and significant phosphorylation at AS160. These signalling components together with actin remodelling satisfied the molecular requirements for GLUT4 translocation without input of insulin.

129

CHAPTER 5: Summary and future directions

130

5.1: Summary

Since the cloning of GLUT4 from insulin-responsive tissues, extensive efforts

have been devoted to elucidate the complex molecular events leading to the insulin-

induced GLUT4 mobilization from intracellular compartments to the plasma membrane.

Much excitement was generated when AS160 was discovered as the Akt effector that

controls the activation of Rabs (154). Because Rabs are the master regulators of vesicle

traffic, this mechanism provides a direct signalling cue to the mobilization of GLUT4

vesicles. What is equally exciting is the appreciation of Rho GTPase-controlled actin

reorganization in the overall GLUT4 translocation process. In muscles, the contribution

of actin dynamics to insulin-mediated GLUT4 traffic was demonstrated with the use of

actin disrupting agents such as LB, CD, and jasplakinolide in cell culture and isolated

muscle fibers (161,165-167). Experiments using dominant negative mutants or siRNA-

mediated knockdown demonstrate that this insulin-induced actin remodelling event is

Rac-1-dependent in muscle cells (161,177). Recent muscle-specific Rac-1 knockout

mouse models have recapitulated these in vitro findings and cemented the important

role of Rac-1 in the outcome of insulin-stimulated GLUT4 translocation in muscles

(178,179). Nonetheless, questions about the downstream effectors governing the Rac-

1-induced actin dynamics and the effect of additional Rac-1 activity towards the GLUT4

traffic response remain unexplored.

In chapter 3, Arp2/3 and cofilin are identified to act downstream of Rac-1 to

regulate the dynamics of insulin-stimulated actin remodelling. In agreement with its

principal property of F-actin assembly, Arp2/3 initiates the actin branching responsible

for the formation of the remodelled actin while cofilin balances out the burst in actin

131

assembly through its severing and depolymerizing activity. This dynamic regulation

must be maintained in order to achieve proper actin remodelling for the traffic of GLUT4

vesicles to the plasma membrane because perturbation of either molecule significantly

reduces the insulin-mediated gain in surface GLUT4 in muscle cells. This concept of

actin dynamics governing membrane protein traffic to plasma membrane is not limited

to GLUT4 as cofilin-regulated actin dynamics is also necessary in the gain of AMPA

receptors on the plasma membrane of hippocampal neurons (306).

In both cases, stimulus-induced cofilin dephosphosphorylation is the prerequisite

for the increase in severing and depolymerizing activity. The phosphorylation status of

cofilin is the result of an intricate balance between LIMK and slingshot phosphatase.

Although insulin activates LIMK through the Rac->PAK pathway, the overall response is

the dephosphorylation of cofilin, which suggests the outweighing phosphatase activity

from slingshot. This enhanced slingshot action is impinged upon the formation of

remodelled actin as binding to F-actin significantly augments its phosphatase activity

(239,307). To minimize slingshot’s function in the basal state, protein kinase D has been

shown to exert inhibitory phosphorylation on slingshot that prevents its interaction with

F-actin and directly reduces its phosphatase activity (308,309). Interestingly, intrinsically

active GSK can also inhibit slingshot activity through phosphorylation (310). Because

GSK is turned off during insulin stimulation by activated Akt, this GSK regulatory

mechanism could synergize with remodelled actin to increase the dephosphorylating

capacity of slingshot on cofilin.

A defect in cofilin dephosphorylation upon insulin stimulation has recently been

linked to impaired GLUT4 translocation and glucose uptake in skeletal muscles from

132

PAK1 knockout animals (311). Although the contribution of PAK1 towards cofilin

dephosphorylation is unknown at the moment, it nonetheless provides the first

suggestive evidence in vivo for a role of cofilin in the insulin-induced GLUT4

translocation response.

With the emergence of Rac-1 as a key component of GLUT4 traffic following

insulin stimulation of muscles, experiments were designed to examine the influence of

additional Rac-1 activity towards the translocation response. In chapter 4, we found an

insulin-independent gain in surface GLUT4 upon overexpression of CA-Rac in

myoblasts. This phenotype can also be achieved via acute Rac-1 activation. We further

demonstrated the molecular principle behind this Rac-1-driven response by revealing

the concomitant activation of Akt and AS160, which together with active Rac-1 provides

the two independent signalling arms required for insulin-stimulated GLUT4 translocation

in muscle cells. This unique signalling capacity induced by excess active Rac-1, which

bypasses the requirement for IRS-1, was applied to evade the signalling defects

imposed during stress kinase- and ceramide-induced insulin resistance. Moreover, this

in vitro finding can be reproduced with isolated gastrocnemius muscle fibers

overexpressing CA-Rac, suggesting similar molecular response is achievable in vivo

(178).

Recently, Nozaki et al. proposed that RalA is an important downstream effector

of Rac-1 in its insulin-independent action on GLUT4 translocation. Overexpression of

CA-Rac in muscle cells causes the GTP loading of RalA and down-regulation of RalA

dampens the CA-Rac-mediated gain in surface GLUT4 (312). Nonetheless, a

mechanism for Rac-dependent RalA activation is not proposed. The activation of RalA

133

following insulin stimulation has been demonstrated in adipocytes and its GTP-bound

state is achieved through Akt-dependent inhibitory phosphorylation on the Ral GAP

complex (313). If a similar molecular mechanism holds true in muscle cells, the modest

activation of Akt induced by active Rac-1 could contribute to the observed RalA GTP-

loaded status. This would suggest that the CA-Rac-induced effect on RalA is mediated

by Akt. Therefore, RalA is most likely downstream of Akt instead of Rac-1 in the overall

insulin signalling cascade leading to the increase in surface GLUT4 in muscle cells.

Rac-1 has also been linked to contraction-induced glucose uptake in skeletal

muscles (314). However, the effector which Rac-1 employs to achieve this response is

unknown at the moment. Uncovering new players in this Rac-1-dependent glucose

uptake during muscle contraction could shed insight into other contributing molecules

that might also function in the Rac-1-induced GLUT4 translocation in muscle cells.

134

5.2: Future directions

5.2-1: Regulation of Rac-1 activity during insulin stimulation

5.2-1-I: Activation by GEFs

Although Rac-1 and its subsequent actin remodelling response were

characterized following insulin stimulation in muscle cells, little exploration has been

made to discover the regulatory mechanism governing its GTP-loaded status. Studies

thus far indicate that the activation is PI3K-dependent because wortmannin treatment in

muscle cells partially blocks the insulin-mediated GTP loading of Rac-1 (175,312).

Given that GTPases are turned on by GEFs and many GEFs for Rho GTPases function

downstream of PI3K (315), GEFs appear to be logical candidates responsible for the

insulin-induced Rac-1 activation. One report proposes that FLJ00068 is the Rac-GEF

during insulin stimulation but the lack of direct evidence illustrating impaired Rac

activation with FLJ00068 knockdown invites more thorough examination before a

definitive conclusion is reached.

Analysis of the existing literature for the criteria of PI3K-regulated activity and

induction of Rac GTP loading suggests the following GEFs are the most likely

candidates: Vav, Tiam, P-Rex, SWAP-70, SOS, α-PIX, β-PIX, and DOCK180.

Preliminary semi-quantitative PCR analysis illustrates the expression of Vav-2, Vav-3,

Tiam1, SWAP-70, SOS-1, SOS-2, α-PIX, β-PIX, DOCK180 and the proposed

FLJ00068/PLEKHG in L6 myoblasts (Figure 5-1).

135

Figure 5-1: Expression profile of candidate Rac-GEFs in L6 myoblasts measured

by semi-quantitative PCR. Primers and PCR cycles used are described in the method

section.

This presents a scenario in which functional redundancy may occur because of

the large number of GEFs with Rac GTP-loading activity in muscle cells. For example,

although Vav-2 is tyrosine phosphorylation upon insulin stimulation to relieve itself from

the autoinhibitory state (316), down-regulation of Vav-2 does not affect the net

activation of Rac-1 by insulin in myoblasts (Figure 5-2A,B,C,D).

136

Figure 5-2: Vav-2 undergoes insulin-induced tyrosine phosphorylation but does

not influence insulin-dependent Rac activation in myoblasts. A-B) Confluent

myoblasts grown in 10cm diameter dishes were treated with/without insulin before

subjecting to cell lysate preparation and immunoprecipitation with anti-Vav-2 antibody.

The precipitate was resolved on a gel and blotted for tyrosine phosphorylation by P-

tyrosine antibody. Changes in P-tyrosine were expressed relative to the basal state. C-

D) Vav-2 was down-regulated by siRNA before subjecting to insulin-stimulated Rac

activation assay. Quantification was made relative to active Rac in the basal state.

Representative images of >3 experiments are shown. (mean ± SE, *p<0.05).

On the contrary, siRNA-mediated knockdown of Tiam1 reduces the insulin-

stimulated Rac-1 activation (Figure 5-3A-B). This reduction is partial which implies other

GEFs could also contribute to the net result of GTP-loaded Rac-1.

Figure 5-3: Tiam1 knockdown reduces insulin-mediated Rac activation. A-B)

Tiam1 expression was down-regulated in myoblasts with siRNA before subjecting to

insulin-induced Rac activation. Quantification was made relative to the basal state.

Representative images of 6 independent experiments are shown. (mean ± SE, *p<0.05).

Sorting out the GEFs involved in this process will probably require down-

regulation of multiple GEFs at the same time to achieve a complete impairment in Rac-1

activation following insulin stimulation. Nonetheless, the identification of Tiam1 serves

as a starting point for future investigation. Additional experiments comparing the effect

of FLJ00068 and Tiam1+FLJ00068 double knockdown on the level of GTP bound Rac-1

would reveal the contribution of each during insulin response.

137

One other GEF that would be interesting to test is Trio. Its interaction with F-actin

crosslinking protein, filamin A, determines the localization of its GEF activity towards

Rac (317). Because filamin A can be enriched at the plasma membrane by associating

with remodelled actin or binding to integrins/membrane glycoproteins, it directly

positions Trio at the plasma membrane where Rac needs to be activated. Such

molecular mechanism could be another method contributing to the burst of Rac-1 GTP

following insulin stimulation.

5.2-1-II: Inactivation by GAP

The other side of the equation for Rac activation is the control of GAPs. Inhibition

of Rac-GAP activity could also contribute to the net increase in Rac-1 GTP during

insulin stimulation in muscle cells. Although the regulation of GAPs is less developed

compared to GEFs, one intriguing notion has been the RhoA-dependent crosstalk to

Rac through a Rac-GAP. Overexpression of CA-RhoA blocks nerve growth factor-

induced Rac activation and Rac-dependent neurite outgrowth in PC12 cells and this

inhibition is dependent on its downstream effector ROCK (318). It was subsequently

revealed that ROCK phosphorylates FilGAP, which has GAP activity towards Rac, to

enhance the hydrolysis of GTP-bound Rac (319). Interestingly, in parallel with nerve

growth factor-stimulated Rac activation, the amount of GTP-associated RhoA was

concomitantly decreased. It is therefore proposed that this chain of RhoA->ROCK-

>FilGAP signalling event towards Rac-GTP hydrolysis is hindered by the lower level of

active RhoA so that a greater Rac activation is achieved following external stimulation.

A similar mechanism could play a role in the insulin-mediated Rac-1 activation in

muscle cells where the amount of GTP-loaded RhoA decreases upon insulin stimulation

138

to reduce the GAP activity of FilGAP towards Rac-1. A time course measurement of

RhoA activation during insulin treatment and examining the effect of CA-RhoA

overexpression on Rac-dependent actin remodelling will provide the initial data to test

this hypothesis.

5.2-2: The role of PAK in GLUT4 translocation

In addition to Arp2/3- and cofilin-driven activities, there are still several effector

molecules that are controlled by Rac activation (320). With Rac-1 now being cemented

as a critical component of insulin-induced GLUT4 translocation in muscles, examining

different Rac-dependent signalling response in relation to the overall GLUT4 traffic

could reveal a new Rac-induced mechanism. One of the common effectors regulated by

Rac is PAK. PAK is relieved from its autoinhibitory state with the binding of active Rac

and Cdc42 (321). In a PAK1 knockout mouse model, Wang et al. observed impaired

insulin-mediated GLUT4 translocation in skeletal muscles which led to peripheral insulin

resistance in the animal (311). However, the molecular mechanism by which PAK1

affects GLUT4 translocation remains elusive.

Previous studies on PAK have illustrated its ability to influence actin dynamics

through the PAK->LIMK->cofilin pathway (80). At the same time, it can modulate the

level of Rac activation by promoting the phosphorylation of GDI and GDI’s subsequent

dissociation from Rac GTPase (322). Because proper activity of Rac-1 and actin

dynamics are prerequisites for insulin-induced gain in surface GLUT4 in muscle cells, it

can therefore be hypothesized that PAK regulates the insulin response via these two

molecular mechanisms. Preliminary results utilizing IPA-3, a PAK inhibitor, in muscle

139

cells shows impaired insulin-induced Rac-1 activation and actin remodelling, which

suggests PAK’s participation in Rac-regulated actin dynamics (Figure 5-4A,B).

Figure 5-4: IPA-3 inhibits insulin-mediated Rac activation and actin remodelling.

Myoblasts were pretreated with DMSO or 30µM IPA-3 followed by 10 min of insulin

stimulation before measurement of A) Rac activation, and B) actin remodelling.

Representative blots and images of 2 independent experiments.

To evaluate the effect of PAK towards Rac activation via GDI, we can show that

insulin stimulates the phosphorylation of GDI via detection with an antibody against

PAK-specific phosphorylation site on GDI (Figure 5-5). Concomitant with the

phosphorylation of GDI is a reduction in GDI-associated Rac-1, implying the release of

sequestered Rac-1 and priming for GTP loading (Figure 5-5).

140

Figure 5-5: Insulin stimulates the phosphorylation of GDI and the release of Rac

from GDI. Myoblasts were stimulated with/without insulin for 10 min before subjecting to

immunoprecipitation with GDI antibody. The precipitates were subsequently analyzed

with gel electrophoresis to reveal the changes in P-GDI and the level of GDI-Rac

association. Representative blots of >6 independent experiments were shown.

These preliminary findings pave the groundwork to investigate PAK in the insulin-

regulated response in muscle cells. It would be intriguing to apply IPA-3 to observe if it

reduces the effect of insulin-stimulated phosphorylation of GDI caused by PAK. These

findings will need to be validated with siRNA-mediated knockdown of PAK isoforms. In

addition, PAK is a serine/threonine kinase whose phosphorylation capability on other

common insulin signalling molecules with serine/threonine phospho-modulation has

never been examined in detail. For example, AS160 has multiple serine and threonine

phosphorylation sites that are for now attributed to Akt (154). However, it is equally

possible that PAK may have an unestablished connection through direct AS160

phosphorylation. This hypothesis could be another explanation for substantial

phosphorylation AS160 seen with CA-Rac overexpression. Uncovering the precise

regulation induced by PAK downstream of Rac-1 activation would provide additional

signalling cues that contribute to GLUT4 traffic.

5.2-3: Function of remodelled actin in GLUT4 traffic in muscle cells

The proposed mechanism of remodelled actin in GLUT4 traffic is largely derived

from actin disrupting agents that harshly perturb whole cell actin dynamics. Furthermore,

advanced TIRF microscopy studying the effect of remodelled actin has only been

examined in adipocytes but not muscle cells (192-194). With the identification of Arp2/3

and cofilin in controlling the respective polymerization and depolymerization step during

insulin-mediated actin remodelling without disrupting F-actin at the level of stress fibers,

141

we have the opportunity to examine the finer changes in GLUT4 vesicle traffic within the

TIRF zone in muscle cells with downregulated Arp2/3 or cofilin.

Because siRNA to Arp2/3 prevents the formation of insulin-stimulated remodelled

actin and cofilin knockdown produces cortical F-actin aggregates, a comparison of their

impact on GLUT4 vesicle mobility, enrichment, and insertion beneath the plasma

membrane via TIRF microscopy would differentiate the traffic defects in the absence of

remodelled actin versus that in the presence of aggregated actin meshwork. The

recently engineered pHluorin-GLUT4-TdTomato construct (193), which allows precise

distinction of vesicle tethering and fusion events in the TIRF zone, would help clarifying

the mode of GLUT4 traffic in muscle cells. Findings from such experiments would

expand our knowledge on the function of the remodelled actin in GLUT4 traffic and

address any similarities and differences in the contribution of remodelled actin towards

GLUT4 mobilization between adipocytes and muscles.

5.2-4: Bridging microtubule and F-actin in insulin-stimulated GLUT4 vesicle traffic

The cytoskeleton input towards insulin-mediated GLUT4 traffic to the plasma

membrane is not limited to cortical remodelled actin, and indeed microtubules have also

been shown to participate in this mobilization event. GLUT4 containing vesicles migrate

on fluorescent tubulin-decorated microtubules and this long range movement is inhibited

upon the addition of microtubule disrupting agents such as nocodazole and colchicine

(198,199,323). Furthermore, overexpression of a functionally dead mutant of kinesin, a

microtubule motor protein, prevents the vesicle movement leading to reduced gain in

surface GLUT4 on the plasma membrane of adipocytes (199). These observations have

142

led to the proposition that microtubule-dependent tracks are involved in long range

guidance of GLUT4 vesicles towards the plasma membrane.

On the other hand, previous studies have also implicated myosin5, an actin

motor protein, in mobilizing GLUT4 vesicles for the insulin-induced translocation event

(159,197). Because the disruption of actin dynamics do not inhibit the arrival of GLUT4

vesicles near the plasma membrane (193,194), the actin-based motor process is most

likely occurring at the region of cortical remodelled actin beneath the plasma membrane,

which contrasts the long range vesicle movement controlled by microtubules. In order to

coordinate the movement of GLUT4 vesicles on two cytoskeleton networks, it can be

hypothesized that GLUT4 vesicles first travel on the microtubule network followed by

the switch to the F-actin tracks when approaching the membrane. This crosstalk

between microtubule and F-actin during vesicle traffic can be supported by the

observation that kinesin and myosin5 interact with one another to potentially enable

tract switching (324). This change in tracts can be visualized in vitro when beads are

artificially attached with both actin and microtubule motors (325).

In the context of GLUT4 traffic, the switching model is reinforced by the lack of

colocalization between the remodelled actin and microtubules at the cell cortex following

insulin stimulation in myotubes (326). Instead, microtubules are clustered around

remodelled actin which favours a need to change tracks for vesicles to reach to the

plasma membrane. In order for the switching to occur efficiently, it can be imagined that

the two cytoskeleton networks must be integrated closely together to facilitate the motor

proteins to change tracks. This concept has led to the identification of linker proteins

that bridge between microtubules and F-actin. Besides being an F-actin crosslinking

143

protein, IQGAP simultaneously associates with microtubule via its interaction with

microtubule tip protein CLIP-70 (327). Combining IQGAP’s microtubule connection with

its ability to bind to active Rac through its GTPase binding domain (327), IQGAP can

potentially direct microtubule orientation towards the site of active actin remodelling to

facilitate track-mediated vesicle movement towards the plasma membrane. More

recently, another protein CLIPS2 was also shown to bridge IQGAP to microtubule and

this interaction is prevented by GSK-3-dependent phosphorylation of CLIPS2 (328).

Given that insulin-stimulated Akt activity can inactivate GSK-3 (329), this may promote

the complex formation between CLIPS2 and IQGAP in order to link microtubule and F-

actin at the cell cortex.

Although the participation of IQGAP-CLIP-70 or IQGAP-CLIPS2 in the GLUT4

traffic response has not yet been fully examined, a few existing evidences do support

their role in insulin response. First, single nucleotide polymorphism of IQGAP is

associated with the development of type 2 diabetes (330). Down-regulation of IQGAP in

muscle cells would address whether IQGAP has a functional input in insulin-stimulated

GLUT4 traffic. Secondly, CLIPS2 is serine phosphorylated in response to insulin and

siRNA-mediated knockdown of CLIPS2 reduces insulin-induced GLUT4 translocation in

myotubes (331). Nonetheless, the visualization of the cellular defect in GLUT4 traffic in

relation to microtubule and F-actin that occurs following CLIPS2 down-regulation has

yet to be examined. It would be intriguing to expand this study by comparing the

microtubule-actin connection beneath the plasma membrane with IQGAP, CLIP-70, or

CLIPS2 knockdown by TIRF microscopy. Capturing GLUT4 vesicles switching between

microtubules and F-actin by TIRF would also provide first evidence supporting this track

144

switching hypothesis. Furthermore, the validation of serine phosphorylation on CLIPS2

by Akt following insulin stimulation would enable the test on its contribution to the

complex formation with IQGAP and microtubule-actin linking capability.

Collectively, these proposed studies will lead to a better understanding of 1) how

Rac-1 is activated in response to insulin in muscle cells, 2) how Rac-dependent PAK

functions in insulin-stimulated GLUT4 translocation, 3) how modulation of actin

dynamics influences the hypothesized functions of remodelled actin in GLUT4 traffic,

and 4) how microtubules and actin filaments integrate to achieve the net mobilization of

GLUT4 vesicles. This effort will introduce novel regulators and molecules to the existing

insulin signalling cascade in muscle cells. The growth in understanding of molecular

signals contributing to insulin-induced GLUT4 translocation will lay the basic

groundwork necessary to dissect the varying molecular defects in the growing number

of patients, families, and populations with insulin resistance. The ability to pinpoint with

precision the molecules responsible for impaired GLUT4 translocation and consequent

defective glucose uptake in muscles will assist in the targeted therapeutic design to

combat insulin resistance. The significance of such findings cannot be underestimated,

as there is currently few reliable treatment option targeted to reverse insulin resistance

conditions. Type 2 diabetes is managed at present with drugs that promote insulin

secretion (sulfonylureas, GLP-1 analogues or dipeptidyl peptidase IV inhibitors) or that

reduce hepatic glucose output (metformin). There is a sore need to develop strategies

that will relieve peripheral (i.e. muscle) insulin resistance, which is the first event leading

to whole body insulin resistance and progression to type 2 diabetes.

145

CHAPTER 6: References

146

1. Wennerberg, K., Rossman, K. L., and Der, C. J. (2005) The Ras superfamily at a glance. J Cell Sci 118, 843-846

2. Aspenstrom, P., Fransson, A., and Saras, J. (2004) Rho GTPases have diverse effects on the organization of the actin filament system. Biochem J 377, 327-337

3. Hart, M. J., Eva, A., Evans, T., Aaronson, S. A., and Cerione, R. A. (1991) Catalysis of guanine nucleotide exchange on the CDC42Hs protein by the dbl oncogene product. Nature 354, 311-314

4. Cote, J. F., and Vuori, K. (2007) GEF what? Dock180 and related proteins help Rac to polarize cells in new ways. Trends Cell Biol 17, 383-393

5. Mitin, N., Roberts, P. J., Chenette, E. J., and Der, C. J. (2012) Posttranslational lipid modification of Rho family small GTPases. Methods Mol Biol 827, 87-95

6. Tu, S., Wu, W. J., Wang, J., and Cerione, R. A. (2003) Epidermal growth factor-dependent regulation of Cdc42 is mediated by the Src tyrosine kinase. J Biol Chem 278, 49293-49300

7. Lang, P., Gesbert, F., Delespine-Carmagnat, M., Stancou, R., Pouchelet, M., and Bertoglio, J. (1996) Protein kinase A phosphorylation of RhoA mediates the morphological and functional effects of cyclic AMP in cytotoxic lymphocytes. EMBO J 15, 510-519

8. Kwon, T., Kwon, D. Y., Chun, J., Kim, J. H., and Kang, S. S. (2000) Akt protein kinase inhibits Rac1-GTP binding through phosphorylation at serine 71 of Rac1. J Biol Chem 275, 423-428

9. Torrino, S., Visvikis, O., Doye, A., Boyer, L., Stefani, C., Munro, P., Bertoglio, J., Gacon, G., Mettouchi, A., and Lemichez, E. (2011) The E3 ubiquitin-ligase HACE1 catalyzes the ubiquitylation of active Rac1. Dev Cell 21, 959-965

10. Castillo-Lluva, S., Tatham, M. H., Jones, R. C., Jaffray, E. G., Edmondson, R. D., Hay, R. T., and Malliri, A. (2010) SUMOylation of the GTPase Rac1 is required for optimal cell migration. Nat Cell Biol 12, 1078-1085

11. Navarro-Lerida, I., Sanchez-Perales, S., Calvo, M., Rentero, C., Zheng, Y., Enrich, C., and Del Pozo, M. A. (2012) A palmitoylation switch mechanism regulates Rac1 function and membrane organization. EMBO J 31, 534-551

12. Liu, M., Bi, F., Zhou, X., and Zheng, Y. (2012) Rho GTPase regulation by miRNAs and covalent modifications. Trends Cell Biol 22, 365-373

13. Welsh, C. F., Roovers, K., Villanueva, J., Liu, Y., Schwartz, M. A., and Assoian, R. K. (2001) Timing of cyclin D1 expression within G1 phase is controlled by Rho. Nat Cell Biol 3, 950-957

14. Olson, M. F., Paterson, H. F., and Marshall, C. J. (1998) Signals from Ras and Rho GTPases interact to regulate expression of p21Waf1/Cip1. Nature 394, 295-299

15. Yasuda, S., Oceguera-Yanez, F., Kato, T., Okamoto, M., Yonemura, S., Terada, Y., Ishizaki, T., and Narumiya, S. (2004) Cdc42 and mDia3 regulate microtubule attachment to kinetochores. Nature 428, 767-771

16. Narumiya, S., and Yasuda, S. (2006) Rho GTPases in animal cell mitosis. Curr Opin Cell Biol 18, 199-205

17. Menke, A., and Giehl, K. (2012) Regulation of adherens junctions by Rho GTPases and p120-catenin. Arch Biochem Biophys 524, 48-55

18. Terry, S., Nie, M., Matter, K., and Balda, M. S. (2010) Rho signaling and tight junction functions. Physiology (Bethesda) 25, 16-26

19. Spiering, D., and Hodgson, L. (2011) Dynamics of the Rho-family small GTPases in actin regulation and motility. Cell Adh Migr 5, 170-180

20. Allen, W. E., Zicha, D., Ridley, A. J., and Jones, G. E. (1998) A role for Cdc42 in macrophage chemotaxis. J Cell Biol 141, 1147-1157

21. Chi, X., Wang, S., Huang, Y., Stamnes, M., and Chen, J. L. (2013) Roles of rho GTPases in intracellular transport and cellular transformation. Int J Mol Sci 14, 7089-7108

147

22. Takeya, R., and Sumimoto, H. (2003) Molecular mechanism for activation of superoxide-producing NADPH oxidases. Mol Cells 16, 271-277

23. Weernink, P. A., Meletiadis, K., Hommeltenberg, S., Hinz, M., Ishihara, H., Schmidt, M., and Jakobs, K. H. (2004) Activation of type I phosphatidylinositol 4-phosphate 5-kinase isoforms by the Rho GTPases, RhoA, Rac1, and Cdc42. J Biol Chem 279, 7840-7849

24. Nicholson-Dykstra, S., Higgs, H. N., and Harris, E. S. (2005) Actin dynamics: growth from dendritic branches. Curr Biol 15, R346-357

25. Pollard, T. D., Blanchoin, L., and Mullins, R. D. (2000) Molecular mechanisms controlling actin filament dynamics in nonmuscle cells. Annu Rev Biophys Biomol Struct 29, 545-576

26. Goldschmidt-Clermont, P. J., Machesky, L. M., Doberstein, S. K., and Pollard, T. D. (1991) Mechanism of the interaction of human platelet profilin with actin. J Cell Biol 113, 1081-1089

27. Goldschmidt-Clermont, P. J., Furman, M. I., Wachsstock, D., Safer, D., Nachmias, V. T., and Pollard, T. D. (1992) The control of actin nucleotide exchange by thymosin beta 4 and profilin. A potential regulatory mechanism for actin polymerization in cells. Mol Biol Cell 3, 1015-1024

28. Pruyne, D., Evangelista, M., Yang, C., Bi, E., Zigmond, S., Bretscher, A., and Boone, C. (2002) Role of formins in actin assembly: nucleation and barbed-end association. Science 297, 612-615

29. Copeland, J. W., Copeland, S. J., and Treisman, R. (2004) Homo-oligomerization is essential for F-actin assembly by the formin family FH2 domain. J Biol Chem 279, 50250-50256

30. Xu, Y., Moseley, J. B., Sagot, I., Poy, F., Pellman, D., Goode, B. L., and Eck, M. J. (2004) Crystal structures of a Formin Homology-2 domain reveal a tethered dimer architecture. Cell 116, 711-723

31. Zigmond, S. H., Evangelista, M., Boone, C., Yang, C., Dar, A. C., Sicheri, F., Forkey, J., and Pring, M. (2003) Formin leaky cap allows elongation in the presence of tight capping proteins. Curr Biol 13, 1820-1823

32. Wallar, B. J., Stropich, B. N., Schoenherr, J. A., Holman, H. A., Kitchen, S. M., and Alberts, A. S. (2006) The basic region of the diaphanous-autoregulatory domain (DAD) is required for autoregulatory interactions with the diaphanous-related formin inhibitory domain. J Biol Chem 281, 4300-4307

33. Wallar, B. J., and Alberts, A. S. (2003) The formins: active scaffolds that remodel the cytoskeleton. Trends Cell Biol 13, 435-446

34. Li, F., and Higgs, H. N. (2003) The mouse Formin mDia1 is a potent actin nucleation factor regulated by autoinhibition. Curr Biol 13, 1335-1340

35. Rotty, J. D., Wu, C., and Bear, J. E. (2013) New insights into the regulation and cellular functions of the ARP2/3 complex. Nat Rev Mol Cell Biol 14, 7-12

36. LeClaire, L. L., 3rd, Baumgartner, M., Iwasa, J. H., Mullins, R. D., and Barber, D. L. (2008) Phosphorylation of the Arp2/3 complex is necessary to nucleate actin filaments. J Cell Biol 182, 647-654

37. Anton, I. M., Jones, G. E., Wandosell, F., Geha, R., and Ramesh, N. (2007) WASP-interacting protein (WIP): working in polymerisation and much more. Trends Cell Biol 17, 555-562

38. Kim, A. S., Kakalis, L. T., Abdul-Manan, N., Liu, G. A., and Rosen, M. K. (2000) Autoinhibition and activation mechanisms of the Wiskott-Aldrich syndrome protein. Nature 404, 151-158

39. Prehoda, K. E., Scott, J. A., Mullins, R. D., and Lim, W. A. (2000) Integration of multiple signals through cooperative regulation of the N-WASP-Arp2/3 complex. Science 290, 801-806

40. Rohatgi, R., Nollau, P., Ho, H. Y., Kirschner, M. W., and Mayer, B. J. (2001) Nck and phosphatidylinositol 4,5-bisphosphate synergistically activate actin polymerization through the N-WASP-Arp2/3 pathway. J Biol Chem 276, 26448-26452

148

41. Padrick, S. B., Cheng, H. C., Ismail, A. M., Panchal, S. C., Doolittle, L. K., Kim, S., Skehan, B. M., Umetani, J., Brautigam, C. A., Leong, J. M., and Rosen, M. K. (2008) Hierarchical regulation of WASP/WAVE proteins. Mol Cell 32, 426-438

42. Campellone, K. G., and Welch, M. D. (2010) A nucleator arms race: cellular control of actin assembly. Nat Rev Mol Cell Biol 11, 237-251

43. Steffen, A., Rottner, K., Ehinger, J., Innocenti, M., Scita, G., Wehland, J., and Stradal, T. E. (2004) Sra-1 and Nap1 link Rac to actin assembly driving lamellipodia formation. EMBO J 23, 749-759

44. Innocenti, M., Zucconi, A., Disanza, A., Frittoli, E., Areces, L. B., Steffen, A., Stradal, T. E., Di Fiore, P. P., Carlier, M. F., and Scita, G. (2004) Abi1 is essential for the formation and activation of a WAVE2 signalling complex. Nat Cell Biol 6, 319-327

45. Ismail, A. M., Padrick, S. B., Chen, B., Umetani, J., and Rosen, M. K. (2009) The WAVE regulatory complex is inhibited. Nat Struct Mol Biol 16, 561-563

46. Lebensohn, A. M., and Kirschner, M. W. (2009) Activation of the WAVE complex by coincident signals controls actin assembly. Mol Cell 36, 512-524

47. Miki, H., Yamaguchi, H., Suetsugu, S., and Takenawa, T. (2000) IRSp53 is an essential intermediate between Rac and WAVE in the regulation of membrane ruffling. Nature 408, 732-735

48. Leng, Y., Zhang, J., Badour, K., Arpaia, E., Freeman, S., Cheung, P., Siu, M., and Siminovitch, K. (2005) Abelson-interactor-1 promotes WAVE2 membrane translocation and Abelson-mediated tyrosine phosphorylation required for WAVE2 activation. Proc Natl Acad Sci U S A 102, 1098-1103

49. Linardopoulou, E. V., Parghi, S. S., Friedman, C., Osborn, G. E., Parkhurst, S. M., and Trask, B. J. (2007) Human subtelomeric WASH genes encode a new subclass of the WASP family. PLoS Genet 3, e237

50. Jia, D., Gomez, T. S., Metlagel, Z., Umetani, J., Otwinowski, Z., Rosen, M. K., and Billadeau, D. D. (2010) WASH and WAVE actin regulators of the Wiskott-Aldrich syndrome protein (WASP) family are controlled by analogous structurally related complexes. Proc Natl Acad Sci U S A 107, 10442-10447

51. Akin, O., and Mullins, R. D. (2008) Capping protein increases the rate of actin-based motility by promoting filament nucleation by the Arp2/3 complex. Cell 133, 841-851

52. Duleh, S. N., and Welch, M. D. (2010) WASH and the Arp2/3 complex regulate endosome shape and trafficking. Cytoskeleton (Hoboken) 67, 193-206

53. Gomez, T. S., and Billadeau, D. D. (2009) A FAM21-containing WASH complex regulates retromer-dependent sorting. Dev Cell 17, 699-711

54. Helfer, E., Harbour, M. E., Henriot, V., Lakisic, G., Sousa-Blin, C., Volceanov, L., Seaman, M. N., and Gautreau, A. (2013) Endosomal recruitment of the WASH complex: active sequences and mutations impairing interaction with the retromer. Biol Cell 105, 191-207

55. Campellone, K. G., Webb, N. J., Znameroski, E. A., and Welch, M. D. (2008) WHAMM is an Arp2/3 complex activator that binds microtubules and functions in ER to Golgi transport. Cell 134, 148-161

56. Zuchero, J. B., Coutts, A. S., Quinlan, M. E., Thangue, N. B., and Mullins, R. D. (2009) p53-cofactor JMY is a multifunctional actin nucleation factor. Nat Cell Biol 11, 451-459

57. Chesarone, M. A., and Goode, B. L. (2009) Actin nucleation and elongation factors: mechanisms and interplay. Curr Opin Cell Biol 21, 28-37

58. Coutts, A. S., Weston, L., and La Thangue, N. B. (2009) A transcription co-factor integrates cell adhesion and motility with the p53 response. Proc Natl Acad Sci U S A 106, 19872-19877

149

59. Weaver, A. M., Karginov, A. V., Kinley, A. W., Weed, S. A., Li, Y., Parsons, J. T., and Cooper, J. A. (2001) Cortactin promotes and stabilizes Arp2/3-induced actin filament network formation. Curr Biol 11, 370-374

60. Martinez-Quiles, N., Ho, H. Y., Kirschner, M. W., Ramesh, N., and Geha, R. S. (2004) Erk/Src phosphorylation of cortactin acts as a switch on-switch off mechanism that controls its ability to activate N-WASP. Mol Cell Biol 24, 5269-5280

61. Lua, B. L., and Low, B. C. (2005) Cortactin phosphorylation as a switch for actin cytoskeletal network and cell dynamics control. FEBS Lett 579, 577-585

62. Clark, E. S., Whigham, A. S., Yarbrough, W. G., and Weaver, A. M. (2007) Cortactin is an essential regulator of matrix metalloproteinase secretion and extracellular matrix degradation in invadopodia. Cancer Res 67, 4227-4235

63. Bryce, N. S., Clark, E. S., Leysath, J. L., Currie, J. D., Webb, D. J., and Weaver, A. M. (2005) Cortactin promotes cell motility by enhancing lamellipodial persistence. Curr Biol 15, 1276-1285

64. Quinlan, M. E., Heuser, J. E., Kerkhoff, E., and Mullins, R. D. (2005) Drosophila Spire is an actin nucleation factor. Nature 433, 382-388

65. Chereau, D., Boczkowska, M., Skwarek-Maruszewska, A., Fujiwara, I., Hayes, D. B., Rebowski, G., Lappalainen, P., Pollard, T. D., and Dominguez, R. (2008) Leiomodin is an actin filament nucleator in muscle cells. Science 320, 239-243

66. Ahuja, R., Pinyol, R., Reichenbach, N., Custer, L., Klingensmith, J., Kessels, M. M., and Qualmann, B. (2007) Cordon-bleu is an actin nucleation factor and controls neuronal morphology. Cell 131, 337-350

67. Ono, S. (2007) Mechanism of depolymerization and severing of actin filaments and its significance in cytoskeletal dynamics. Int Rev Cytol 258, 1-82

68. McGough, A. M., Staiger, C. J., Min, J. K., and Simonetti, K. D. (2003) The gelsolin family of actin regulatory proteins: modular structures, versatile functions. FEBS Lett 552, 75-81

69. Lin, K. M., Mejillano, M., and Yin, H. L. (2000) Ca2+ regulation of gelsolin by its C-terminal tail. J Biol Chem 275, 27746-27752

70. Kinosian, H. J., Newman, J., Lincoln, B., Selden, L. A., Gershman, L. C., and Estes, J. E. (1998) Ca2+ regulation of gelsolin activity: binding and severing of F-actin. Biophys J 75, 3101-3109

71. Laham, L. E., Way, M., Yin, H. L., and Janmey, P. A. (1995) Identification of two sites in gelsolin with different sensitivities to adenine nucleotides. Eur J Biochem 234, 1-7

72. Janmey, P. A., Iida, K., Yin, H. L., and Stossel, T. P. (1987) Polyphosphoinositide micelles and polyphosphoinositide-containing vesicles dissociate endogenous gelsolin-actin complexes and promote actin assembly from the fast-growing end of actin filaments blocked by gelsolin. J Biol Chem 262, 12228-12236

73. Vartiainen, M. K., Mustonen, T., Mattila, P. K., Ojala, P. J., Thesleff, I., Partanen, J., and Lappalainen, P. (2002) The three mouse actin-depolymerizing factor/cofilins evolved to fulfill cell-type-specific requirements for actin dynamics. Mol Biol Cell 13, 183-194

74. Moriyama, K., Iida, K., and Yahara, I. (1996) Phosphorylation of Ser-3 of cofilin regulates its essential function on actin. Genes Cells 1, 73-86

75. Yang, N., Higuchi, O., Ohashi, K., Nagata, K., Wada, A., Kangawa, K., Nishida, E., and Mizuno, K. (1998) Cofilin phosphorylation by LIM-kinase 1 and its role in Rac-mediated actin reorganization. Nature 393, 809-812

76. Toshima, J., Toshima, J. Y., Amano, T., Yang, N., Narumiya, S., and Mizuno, K. (2001) Cofilin phosphorylation by protein kinase testicular protein kinase 1 and its role in integrin-mediated actin reorganization and focal adhesion formation. Mol Biol Cell 12, 1131-1145

150

77. Niwa, R., Nagata-Ohashi, K., Takeichi, M., Mizuno, K., and Uemura, T. (2002) Control of actin reorganization by Slingshot, a family of phosphatases that dephosphorylate ADF/cofilin. Cell 108, 233-246

78. Gohla, A., Birkenfeld, J., and Bokoch, G. M. (2005) Chronophin, a novel HAD-type serine protein phosphatase, regulates cofilin-dependent actin dynamics. Nat Cell Biol 7, 21-29

79. Ohashi, K., Nagata, K., Maekawa, M., Ishizaki, T., Narumiya, S., and Mizuno, K. (2000) Rho-associated kinase ROCK activates LIM-kinase 1 by phosphorylation at threonine 508 within the activation loop. J Biol Chem 275, 3577-3582

80. Edwards, D. C., Sanders, L. C., Bokoch, G. M., and Gill, G. N. (1999) Activation of LIM-kinase by Pak1 couples Rac/Cdc42 GTPase signalling to actin cytoskeletal dynamics. Nat Cell Biol 1, 253-259

81. Gorbatyuk, V. Y., Nosworthy, N. J., Robson, S. A., Bains, N. P., Maciejewski, M. W., Dos Remedios, C. G., and King, G. F. (2006) Mapping the phosphoinositide-binding site on chick cofilin explains how PIP2 regulates the cofilin-actin interaction. Mol Cell 24, 511-522

82. Chen, H., Bernstein, B. W., Sneider, J. M., Boyle, J. A., Minamide, L. S., and Bamburg, J. R. (2004) In vitro activity differences between proteins of the ADF/cofilin family define two distinct subgroups. Biochemistry 43, 7127-7142

83. Bernstein, B. W., and Bamburg, J. R. (1982) Tropomyosin binding to F-actin protects the F-actin from disassembly by brain actin-depolymerizing factor (ADF). Cell Motil 2, 1-8

84. Didry, D., Carlier, M. F., and Pantaloni, D. (1998) Synergy between actin depolymerizing factor/cofilin and profilin in increasing actin filament turnover. J Biol Chem 273, 25602-25611

85. Lin, M. C., Galletta, B. J., Sept, D., and Cooper, J. A. (2010) Overlapping and distinct functions for cofilin, coronin and Aip1 in actin dynamics in vivo. J Cell Sci 123, 1329-1342

86. Kim, K., McCully, M. E., Bhattacharya, N., Butler, B., Sept, D., and Cooper, J. A. (2007) Structure/function analysis of the interaction of phosphatidylinositol 4,5-bisphosphate with actin-capping protein: implications for how capping protein binds the actin filament. J Biol Chem 282, 5871-5879

87. Uruno, T., Remmert, K., and Hammer, J. A., 3rd. (2006) CARMIL is a potent capping protein antagonist: identification of a conserved CARMIL domain that inhibits the activity of capping protein and uncaps capped actin filaments. J Biol Chem 281, 10635-10650

88. Canton, D. A., Olsten, M. E., Kim, K., Doherty-Kirby, A., Lajoie, G., Cooper, J. A., and Litchfield, D. W. (2005) The pleckstrin homology domain-containing protein CKIP-1 is involved in regulation of cell morphology and the actin cytoskeleton and interaction with actin capping protein. Mol Cell Biol 25, 3519-3534

89. Stevenson, R. P., Veltman, D., and Machesky, L. M. (2012) Actin-bundling proteins in cancer progression at a glance. J Cell Sci 125, 1073-1079

90. Kimura, K., Ito, M., Amano, M., Chihara, K., Fukata, Y., Nakafuku, M., Yamamori, B., Feng, J., Nakano, T., Okawa, K., Iwamatsu, A., and Kaibuchi, K. (1996) Regulation of myosin phosphatase by Rho and Rho-associated kinase (Rho-kinase). Science 273, 245-248

91. Amano, M., Ito, M., Kimura, K., Fukata, Y., Chihara, K., Nakano, T., Matsuura, Y., and Kaibuchi, K. (1996) Phosphorylation and activation of myosin by Rho-associated kinase (Rho-kinase). J Biol Chem 271, 20246-20249

92. Maekawa, M., Ishizaki, T., Boku, S., Watanabe, N., Fujita, A., Iwamatsu, A., Obinata, T., Ohashi, K., Mizuno, K., and Narumiya, S. (1999) Signaling from Rho to the actin cytoskeleton through protein kinases ROCK and LIM-kinase. Science 285, 895-898

93. Watanabe, N., Kato, T., Fujita, A., Ishizaki, T., and Narumiya, S. (1999) Cooperation between mDia1 and ROCK in Rho-induced actin reorganization. Nat Cell Biol 1, 136-143

151

94. Heasman, S. J., and Ridley, A. J. (2008) Mammalian Rho GTPases: new insights into their functions from in vivo studies. Nat Rev Mol Cell Biol 9, 690-701

95. Lejen, T., Skolnik, K., Rose, S. D., Marcu, M. G., Elzagallaai, A., and Trifaro, J. M. (2001) An antisense oligodeoxynucleotide targeted to chromaffin cell scinderin gene decreased scinderin levels and inhibited depolarization-induced cortical F-actin disassembly and exocytosis. J Neurochem 76, 768-777

96. Gasman, S., Chasserot-Golaz, S., Malacombe, M., Way, M., and Bader, M. F. (2004) Regulated exocytosis in neuroendocrine cells: a role for subplasmalemmal Cdc42/N-WASP-induced actin filaments. Mol Biol Cell 15, 520-531

97. Malacombe, M., Ceridono, M., Calco, V., Chasserot-Golaz, S., McPherson, P. S., Bader, M. F., and Gasman, S. (2006) Intersectin-1L nucleotide exchange factor regulates secretory granule exocytosis by activating Cdc42. EMBO J 25, 3494-3503

98. Li, Q., Ho, C. S., Marinescu, V., Bhatti, H., Bokoch, G. M., Ernst, S. A., Holz, R. W., and Stuenkel, E. L. (2003) Facilitation of Ca(2+)-dependent exocytosis by Rac1-GTPase in bovine chromaffin cells. J Physiol 550, 431-445

99. Jerdeva, G. V., Wu, K., Yarber, F. A., Rhodes, C. J., Kalman, D., Schechter, J. E., and Hamm-Alvarez, S. F. (2005) Actin and non-muscle myosin II facilitate apical exocytosis of tear proteins in rabbit lacrimal acinar epithelial cells. J Cell Sci 118, 4797-4812

100. Nightingale, T. D., White, I. J., Doyle, E. L., Turmaine, M., Harrison-Lavoie, K. J., Webb, K. F., Cramer, L. P., and Cutler, D. F. (2011) Actomyosin II contractility expels von Willebrand factor from Weibel-Palade bodies during exocytosis. J Cell Biol 194, 613-629

101. Nemoto, T., Kojima, T., Oshima, A., Bito, H., and Kasai, H. (2004) Stabilization of exocytosis by dynamic F-actin coating of zymogen granules in pancreatic acini. J Biol Chem 279, 37544-37550

102. Sokac, A. M., Co, C., Taunton, J., and Bement, W. (2003) Cdc42-dependent actin polymerization during compensatory endocytosis in Xenopus eggs. Nat Cell Biol 5, 727-732

103. Abdel-Latif, D., Steward, M., Macdonald, D. L., Francis, G. A., Dinauer, M. C., and Lacy, P. (2004) Rac2 is critical for neutrophil primary granule exocytosis. Blood 104, 832-839

104. Schuh, M. (2011) An actin-dependent mechanism for long-range vesicle transport. Nat Cell Biol 13, 1431-1436

105. Collins, A., Warrington, A., Taylor, K. A., and Svitkina, T. (2011) Structural organization of the actin cytoskeleton at sites of clathrin-mediated endocytosis. Curr Biol 21, 1167-1175

106. Aghamohammadzadeh, S., and Ayscough, K. R. (2009) Differential requirements for actin during yeast and mammalian endocytosis. Nat Cell Biol 11, 1039-1042

107. Hussain, N. K., Jenna, S., Glogauer, M., Quinn, C. C., Wasiak, S., Guipponi, M., Antonarakis, S. E., Kay, B. K., Stossel, T. P., Lamarche-Vane, N., and McPherson, P. S. (2001) Endocytic protein intersectin-l regulates actin assembly via Cdc42 and N-WASP. Nat Cell Biol 3, 927-932

108. Bu, W., Lim, K. B., Yu, Y. H., Chou, A. M., Sudhaharan, T., and Ahmed, S. (2010) Cdc42 interaction with N-WASP and Toca-1 regulates membrane tubulation, vesicle formation and vesicle motility: implications for endocytosis. PLoS One 5, e12153

109. Morel, E., Parton, R. G., and Gruenberg, J. (2009) Annexin A2-dependent polymerization of actin mediates endosome biogenesis. Dev Cell 16, 445-457

110. Fernandez-Borja, M., Janssen, L., Verwoerd, D., Hordijk, P., and Neefjes, J. (2005) RhoB regulates endosome transport by promoting actin assembly on endosomal membranes through Dia1. J Cell Sci 118, 2661-2670

111. Dubois, T., Paleotti, O., Mironov, A. A., Fraisier, V., Stradal, T. E., De Matteis, M. A., Franco, M., and Chavrier, P. (2005) Golgi-localized GAP for Cdc42 functions downstream of ARF1 to control Arp2/3 complex and F-actin dynamics. Nat Cell Biol 7, 353-364

152

112. Myers, K. R., and Casanova, J. E. (2008) Regulation of actin cytoskeleton dynamics by Arf-family GTPases. Trends Cell Biol 18, 184-192

113. von Blume, J., Alleaume, A. M., Cantero-Recasens, G., Curwin, A., Carreras-Sureda, A., Zimmermann, T., van Galen, J., Wakana, Y., Valverde, M. A., and Malhotra, V. (2011) ADF/cofilin regulates secretory cargo sorting at the TGN via the Ca2+ ATPase SPCA1. Dev Cell 20, 652-662

114. Postic, C., and Girard, J. (2008) Contribution of de novo fatty acid synthesis to hepatic steatosis and insulin resistance: lessons from genetically engineered mice. J Clin Invest 118, 829-838

115. Yu, J., and Auwerx, J. (2009) The role of sirtuins in the control of metabolic homeostasis. Ann N Y Acad Sci 1173 Suppl 1, E10-19

116. Uldry, M., and Thorens, B. (2004) The SLC2 family of facilitated hexose and polyol transporters. Pflugers Arch 447, 480-489

117. Manolescu, A. R., Witkowska, K., Kinnaird, A., Cessford, T., and Cheeseman, C. (2007) Facilitated hexose transporters: new perspectives on form and function. Physiology (Bethesda) 22, 234-240

118. Chen, C., Pore, N., Behrooz, A., Ismail-Beigi, F., and Maity, A. (2001) Regulation of glut1 mRNA by hypoxia-inducible factor-1. Interaction between H-ras and hypoxia. J Biol Chem 276, 9519-9525

119. Simpson, I. A., Appel, N. M., Hokari, M., Oki, J., Holman, G. D., Maher, F., Koehler-Stec, E. M., Vannucci, S. J., and Smith, Q. R. (1999) Blood-brain barrier glucose transporter: effects of hypo- and hyperglycemia revisited. J Neurochem 72, 238-247

120. Santer, R., Groth, S., Kinner, M., Dombrowski, A., Berry, G. T., Brodehl, J., Leonard, J. V., Moses, S., Norgren, S., Skovby, F., Schneppenheim, R., Steinmann, B., and Schaub, J. (2002) The mutation spectrum of the facilitative glucose transporter gene SLC2A2 (GLUT2) in patients with Fanconi-Bickel syndrome. Hum Genet 110, 21-29

121. Gouyon, F., Caillaud, L., Carriere, V., Klein, C., Dalet, V., Citadelle, D., Kellett, G. L., Thorens, B., Leturque, A., and Brot-Laroche, E. (2003) Simple-sugar meals target GLUT2 at enterocyte apical membranes to improve sugar absorption: a study in GLUT2-null mice. J Physiol 552, 823-832

122. Henquin, J. C., Ravier, M. A., Nenquin, M., Jonas, J. C., and Gilon, P. (2003) Hierarchy of the beta-cell signals controlling insulin secretion. Eur J Clin Invest 33, 742-750

123. Guillam, M. T., Hummler, E., Schaerer, E., Yeh, J. I., Birnbaum, M. J., Beermann, F., Schmidt, A., Deriaz, N., and Thorens, B. (1997) Early diabetes and abnormal postnatal pancreatic islet development in mice lacking Glut-2. Nat Genet 17, 327-330

124. Simpson, I. A., Dwyer, D., Malide, D., Moley, K. H., Travis, A., and Vannucci, S. J. (2008) The facilitative glucose transporter GLUT3: 20 years of distinction. Am J Physiol Endocrinol Metab 295, E242-253

125. Maratou, E., Dimitriadis, G., Kollias, A., Boutati, E., Lambadiari, V., Mitrou, P., and Raptis, S. A. (2007) Glucose transporter expression on the plasma membrane of resting and activated white blood cells. Eur J Clin Invest 37, 282-290

126. Kraegen, E. W., James, D. E., Jenkins, A. B., and Chisholm, D. J. (1985) Dose-response curves for in vivo insulin sensitivity in individual tissues in rats. Am J Physiol 248, E353-362

127. Katz, L. D., Glickman, M. G., Rapoport, S., Ferrannini, E., and DeFronzo, R. A. (1983) Splanchnic and peripheral disposal of oral glucose in man. Diabetes 32, 675-679

128. Ferrannini, E., Bjorkman, O., Reichard, G. A., Jr., Pilo, A., Olsson, M., Wahren, J., and DeFronzo, R. A. (1985) The disposal of an oral glucose load in healthy subjects. A quantitative study. Diabetes 34, 580-588

129. Wang, Q., Khayat, Z., Kishi, K., Ebina, Y., and Klip, A. (1998) GLUT4 translocation by insulin in intact muscle cells: detection by a fast and quantitative assay. FEBS Lett 427, 193-197

130. Guma, A., Zierath, J. R., Wallberg-Henriksson, H., and Klip, A. (1995) Insulin induces translocation of GLUT-4 glucose transporters in human skeletal muscle. Am J Physiol 268, E613-622

153

131. Zaid, H., Antonescu, C. N., Randhawa, V. K., and Klip, A. (2008) Insulin action on glucose transporters through molecular switches, tracks and tethers. Biochem J 413, 201-215

132. Sargeant, R. J., and Paquet, M. R. (1993) Effect of insulin on the rates of synthesis and degradation of GLUT1 and GLUT4 glucose transporters in 3T3-L1 adipocytes. Biochem J 290 ( Pt 3), 913-919

133. Zeigerer, A., Lampson, M. A., Karylowski, O., Sabatini, D. D., Adesnik, M., Ren, M., and McGraw, T. E. (2002) GLUT4 retention in adipocytes requires two intracellular insulin-regulated transport steps. Mol Biol Cell 13, 2421-2435

134. Shewan, A. M., van Dam, E. M., Martin, S., Luen, T. B., Hong, W., Bryant, N. J., and James, D. E. (2003) GLUT4 recycles via a trans-Golgi network (TGN) subdomain enriched in Syntaxins 6 and 16 but not TGN38: involvement of an acidic targeting motif. Mol Biol Cell 14, 973-986

135. Martin, S., Tellam, J., Livingstone, C., Slot, J. W., Gould, G. W., and James, D. E. (1996) The glucose transporter (GLUT-4) and vesicle-associated membrane protein-2 (VAMP-2) are segregated from recycling endosomes in insulin-sensitive cells. J Cell Biol 134, 625-635

136. Subtil, A., Lampson, M. A., Keller, S. R., and McGraw, T. E. (2000) Characterization of the insulin-regulated endocytic recycling mechanism in 3T3-L1 adipocytes using a novel reporter molecule. J Biol Chem 275, 4787-4795

137. Coster, A. C., Govers, R., and James, D. E. (2004) Insulin stimulates the entry of GLUT4 into the endosomal recycling pathway by a quantal mechanism. Traffic 5, 763-771

138. Blot, V., and McGraw, T. E. (2008) Molecular mechanisms controlling GLUT4 intracellular retention. Mol Biol Cell 19, 3477-3487

139. Foster, L. J., Li, D., Randhawa, V. K., and Klip, A. (2001) Insulin accelerates inter-endosomal GLUT4 traffic via phosphatidylinositol 3-kinase and protein kinase B. J Biol Chem 276, 44212-44221

140. Muretta, J. M., Romenskaia, I., and Mastick, C. C. (2008) Insulin releases Glut4 from static storage compartments into cycling endosomes and increases the rate constant for Glut4 exocytosis. J Biol Chem 283, 311-323

141. Antonescu, C. N., Foti, M., Sauvonnet, N., and Klip, A. (2009) Ready, set, internalize: mechanisms and regulation of GLUT4 endocytosis. Biosci Rep 29, 1-11

142. Foley, K., Boguslavsky, S., and Klip, A. (2011) Endocytosis, recycling, and regulated exocytosis of glucose transporter 4. Biochemistry 50, 3048-3061

143. Leto, D., and Saltiel, A. R. (2012) Regulation of glucose transport by insulin: traffic control of GLUT4. Nat Rev Mol Cell Biol 13, 383-396

144. Thirone, A. C., Huang, C., and Klip, A. (2006) Tissue-specific roles of IRS proteins in insulin signaling and glucose transport. Trends Endocrinol Metab 17, 72-78

145. Huang, C., Thirone, A. C., Huang, X., and Klip, A. (2005) Differential contribution of insulin receptor substrates 1 versus 2 to insulin signaling and glucose uptake in l6 myotubes. J Biol Chem 280, 19426-19435

146. Tsakiridis, T., McDowell, H. E., Walker, T., Downes, C. P., Hundal, H. S., Vranic, M., and Klip, A. (1995) Multiple roles of phosphatidylinositol 3-kinase in regulation of glucose transport, amino acid transport, and glucose transporters in L6 skeletal muscle cells. Endocrinology 136, 4315-4322

147. Wang, Q., Somwar, R., Bilan, P. J., Liu, Z., Jin, J., Woodgett, J. R., and Klip, A. (1999) Protein kinase B/Akt participates in GLUT4 translocation by insulin in L6 myoblasts. Mol Cell Biol 19, 4008-4018

148. Frevert, E. U., and Kahn, B. B. (1997) Differential effects of constitutively active phosphatidylinositol 3-kinase on glucose transport, glycogen synthase activity, and DNA synthesis in 3T3-L1 adipocytes. Mol Cell Biol 17, 190-198

154

149. Alessi, D. R., James, S. R., Downes, C. P., Holmes, A. B., Gaffney, P. R., Reese, C. B., and Cohen, P. (1997) Characterization of a 3-phosphoinositide-dependent protein kinase which phosphorylates and activates protein kinase Balpha. Curr Biol 7, 261-269

150. Sarbassov, D. D., Guertin, D. A., Ali, S. M., and Sabatini, D. M. (2005) Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science 307, 1098-1101

151. Cho, H., Mu, J., Kim, J. K., Thorvaldsen, J. L., Chu, Q., Crenshaw, E. B., 3rd, Kaestner, K. H., Bartolomei, M. S., Shulman, G. I., and Birnbaum, M. J. (2001) Insulin resistance and a diabetes mellitus-like syndrome in mice lacking the protein kinase Akt2 (PKB beta). Science 292, 1728-1731

152. Manning, B. D., and Cantley, L. C. (2007) AKT/PKB signaling: navigating downstream. Cell 129, 1261-1274

153. Karlsson, H. K., Zierath, J. R., Kane, S., Krook, A., Lienhard, G. E., and Wallberg-Henriksson, H. (2005) Insulin-stimulated phosphorylation of the Akt substrate AS160 is impaired in skeletal muscle of type 2 diabetic subjects. Diabetes 54, 1692-1697

154. Sano, H., Kane, S., Sano, E., Miinea, C. P., Asara, J. M., Lane, W. S., Garner, C. W., and Lienhard, G. E. (2003) Insulin-stimulated phosphorylation of a Rab GTPase-activating protein regulates GLUT4 translocation. J Biol Chem 278, 14599-14602

155. Miinea, C. P., Sano, H., Kane, S., Sano, E., Fukuda, M., Peranen, J., Lane, W. S., and Lienhard, G. E. (2005) AS160, the Akt substrate regulating GLUT4 translocation, has a functional Rab GTPase-activating protein domain. Biochem J 391, 87-93

156. Sun, Y., Bilan, P. J., Liu, Z., and Klip, A. (2010) Rab8A and Rab13 are activated by insulin and regulate GLUT4 translocation in muscle cells. Proc Natl Acad Sci U S A 107, 19909-19914

157. Ishikura, S., and Klip, A. (2008) Muscle cells engage Rab8A and myosin Vb in insulin-dependent GLUT4 translocation. Am J Physiol Cell Physiol 295, C1016-1025

158. Sano, H., Eguez, L., Teruel, M. N., Fukuda, M., Chuang, T. D., Chavez, J. A., Lienhard, G. E., and McGraw, T. E. (2007) Rab10, a target of the AS160 Rab GAP, is required for insulin-stimulated translocation of GLUT4 to the adipocyte plasma membrane. Cell Metab 5, 293-303

159. Chen, Y., Wang, Y., Zhang, J., Deng, Y., Jiang, L., Song, E., Wu, X. S., Hammer, J. A., Xu, T., and Lippincott-Schwartz, J. (2012) Rab10 and myosin-Va mediate insulin-stimulated GLUT4 storage vesicle translocation in adipocytes. J Cell Biol 198, 545-560

160. Tsakiridis, T., Vranic, M., and Klip, A. (1994) Disassembly of the actin network inhibits insulin-dependent stimulation of glucose transport and prevents recruitment of glucose transporters to the plasma membrane. J Biol Chem 269, 29934-29942

161. Khayat, Z. A., Tong, P., Yaworsky, K., Bloch, R. J., and Klip, A. (2000) Insulin-induced actin filament remodeling colocalizes actin with phosphatidylinositol 3-kinase and GLUT4 in L6 myotubes. J Cell Sci 113 Pt 2, 279-290

162. Patel, N., Rudich, A., Khayat, Z. A., Garg, R., and Klip, A. (2003) Intracellular segregation of phosphatidylinositol-3,4,5-trisphosphate by insulin-dependent actin remodeling in L6 skeletal muscle cells. Mol Cell Biol 23, 4611-4626

163. Wang, Q., Bilan, P. J., Tsakiridis, T., Hinek, A., and Klip, A. (1998) Actin filaments participate in the relocalization of phosphatidylinositol3-kinase to glucose transporter-containing compartments and in the stimulation of glucose uptake in 3T3-L1 adipocytes. Biochem J 331 ( Pt 3), 917-928

164. Kanzaki, M., and Pessin, J. E. (2001) Insulin-stimulated GLUT4 translocation in adipocytes is dependent upon cortical actin remodeling. J Biol Chem 276, 42436-42444

165. Tong, P., Khayat, Z. A., Huang, C., Patel, N., Ueyama, A., and Klip, A. (2001) Insulin-induced cortical actin remodeling promotes GLUT4 insertion at muscle cell membrane ruffles. J Clin Invest 108, 371-381

155

166. Torok, D., Patel, N., Jebailey, L., Thong, F. S., Randhawa, V. K., Klip, A., and Rudich, A. (2004) Insulin but not PDGF relies on actin remodeling and on VAMP2 for GLUT4 translocation in myoblasts. J Cell Sci 117, 5447-5455

167. Brozinick, J. T., Jr., Hawkins, E. D., Strawbridge, A. B., and Elmendorf, J. S. (2004) Disruption of cortical actin in skeletal muscle demonstrates an essential role of the cytoskeleton in glucose transporter 4 translocation in insulin-sensitive tissues. J Biol Chem 279, 40699-40706

168. Omata, W., Shibata, H., Li, L., Takata, K., and Kojima, I. (2000) Actin filaments play a critical role in insulin-induced exocytotic recruitment but not in endocytosis of GLUT4 in isolated rat adipocytes. Biochem J 346 Pt 2, 321-328

169. Kanzaki, M., Watson, R. T., Hou, J. C., Stamnes, M., Saltiel, A. R., and Pessin, J. E. (2002) Small GTP-binding protein TC10 differentially regulates two distinct populations of filamentous actin in 3T3L1 adipocytes. Mol Biol Cell 13, 2334-2346

170. Chang, L., Chiang, S. H., and Saltiel, A. R. (2007) TC10alpha is required for insulin-stimulated glucose uptake in adipocytes. Endocrinology 148, 27-33

171. Chiang, S. H., Baumann, C. A., Kanzaki, M., Thurmond, D. C., Watson, R. T., Neudauer, C. L., Macara, I. G., Pessin, J. E., and Saltiel, A. R. (2001) Insulin-stimulated GLUT4 translocation requires the CAP-dependent activation of TC10. Nature 410, 944-948

172. Mitra, P., Zheng, X., and Czech, M. P. (2004) RNAi-based analysis of CAP, Cbl, and CrkII function in the regulation of GLUT4 by insulin. J Biol Chem 279, 37431-37435

173. Chunqiu Hou, J., and Pessin, J. E. (2003) Lipid Raft targeting of the TC10 amino terminal domain is responsible for disruption of adipocyte cortical actin. Mol Biol Cell 14, 3578-3591

174. Balamatsias, D., Kong, A. M., Waters, J. E., Sriratana, A., Gurung, R., Bailey, C. G., Rasko, J. E., Tiganis, T., Macaulay, S. L., and Mitchell, C. A. (2011) Identification of P-Rex1 as a novel Rac1-guanine nucleotide exchange factor (GEF) that promotes actin remodeling and GLUT4 protein trafficking in adipocytes. J Biol Chem 286, 43229-43240

175. JeBailey, L., Rudich, A., Huang, X., Di Ciano-Oliveira, C., Kapus, A., and Klip, A. (2004) Skeletal muscle cells and adipocytes differ in their reliance on TC10 and Rac for insulin-induced actin remodeling. Mol Endocrinol 18, 359-372

176. Ishikura, S., Koshkina, A., and Klip, A. (2008) Small G proteins in insulin action: Rab and Rho families at the crossroads of signal transduction and GLUT4 vesicle traffic. Acta Physiol (Oxf) 192, 61-74

177. JeBailey, L., Wanono, O., Niu, W., Roessler, J., Rudich, A., and Klip, A. (2007) Ceramide- and oxidant-induced insulin resistance involve loss of insulin-dependent Rac-activation and actin remodeling in muscle cells. Diabetes 56, 394-403

178. Ueda, S., Kitazawa, S., Ishida, K., Nishikawa, Y., Matsui, M., Matsumoto, H., Aoki, T., Nozaki, S., Takeda, T., Tamori, Y., Aiba, A., Kahn, C. R., Kataoka, T., and Satoh, T. (2010) Crucial role of the small GTPase Rac1 in insulin-stimulated translocation of glucose transporter 4 to the mouse skeletal muscle sarcolemma. FASEB J 24, 2254-2261

179. Sylow, L., Jensen, T. E., Kleinert, M., Hojlund, K., Kiens, B., Wojtaszewski, J., Prats, C., Schjerling, P., and Richter, E. A. (2013) Rac1 signaling is required for insulin-stimulated glucose uptake and is dysregulated in insulin resistant murine and human skeletal muscle. Diabetes

180. Rossman, K. L., Der, C. J., and Sondek, J. (2005) GEF means go: turning on RHO GTPases with guanine nucleotide-exchange factors. Nat Rev Mol Cell Biol 6, 167-180

181. Ueda, S., Kataoka, T., and Satoh, T. (2008) Activation of the small GTPase Rac1 by a specific guanine-nucleotide-exchange factor suffices to induce glucose uptake into skeletal-muscle cells. Biol Cell 100, 645-657

156

182. Chiu, T. T., Sun, Y., Koshkina, A., and Klip, A. (2013) Rac-1 superactivation triggers insulin-independent GLUT4 translocation that bypasses signalling defects exerted by JNK- and ceramide-induced insulin resistance. J Biol Chem

183. Nozaki, S., Takeda, T., Kitaura, T., Takenaka, N., Kataoka, T., and Satoh, T. (2013) Akt2 regulates Rac1 activity in the insulin-dependent signaling pathway leading to GLUT4 translocation to the plasma membrane in skeletal muscle cells. Cell Signal 25, 1361-1371

184. Barnett, S. F., Defeo-Jones, D., Fu, S., Hancock, P. J., Haskell, K. M., Jones, R. E., Kahana, J. A., Kral, A. M., Leander, K., Lee, L. L., Malinowski, J., McAvoy, E. M., Nahas, D. D., Robinson, R. G., and Huber, H. E. (2005) Identification and characterization of pleckstrin-homology-domain-dependent and isoenzyme-specific Akt inhibitors. Biochem J 385, 399-408

185. Kau, T. R., Schroeder, F., Ramaswamy, S., Wojciechowski, C. L., Zhao, J. J., Roberts, T. M., Clardy, J., Sellers, W. R., and Silver, P. A. (2003) A chemical genetic screen identifies inhibitors of regulated nuclear export of a Forkhead transcription factor in PTEN-deficient tumor cells. Cancer Cell 4, 463-476

186. Grusovin, J., and Macaulay, S. L. (2003) Snares for GLUT4--mechanisms directing vesicular trafficking of GLUT4. Front Biosci 8, d620-641

187. Randhawa, V. K., Ishikura, S., Talior-Volodarsky, I., Cheng, A. W., Patel, N., Hartwig, J. H., and Klip, A. (2008) GLUT4 vesicle recruitment and fusion are differentially regulated by Rac, AS160, and Rab8A in muscle cells. J Biol Chem 283, 27208-27219

188. Talior-Volodarsky, I., Randhawa, V. K., Zaid, H., and Klip, A. (2008) Alpha-actinin-4 is selectively required for insulin-induced GLUT4 translocation. J Biol Chem 283, 25115-25123

189. Foster, L. J., Rudich, A., Talior, I., Patel, N., Huang, X., Furtado, L. M., Bilan, P. J., Mann, M., and Klip, A. (2006) Insulin-dependent interactions of proteins with GLUT4 revealed through stable isotope labeling by amino acids in cell culture (SILAC). J Proteome Res 5, 64-75

190. Bose, A., Robida, S., Furcinitti, P. S., Chawla, A., Fogarty, K., Corvera, S., and Czech, M. P. (2004) Unconventional myosin Myo1c promotes membrane fusion in a regulated exocytic pathway. Mol Cell Biol 24, 5447-5458

191. Boguslavsky, S., Chiu, T., Foley, K. P., Osorio-Fuentealba, C., Antonescu, C. N., Bayer, K. U., Bilan, P. J., and Klip, A. (2012) Myo1c binding to submembrane actin mediates insulin-induced tethering of GLUT4 vesicles. Mol Biol Cell 23, 4065-4078

192. Fujita, H., Hatakeyama, H., Watanabe, T. M., Sato, M., Higuchi, H., and Kanzaki, M. (2010) Identification of three distinct functional sites of insulin-mediated GLUT4 trafficking in adipocytes using quantitative single molecule imaging. Mol Biol Cell 21, 2721-2731

193. Burchfield, J. G., Lu, J., Fazakerley, D. J., Tan, S. X., Ng, Y., Mele, K., Buckley, M. J., Han, W., Hughes, W. E., and James, D. E. (2013) Novel systems for dynamically assessing insulin action in live cells reveals heterogeneity in the insulin response. Traffic 14, 259-273

194. Lopez, J. A., Burchfield, J. G., Blair, D. H., Mele, K., Ng, Y., Vallotton, P., James, D. E., and Hughes, W. E. (2009) Identification of a distal GLUT4 trafficking event controlled by actin polymerization. Mol Biol Cell 20, 3918-3929

195. Lizunov, V. A., Stenkula, K., Troy, A., Cushman, S. W., and Zimmerberg, J. (2013) Insulin regulates glut4 confinement in plasma membrane clusters in adipose cells. PLoS One 8, e57559

196. Loubery, S., and Coudrier, E. (2008) Myosins in the secretory pathway: tethers or transporters? Cell Mol Life Sci 65, 2790-2800

197. Yoshizaki, T., Imamura, T., Babendure, J. L., Lu, J. C., Sonoda, N., and Olefsky, J. M. (2007) Myosin 5a is an insulin-stimulated Akt2 (protein kinase Bbeta) substrate modulating GLUT4 vesicle translocation. Mol Cell Biol 27, 5172-5183

157

198. Xu, Y. K., Xu, K. D., Li, J. Y., Feng, L. Q., Lang, D., and Zheng, X. X. (2007) Bi-directional transport of GLUT4 vesicles near the plasma membrane of primary rat adipocytes. Biochem Biophys Res Commun 359, 121-128

199. Semiz, S., Park, J. G., Nicoloro, S. M., Furcinitti, P., Zhang, C., Chawla, A., Leszyk, J., and Czech, M. P. (2003) Conventional kinesin KIF5B mediates insulin-stimulated GLUT4 movements on microtubules. EMBO J 22, 2387-2399

200. DeFronzo, R. A., Gunnarsson, R., Bjorkman, O., Olsson, M., and Wahren, J. (1985) Effects of insulin on peripheral and splanchnic glucose metabolism in noninsulin-dependent (type II) diabetes mellitus. J Clin Invest 76, 149-155

201. Muoio, D. M., and Newgard, C. B. (2006) Obesity-related derangements in metabolic regulation. Annu Rev Biochem 75, 367-401

202. Lumeng, C. N., and Saltiel, A. R. (2011) Inflammatory links between obesity and metabolic disease. J Clin Invest 121, 2111-2117

203. Dimopoulos, N., Watson, M., Sakamoto, K., and Hundal, H. S. (2006) Differential effects of palmitate and palmitoleate on insulin action and glucose utilization in rat L6 skeletal muscle cells. Biochem J 399, 473-481

204. Watson, M. L., Coghlan, M., and Hundal, H. S. (2009) Modulating serine palmitoyl transferase (SPT) expression and activity unveils a crucial role in lipid-induced insulin resistance in rat skeletal muscle cells. Biochem J 417, 791-801

205. Chavez, J. A., Knotts, T. A., Wang, L. P., Li, G., Dobrowsky, R. T., Florant, G. L., and Summers, S. A. (2003) A role for ceramide, but not diacylglycerol, in the antagonism of insulin signal transduction by saturated fatty acids. J Biol Chem 278, 10297-10303

206. Hoehn, K. L., Hohnen-Behrens, C., Cederberg, A., Wu, L. E., Turner, N., Yuasa, T., Ebina, Y., and James, D. E. (2008) IRS1-independent defects define major nodes of insulin resistance. Cell Metab 7, 421-433

207. Samokhvalov, V., Bilan, P. J., Schertzer, J. D., Antonescu, C. N., and Klip, A. (2009) Palmitate- and lipopolysaccharide-activated macrophages evoke contrasting insulin responses in muscle cells. Am J Physiol Endocrinol Metab 296, E37-46

208. Tan, S. X., Ng, Y., Meoli, C. C., Kumar, A., Khoo, P. S., Fazakerley, D. J., Junutula, J. R., Vali, S., James, D. E., and Stockli, J. (2012) Amplification and demultiplexing in insulin-regulated Akt protein kinase pathway in adipocytes. J Biol Chem 287, 6128-6138

209. Ng, Y., Ramm, G., Burchfield, J. G., Coster, A. C., Stockli, J., and James, D. E. (2010) Cluster analysis of insulin action in adipocytes reveals a key role for Akt at the plasma membrane. J Biol Chem 285, 2245-2257

210. Somwar, R., Niu, W., Kim, D. Y., Sweeney, G., Randhawa, V. K., Huang, C., Ramlal, T., and Klip, A. (2001) Differential effects of phosphatidylinositol 3-kinase inhibition on intracellular signals regulating GLUT4 translocation and glucose transport. J Biol Chem 276, 46079-46087

211. Newsholme, P., Gaudel, C., and Krause, M. (2012) Mitochondria and diabetes. An intriguing pathogenetic role. Adv Exp Med Biol 942, 235-247

212. Chavez, J. A., and Summers, S. A. (2012) A ceramide-centric view of insulin resistance. Cell Metab 15, 585-594

213. Meberg, P. J., Ono, S., Minamide, L. S., Takahashi, M., and Bamburg, J. R. (1998) Actin depolymerizing factor and cofilin phosphorylation dynamics: response to signals that regulate neurite extension. Cell Motil Cytoskeleton 39, 172-190

214. Shaw, A. E., Minamide, L. S., Bill, C. L., Funk, J. D., Maiti, S., and Bamburg, J. R. (2004) Cross-reactivity of antibodies to actin- depolymerizing factor/cofilin family proteins and identification of the major epitope recognized by a mammalian actin-depolymerizing factor/cofilin antibody. Electrophoresis 25, 2611-2620

158

215. Ashworth, S. L., Southgate, E. L., Sandoval, R. M., Meberg, P. J., Bamburg, J. R., and Molitoris, B. A. (2003) ADF/cofilin mediates actin cytoskeletal alterations in LLC-PK cells during ATP depletion. Am J Physiol Renal Physiol 284, F852-862

216. Inoue, T., Heo, W. D., Grimley, J. S., Wandless, T. J., and Meyer, T. (2005) An inducible translocation strategy to rapidly activate and inhibit small GTPase signaling pathways. Nat Methods 2, 415-418

217. Henstridge, D. C., Bruce, C. R., Pang, C. P., Lancaster, G. I., Allen, T. L., Estevez, E., Gardner, T., Weir, J. M., Meikle, P. J., Lam, K. S., Xu, A., Fujii, N., Goodyear, L. J., and Febbraio, M. A. (2012) Skeletal muscle-specific overproduction of constitutively activated c-Jun N-terminal kinase (JNK) induces insulin resistance in mice. Diabetologia 55, 2769-2778

218. Korobova, F., and Svitkina, T. (2008) Arp2/3 complex is important for filopodia formation, growth cone motility, and neuritogenesis in neuronal cells. Mol Biol Cell 19, 1561-1574

219. Ueyama, A., Yaworsky, K. L., Wang, Q., Ebina, Y., and Klip, A. (1999) GLUT-4myc ectopic expression in L6 myoblasts generates a GLUT-4-specific pool conferring insulin sensitivity. Am J Physiol 277, E572-578

220. Yan, Q., Sun, W., Kujala, P., Lotfi, Y., Vida, T. A., and Bean, A. J. (2005) CART: an Hrs/actinin-4/BERP/myosin V protein complex required for efficient receptor recycling. Mol Biol Cell 16, 2470-2482

221. Larance, M., Ramm, G., and James, D. E. (2008) The GLUT4 code. Mol Endocrinol 22, 226-233 222. Huang, S., and Czech, M. P. (2007) The GLUT4 glucose transporter. Cell Metab 5, 237-252 223. Garvey, W. T., Maianu, L., Zhu, J. H., Brechtel-Hook, G., Wallace, P., and Baron, A. D. (1998)

Evidence for defects in the trafficking and translocation of GLUT4 glucose transporters in skeletal muscle as a cause of human insulin resistance. J Clin Invest 101, 2377-2386

224. Klip, A., Ramlal, T., Bilan, P. J., Cartee, G. D., Gulve, E. A., and Holloszy, J. O. (1990) Recruitment of GLUT-4 glucose transporters by insulin in diabetic rat skeletal muscle. Biochem Biophys Res Commun 172, 728-736

225. Zierath, J. R., He, L., Guma, A., Odegoard Wahlstrom, E., Klip, A., and Wallberg-Henriksson, H. (1996) Insulin action on glucose transport and plasma membrane GLUT4 content in skeletal muscle from patients with NIDDM. Diabetologia 39, 1180-1189

226. Mora, S., and Pessin, J. E. (2002) An adipocentric view of signaling and intracellular trafficking. Diabetes Metab Res Rev 18, 345-356

227. Patel, N., Huang, C., and Klip, A. (2006) Cellular location of insulin-triggered signals and implications for glucose uptake. Pflugers Arch 451, 499-510

228. Krook, A., Wallberg-Henriksson, H., and Zierath, J. R. (2004) Sending the signal: molecular mechanisms regulating glucose uptake. Med Sci Sports Exerc 36, 1212-1217

229. Ruderman, N. B., Kapeller, R., White, M. F., and Cantley, L. C. (1990) Activation of phosphatidylinositol 3-kinase by insulin. Proc Natl Acad Sci U S A 87, 1411-1415

230. Thong, F. S., Bilan, P. J., and Klip, A. (2007) The Rab GTPase-activating protein AS160 integrates Akt, protein kinase C, and AMP-activated protein kinase signals regulating GLUT4 traffic. Diabetes 56, 414-423

231. Ishikura, S., Bilan, P. J., and Klip, A. (2007) Rabs 8A and 14 are targets of the insulin-regulated Rab-GAP AS160 regulating GLUT4 traffic in muscle cells. Biochem Biophys Res Commun 353, 1074-1079

232. Gonzalez, E., and McGraw, T. E. (2006) Insulin signaling diverges into Akt-dependent and -independent signals to regulate the recruitment/docking and the fusion of GLUT4 vesicles to the plasma membrane. Mol Biol Cell 17, 4484-4493

233. Bernards, A., and Settleman, J. (2004) GAP control: regulating the regulators of small GTPases. Trends Cell Biol 14, 377-385

159

234. Goley, E. D., and Welch, M. D. (2006) The ARP2/3 complex: an actin nucleator comes of age. Nat Rev Mol Cell Biol 7, 713-726

235. Insall, R. H., and Machesky, L. M. (2009) Actin dynamics at the leading edge: from simple machinery to complex networks. Dev Cell 17, 310-322

236. Pollard, T. D. (2007) Regulation of actin filament assembly by Arp2/3 complex and formins. Annu Rev Biophys Biomol Struct 36, 451-477

237. Nishita, M., Wang, Y., Tomizawa, C., Suzuki, A., Niwa, R., Uemura, T., and Mizuno, K. (2004) Phosphoinositide 3-kinase-mediated activation of cofilin phosphatase Slingshot and its role for insulin-induced membrane protrusion. J Biol Chem 279, 7193-7198

238. Van Troys, M., Huyck, L., Leyman, S., Dhaese, S., Vandekerkhove, J., and Ampe, C. (2008) Ins and outs of ADF/cofilin activity and regulation. Eur J Cell Biol 87, 649-667

239. Kurita, S., Watanabe, Y., Gunji, E., Ohashi, K., and Mizuno, K. (2008) Molecular dissection of the mechanisms of substrate recognition and F-actin-mediated activation of cofilin-phosphatase Slingshot-1. J Biol Chem 283, 32542-32552

240. Nagata-Ohashi, K., Ohta, Y., Goto, K., Chiba, S., Mori, R., Nishita, M., Ohashi, K., Kousaka, K., Iwamatsu, A., Niwa, R., Uemura, T., and Mizuno, K. (2004) A pathway of neuregulin-induced activation of cofilin-phosphatase Slingshot and cofilin in lamellipodia. J Cell Biol 165, 465-471

241. Sidani, M., Wessels, D., Mouneimne, G., Ghosh, M., Goswami, S., Sarmiento, C., Wang, W., Kuhl, S., El-Sibai, M., Backer, J. M., Eddy, R., Soll, D., and Condeelis, J. (2007) Cofilin determines the migration behavior and turning frequency of metastatic cancer cells. J Cell Biol 179, 777-791

242. Nishita, M., Tomizawa, C., Yamamoto, M., Horita, Y., Ohashi, K., and Mizuno, K. (2005) Spatial and temporal regulation of cofilin activity by LIM kinase and Slingshot is critical for directional cell migration. J Cell Biol 171, 349-359

243. McCarthy, A. M., Spisak, K. O., Brozinick, J. T., and Elmendorf, J. S. (2006) Loss of cortical actin filaments in insulin-resistant skeletal muscle cells impairs GLUT4 vesicle trafficking and glucose transport. Am J Physiol Cell Physiol 291, C860-868

244. Ridley, A. J., Paterson, H. F., Johnston, C. L., Diekmann, D., and Hall, A. (1992) The small GTP-binding protein rac regulates growth factor-induced membrane ruffling. Cell 70, 401-410

245. Jiang, Z. Y., Chawla, A., Bose, A., Way, M., and Czech, M. P. (2002) A phosphatidylinositol 3-kinase-independent insulin signaling pathway to N-WASP/Arp2/3/F-actin required for GLUT4 glucose transporter recycling. J Biol Chem 277, 509-515

246. Machesky, L. M., Mullins, R. D., Higgs, H. N., Kaiser, D. A., Blanchoin, L., May, R. C., Hall, M. E., and Pollard, T. D. (1999) Scar, a WASp-related protein, activates nucleation of actin filaments by the Arp2/3 complex. Proc Natl Acad Sci U S A 96, 3739-3744

247. Suetsugu, S., Miki, H., and Takenawa, T. (1999) Identification of two human WAVE/SCAR homologues as general actin regulatory molecules which associate with the Arp2/3 complex. Biochem Biophys Res Commun 260, 296-302

248. Weed, S. A., Karginov, A. V., Schafer, D. A., Weaver, A. M., Kinley, A. W., Cooper, J. A., and Parsons, J. T. (2000) Cortactin localization to sites of actin assembly in lamellipodia requires interactions with F-actin and the Arp2/3 complex. J Cell Biol 151, 29-40

249. Soosairajah, J., Maiti, S., Wiggan, O., Sarmiere, P., Moussi, N., Sarcevic, B., Sampath, R., Bamburg, J. R., and Bernard, O. (2005) Interplay between components of a novel LIM kinase-slingshot phosphatase complex regulates cofilin. Embo J 24, 473-486

250. Jovceva, E., Larsen, M. R., Waterfield, M. D., Baum, B., and Timms, J. F. (2007) Dynamic cofilin phosphorylation in the control of lamellipodial actin homeostasis. J Cell Sci 120, 1888-1897

251. Spector, I., Shochet, N. R., Kashman, Y., and Groweiss, A. (1983) Latrunculins: novel marine toxins that disrupt microfilament organization in cultured cells. Science 219, 493-495

160

252. Bubb, M. R., Senderowicz, A. M., Sausville, E. A., Duncan, K. L., and Korn, E. D. (1994) Jasplakinolide, a cytotoxic natural product, induces actin polymerization and competitively inhibits the binding of phalloidin to F-actin. J Biol Chem 269, 14869-14871

253. Peyrollier, K., Hajduch, E., Gray, A., Litherland, G. J., Prescott, A. R., Leslie, N. R., and Hundal, H. S. (2000) A role for the actin cytoskeleton in the hormonal and growth-factor-mediated activation of protein kinase B. Biochem J 352 Pt 3, 617-622

254. Eyster, C. A., Duggins, Q. S., and Olson, A. L. (2005) Expression of constitutively active Akt/protein kinase B signals GLUT4 translocation in the absence of an intact actin cytoskeleton. J Biol Chem 280, 17978-17985

255. Ng, Y., Ramm, G., Lopez, J. A., and James, D. E. (2008) Rapid activation of Akt2 is sufficient to stimulate GLUT4 translocation in 3T3-L1 adipocytes. Cell Metab 7, 348-356

256. Gonzalez, E., and McGraw, T. E. (2009) Insulin-modulated Akt subcellular localization determines Akt isoform-specific signaling. Proc Natl Acad Sci U S A 106, 7004-7009

257. Trifaro, J. M., Gasman, S., and Gutierrez, L. M. (2008) Cytoskeletal control of vesicle transport and exocytosis in chromaffin cells. Acta Physiol (Oxf) 192, 165-172

258. Baron, A. D., Brechtel, G., Wallace, P., and Edelman, S. V. (1988) Rates and tissue sites of non-insulin- and insulin-mediated glucose uptake in humans. Am J Physiol 255, E769-774

259. Bruss, M. D., Arias, E. B., Lienhard, G. E., and Cartee, G. D. (2005) Increased phosphorylation of Akt substrate of 160 kDa (AS160) in rat skeletal muscle in response to insulin or contractile activity. Diabetes 54, 41-50

260. Chiu, T. T., Patel, N., Shaw, A. E., Bamburg, J. R., and Klip, A. (2010) Arp2/3- and cofilin-coordinated actin dynamics is required for insulin-mediated GLUT4 translocation to the surface of muscle cells. Mol Biol Cell 21, 3529-3539

261. Tcherkezian, J., and Lamarche-Vane, N. (2007) Current knowledge of the large RhoGAP family of proteins. Biol Cell 99, 67-86

262. Michiels, F., Habets, G. G., Stam, J. C., van der Kammen, R. A., and Collard, J. G. (1995) A role for Rac in Tiam1-induced membrane ruffling and invasion. Nature 375, 338-340

263. Michiels, F., Stam, J. C., Hordijk, P. L., van der Kammen, R. A., Ruuls-Van Stalle, L., Feltkamp, C. A., and Collard, J. G. (1997) Regulated membrane localization of Tiam1, mediated by the NH2-terminal pleckstrin homology domain, is required for Rac-dependent membrane ruffling and C-Jun NH2-terminal kinase activation. J Cell Biol 137, 387-398

264. Bohdanowicz, M., and Fairn, G. D. (2011) Rapamycin-based inducible translocation systems for studying phagocytosis. Methods Mol Biol 748, 183-193

265. Seabra, M. C. (1998) Membrane association and targeting of prenylated Ras-like GTPases. Cell Signal 10, 167-172

266. Kinsella, B. T., Erdman, R. A., and Maltese, W. A. (1991) Carboxyl-terminal isoprenylation of ras-related GTP-binding proteins encoded by rac1, rac2, and ralA. J Biol Chem 266, 9786-9794

267. Gray, A., Van Der Kaay, J., and Downes, C. P. (1999) The pleckstrin homology domains of protein kinase B and GRP1 (general receptor for phosphoinositides-1) are sensitive and selective probes for the cellular detection of phosphatidylinositol 3,4-bisphosphate and/or phosphatidylinositol 3,4,5-trisphosphate in vivo. Biochem J 344 Pt 3, 929-936

268. Alessi, D. R., Andjelkovic, M., Caudwell, B., Cron, P., Morrice, N., Cohen, P., and Hemmings, B. A. (1996) Mechanism of activation of protein kinase B by insulin and IGF-1. EMBO J 15, 6541-6551

269. Niu, W., Bilan, P. J., Ishikura, S., Schertzer, J. D., Contreras-Ferrat, A., Fu, Z., Liu, J., Boguslavsky, S., Foley, K. P., Liu, Z., Li, J., Chu, G., Panakkezhum, T., Lopaschuk, G. D., Lavandero, S., Yao, Z., and Klip, A. (2010) Contraction-related stimuli regulate GLUT4 traffic in C2C12-GLUT4myc skeletal muscle cells. Am J Physiol Endocrinol Metab 298, E1058-1071

161

270. Bilan, P. J., Samokhvalov, V., Koshkina, A., Schertzer, J. D., Samaan, M. C., and Klip, A. (2009) Direct and macrophage-mediated actions of fatty acids causing insulin resistance in muscle cells. Arch Physiol Biochem 115, 176-190

271. Savage, D. B., Petersen, K. F., and Shulman, G. I. (2007) Disordered lipid metabolism and the pathogenesis of insulin resistance. Physiol Rev 87, 507-520

272. Garvey, W. T., Huecksteadt, T. P., Matthaei, S., and Olefsky, J. M. (1988) Role of glucose transporters in the cellular insulin resistance of type II non-insulin-dependent diabetes mellitus. J Clin Invest 81, 1528-1536

273. Hirosumi, J., Tuncman, G., Chang, L., Gorgun, C. Z., Uysal, K. T., Maeda, K., Karin, M., and Hotamisligil, G. S. (2002) A central role for JNK in obesity and insulin resistance. Nature 420, 333-336

274. Tanti, J. F., and Jager, J. (2009) Cellular mechanisms of insulin resistance: role of stress-regulated serine kinases and insulin receptor substrates (IRS) serine phosphorylation. Curr Opin Pharmacol 9, 753-762

275. Hajduch, E., Balendran, A., Batty, I. H., Litherland, G. J., Blair, A. S., Downes, C. P., and Hundal, H. S. (2001) Ceramide impairs the insulin-dependent membrane recruitment of protein kinase B leading to a loss in downstream signalling in L6 skeletal muscle cells. Diabetologia 44, 173-183

276. Summers, S. A., Garza, L. A., Zhou, H., and Birnbaum, M. J. (1998) Regulation of insulin-stimulated glucose transporter GLUT4 translocation and Akt kinase activity by ceramide. Mol Cell Biol 18, 5457-5464

277. Fazakerley, D. J., Holman, G. D., Marley, A., James, D. E., Stockli, J., and Coster, A. C. (2010) Kinetic evidence for unique regulation of GLUT4 trafficking by insulin and AMP-activated protein kinase activators in L6 myotubes. J Biol Chem 285, 1653-1660

278. Habegger, K. M., Hoffman, N. J., Ridenour, C. M., Brozinick, J. T., and Elmendorf, J. S. (2012) AMPK enhances insulin-stimulated GLUT4 regulation via lowering membrane cholesterol. Endocrinology 153, 2130-2141

279. Das, B., Shu, X., Day, G. J., Han, J., Krishna, U. M., Falck, J. R., and Broek, D. (2000) Control of intramolecular interactions between the pleckstrin homology and Dbl homology domains of Vav and Sos1 regulates Rac binding. J Biol Chem 275, 15074-15081

280. Crompton, A. M., Foley, L. H., Wood, A., Roscoe, W., Stokoe, D., McCormick, F., Symons, M., and Bollag, G. (2000) Regulation of Tiam1 nucleotide exchange activity by pleckstrin domain binding ligands. J Biol Chem 275, 25751-25759

281. Welch, H. C., Coadwell, W. J., Ellson, C. D., Ferguson, G. J., Andrews, S. R., Erdjument-Bromage, H., Tempst, P., Hawkins, P. T., and Stephens, L. R. (2002) P-Rex1, a PtdIns(3,4,5)P3- and Gbetagamma-regulated guanine-nucleotide exchange factor for Rac. Cell 108, 809-821

282. Srinivasan, S., Wang, F., Glavas, S., Ott, A., Hofmann, F., Aktories, K., Kalman, D., and Bourne, H. R. (2003) Rac and Cdc42 play distinct roles in regulating PI(3,4,5)P3 and polarity during neutrophil chemotaxis. J Cell Biol 160, 375-385

283. Yang, H. W., Shin, M. G., Lee, S., Kim, J. R., Park, W. S., Cho, K. H., Meyer, T., and Do Heo, W. (2012) Cooperative activation of PI3K by Ras and Rho family small GTPases. Mol Cell 47, 281-290

284. Bokoch, G. M., Vlahos, C. J., Wang, Y., Knaus, U. G., and Traynor-Kaplan, A. E. (1996) Rac GTPase interacts specifically with phosphatidylinositol 3-kinase. Biochem J 315 ( Pt 3), 775-779

285. Sasaki, A. T., Chun, C., Takeda, K., and Firtel, R. A. (2004) Localized Ras signaling at the leading edge regulates PI3K, cell polarity, and directional cell movement. J Cell Biol 167, 505-518

286. Servant, G., Weiner, O. D., Herzmark, P., Balla, T., Sedat, J. W., and Bourne, H. R. (2000) Polarization of chemoattractant receptor signaling during neutrophil chemotaxis. Science 287, 1037-1040

162

287. McManus, E. J., Collins, B. J., Ashby, P. R., Prescott, A. R., Murray-Tait, V., Armit, L. J., Arthur, J. S., and Alessi, D. R. (2004) The in vivo role of PtdIns(3,4,5)P3 binding to PDK1 PH domain defined by knockin mutation. EMBO J 23, 2071-2082

288. Williams, M. R., Arthur, J. S., Balendran, A., van der Kaay, J., Poli, V., Cohen, P., and Alessi, D. R. (2000) The role of 3-phosphoinositide-dependent protein kinase 1 in activating AGC kinases defined in embryonic stem cells. Curr Biol 10, 439-448

289. Jacinto, E., Facchinetti, V., Liu, D., Soto, N., Wei, S., Jung, S. Y., Huang, Q., Qin, J., and Su, B. (2006) SIN1/MIP1 maintains rictor-mTOR complex integrity and regulates Akt phosphorylation and substrate specificity. Cell 127, 125-137

290. Andjelkovic, M., Alessi, D. R., Meier, R., Fernandez, A., Lamb, N. J., Frech, M., Cron, P., Cohen, P., Lucocq, J. M., and Hemmings, B. A. (1997) Role of translocation in the activation and function of protein kinase B. J Biol Chem 272, 31515-31524

291. Vincent, E. E., Elder, D. J., Thomas, E. C., Phillips, L., Morgan, C., Pawade, J., Sohail, M., May, M. T., Hetzel, M. R., and Tavare, J. M. (2011) Akt phosphorylation on Thr308 but not on Ser473 correlates with Akt protein kinase activity in human non-small cell lung cancer. Br J Cancer 104, 1755-1761

292. Gallay, N., Dos Santos, C., Cuzin, L., Bousquet, M., Simmonet Gouy, V., Chaussade, C., Attal, M., Payrastre, B., Demur, C., and Recher, C. (2009) The level of AKT phosphorylation on threonine 308 but not on serine 473 is associated with high-risk cytogenetics and predicts poor overall survival in acute myeloid leukaemia. Leukemia 23, 1029-1038

293. Guertin, D. A., Stevens, D. M., Thoreen, C. C., Burds, A. A., Kalaany, N. Y., Moffat, J., Brown, M., Fitzgerald, K. J., and Sabatini, D. M. (2006) Ablation in mice of the mTORC components raptor, rictor, or mLST8 reveals that mTORC2 is required for signaling to Akt-FOXO and PKCalpha, but not S6K1. Dev Cell 11, 859-871

294. Wullschleger, S., Loewith, R., and Hall, M. N. (2006) TOR signaling in growth and metabolism. Cell 124, 471-484

295. Saci, A., Cantley, L. C., and Carpenter, C. L. (2011) Rac1 regulates the activity of mTORC1 and mTORC2 and controls cellular size. Mol Cell 42, 50-61

296. Mao, K., Kobayashi, S., Jaffer, Z. M., Huang, Y., Volden, P., Chernoff, J., and Liang, Q. (2008) Regulation of Akt/PKB activity by P21-activated kinase in cardiomyocytes. J Mol Cell Cardiol 44, 429-434

297. Huynh, N., Liu, K. H., Baldwin, G. S., and He, H. (2010) P21-activated kinase 1 stimulates colon cancer cell growth and migration/invasion via ERK- and AKT-dependent pathways. Biochim Biophys Acta 1803, 1106-1113

298. Arias-Romero, L. E., Villamar-Cruz, O., Pacheco, A., Kosoff, R., Huang, M., Muthuswamy, S. K., and Chernoff, J. (2010) A Rac-Pak signaling pathway is essential for ErbB2-mediated transformation of human breast epithelial cancer cells. Oncogene 29, 5839-5849

299. Higuchi, M., Onishi, K., Kikuchi, C., and Gotoh, Y. (2008) Scaffolding function of PAK in the PDK1-Akt pathway. Nat Cell Biol 10, 1356-1364

300. Calleja, V., Laguerre, M., Parker, P. J., and Larijani, B. (2009) Role of a novel PH-kinase domain interface in PKB/Akt regulation: structural mechanism for allosteric inhibition. PLoS Biol 7, e17

301. Gregor, M. F., and Hotamisligil, G. S. (2011) Inflammatory mechanisms in obesity. Annu Rev Immunol 29, 415-445

302. Kewalramani, G., Fink, L. N., Asadi, F., and Klip, A. (2011) Palmitate-activated macrophages confer insulin resistance to muscle cells by a mechanism involving protein kinase C theta and epsilon. PLoS One 6, e26947

163

303. Schmitz-Peiffer, C., Craig, D. L., and Biden, T. J. (1999) Ceramide generation is sufficient to account for the inhibition of the insulin-stimulated PKB pathway in C2C12 skeletal muscle cells pretreated with palmitate. J Biol Chem 274, 24202-24210

304. Stratford, S., DeWald, D. B., and Summers, S. A. (2001) Ceramide dissociates 3'-phosphoinositide production from pleckstrin homology domain translocation. Biochem J 354, 359-368

305. Teruel, T., Hernandez, R., and Lorenzo, M. (2001) Ceramide mediates insulin resistance by tumor necrosis factor-alpha in brown adipocytes by maintaining Akt in an inactive dephosphorylated state. Diabetes 50, 2563-2571

306. Gu, J., Lee, C. W., Fan, Y., Komlos, D., Tang, X., Sun, C., Yu, K., Hartzell, H. C., Chen, G., Bamburg, J. R., and Zheng, J. Q. (2010) ADF/cofilin-mediated actin dynamics regulate AMPA receptor trafficking during synaptic plasticity. Nat Neurosci 13, 1208-1215

307. Iwase, S., Sato, R., De Bock, P. J., Gevaert, K., Fujiki, S., Tawada, T., Kuchitsu, M., Yamagishi, Y., Ono, S., and Abe, H. (2013) Activation of ADF/cofilin by phosphorylation-regulated Slingshot phosphatase is required for the meiotic spindle assembly in Xenopus laevis oocytes. Mol Biol Cell

308. Eiseler, T., Doppler, H., Yan, I. K., Kitatani, K., Mizuno, K., and Storz, P. (2009) Protein kinase D1 regulates cofilin-mediated F-actin reorganization and cell motility through slingshot. Nat Cell Biol 11, 545-556

309. Barisic, S., Nagel, A. C., Franz-Wachtel, M., Macek, B., Preiss, A., Link, G., Maier, D., and Hausser, A. (2011) Phosphorylation of Ser 402 impedes phosphatase activity of slingshot 1. EMBO Rep 12, 527-533

310. Tang, W., Zhang, Y., Xu, W., Harden, T. K., Sondek, J., Sun, L., Li, L., and Wu, D. (2011) A PLCbeta/PI3Kgamma-GSK3 signaling pathway regulates cofilin phosphatase slingshot2 and neutrophil polarization and chemotaxis. Dev Cell 21, 1038-1050

311. Wang, Z., Oh, E., Clapp, D. W., Chernoff, J., and Thurmond, D. C. (2011) Inhibition or ablation of p21-activated kinase (PAK1) disrupts glucose homeostatic mechanisms in vivo. J Biol Chem 286, 41359-41367

312. Nozaki, S., Ueda, S., Takenaka, N., Kataoka, T., and Satoh, T. (2012) Role of RalA downstream of Rac1 in insulin-dependent glucose uptake in muscle cells. Cell Signal 24, 2111-2117

313. Chen, X. W., Leto, D., Xiong, T., Yu, G., Cheng, A., Decker, S., and Saltiel, A. R. (2011) A Ral GAP complex links PI 3-kinase/Akt signaling to RalA activation in insulin action. Mol Biol Cell 22, 141-152

314. Sylow, L., Jensen, T. E., Kleinert, M., Mouatt, J. R., Maarbjerg, S. J., Jeppesen, J., Prats, C., Chiu, T. T., Boguslavsky, S., Klip, A., Schjerling, P., and Richter, E. A. (2013) Rac1 is a novel regulator of contraction-stimulated glucose uptake in skeletal muscle. Diabetes 62, 1139-1151

315. Welch, H. C., Coadwell, W. J., Stephens, L. R., and Hawkins, P. T. (2003) Phosphoinositide 3-kinase-dependent activation of Rac. FEBS Lett 546, 93-97

316. Schuebel, K. E., Movilla, N., Rosa, J. L., and Bustelo, X. R. (1998) Phosphorylation-dependent and constitutive activation of Rho proteins by wild-type and oncogenic Vav-2. EMBO J 17, 6608-6621

317. Bellanger, J. M., Astier, C., Sardet, C., Ohta, Y., Stossel, T. P., and Debant, A. (2000) The Rac1- and RhoG-specific GEF domain of Trio targets filamin to remodel cytoskeletal actin. Nat Cell Biol 2, 888-892

318. Yamaguchi, Y., Katoh, H., Yasui, H., Mori, K., and Negishi, M. (2001) RhoA inhibits the nerve growth factor-induced Rac1 activation through Rho-associated kinase-dependent pathway. J Biol Chem 276, 18977-18983

319. Ohta, Y., Hartwig, J. H., and Stossel, T. P. (2006) FilGAP, a Rho- and ROCK-regulated GAP for Rac binds filamin A to control actin remodelling. Nat Cell Biol 8, 803-814

164

320. Bishop, A. L., and Hall, A. (2000) Rho GTPases and their effector proteins. Biochem J 348 Pt 2, 241-255

321. Arias-Romero, L. E., and Chernoff, J. (2008) A tale of two Paks. Biol Cell 100, 97-108 322. DerMardirossian, C., Schnelzer, A., and Bokoch, G. M. (2004) Phosphorylation of RhoGDI by Pak1

mediates dissociation of Rac GTPase. Mol Cell 15, 117-127 323. Fletcher, L. M., Welsh, G. I., Oatey, P. B., and Tavare, J. M. (2000) Role for the microtubule

cytoskeleton in GLUT4 vesicle trafficking and in the regulation of insulin-stimulated glucose uptake. Biochem J 352 Pt 2, 267-276

324. Huang, J. D., Brady, S. T., Richards, B. W., Stenolen, D., Resau, J. H., Copeland, N. G., and Jenkins, N. A. (1999) Direct interaction of microtubule- and actin-based transport motors. Nature 397, 267-270

325. Schroeder, H. W., 3rd, Mitchell, C., Shuman, H., Holzbaur, E. L., and Goldman, Y. E. (2010) Motor number controls cargo switching at actin-microtubule intersections in vitro. Curr Biol 20, 687-696

326. Liu, L. Z., Cheung, S. C., Lan, L. L., Ho, S. K., Chan, J. C., and Tong, P. C. (2013) Microtubule network is required for insulin-induced signal transduction and actin remodeling. Mol Cell Endocrinol 365, 64-74

327. Fukata, M., Watanabe, T., Noritake, J., Nakagawa, M., Yamaga, M., Kuroda, S., Matsuura, Y., Iwamatsu, A., Perez, F., and Kaibuchi, K. (2002) Rac1 and Cdc42 capture microtubules through IQGAP1 and CLIP-170. Cell 109, 873-885

328. Watanabe, T., Noritake, J., Kakeno, M., Matsui, T., Harada, T., Wang, S., Itoh, N., Sato, K., Matsuzawa, K., Iwamatsu, A., Galjart, N., and Kaibuchi, K. (2009) Phosphorylation of CLASP2 by GSK-3beta regulates its interaction with IQGAP1, EB1 and microtubules. J Cell Sci 122, 2969-2979

329. Cross, D. A., Alessi, D. R., Cohen, P., Andjelkovich, M., and Hemmings, B. A. (1995) Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature 378, 785-789

330. Mercader, J. M., Puiggros, M., Segre, A. V., Planet, E., Sorianello, E., Sebastian, D., Rodriguez-Cuenca, S., Ribas, V., Bonas-Guarch, S., Draghici, S., Yang, C., Mora, S., Vidal-Puig, A., Dupuis, J., Florez, J. C., Zorzano, A., and Torrents, D. (2012) Identification of novel type 2 diabetes candidate genes involved in the crosstalk between the mitochondrial and the insulin signaling systems. PLoS Genet 8, e1003046

331. Langlais, P., Dillon, J. L., Mengos, A., Baluch, D. P., Ardebili, R., Miranda, D. N., Xie, X., Heckmann, B. L., Liu, J., and Mandarino, L. J. (2012) Identification of a role for CLASP2 in insulin action. J Biol Chem 287, 39245-39253

Rac GTPase regulation of GLUT4 traffic in muscle cells ... · Rac GTPase regulation of GLUT4...

Documents

Transcript of Rac GTPase regulation of GLUT4 traffic in muscle cells ... · Rac GTPase regulation of GLUT4...